metricas
covid
Buscar en
Actas Urológicas Españolas (English Edition)
Toda la web
Inicio Actas Urológicas Españolas (English Edition) Correlation between LHCGR and NR5A1 genes polymorphism and male infertility risk
Journal Information

Statistics

Follow this link to access the full text of the article

Original article
Correlation between LHCGR and NR5A1 genes polymorphism and male infertility risk
Correlación entre el polimorfismo de los genes LHCGR y NR5A1y el riesgo de infertilidad masculina
M. Behvarza, S.A. Rahmanib, E. Siasi Torbatia,
Corresponding author
emi_biotech2006@yahoo.com

Corresponding author.
, S. Danaei Mehrabadc, M. Bikhof Torbatid
a Departamento de Genética, Facultad de Ciencias, Sede del Norte de Teherán, Universidad Islámica Azad, Teherán, Iran
b Departamento de Genética Médica, Facultad de Medicina, Universidad de Ciencias Médicas de Tabriz, Tabriz, Iran
c Departamento de Ginecología, Centro ACECR ART, Sede ACECR Azerbaiyán Oriental, Tabriz, Iran
d Departamento de Biología, Sede Yadegar-e-Imam Khomeini (RAH) Shahr-e-Rey, Universidad Islámica Azad, Teherán, Iran
Read
3
Times
was read the article
2
Total PDF
1
Total HTML
Share statistics
 array:24 [
  "pii" => "S2173578623001129"
  "issn" => "21735786"
  "doi" => "10.1016/j.acuroe.2023.10.001"
  "estado" => "S300"
  "fechaPublicacion" => "2024-04-01"
  "aid" => "1587"
  "copyright" => "AEU"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Actas Urol Esp. 2024;48:246-53"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "es" => array:19 [
      "pii" => "S0210480623001286"
      "issn" => "02104806"
      "doi" => "10.1016/j.acuro.2023.08.002"
      "estado" => "S300"
      "fechaPublicacion" => "2024-04-01"
      "aid" => "1587"
      "copyright" => "AEU"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Actas Urol Esp. 2024;48:246-53"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "es" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Art&#237;culo original</span>"
        "titulo" => "Correlaci&#243;n entre el polimorfismo de los genes <span class="elsevierStyleItalic">LHCGR</span> y <span class="elsevierStyleItalic">NR5A1y</span> el riesgo de infertilidad masculina"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "tieneResumen" => array:2 [
          0 => "es"
          1 => "en"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "246"
            "paginaFinal" => "253"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "Correlation between <span class="elsevierStyleItalic">LHCGR</span> and <span class="elsevierStyleItalic">NR5A1</span> genes polymorphism and male infertility risk"
          ]
        ]
        "contieneResumen" => array:2 [
          "es" => true
          "en" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Figura 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 2538
                "Ancho" => 2341
                "Tamanyo" => 318455
              ]
            ]
            "descripcion" => array:1 [
              "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Se seleccionaron 100 controles sanos y 100 pacientes varones inf&#233;rtiles&#46; Se investigaron los polimorfismos de nucle&#243;tido &#250;nico &#40;SNP&#41; de los genes <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; y <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; mediante el m&#233;todo PCR Tetra-ARMS&#46; El an&#225;lisis estad&#237;stico revel&#243; que la frecuencia del alelo C en el polimorfismo <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; y la frecuencia del alelo A en el polimorfismo <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; en pacientes con infertilidad masculina eran significativamente superiores a las de los controles sanos&#46; Estos alelos pueden ser factores de riesgo de infertilidad masculina&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "M&#46; Behvarz, S&#46;A&#46; Rahmani, E&#46; Siasi Torbati, S&#46; Danaei Mehrabad, M&#46; Bikhof Torbati"
            "autores" => array:5 [
              0 => array:2 [
                "nombre" => "M&#46;"
                "apellidos" => "Behvarz"
              ]
              1 => array:2 [
                "nombre" => "S&#46;A&#46;"
                "apellidos" => "Rahmani"
              ]
              2 => array:2 [
                "nombre" => "E&#46;"
                "apellidos" => "Siasi Torbati"
              ]
              3 => array:2 [
                "nombre" => "S&#46;"
                "apellidos" => "Danaei Mehrabad"
              ]
              4 => array:2 [
                "nombre" => "M&#46;"
                "apellidos" => "Bikhof Torbati"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S2173578623001129"
          "doi" => "10.1016/j.acuroe.2023.10.001"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173578623001129?idApp=UINPBA00004N"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210480623001286?idApp=UINPBA00004N"
      "url" => "/02104806/0000004800000003/v1_202404020536/S0210480623001286/v1_202404020536/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S2173578623001087"
    "issn" => "21735786"
    "doi" => "10.1016/j.acuroe.2023.08.010"
    "estado" => "S300"
    "fechaPublicacion" => "2024-04-01"
    "aid" => "1584"
    "copyright" => "AEU"
    "documento" => "simple-article"
    "crossmark" => 1
    "subdocumento" => "crp"
    "cita" => "Actas Urol Esp. 2024;48:254-6"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Case and Research Letter</span>"
      "titulo" => "Intravesical fat-fluid level as a warning sign of contained bladder perforation&#58; Correlation between cystoscopy and computed tomography findings"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "254"
          "paginaFinal" => "256"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Nivel l&#237;quido-grasa intravesical como se&#241;al de alerta de perforaci&#243;n vesical contenida&#58; correlaci&#243;n entre los hallazgos de la cistoscopia y la tomograf&#237;a computarizada"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 646
              "Ancho" => 1674
              "Tamanyo" => 107939
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0015"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Computed tomography cystography <span class="elsevierStyleBold">&#40;A</span>&#44; supine position&#59; <span class="elsevierStyleBold">B</span>&#44; prone position&#41;&#46; Intravesical fat-fluid level in antigravitational position that mobilizes with the patient&#39;s movements &#40;asterisks&#41; and wall defect in the left lateral wall contained by herniation of perivesical fat&#44; without evidence of urinary leakage &#40;arrows&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "P&#46; Montosa R&#243;denas, M&#46; G&#243;mez Huertas, M&#46;&#193;&#46; P&#233;rez Rosillo, A&#46;J&#46; L&#225;inez Ramos-Bossini"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "P&#46;"
              "apellidos" => "Montosa R&#243;denas"
            ]
            1 => array:2 [
              "nombre" => "M&#46;"
              "apellidos" => "G&#243;mez Huertas"
            ]
            2 => array:2 [
              "nombre" => "M&#46;&#193;&#46;"
              "apellidos" => "P&#233;rez Rosillo"
            ]
            3 => array:2 [
              "nombre" => "A&#46;J&#46;"
              "apellidos" => "L&#225;inez Ramos-Bossini"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0210480623001250"
        "doi" => "10.1016/j.acuro.2023.07.007"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210480623001250?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173578623001087?idApp=UINPBA00004N"
    "url" => "/21735786/0000004800000003/v1_202404020631/S2173578623001087/v1_202404020631/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S2173578623001154"
    "issn" => "21735786"
    "doi" => "10.1016/j.acuroe.2023.10.004"
    "estado" => "S300"
    "fechaPublicacion" => "2024-04-01"
    "aid" => "1586"
    "copyright" => "AEU"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Actas Urol Esp. 2024;48:238-45"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "The effect of the combination of prostate-specific antigen derivatives with multiparametric prostate magnetic resonance imaging scores on the negative predictive value of it in grey zone patients"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "238"
          "paginaFinal" => "245"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Evaluaci&#243;n del valor predictivo negativo de la resonancia magn&#233;tica multiparam&#233;trica de pr&#243;stata al combinar su puntuaci&#243;n con par&#225;metros del ant&#237;geno prost&#225;tico espec&#237;fico en pacientes con PSA en zona gris"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1973
              "Ancho" => 1508
              "Tamanyo" => 132052
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0005"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Scatterplot of PSAD vs f&#47;t PSA according to pathology results &#40;a&#41;&#44; according to PSAD &#40;b&#41;&#44; according to f&#47;t PSA &#40;c&#41;&#46;</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">&#40;a&#41; Scatterplot of PSAD vs f&#47;t PSA according to pathology results&#46;</p> <p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">&#40;b&#41; Pathology groups according to PSAD&#46;</p> <p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">&#40;c&#41; Pathology groups according to f&#47;t PSA&#46;</p> <p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">BPH&#58; benign prostate hyperplasia&#59; CISPCa&#58; clinically insignificant prostate carcinoma&#59; CSPCaclinically significant prostate carcinoma&#59; PSAD&#58; prostate specific antigen density&#59; f&#47;t PSA&#58; free total prostate specific antigen ratio&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "C&#46; Bostanc&#305;, D&#46;&#214;&#46; Demir"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "C&#46;"
              "apellidos" => "Bostanc&#305;"
            ]
            1 => array:2 [
              "nombre" => "D&#46;&#214;&#46;"
              "apellidos" => "Demir"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0210480623001274"
        "doi" => "10.1016/j.acuro.2023.08.001"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210480623001274?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173578623001154?idApp=UINPBA00004N"
    "url" => "/21735786/0000004800000003/v1_202404020631/S2173578623001154/v1_202404020631/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Correlation between <span class="elsevierStyleItalic">LHCGR</span> and <span class="elsevierStyleItalic">NR5A1</span> genes polymorphism and male infertility risk"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "246"
        "paginaFinal" => "253"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "M&#46; Behvarz, S&#46;A&#46; Rahmani, E&#46; Siasi Torbati, S&#46; Danaei Mehrabad, M&#46; Bikhof Torbati"
        "autores" => array:5 [
          0 => array:3 [
            "nombre" => "M&#46;"
            "apellidos" => "Behvarz"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "S&#46;A&#46;"
            "apellidos" => "Rahmani"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:4 [
            "nombre" => "E&#46;"
            "apellidos" => "Siasi Torbati"
            "email" => array:1 [
              0 => "emi_biotech2006@yahoo.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "S&#46;"
            "apellidos" => "Danaei Mehrabad"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "M&#46;"
            "apellidos" => "Bikhof Torbati"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Departamento de Gen&#233;tica&#44; Facultad de Ciencias&#44; Sede del Norte de Teher&#225;n&#44; Universidad Isl&#225;mica Azad&#44; Teher&#225;n&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Departamento de Gen&#233;tica M&#233;dica&#44; Facultad de Medicina&#44; Universidad de Ciencias M&#233;dicas de Tabriz&#44; Tabriz&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Departamento de Ginecolog&#237;a&#44; Centro ACECR ART&#44; Sede ACECR Azerbaiy&#225;n Oriental&#44; Tabriz&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Departamento de Biolog&#237;a&#44; Sede Yadegar-e-Imam Khomeini &#40;RAH&#41; Shahr-e-Rey&#44; Universidad Isl&#225;mica Azad&#44; Teher&#225;n&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Correlaci&#243;n entre el polimorfismo de los genes <span class="elsevierStyleItalic">LHCGR</span> y <span class="elsevierStyleItalic">NR5A1y</span> el riesgo de infertilidad masculina"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2525
            "Ancho" => 2341
            "Tamanyo" => 347824
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">100 healthy controls and 100 patients with male infertility were screened out&#46; Single nucleotide polymorphisms &#40;SNPs&#41; of <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; genes were investigated by Tetra-ARMS PCR method&#46; Statistical analysis that frequency of C allele in <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; polymorphism and frequency of A allele in <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphism in patients with male infertility were significantly more than healthy controls&#46; These alleles may be risk factor for male infertility&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Infertility is an important reproductive problem that affects 10&#37;&#8211;15&#37; of couples worldwide&#46; Approximately 20&#37;&#8211;30&#37; of human infertility cases are related to male factors&#46;<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1&#44;2</span></a> Defects in the quantity and quality of sperm are one of the most important causes of male infertility&#44; which can occur due to environmental factors and genetic background&#46; However&#44; 30&#37; of infertility cases are still unknown and considered idiopathic infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3&#44;4</span></a> Idiopathic oligozoospermia and azoospermia&#44; common spermatogenesis disorders&#44; are observed in a large number of men with infertility&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Therefore&#44; investigating the underlying molecular mechanisms of spermatogenesis defects is important for recognizing and managing infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;7</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Previous studies reported that single-nucleotide polymorphisms &#40;SNPs&#41; in various genes involved in spermatogenesis are an important cause of male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0040"><span class="elsevierStyleSup">8&#44;9</span></a> In recent years&#44; numerous studies have investigated the association between SNPs and mutations in male infertility-related candidate genes and idiopathic male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0050"><span class="elsevierStyleSup">10&#44;11</span></a> Several polymorphisms in both <span class="elsevierStyleItalic">LHCGR</span> and <span class="elsevierStyleItalic">NR5A1</span> genes have been identified that play critical roles in idiopathic oligozoospermia and azoospermia in humans&#46;<a class="elsevierStyleCrossRefs" href="#bib0060"><span class="elsevierStyleSup">12&#44;13</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The luteinizing hormone&#47;choriogonadotropin receptor &#40;<span class="elsevierStyleItalic">LHCGR</span>&#41; gene encodes classical G protein-coupled receptors &#40;GPCRs&#41; that are involved in extracellular signal transduction through activation of the G protein cascade&#46;<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;15</span></a> This gene is expressed in stromal&#44; theca&#44; luteal&#44; and late-stage &#40;luteinizing&#41; granulosa cells in the ovary and testes&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> So far&#44; more than 300 polymorphisms have been identified in the <span class="elsevierStyleItalic">LHCGR</span> gene&#59; however&#44; only four are nonsynonymous and occur within exons&#46; The nonsynonymous rs2293275 &#40;c&#46;935G&#62;A&#47;p&#46;Ser312Asn&#41; polymorphism&#44; located on exon 11 of the <span class="elsevierStyleItalic">LHCGR</span> gene&#44; has been reported as an important SNP that is associated with male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;18</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">The nuclear receptor subfamily 5 group A member 1 &#40;<span class="elsevierStyleItalic">NR5A1</span>&#44; previously called <span class="elsevierStyleItalic">SF-1</span>&#41; gene encodes an essential transcriptional activator that plays an important role in reproduction regulation and sexual differentiation&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> This gene is expressed in Leydig and Sertoli cells of the testis and mature ovary and fetal cells&#46; Previous studies reported that the NR5A1 gene plays an important role in gonadal development and that polymorphism in this gene is associated with male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">20&#8211;22</span></a> The missense rs1057517779 &#40;c&#46;938G&#62;A&#47;p&#46;Arg313Cys&#41; polymorphism&#44; located on exon 7 of the <span class="elsevierStyleItalic">NR5A1</span> gene&#44; has been reported as an important SNP that is associated with male infertility&#46;<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">So far&#44; a correlation between <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphisms and male infertility risk has not been reported in the Iranian Azeri population&#46; In the present study&#44; we aimed to investigate the correlation between <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphism and idiopathic male infertility for the first time in the Iranian Azeri population &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Study subjects</span><p id="par0030" class="elsevierStylePara elsevierViewall">This case-control study comprised 200 Iranian Azeri males from the East Azerbaijan province of Iran&#46; The case group consisted of 100 males with confirmed idiopathic azoospermia and oligozoospermia referred to the Department of Infertility&#44; Valiasr Hospital&#44; Tabriz&#44; Iran&#44; from January 2018 to December 2020&#46; Moreover&#44; the control group comprised 100 age&#44; race&#44; and ethnically-matched individuals and genetically unrelated healthy fertile males without abnormal sperm&#46; The exclusion criteria for the case group were an abnormal karyotype and&#47;or microdeletions on the Y chromosome&#44; hypogonadotropy&#44; orchitis&#44; ejaculatory duct obstruction&#44; cryptorchidism&#44; and hypogonadism&#46; We collected demographic variables and characteristics of patients and healthy controls through a questionnaire and interviews &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; This study was approved by the ethical review committee of Islamic Azad University&#44; North Tehran Branch&#44; Tehran&#44; Iran &#40;The ethical code is IR&#46;IAU&#46;TNB&#46;REC&#46;1399&#46;030&#41;&#46; After signing an informed consent form&#44; all subjects were requested to participate in the present study&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">DNA extraction and genotype analysis</span><p id="par0035" class="elsevierStylePara elsevierViewall">The venous blood samples &#40;3&#8239;ml&#41; were collected from all subjects and poured into vials containing an anticoagulant agent &#40;EDTA&#58; Ethylene diamine tetraacetic acid&#41;&#46; Isolation of the genomic DNA samples from whole blood samples was conducted using the proteinase K method&#46; The nanodrop instrument and agarose gel electrophoresis confirmed the quantity and quality of isolated genomic DNA samples&#46; The Tetra-primer amplification refractory mutation system-polymerase chain reaction &#40;Tetra-ARMS-PCR&#41; method was used for the genotyping analysis of the DNA samples&#46; The designed specific primers for amplifying both <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphisms are presented in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; Amplification was conducted in a 25&#8239;&#956;L total volume &#40;50&#8239;ng template DNA&#44; 7&#46;5&#8239;&#956;L sterile double distilled water&#44; 1&#8239;&#956;L from each primer&#44; and 12&#46;5&#8239;&#956;L PCR Master Mix&#41; in the following condition&#58; 1 cycle initial denaturation for 4&#8239;min in 94&#8239;&#176;C&#44; 40 cycles denaturation for 40&#8239;s in 94&#8239;&#176;C&#44; annealing for 30&#8239;s&#44; and extension for 25&#8239;s in 72&#8239;&#176;C&#44; and 1 cycle final extension for 5&#8239;min in 72&#8239;&#176;C&#46; The amplified PCR products were electrophoresed on 2&#37; agarose gel stained with safe stain and visualized by a gel documentation instrument&#46; The alleles were identified according to the size of the DNA bands estimated by a DNA marker &#40;50 bp ladder&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Statistical analysis</span><p id="par0040" class="elsevierStylePara elsevierViewall">We used the statistical package for the social sciences &#40;SPSS&#41; software to analyze the obtained data&#46; The logistic regression was carried out to investigate the correlation of <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphisms with azoospermia and oligozoospermia&#46; In addition&#44; chi-square &#40;&#967;2&#41; and Fisher&#8217;s exact tests were used to investigate Hardy-Weinberg equilibrium &#40;HWE&#41; in the genotype&#8217;s frequencies of infertile patients and healthy controls&#46; The odds ratios &#40;OR&#41; were calculated with a 95&#37; confidence interval &#40;CI&#41; further to affirm the statistical significance of the genotypes with infertility&#46; An independent sample <span class="elsevierStyleItalic">t</span>-test compared the demographic characteristics of all subjects in the case and control groups&#46; A <span class="elsevierStyleItalic">P</span>-value &#60;&#46;05 was considered statistically significant&#46;</p></span></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Results</span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Demographic characteristics</span><p id="par0045" class="elsevierStylePara elsevierViewall">The statistical analysis indicated that infertile patients smoked significantly more tobacco than healthy controls &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#61;&#8239;&#46;004&#41;&#46; We observed that a positive family history of infertility is an important factor significantly higher in infertile patients than in healthy controls &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#61;&#8239;&#46;008&#41;&#46; In addition&#44; semen analysis indicated that sperm concentration&#44; motility&#44; and volume in infertile patients were significantly higher than in healthy controls &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;0001&#41;&#46; However&#44; we found no significant differences between the case and control groups in terms of age&#44; body mass index &#40;BMI&#41;&#44; or alcohol consumption &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#62;&#8239;&#46;05&#41;&#46; The demographic characteristics of all subjects are presented in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Hardy-Weinberg equilibrium</span><p id="par0050" class="elsevierStylePara elsevierViewall">The obtained results indicated that the genotype distribution of both <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphisms in the case and control groups were in agreement with HWE &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#62;&#8239;&#46;05&#41;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Genotype and allele frequency</span><p id="par0055" class="elsevierStylePara elsevierViewall">The genotype and allele frequencies of <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphisms in infertile patients and healthy controls are presented in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46; The statistical analysis indicated a significant correlation between <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphisms and male infertility risk in the Iranian Azeri population&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110"><span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; gene polymorphism</span><p id="par0060" class="elsevierStylePara elsevierViewall">Genotyping analysis for the <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; polymorphism indicated that the frequency of homozygous TT&#44; heterozygous TC&#44; and homozygous CC genotypes in infertile patients were 90&#37;&#44; 6&#37;&#44; and 4&#37;&#44; respectively&#46; In contrast&#44; in healthy controls&#44; the frequency of homozygous TT&#44; heterozygous TC&#44; and homozygous CC were 96&#37;&#44; 4&#37;&#44; and 0&#37;&#44; respectively&#46; Moreover&#44; the frequency of T and C alleles in infertile patients was 93&#37; and 7&#37;&#44; respectively&#44; whereas 98&#37; and 2&#37; were in healthy controls&#46; The statistical analysis indicated that the frequency of the C allele &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#61;&#8239;&#46;016&#59; OR&#8239;&#61;&#8239;3&#46;69&#59; 95&#37; CI&#8239;&#61;&#8239;1&#46;2&#8722;10&#46;4&#41; in infertile patients was significantly higher than in healthy controls &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115"><span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphism</span><p id="par0065" class="elsevierStylePara elsevierViewall">Genotyping analysis for the <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphism indicated that the frequency of homozygous GG&#44; heterozygous GA&#44; and homozygous AA genotypes in infertile patients were 89&#37;&#44; 9&#37;&#44; and 2&#37;&#44; respectively&#46; In contrast&#44; in healthy controls&#44; the frequency of homozygous GG&#44; heterozygous GA&#44; and homozygous AA were 98&#37;&#44; 2&#37;&#44; and 0&#37;&#44; respectively&#46; Moreover&#44; the frequency of G allele and A allele in infertile patients were 93&#46;5&#37; and 6&#46;5&#37;&#44; whereas the frequency of G allele and A allele in healthy controls were 99&#37; and 1&#37;&#44; respectively&#46; The statistical analysis indicated that the frequencies of the A allele &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#61;&#8239;&#46;004&#59; OR&#8239;&#61;&#8239;6&#46;88&#59; 95&#37; CI&#8239;&#61;&#8239;1&#46;7&#8722;30&#46;9&#41; and heterozygote GA genotype &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#61;&#8239;&#46;032&#59; OR&#8239;&#61;&#8239;4&#46;95&#59; 95&#37; CI&#8239;&#61;&#8239;1&#46;24&#8722;23&#46;2&#41; in the case group were significantly higher than those in the control group &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Discussion</span><p id="par0070" class="elsevierStylePara elsevierViewall">Infertility is the inability to conceive after one year of regular and unprotected intercourse&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> Idiopathic oligozoospermia and azoospermia are the main causes of male infertility&#44; and recently a large number of studies have focused on this issue&#46; The main cause of oligozoospermia and azoospermia are infection&#44; abnormal sperm structure&#44; abnormal sperm quantity&#44; abnormal immunity&#44; chromosomal abnormalities&#44; varicocele&#44; and endocrine dysfunction&#46; Idiopathic oligozoospermia and azoospermia with abnormal sperm quantity are the main causes of male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0125"><span class="elsevierStyleSup">25&#44;26</span></a> Recent extensive studies have been conducted to identify the underlying molecular mechanisms of male infertility&#59; however&#44; many male infertility cases are still idiopathic&#46; The presence of mutations and SNPs on spermatogenesis-related genes is suggested as the common cause of male oligozoospermia or azoospermia&#46;<a class="elsevierStyleCrossRefs" href="#bib0035"><span class="elsevierStyleSup">7&#44;27</span></a></p><p id="par0075" class="elsevierStylePara elsevierViewall">In this study&#44; 100 infertile males &#40;azoospermia and&#47;or oligozoospermia&#41; and 100 healthy controls from the Iranian Azeri population are genotyped to investigate the association between <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphisms and idiopathic male infertility&#46; The results indicated a significant association between rs2293275 and rs1057517779 polymorphisms and idiopathic male infertility in the Iranian Azeri population&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Previous studies suggested that the normal <span class="elsevierStyleItalic">LHCGR</span> gene is essential for men&#8217;s and women&#8217;s fertility&#44; whereas defects in the <span class="elsevierStyleItalic">LHCGR</span> gene can cause infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">28&#44;29</span></a> Several studies have reported that <span class="elsevierStyleItalic">LHCGR</span> gene polymorphisms are associated with <span class="elsevierStyleItalic">in vitro</span> fertilization &#40;IVF&#41; and testosterone levels&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;30</span></a> The sole study by Simoni et al&#46; reported that <span class="elsevierStyleItalic">LHCGR</span> gene polymorphisms are significantly associated with mal-descended testes and male infertility&#46; They demonstrated that the C allele in the rs2293275 polymorphism in exon 10 of the <span class="elsevierStyleItalic">LHCGR</span> gene was significantly less frequent in men with mal-descended testes than in healthy controls&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> Our study is the first report on a significant correlation between the <span class="elsevierStyleItalic">LHCGR</span> rs2845570 polymorphism&#44; azoospermia&#44; and oligozoospermia worldwide&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">Abnormal functions of the <span class="elsevierStyleItalic">NR5A1</span> gene were initially reported in patients with defects in primary adrenal failure&#44; M&#252;llerian structures&#44; and sex development disorders&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> In addition&#44; previous studies suggested that <span class="elsevierStyleItalic">NR5A1</span> gene variants are associated with male infertility&#46;<a class="elsevierStyleCrossRefs" href="#bib0165"><span class="elsevierStyleSup">33&#44;34</span></a> So far&#44; several studies with different results have reported the correlation between <span class="elsevierStyleItalic">NR5A1</span> gene polymorphisms and male infertility&#46; In a study by R&#246;pke et al&#46;&#44; a significant correlation was reported between <span class="elsevierStyleItalic">NR5A1</span> gene variants and male infertility in the German population&#46;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">35</span></a> However&#44; two studies by Sudhakar et al&#46; and Adamovic et al&#46; reported no significant association between <span class="elsevierStyleItalic">NR5A1</span> gene polymorphisms and male infertility in the Indian and Chinese populations&#46;<a class="elsevierStyleCrossRefs" href="#bib0115"><span class="elsevierStyleSup">23&#44;36</span></a> Our study is the first positive report on the significant association between <span class="elsevierStyleItalic">NR5A1</span> rs1057517779 gene polymorphism and male infertility in the Iranian population&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">The contradiction in the results of the mentioned studies can be due to the effects of other involved genes or polymorphisms in male infertility&#44; sample selection bias and sample size&#44; genetic background of the population&#44; environmental factors&#44; differences in geographic area&#44; and heterogeneity in ethnicity and race&#46;<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">37&#8211;39</span></a></p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Conclusions</span><p id="par0095" class="elsevierStylePara elsevierViewall">Generally&#44; our study suggested that <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; gene polymorphisms are significantly associated with the risk of male infertility in the Iranian Azeri population&#46; However&#44; further studies with a larger sample size are required on other populations&#44; ethnic origins&#44; and races&#46; Furthermore&#44; functional experiments are needed to understand the role of these polymorphisms in the molecular pathways involved in male fertility&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Funding</span><p id="par0100" class="elsevierStylePara elsevierViewall">Not applicable&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Ethics approval and consent to participate</span><p id="par0105" class="elsevierStylePara elsevierViewall">This study was approved by the ethical review committee&#44; Islamic Azad University&#44; North Tehran Branch&#44; Tehran&#44; Iran &#40;The ethical code&#58; IR&#46;IAU&#46;TNB&#46;REC&#46;1399&#46;030&#41;&#46; All subjects were requested to participate in the present study after signing of informed consent form&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Authors&#8217; contributions</span><p id="par0110" class="elsevierStylePara elsevierViewall">M-B&#44; SA-R&#44; E-ST&#58; Execution&#44; analysis&#44; and interpretation of data&#59; M-B&#44; S-D&#58; Manuscript writing and analysis&#59; M-B&#44; M-BT&#58; Clinical Consultant&#59; S-D&#58; Clinical Consultant&#59; SA-R&#58; participation in study design&#44; manuscript drafting&#44; and critical discussion&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Conflict of interests</span><p id="par0115" class="elsevierStylePara elsevierViewall">The authors declare that they have no competing interests&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:15 [
        0 => array:3 [
          "identificador" => "xres2117095"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1803513"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres2117096"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1803514"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "DNA extraction and genotype analysis"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0030"
          "titulo" => "Results"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Demographic characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Hardy-Weinberg equilibrium"
            ]
            2 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Genotype and allele frequency"
            ]
            3 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "LHCGR &#40;rs2293275&#41; gene polymorphism"
            ]
            4 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "NR5A1 &#40;rs1057517779&#41; gene polymorphism"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Conclusions"
        ]
        9 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Funding"
        ]
        10 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Ethics approval and consent to participate"
        ]
        11 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Authors&#8217; contributions"
        ]
        12 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Conflict of interests"
        ]
        13 => array:2 [
          "identificador" => "xack737011"
          "titulo" => "Acknowledgments"
        ]
        14 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-07-09"
    "fechaAceptado" => "2023-08-04"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1803513"
          "palabras" => array:4 [
            0 => "Male infertility"
            1 => "<span class="elsevierStyleItalic">LHCGR</span>"
            2 => "<span class="elsevierStyleItalic">NR5A1</span>"
            3 => "Polymorphism"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1803514"
          "palabras" => array:4 [
            0 => "Infertilidad masculina"
            1 => "<span class="elsevierStyleItalic">LHCGR</span>"
            2 => "<span class="elsevierStyleItalic">NR5A1</span>"
            3 => "Polimorfismo"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Infertility is one of the important phenomena in human reproduction&#46; Genetic factors are the most important cause of male infertility&#46; Here&#44; we aimed to investigate the correlation between idiopathic male infertility and SNPs of the <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; genes in the Iranian-Azeri population&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">This case-control study consisted of 100 males with infertility and 100 healthy males from the Iranian Azeri population&#46; Genomic DNA isolation from whole blood samples and Tetra-primer amplification refractory mutation system-polymerase chain reaction &#40;Tetra-ARMS-PCR&#41; method was used for genotyping&#46; The data analysis was performed by chi-square &#40;&#967;2&#41; and Fisher&#8217;s exact tests&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Genotyping analysis for <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; polymorphism indicated that the frequency of C in the case group was significantly higher than in the control group &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;05&#41;&#46; Moreover&#44; genotyping analysis for <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphism indicated that the frequencies of the A allele and heterozygote GA genotype in the case group were significantly higher than those in the control group &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;05&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Our study demonstrated that the SNPs of <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; genes may play a critical role in male infertility in the Iranian Azeri population&#46; However&#44; further studies on other ethnic origins with larger sample sizes are essential for accessing more accurate results&#46; Moreover&#44; functional experiments might be needed to understand the role of these polymorphisms in the molecular pathways involved in male fertility&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducci&#243;n</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">La infertilidad constituye un problema de salud que afecta gravemente la reproducci&#243;n humana&#46; En el caso de la infertilidad masculina&#44; la mayor&#237;a de los casos se deben a factores gen&#233;ticos&#46; En este estudio nos propusimos realizar un an&#225;lisis de correlaci&#243;n entre la infertilidad masculina idiop&#225;tica y el polimorfismo de un solo nucle&#243;tido &#40;SNP&#44; por Single Nucleotide Polymorphism&#41; de los genes <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; y <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; en la poblaci&#243;n azer&#237; de Ir&#225;n&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">En este estudio de casos y controles participaron 100 varones inf&#233;rtiles y 100 varones sanos procedentes de la poblaci&#243;n azer&#237; iran&#237;&#46; La genotipificaci&#243;n se realiz&#243; mediante el aislamiento del ADN gen&#243;mico a partir de muestras de sangre total con el sistema de amplificaci&#243;n por reacci&#243;n en cadena de la polimerasa refractario a mutaciones Tetra-primer &#40;Tetra-ARMS-PCR&#41;&#46; El an&#225;lisis de los datos se llev&#243; a cabo mediante la prueba de chi cuadrado &#40;&#967;2&#41; y la prueba exacta de Fisher&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Seg&#250;n el an&#225;lisis de genotipificaci&#243;n del polimorfismo <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41;&#44; la frecuencia del alelo C en el grupo de casos era significativamente mayor que en el grupo de control &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#44;05&#41;&#46; El an&#225;lisis del polimorfismo <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; indic&#243; que la frecuencia del alelo A y del genotipo heterocigoto GA en el grupo de casos era significativamente superior a la del grupo de control &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#44;05&#41;&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Nuestro estudio demostr&#243; que los SNP de los genes <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; y <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; pueden desempe&#241;ar un papel crucial en la infertilidad masculina de la poblaci&#243;n azer&#237; en Ir&#225;n&#46; Sin embargo&#44; se requieren m&#225;s estudios realizados en otros or&#237;genes &#233;tnicos con muestras de mayor tama&#241;o para obtener resultados m&#225;s precisos&#46; Adem&#225;s&#44; podr&#237;an ser necesarios experimentos funcionales para comprender el papel de estos polimorfismos en las v&#237;as moleculares implicadas en la fertilidad masculina&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:4 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2525
            "Ancho" => 2341
            "Tamanyo" => 347824
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">100 healthy controls and 100 patients with male infertility were screened out&#46; Single nucleotide polymorphisms &#40;SNPs&#41; of <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; and <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; genes were investigated by Tetra-ARMS PCR method&#46; Statistical analysis that frequency of C allele in <span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41; polymorphism and frequency of A allele in <span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41; polymorphism in patients with male infertility were significantly more than healthy controls&#46; These alleles may be risk factor for male infertility&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene &#40;polymorphism&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer Sequence &#40;5&#900;&#8594;3&#900;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Products Size&#58; Allele Type&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward outer&#58; ATGGTGCAGAACGAGATGCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">150 bp&#58; allele A &#40;A&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reverse outer&#58; TGCAACAGCTCCGTAACCAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">321 bp&#58; -&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward inner&#58; TGTGAAAGCACAGTAAGGAAAGTGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">225 bp&#58; allele G &#40;B&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reverse inner&#58; GCATGCAAATACTTACAGTGTTTTGTTAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward outer&#58; ACAAAAGACAGAGGTGGGGCCTGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">212 bp&#58; allele C &#40;A&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reverse outer&#58; TGGGGAAAGGGCTGATAATTAGGGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">492 bp&#58; -&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward inner&#58; GCTGGTGTTCGACCACATCTACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">322 bp&#58; allele T &#40;B&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reverse inner&#58; TTGCCGTGCTGGACCTGGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3500653.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">The characteristics and sequences of primers used for detection of genes polymorphisms&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">BMI&#44; Body Mass Index&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variables&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Patients &#40;n&#8239;&#61;&#8239;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;n&#8239;&#61;&#8239;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span>-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;year&#8239;&#177;&#8239;SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29&#46;33&#8239;&#177;&#8239;2&#46;78&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27&#46;6&#8239;&#177;&#8239;3&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;298&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BMI &#40;kg&#47;m&#8239;&#177;&#8239;SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;25&#8239;&#177;&#8239;2&#46;18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;48&#8239;&#177;&#8239;2&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;699&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tobacco smoking</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Never&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">76 &#40;76&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">89 &#40;89&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Ever&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">34 &#40;34&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;11&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;004</span><a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Alcohol drinking</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Never&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39 &#40;39&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;31&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Ever&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">61 &#40;61&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">69 &#40;69&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;376&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Family history</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">79 &#40;79&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;100&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;21&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;008</span><a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Semen parameters</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Concentration &#40;&#215;10<span class="elsevierStyleSup">6</span>&#47;ml&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&#58; 3&#46;5 &#40;0&#8722;6&#46;37&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">125&#46;5 &#40;94&#8722;156&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#60;<span class="elsevierStyleBold">&#46;0001</span><a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#58; 3&#46;71&#8239;&#177;&#8239;3&#46;94&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">126&#8239;&#177;&#8239;40&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Motility &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&#58; 48&#46;5 &#40;0&#8722;63&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60 &#40;49&#8722;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#60;<span class="elsevierStyleBold">&#46;0001</span><a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#58; 33&#46;95&#8239;&#177;&#8239;30&#46;48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#46;6&#8239;&#177;&#8239;11&#46;55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Volume &#40;ml&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&#58; 3&#46;5 &#40;2&#46;35&#8722;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;3&#8722;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#60;<span class="elsevierStyleBold">&#46;0001</span><a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#58; 3&#46;23&#8239;&#177;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;18&#8239;&#177;&#8239;3&#46;19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3500652.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Statistically significant <span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;05&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Demographic variables and characteristics of the studied patients and healthy control&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">OR&#44; Odds Ratio&#59; CI&#44; Confidence Interval&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene &#40;polymorphism&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Inheritance models&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genotype and Allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Case &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Control &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span>-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="11" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">LHCGR</span> &#40;rs2293275&#41;</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Codominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90 &#40;90&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;531&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6 &#40;0&#46;41&#8722;5&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;058&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">infinity &#40;1&#46;02-infinity&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Dominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90 &#40;90&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TC&#8239;&#43;&#8239;CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;10&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;164&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;67 &#40;0&#46;85&#8722;7&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Recessive</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TC&#8239;&#43;&#8239;TT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;100&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;121&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">infinity &#40;1&#46;0-infinity&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Overdominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TT&#8239;&#43;&#8239;CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94 &#40;94&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;747&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;53 &#40;0&#46;39&#8722;4&#46;92&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Alleles</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">T wild&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">186 &#40;93&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">196 &#40;98&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">C mutant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;016</span><a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;69 &#40;1&#46;2&#8722;10&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="11" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">NR5A1</span> &#40;rs1057517779&#41;</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Codominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">89 &#40;89&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">98 &#40;98&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;032</span><a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;95 &#40;1&#46;24&#8722;23&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;230&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">infinity &#40;0&#46;5-infinity&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Dominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">89 &#40;89&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">98 &#40;98&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GA&#8239;&#43;&#8239;AA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;11&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;018</span><a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;05 &#40;1&#46;4&#8722;27&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Recessive</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GA&#8239;&#43;&#8239;GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">98 &#40;98&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;100&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#46;497&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">infinity &#40;0&#46;46-infinity&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Overdominant</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&#8239;&#43;&#8239;AA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">91 &#40;91&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">98 &#40;98&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;004</span><a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;88 &#40;1&#46;7&#8722;30&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Alleles</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G wild&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">187 &#40;93&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">198 &#40;99&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ref&#8239;&#61;&#8239;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">A mutant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;6&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#46;004</span><a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;88 &#40;1&#46;7&#8722;30&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3500651.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Statistically significant <span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;05&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Genotype and allele frequencies of the studied polymorphisms in patients and healthy controls&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetics of male infertility&#58; the new players"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Coutton"
                            1 => "V&#46; Satre"
                            2 => "C&#46; Arnoult"
                            3 => "P&#46; Ray"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Med Sci&#46;"
                        "fecha" => "2012"
                        "volumen" => "28"
                        "paginaInicial" => "497"
                        "paginaFinal" => "502"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of IL-10&#44; IL-18&#44; and IL-33 genetic polymorphisms with recurrent pregnancy loss risk in Iranian women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Soheilyfar"
                            1 => "T&#46; Nikyar"
                            2 => "N&#46; Fathi Maroufi"
                            3 => "F&#46; Mohebi Chamkhorami"
                            4 => "Z&#46; Amini"
                            5 => "M&#46; Ahmadi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/09513590.2018.1528220"
                      "Revista" => array:6 [
                        "tituloSerie" => "Gynecol Endocrinol&#46;"
                        "fecha" => "2019"
                        "volumen" => "35"
                        "paginaInicial" => "342"
                        "paginaFinal" => "345"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30526181"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of rubella&#44; cytomegalovirus&#44; and toxoplasma infections with recurrent miscarriages in Bonab-Iran&#58; a case-control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Nasirpour"
                            1 => "Y&#46; Azari Key"
                            2 => "N&#46; Kazemipur"
                            3 => "M&#46; Majidpour"
                            4 => "S&#46; Mahdavi"
                            5 => "S&#46; Hajazimian"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Gene Cell Tissue&#46;"
                        "fecha" => "2017"
                        "volumen" => "4"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnosis and hormonal treatment of male infertility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46;Z&#46; Serrano"
                            1 => "A&#46;C&#46; Obando"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.acuro.2019.10.013"
                      "Revista" => array:6 [
                        "tituloSerie" => "Actas Urol Esp&#46;"
                        "fecha" => "2020"
                        "volumen" => "44"
                        "paginaInicial" => "321"
                        "paginaFinal" => "327"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32241672"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Validation and application of a novel integrated genetic screening method to a cohort of 1&#44;112 men with idiopathic azoospermia or severe oligozoospermia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;S&#46; Oud"
                            1 => "L&#46; Ramos"
                            2 => "M&#46;K&#46; O&#8217;Bryan"
                            3 => "R&#46;I&#46; McLachlan"
                            4 => "&#214;&#46; Okutman"
                            5 => "S&#46; Viville"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/humu.23312"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hum Mutat&#46;"
                        "fecha" => "2017"
                        "volumen" => "38"
                        "paginaInicial" => "1592"
                        "paginaFinal" => "1605"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28801929"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of CATSPER1&#44; SPATA16&#44; and TEX11 genes polymorphism with idiopathic azoospermia and oligospermia risk in Iranian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Behvarz"
                            1 => "S&#46;A&#46; Rahmani"
                            2 => "E&#46; Siasi Torbati"
                            3 => "S&#46; Danaei Mehrabad"
                            4 => "M&#46; Bikhof Torbati"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Med Genom&#46;"
                        "fecha" => "2022"
                        "volumen" => "15"
                        "paginaInicial" => "1"
                        "paginaFinal" => "7"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effect of factor-xi &#40;rs3756008&#41; polymorphism on recurrent pregnancy loss in Iranian Azeri women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Isazadeh"
                            1 => "S&#46; Hajazimian"
                            2 => "S&#46;A&#46; Rahmani"
                            3 => "M&#46; Mohammadoo-Khorasani"
                            4 => "N&#46; Moghtaran"
                            5 => "N&#46;F&#46; Maroufi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Gene Cell Tissue&#46;"
                        "fecha" => "2017"
                        "volumen" => "4"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effects of high and lowdoses of folic acid on oxidation of protein levels during pregnancy&#58; a randomized double-blind clinical trial"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Shiralizadeh"
                            1 => "H&#46; Barmaki"
                            2 => "S&#46; Haiaty"
                            3 => "Y&#46; Faridvand"
                            4 => "M&#46; Mostafazadeh"
                            5 => "N&#46; Mokarizadeh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Horm Mol Biol Clin Investig&#46;"
                        "fecha" => "2017"
                        "volumen" => "33"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of coagulation factor XIII &#40;Val34Leu&#41; polymorphism on recurrent pregnancy loss in Iranian Azeri women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Isazadeh"
                            1 => "S&#46;H&#46; Azimian"
                            2 => "N&#46; Tariverdi"
                            3 => "S&#46;A&#46; Rahmani"
                            4 => "M&#46; Esmaeili"
                            5 => "S&#46; Karimkhanilouei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Laboratoriums Medizin&#46;"
                        "fecha" => "2017"
                        "volumen" => "41"
                        "paginaInicial" => "89"
                        "paginaFinal" => "92"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Autosomal single-gene disorders involved in human infertility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "I&#46; Jedidi"
                            1 => "M&#46; Ouchari"
                            2 => "Q&#46; Yin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.sjbs.2017.12.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Saudi J Biol Sci&#46;"
                        "fecha" => "2018"
                        "volumen" => "25"
                        "paginaInicial" => "881"
                        "paginaFinal" => "887"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30108436"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Surgical treatment for male infertility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46;Z&#46; Serrano"
                            1 => "A&#46;C&#46; Obando"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.acuro.2019.10.012"
                      "Revista" => array:6 [
                        "tituloSerie" => "Actas Urol Esp&#46;"
                        "fecha" => "2020"
                        "volumen" => "44"
                        "paginaInicial" => "314"
                        "paginaFinal" => "320"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32147350"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New insights into the genetics of spermatogenic failure&#58; a review of the literature"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "R&#46; Cannarella"
                            1 => "R&#46;A&#46; Condorelli"
                            2 => "Y&#46; Duca"
                            3 => "S&#46; La Vignera"
                            4 => "A&#46;E&#46; Calogero"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00439-019-01974-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hum Genet&#46;"
                        "fecha" => "2019"
                        "volumen" => "138"
                        "paginaInicial" => "125"
                        "paginaFinal" => "140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30656449"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of inflammasome activation in peripheral blood mononuclear cells of hemodialysis treated patients with glomerulonephritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Hashemi"
                            1 => "R&#46; Bigdeli"
                            2 => "M&#46; Shahnazari"
                            3 => "F&#46; Oruji"
                            4 => "S&#46; Fattahi"
                            5 => "E&#46; Panahnejad"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.22037/ijpr.2020.114260.14757"
                      "Revista" => array:5 [
                        "tituloSerie" => "Iran J Pharm Res&#46;"
                        "fecha" => "2021"
                        "volumen" => "20"
                        "paginaInicial" => "609"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34904012"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "High expression of luteinizing hormone receptors messenger RNA by human cumulus granulosa cells is in correlation with decreased fertilization"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Maman"
                            1 => "Y&#46; Yung"
                            2 => "A&#46; Kedem"
                            3 => "G&#46;M&#46; Yerushalmi"
                            4 => "S&#46; Konopnicki"
                            5 => "B&#46; Cohen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.fertnstert.2011.12.027"
                      "Revista" => array:6 [
                        "tituloSerie" => "Fertil Steril&#46;"
                        "fecha" => "2012"
                        "volumen" => "97"
                        "paginaInicial" => "592"
                        "paginaFinal" => "598"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22260850"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Localization of luteinizing hormone receptor protein in the human ovary"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Yung"
                            1 => "S&#46; Aviel-Ronen"
                            2 => "E&#46; Maman"
                            3 => "N&#46; Rubinstein"
                            4 => "C&#46; Avivi"
                            5 => "R&#46; Orvieto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/molehr/gau041"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Hum Reprod&#46;"
                        "fecha" => "2014"
                        "volumen" => "20"
                        "paginaInicial" => "844"
                        "paginaFinal" => "849"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24874553"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutations of gonadotropins and gonadotropin receptors&#58; elucidating the physiology and pathophysiology of pituitarygonadal function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46;P&#46;N&#46; Themmen"
                            1 => "I&#46;T&#46; Huhtaniemi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/edrv.21.5.0409"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocr Rev&#46;"
                        "fecha" => "2000"
                        "volumen" => "21"
                        "paginaInicial" => "551"
                        "paginaFinal" => "583"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11041448"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of the prevalence of exons 1 and 10 polymorphisms of LHCGR gene and its relationship with IVF success"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Javadi-Arjmand"
                            1 => "E&#46; Damavandi"
                            2 => "H&#46; Choobineh"
                            3 => "F&#46; Sarafrazi-Esfandabadi"
                            4 => "M&#46; Kabuli"
                            5 => "A&#46; Mahdavi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Reprod Infertil&#46;"
                        "fecha" => "2019"
                        "volumen" => "20"
                        "paginaInicial" => "218"
                        "paginaFinal" => "224"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31897388"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Isolation and characterization of a novel GRP78-specific single-chain variable fragment &#40;scFv&#41; using ribosome display method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46; Shabani"
                            1 => "M&#46;F&#46; Moghadam"
                            2 => "S&#46;L&#46; Gargari"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s12032-021-01561-3"
                      "Revista" => array:5 [
                        "tituloSerie" => "Med Oncol&#46;"
                        "fecha" => "2021"
                        "volumen" => "38"
                        "paginaInicial" => "115"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34390413"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Steroidogenic factor 1&#58; a key determinant of endocrine development and function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46;L&#46; Parker"
                            1 => "B&#46;P&#46; Schimmer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/edrv.18.3.0301"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocr Rev&#46;"
                        "fecha" => "1997"
                        "volumen" => "18"
                        "paginaInicial" => "361"
                        "paginaFinal" => "377"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9183568"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Developmental expression of mouse steroidogenic factor-1&#44; an essential regulator of the steroid hydroxylases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Ikeda"
                            1 => "W&#46;-H&#46; Shen"
                            2 => "H&#46;A&#46; Ingraham"
                            3 => "K&#46;L&#46; Parker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/mend.8.5.8058073"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Endocrinol&#46;"
                        "fecha" => "1994"
                        "volumen" => "8"
                        "paginaInicial" => "654"
                        "paginaFinal" => "662"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8058073"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Functional difference between Ad4BP and ELP&#44; and their distributions in steroidogenic tissues"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46;I&#46; Morohashi"
                            1 => "H&#46; Iida"
                            2 => "M&#46; Nomura"
                            3 => "O&#46; Hatano"
                            4 => "S&#46;I&#46; Honda"
                            5 => "T&#46; Tsukiyama"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/mend.8.5.8058072"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Endocrinol&#46;"
                        "fecha" => "1994"
                        "volumen" => "8"
                        "paginaInicial" => "643"
                        "paginaFinal" => "653"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8058072"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Shedding light on triple-negative breast cancer with Trop2-targeted antibody-drug conjugates"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "P&#46;J&#46; Kaboli"
                            1 => "S&#46; Shabani"
                            2 => "S&#46; Sharma"
                            3 => "M&#46;P&#46; Nasr"
                            4 => "H&#46; Yamaguchi"
                            5 => "M&#46;C&#46; Hung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Am J Cancer Res&#46;"
                        "fecha" => "2022"
                        "volumen" => "12"
                        "paginaInicial" => "1671"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35530278"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The p&#46; G146A and p&#46; P125P polymorphisms in the steroidogenic factor-1 &#40;SF-1&#41; gene do not affect the risk for hypospadias in Caucasians"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Adamovic"
                            1 => "Y&#46; Chen"
                            2 => "H&#46;T&#46; Thai"
                            3 => "X&#46; Zhang"
                            4 => "E&#46; Markljung"
                            5 => "S&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1159/000343782"
                      "Revista" => array:6 [
                        "tituloSerie" => "Sex Dev&#46;"
                        "fecha" => "2012"
                        "volumen" => "6"
                        "paginaInicial" => "292"
                        "paginaFinal" => "297"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23154282"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic causes of spermatogenic failure"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46; Massart"
                            1 => "W&#46; Lissens"
                            2 => "H&#46; Tournaye"
                            3 => "K&#46; Stouffs"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/aja.2011.67"
                      "Revista" => array:6 [
                        "tituloSerie" => "Asian J Androl&#46;"
                        "fecha" => "2012"
                        "volumen" => "14"
                        "paginaInicial" => "40"
                        "paginaFinal" => "48"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22138898"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The CatSper calcium channel in human sperm&#58; relation with motility and involvement in progesterone-induced acrosome reaction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46; Tamburrino"
                            1 => "S&#46; Marchiani"
                            2 => "F&#46; Minetti"
                            3 => "G&#46; Forti"
                            4 => "M&#46; Muratori"
                            5 => "E&#46; Baldi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/humrep/det454"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hum Reprod&#46;"
                        "fecha" => "2014"
                        "volumen" => "29"
                        "paginaInicial" => "418"
                        "paginaFinal" => "428"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24430778"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Non-syndromic monogenic female infertility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Guerri"
                            1 => "T&#46; Maniscalchi"
                            2 => "S&#46; Barati"
                            3 => "S&#46; Gerli"
                            4 => "G&#46;C&#46; Di Renzo"
                            5 => "C&#46; Della Morte"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Acta Biomed&#46;"
                        "fecha" => "2019"
                        "volumen" => "90"
                        "numero" => "Suppl 10"
                        "paginaInicial" => "68"
                        "paginaFinal" => "74"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA&#8211;binding protein gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46; Reijo"
                            1 => "T&#46;Y&#46; Lee"
                            2 => "P&#46; Salo"
                            3 => "R&#46; Alagappan"
                            4 => "L&#46;G&#46; Brown"
                            5 => "M&#46; Rosenberg"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ng0895-383"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Genet&#46;"
                        "fecha" => "1995"
                        "volumen" => "10"
                        "paginaInicial" => "383"
                        "paginaFinal" => "393"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7670487"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Targeted disruption of luteinizing hormone&#47;human chorionic gonadotropin receptor gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z&#46;M&#46; Lei"
                            1 => "S&#46; Mishra"
                            2 => "W&#46; Zou"
                            3 => "B&#46; Xu"
                            4 => "M&#46; Foltz"
                            5 => "X&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/mend.15.1.0586"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Endocrinol&#46;"
                        "fecha" => "2001"
                        "volumen" => "15"
                        "paginaInicial" => "184"
                        "paginaFinal" => "200"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11145749"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout &#40;LuRKO&#41; mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "F&#46;P&#46; Zhang"
                            1 => "M&#46; Poutanen"
                            2 => "J&#46; Wilbertz"
                            3 => "I&#46; Huhtaniemi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/mend.15.1.0582"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Endocrinol&#46;"
                        "fecha" => "2001"
                        "volumen" => "15"
                        "paginaInicial" => "172"
                        "paginaFinal" => "183"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11145748"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Polymorphism in the alternative donor site of the cryptic exon of lhcgr&#58; functional consequences and associations with testosterone level"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Liu"
                            1 => "B&#46; Han"
                            2 => "W&#46; Zhu"
                            3 => "T&#46; Cheng"
                            4 => "M&#46; Fan"
                            5 => "J&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41598-016-0028-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Sci Rep&#46;"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "1"
                        "paginaFinal" => "10"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28127051"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Polymorphisms of the luteinizing hormone&#47;chorionic gonadotropin receptor gene&#58; association with maldescended testes and male infertility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Simoni"
                            1 => "F&#46; T&#252;ttelmann"
                            2 => "C&#46; Michel"
                            3 => "Y&#46; B&#246;ckenfeld"
                            4 => "E&#46; Nieschlag"
                            5 => "J&#46; Gromoll"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/FPC.0b013e3282f4e98c"
                      "Revista" => array:6 [
                        "tituloSerie" => "Pharmacogenet Genomics&#46;"
                        "fecha" => "2008"
                        "volumen" => "18"
                        "paginaInicial" => "193"
                        "paginaFinal" => "200"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18300940"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of SF1 in adrenal and reproductive function&#58; insight from naturally occurring mutations in humans"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "G&#46; Ozisik"
                            1 => "J&#46;C&#46; Achermann"
                            2 => "J&#46;L&#46; Jameson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1096-7192(02)00032-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Genet Metab&#46;"
                        "fecha" => "2002"
                        "volumen" => "76"
                        "paginaInicial" => "85"
                        "paginaFinal" => "91"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12083805"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutational screening of the NR5A1 in azoospermia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Zare-Abdollahi"
                            1 => "S&#46; Safari"
                            2 => "R&#46; Mirfakhraie"
                            3 => "A&#46; Movafagh"
                            4 => "M&#46; Bastami"
                            5 => "P&#46; Azimzadeh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/and.12274"
                      "Revista" => array:6 [
                        "tituloSerie" => "Andrologia&#46;"
                        "fecha" => "2015"
                        "volumen" => "47"
                        "paginaInicial" => "395"
                        "paginaFinal" => "401"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24750329"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutational screening of NR5A1 gene encoding steroidogenic factor 1 in cryptorchidism and male factor infertility and functional analysis of seven undescribed mutations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Ferlin"
                            1 => "M&#46; Santa Rocca"
                            2 => "C&#46; Vinanzi"
                            3 => "M&#46; Ghezzi"
                            4 => "A&#46; Di Nisio"
                            5 => "C&#46; Foresta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.fertnstert.2015.04.017"
                      "Revista" => array:6 [
                        "tituloSerie" => "Fertil Steril&#46;"
                        "fecha" => "2015"
                        "volumen" => "104"
                        "paginaInicial" => "163"
                        "paginaFinal" => "169"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25989977"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comprehensive sequence analysis of the NR5A1 gene encoding steroidogenic factor 1 in a large group of infertile males"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; R&#246;pke"
                            1 => "A&#46;C&#46; Tewes"
                            2 => "J&#46; Gromoll"
                            3 => "S&#46; Kliesch"
                            4 => "P&#46; Wieacker"
                            5 => "F&#46; T&#252;ttelmann"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Eur J Hum Genet&#46;"
                        "fecha" => "2013"
                        "volumen" => "21"
                        "paginaInicial" => "1012"
                        "paginaFinal" => "1015"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "NR 5A1 mutations are not associated with male infertility in Indian men"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;V&#46; Sudhakar"
                            1 => "S&#46; Nizamuddin"
                            2 => "G&#46; Manisha"
                            3 => "J&#46;R&#46; Devi"
                            4 => "N&#46;J&#46; Gupta"
                            5 => "B&#46;N&#46; Chakravarthy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Andrologia&#46;"
                        "fecha" => "2018"
                        "volumen" => "50"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effects of Factor II &#40;rs1799963&#41; polymorphism on recurrent pregnancy loss in Iranian Azeri women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Isazadeh"
                            1 => "S&#46; Hajazimian"
                            2 => "S&#46;A&#46; Rahmani"
                            3 => "M&#46; Mohammadoo-Khorasani"
                            4 => "S&#46; Samanmanesh"
                            5 => "S&#46; Karimkhanilouei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Riv Ital Med Lab&#46;"
                        "fecha" => "2017"
                        "volumen" => "13"
                        "paginaInicial" => "37"
                        "paginaFinal" => "40"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of rs1946518 C&#47;A polymorphism in promoter region of interleukin 18 gene and breast cancer risk in Iranian women&#58; a case-control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;F&#46; Maroufi"
                            1 => "E&#46; Aghayi"
                            2 => "H&#46; Garshasbi"
                            3 => "M&#46;G&#46; Matin"
                            4 => "A&#46;B&#46; Bedoustani"
                            5 => "F&#46;F&#46; Amoudizaj"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18502/ijaai.v18i6.2180"
                      "Revista" => array:6 [
                        "tituloSerie" => "Iran J Allergy Asthma Immunol&#46;"
                        "fecha" => "2019"
                        "volumen" => "18"
                        "paginaInicial" => "671"
                        "paginaFinal" => "678"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32245311"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cytokine sustained delivery for cancer therapy&#59; special focus on stem cell-and biomaterial-based delivery methods"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Mehralizadeh"
                            1 => "A&#46; Nazari"
                            2 => "F&#46; Oruji"
                            3 => "M&#46; Roostaie"
                            4 => "G&#46; Hosseininozari"
                            5 => "O&#46; Yazdani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "Pathol Res Pract&#46;"
                        "fecha" => "2023"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack737011"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0120" class="elsevierStylePara elsevierViewall">This article was extracted from the Ph&#46;D&#46; project of Mohammadreza Behvarz&#44; where Dr&#46; Seyyed Ali Rahmani and Dr&#46; Elham Siasi Torbati supervised&#44; and Dr&#46; Shahla Danaei Mehrabad and Dr&#46; Maryam Bikhof Torbati advised this project&#46; We thank the whole staff of Dr&#46; Rahmani Medical Genetics Laboratory for assistance in the successful strategy of this study&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/21735786/0000004800000003/v1_202404020631/S2173578623001129/v1_202404020631/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "6274"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/21735786/0000004800000003/v1_202404020631/S2173578623001129/v1_202404020631/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173578623001129?idApp=UINPBA00004N"
]
Article information
ISSN: 21735786
Original language: English
The statistics are updated each day
Year/Month Html Pdf Total
2024 April 1 2 3

Follow this link to access the full text of the article

es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos