Down-regulation of endogenous hydrogen sulphide pathway in nasal mucosa of allergic rhinitis in guinea pigs

array:23 ["pii" => "S0301054609000196" "issn" => "03010546" "doi" => "10.1016/j.aller.2009.03.002" "estado" => "S300" "fechaPublicacion" => "2009-07-01" "aid" => "18" "copyright" => "SEICAP" "copyrightAnyo" => "2008" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2009;37:180-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2863 "formatos" => array:3 [ "EPUB" => 7 "HTML" => 2543 "PDF" => 313 ] ] "itemSiguiente" => array:18 [ "pii" => "S0301054609000287" "issn" => "03010546" "doi" => "10.1016/j.aller.2009.02.005" "estado" => "S300" "fechaPublicacion" => "2009-07-01" "aid" => "27" "copyright" => "SEICAP" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2009;37:188-92" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2635 "formatos" => array:3 [ "EPUB" => 6 "HTML" => 2265 "PDF" => 364 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Production of interleukin-10 in asthmatic children after Beta-1-3-glucan" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "188" "paginaFinal" => "192" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig3" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1340 "Ancho" => 1629 "Tamanyo" => 113426 ] ] "descripcion" => array:1 [ "en" => "Mean diary symptom score of the fourth week of run-in period and the 12th week of Beta1-3-glucan administration. There was an improvement in wheezing (p=0.022), day coughing (p=0.018), nocturnal coughing (p=0.044) and there was no significant decrease in Salbutamol Sulphate rescue use (p=0.722)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "E. Sarinho, D. Medeiros, D. Schor, A. Rego Silva, V. Sales, M.E. Motta, A. Costa, A. Azoubel, J.A. Rizzo" "autores" => array:9 [ 0 => array:2 [ "nombre" => "E." "apellidos" => "Sarinho" ] 1 => array:2 [ "nombre" => "D." "apellidos" => "Medeiros" ] 2 => array:2 [ "nombre" => "D." "apellidos" => "Schor" ] 3 => array:2 [ "nombre" => "A." "apellidos" => "Rego Silva" ] 4 => array:2 [ "nombre" => "V." "apellidos" => "Sales" ] 5 => array:2 [ "nombre" => "M.E." "apellidos" => "Motta" ] 6 => array:2 [ "nombre" => "A." "apellidos" => "Costa" ] 7 => array:2 [ "nombre" => "A." "apellidos" => "Azoubel" ] 8 => array:2 [ "nombre" => "J.A." "apellidos" => "Rizzo" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000287?idApp=UINPBA00004N" "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000287/v1_201304101017/en/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S0301054609000184" "issn" => "03010546" "doi" => "10.1016/j.aller.2009.03.001" "estado" => "S300" "fechaPublicacion" => "2009-07-01" "aid" => "17" "copyright" => "SEICAP" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2009;37:175-9" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2242 "formatos" => array:3 [ "EPUB" => 6 "HTML" => 1878 "PDF" => 358 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Exercise-induced bronchospasm in obese adolescents" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "175" "paginaFinal" => "179" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "W.A. Lopes, R.B. Radominski, N.A. Rosário Filho, N. Leite" "autores" => array:4 [ 0 => array:2 [ "nombre" => "W.A." "apellidos" => "Lopes" ] 1 => array:2 [ "nombre" => "R.B." "apellidos" => "Radominski" ] 2 => array:2 [ "nombre" => "N.A." "apellidos" => "Rosário Filho" ] 3 => array:2 [ "nombre" => "N." "apellidos" => "Leite" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000184?idApp=UINPBA00004N" "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000184/v1_201304101017/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Down-regulation of endogenous hydrogen sulphide pathway in nasal mucosa of allergic rhinitis in guinea pigs" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "180" "paginaFinal" => "187" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Y. Shaoqing, Z. Ruxin, C. Yinjian, C. Jianqiu, Y. Zhiqiang, L. Genhong" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Y." "apellidos" => "Shaoqing" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff1" ] ] ] 1 => array:4 [ "nombre" => "Z." "apellidos" => "Ruxin" "email" => array:2 [ 0 => "profrxzhang@163.com" 1 => "rxzhang@x263.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff2" ] 1 => array:2 [ "etiqueta" => "¿" "identificador" => "cor1" ] ] ] 2 => array:3 [ "nombre" => "C." "apellidos" => "Yinjian" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff3" ] ] ] 3 => array:3 [ "nombre" => "C." "apellidos" => "Jianqiu" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff1" ] ] ] 4 => array:3 [ "nombre" => "Y." "apellidos" => "Zhiqiang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff4" ] ] ] 5 => array:3 [ "nombre" => "L." "apellidos" => "Genhong" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff1" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Department of Otolaryngology, Jinan General Hospital of PLA, Shandong, China" "etiqueta" => "a" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Department of Otolaryngology, Huadong Hospital, Fudan University, Shanghai, China" "etiqueta" => "b" "identificador" => "aff2" ] 2 => array:3 [ "entidad" => "Department of Laboratory Medicine, Jinan General Hospital of PLA, Shandong, China" "etiqueta" => "c" "identificador" => "aff3" ] 3 => array:3 [ "entidad" => "Department of Otolaryngology, Xuzhou 97th Hospital of PLA, Jiangshu, China" "etiqueta" => "d" "identificador" => "aff4" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "⁎" "correspondencia" => "Corresponding autor." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig6" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1067 "Ancho" => 1635 "Tamanyo" => 97134 ] ] "descripcion" => array:1 [ "en" => "Correlation between concentration of H2S in plasma and CSE mRNA expression level in nasal mucosa. Pearson Correlation was used to analyse the relationship between the level of H2S and expression of CSE mRNA. There was a highly significant direct relationship between them (r=0.87, P=0.001)." ] ] ] "textoCompleto" => "IntroductionRhinitis, especially allergic rhinitis (AR), continues to be a major health problem and although some treatments are available, none is ideal. Research on the role of the gas signal messenger such as nitric oxide (NO) and carbon monoxide (CO) in allergy medicine is a rapidly emerging field.<a class="elsevierStyleCrossRefs" href="#bib1">1,2</a> However, the molecular mechanisms of AR are still poorly understood, and researchers are seeking novel endogenously produced gasotransmitters to investigate their possible roles in the pathogenesis of allergic inflammation. Recently, hydrogen sulphide (H2S) was found to be the third endogenous signalling gasotransmitter because of its endogenous metabolism and physiologic functions.<a class="elsevierStyleCrossRef" href="#bib3">3</a> Now H2S is increasingly recognised as a member of a growing family of “gasotransmitters”, together with its two counterparts, NO and CO.H2S was only recognised as a kind of toxic gas in contaminated environments with a strong odour of rotten eggs for a long time, and its major effects were intoxication of the central nervous system and inhibition of respiratory system. Endogenous H2S may be generated by two pyridoxal-5′-phosphate-dependent enzymes: cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE) in mammalian tissues, which use L-cysteine as the main substrate. The expressions of these two enzymes are tissue-type specific.<a class="elsevierStyleCrossRefs" href="#bib4">4,5</a> H2S is directly produced in myocardial tissues, arterial and venous tissues by CSE,<a class="elsevierStyleCrossRefs" href="#bib6">6–8</a> and in some tissues such as the nervous system, CBS is only needed for the generation of H2S.<a class="elsevierStyleCrossRef" href="#bib9">9</a> Otherwise, the expressions of CBS and CSE are both identified in several mammalian tissues, including liver, kidney, brain, ileum, and blood lymphocytes.<a class="elsevierStyleCrossRefs" href="#bib3">3,10</a>Recent data suggest that H2S may contribute to many inflammatory processes such as asthma,<a class="elsevierStyleCrossRef" href="#bib11">11</a> acute pancreatitis,<a class="elsevierStyleCrossRef" href="#bib12">12</a> endotoxaemia,<a class="elsevierStyleCrossRef" href="#bib13">13</a> and COPD.<a class="elsevierStyleCrossRef" href="#bib14">14</a> This demonstrated that H2S plays a key role in modulating leukocyte adhesion to vascular endothelium, leukocyte infiltration, and oedema formation, which are characters of inflammation.To clarify the role of endogenous H2S in the pathogenesis of AR, we investigated the level of plasma H2S in guinea pigs with AR. Clinical symptoms of animals such as sneezing and nose rubbing, and leukocyte infiltration in nasal lavage fluid (NLF) were studied as non-invasive markers of inflammation. The expressions of CBS and CSE of nasal mucosa were also studied by real time RT-PCR. Sodium hydrosulphide (NaHS) and propargylglycine (PPG) were used as donor and inhibitor of H2S respectively in our study,<a class="elsevierStyleCrossRef" href="#bib15">15</a> and PPG is a specific inhibitor of CSE, which can suppress H2S production in tissues.<a class="elsevierStyleCrossRef" href="#bib16">16</a> Through regulated H2S level by NaHS and PPG, we investigated the changes of H2S on the inflammation process of AR.Materials and methodsMaterial and animal modelTwenty-four aged healthy male Hartley guinea pigs, weight 230–280g (National rodent laboratory animal resources, Shanghai branch, China) were taken and divided into four groups: Saline control group, AR sensitised group, NaHS treated group, and PPG treated group. The animal models of allergic rhinitis were prepared according to the methods made by Al Suleimani M et al.<a class="elsevierStyleCrossRef" href="#bib17">17</a> Guinea pigs (n=18) were initially exposed to 1% ovalbumin (10mg/kg, Sigma Inc.MD ) in saline given as a 1% aerosol twice for 10min each, 7 days apart. On days 14, 15 and 16, a booster of 1% ovalbumin in saline was instilled intranasally at a volume of 20μl/nostril/day into both nostrils. On day 21 guinea pigs were challenged with 2% ovalbumin in saline instilled intranasally at a volume of 20μl/nostril in each nostril. Eighteen sensitised guinea pigs were divided into three groups, one was continually treated with OVA as AR group. In the second group, named as NaHS group, animals (n=6) were intraperitoneally administered NaHS (Sigma Inc. MD) at a dose of 14μmol/kg/day, 12h after every nose inspiration with ovalbumin and continually for two weeks. In the third group, named as PPG group, animals (n=6) were intraperitoneally administered PPG (Sigma Inc.MD) at a dose of 30mg/kg/day immediately after every nose inspiration with ovalbumin continually for two weeks too. Control animals (n=6) were challenged in a similar manner by using saline.Observation of sneezing and nose rubbing and assessment of leukocyte infiltrationFrequency of sneezing and nose rubbing were assessed as previously described by Al Suleimani M et al. with modifications.<a class="elsevierStyleCrossRef" href="#bib17">17</a> They were counted directly following nasal challenge, and for 30min thereafter. A sneeze was characterized by an explosive expiration just after deep inspiration and an external perinasal scratch with the animal's forelimbs characterized a nose rub. NLF was collected from guinea pigs 1h post-challenge as follows<a class="elsevierStyleCrossRef" href="#bib17">17</a>: nasal cavities were washed with 2ml of pre-warmed saline infused from the tracheal side. NLF was collected from the anterior naris and total cell count was assessed using a standard haemocytometer. Leukocytes were counted under light microscope at power 40×, and the following formula was used:Number of cells/ml=total number of cells counted×dilution factor×1000/total volume counted (0.1mm3).Measurement of plasma H2S concentrationGuinea pigs were anaesthetised by intraperitoneal administration of pentobarbital (40mg/Kg). 1ml blood was collected from heart through direct cardiac puncturation, avoiding air contact. A sample of plasma (0.1ml) was added to a test tube containing 0.5ml of 1% zinc acetate and 2.5ml of distilled water, then 0.5ml of 20mmol/L N,N-dimethyl-p-phenylenediamine dihydrochloride in 7.2mol/L HCl and 0.4ml of 30mmol/L FeCl3 in 1.2mol/L HCl were also added to the same test tube for 20min of incubation at room temperature. The protein in the plasma was removed by adding 1ml of 10% trichloroacetic acid to the solution and centrifuging it. The optical absorbance of the resulting solution at 670nm was measured with a spectrometer (Lambda Bio, Perkin Elmer Inc, MD). H2S concentration in the solution was calculated against the calibration curve of the standard NaHS solution.Total RNA extraction and cDNA synthesisThe guinea pigs were sacrificed by rapid decapitation. Biopsies of nasal mucosa were taken from the inferior turbinate and put in liquid nitrogen immediately. They were then minced with a scalpel on dry ice and transferred immediately to 2ml polypropylene tubes, homogenised and total RNA was extracted using Trizol™ reagent (Invitrogen Inc, MD) following the manufacturer's instructions. The concentration and purity of RNA were determined spectrophotometrically. Then the synthesis of cDNA was performed according to a cDNA synthesis kit (PrimeScript RTase, TaKaRa Inc, Japan).Real time reverse transcriptase-polymerase chain reaction for CBS and CSE mRNA expressionsTo determine the expressions of the CBS and CSE gene in nasal mucosa, fluorescent quantitative real time RT-PCR assay was performed. The sequences of the primers (TaKaRa Inc, Japan) specific for CBS and CSE were performed with sense (CBS: CCAGGACTTGGAGGTACAGC, CSE: TCCGGATGGAGAAACACTTC) and antisense (CBS: TCGGCACTGTGTGGTAATGT,CSE:GCTGCCTTTAAAGCTTGACC) primers, with an expected size of the amplified sequence of 155bp for CBS and 400bp for CSE. β-actin was used as control (sense: ACCCTTAAGGCCAACCGTGAAAAG, antisense: TCATGAGGTAGTCTGTC AGGT, 240bp). Then the incubation of cDNA and primer was performed at 95°C for 5min and the PCR reaction proceeded for 45 cycles: 95°C for 20s, 57°C for 20s, and 72°C for 20s in a programmable thermal cycler (Line-Gene real-time PCR detection system, bioer Inc, China) using a thermostable Taq DNA polymerase (SYBR PrimeScript Ex Taq, TaKaRa Inc, Japan) final incubation at 72°C for 7min. Fluorescent product was measured by a single acquisition mode at 86°C after each cycle. After the completion of PCR amplification, a melting curve analysis was performed. <a class="elsevierStyleCrossRef" href="#fig1">Fig. 1</a> shows a sharp peak with a melting temperature (Tm) of CBS(Tm A) of 86°C, CSE(Tm B) of 84°C and β-actin (Tm C) of 90°C. For each sample, the amount of both target and endogenous control (β-actin, a housekeeping gene) were determined. The typical amplification curves of real-time RT-PCR for CBS, CSE and β-actin mRNA are shown in <a class="elsevierStyleCrossRef" href="#fig2">Fig. 2</a>. The amount of the target molecule was then divided by the amount of the endogenous reference, to obtain a normalised target value. The PCR products were also run on 1.5% agarose gel and visualised by ultraviolet light.<elsevierMultimedia ident="fig1"></elsevierMultimedia><elsevierMultimedia ident="fig2"></elsevierMultimedia>Statistical analysisAll data were expressed as mean±S.D. Statistical analyses of data were performed using ANOVA for multiple comparison and LSD for comparison among groups, and Pearson Correlation for the two-variable correlation analysis. P<0.05 was considered to be statistically significant.ResultsConcentration of H2S in plasmaThe blood H2S level of the AR group was lower than that of the non-sensitised group (p<0.01). H2S level increased significantly after being treated with H2S donor NaHS, and decreased after PPG was administrated, as compared with AR group (p<0.05) (see <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>). It indicated that down-regulation of H2S level existed in AR, and NaHS increased H2S level and PPG decreased it successfully.<elsevierMultimedia ident="tbl1"></elsevierMultimedia>Sneezing, nose rubbing and leukocyte infiltrationThe results are shown in <a class="elsevierStyleCrossRef" href="#fig3">Fig. 3</a>. Sneezing frequency and number of nose rubbings in sensitised AR group were significantly increased (p<0.01) as compared with a non-sensitised group, and increased further in PPG treated group as compared with AR group (p<0.05), but significantly decreased in NaSH treated group (p<0.05). In AR group, there was a significant increase of total cell count in NLF (p<0.01), especially eosinophils and neutrophils as compared with non-sensitised groups. Total cell count significantly increased after PPG treated, and decreased after NaHS treated (p<0.05), as compared with AR group. It indicated that NaHS increased the H2S level but reduced the inflammatory response of allergy e.g. inhibited leukocyte infiltration in nasal mucosa, but PPG had the opposite effect on allergy.<elsevierMultimedia ident="fig3"></elsevierMultimedia>Expressions of CBS and CSE by real-time RT-PCRThe cumulative data for mRNA expressions of CBS and CSE are presented in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a> and <a class="elsevierStyleCrossRef" href="#fig4">Fig. 4</a>. CSE mRNA expression was down-regulated significantly in AR group as compared with control (p<0.05) and the expression was increased significantly after being stimulated by NaHS (p<0.05), and decreased significantly with PPG administration as compared with AR group (p<0.05). The expression of CBS in nasal mucosa was very weak and no significant changes of CBS mRNA levels were observed between groups (p>0.05). To verify the amplification curve results, representative samples of the PCR products were run on 1.5% agarose gels. Electrophoresis results showed that the order of CSE mRNA expression levels from high to low was control, NaHS, AR and PPG group (<a class="elsevierStyleCrossRef" href="#fig5">Fig. 5</a>). Moreover, correlation between the level of CSE mRNA and concentration of H2S was also analysed. There was a high significant direct relationship between them (r=0.87, P=0.001) (<a class="elsevierStyleCrossRef" href="#fig6">Fig. 6</a>). It suggested that the level of H2S was positively correlated with CSE of nasal mucosa through a concentration-dependent manner and that the NaHS and PPG regulated the level and might have a relationship with the expression of CSE of nasal mucosa in AR. The CBS of nasal mucosa perhaps had little effect on level of H2S in AR.<elsevierMultimedia ident="fig4"></elsevierMultimedia><elsevierMultimedia ident="fig5"></elsevierMultimedia><elsevierMultimedia ident="fig6"></elsevierMultimedia>DiscussionAfter nasal provocation with ovalbumin, the AR was evaluated from the occurrence of typical clinical symptoms with respect to nose and eyes irritation, like sneezing, conjunctival and nasal secretion. In comparison to saline, ovalbumin sensitisation increased sneezing frequency and numbers of nasal rubs. Nasal cellular infiltration (extravasation of leukocytes) is a characteristic hallmark of AR. Following nasal allergen challenge in sensitised guinea pigs, there was a significant increase in total cell count (p<0.01) as compared with non-sensitised groups. Furthermore, both eosinophils and neutrophils were significantly induced. Sneezing frequency, number of nasal rubs, and total cell counts in nasal washings can be used as indices of allergic response.This study was the first to show down-regulation of endogenous H2S in sensitised AR guinea pigs. Previous studies had shown that gaseous transmitters, NO and CO, played important roles in the pathogenesis of AR.<a class="elsevierStyleCrossRefs" href="#bib18">18,19</a> H2S is a colourless and flammable gas with a small molecular weight, and now is increasingly recognised as a member of a growing family of “gasotransmitters”, together with its two counterparts, NO and CO. It was only recently that researchers came to understand H2S as a novel gasotransmitter playing an important biological role, especially in airway inflammation such as in asthma, COPD, or lung injury.<a class="elsevierStyleCrossRefs" href="#bib12">12,14</a>H2S is produced mainly by two pyridoxal-5’phosphate-dependent enzymes responsible for the metabolism of L-cysteine, CBS and CSE. It should be noted that H2S generation is closely associated with the catabolism of cysteine and methionine as well as with glutathione metabolism. Both CBS and CSE are responsible for the metabolism of methionine into cysteine, which is in turn used for the generation of H2S,<a class="elsevierStyleCrossRef" href="#bib20">20</a> but the two enzymes differ in the specific mechanism of H2S formation. CSE catalyses the conversion of cystine (a cysteine disulphide) to thiocysteine, pyruvate and ammonia, thiocysteine then non-enzymatically decomposes to cysteine and H2S. The major mechanism of H2S produced by CBS probably involves the condensation of homocysteine with cysteine to yield cystathionine, and H2S is released during this reaction.<a class="elsevierStyleCrossRefs" href="#bib21">21,22</a> The expressions of CBS and CSE had been identified in many human and other mammalian cells, including those from liver, kidney, brain, skin fibroblasts, and blood lymphocytes. In some tissues CBS and CSE are both needed for generation of H2S, whereas in others only one enzyme is needed.<a class="elsevierStyleCrossRefs" href="#bib4">4–8</a> Thus, it has come to be known that the expression of CBS and/or CSE is tissue specific. In nasal mucosa, more expression of CSE was found but not of CBS, and the mRNA expression of CSE was positively correlated with the concentration of H2S by concentration-dependent manner, so the CSE was maybe the major H2S-producing enzyme in nasal mucosa and it was positively correlated with the level of H2S in AR, because CSE mainly exists in vascular smooth muscle cells (SMC),<a class="elsevierStyleCrossRef" href="#bib23">23</a> and expressed in nasal mucosa might be attributed to the rich distribution of vascular SMC.In order to investigate the influence of H2S level on symptoms of AR, NaHS was used as H2S donor. NaHS can be dissociated to Na+ and HS− in solution, and then HS− associates with H+ and produces H2S.<a class="elsevierStyleCrossRef" href="#bib24">24</a> In the experiment after NaHS treatment, H2S level was successfully up-regulated in plasma as compared with the AR group (p<0.05), and it alleviated the symptoms of AR. PPG was used as an inhibitor of H2S. Our observations had shown that PPG significantly attenuated the expression of CSE, and in the PGG group the level of H2S was decreased significantly as compared with the AR group. PPG can suppress the production of H2S by inhibited CSE, and symptoms of AR were aggravated after PPG treatment, accompanied by enhanced leukocyte adhesion, leukocyte infiltration, perhaps with oedema formation. All these suggested that the level of H2S has a negative effect on symptoms of AR.In mammalian tissues H2S may be a physiological regulator with its vascular effect possibly mediated by the opening of the KATP channel of vascular tissue,<a class="elsevierStyleCrossRef" href="#bib25">25</a> and H2S could also inhibit vascular SMC proliferation,<a class="elsevierStyleCrossRef" href="#bib26">26</a> and CSE mRNA was expressed mainly by the SMC of the vascular cells but not by the endothelial cells.<a class="elsevierStyleCrossRef" href="#bib27">27</a> A potentially critical role for CSE-derived H2S in allergic response is its ability to regulate airway smooth muscle associated with the tone of vascular. H2S can also suppress leukocyte adherence to the vascular endothelium and reduce leukocyte infiltration and oedema formation.<a class="elsevierStyleCrossRef" href="#bib28">28</a> We speculated that the down-regulation of the H2S/CSE pathway in the nasal mucosa of AR was associated with the change of blood flow. The release of H2S was decreased as CSE was suppressed by PPG leading to increased vasodilatation, and increased permeability of the nasal mucosa epithelium and vascular endothelium, and rapidly generated mediators of inflammation (leukotrienes, chemokines), associated with the allergic response, including rhinorrhoea, mucosal oedema, neutrophil and eosinophil chemotactic effects. The level of H2S increased by NaHS had the opposite results with vasoconstrictor effects and was accompanied by the inhibition of inflammatory mediator release.As mentioned above, H2S is also an important modulator of vascular tone like NO and CO, and plays an anti-oxidant role in inflammation.<a class="elsevierStyleCrossRef" href="#bib29">29</a> It should be noted that NO and CO may have direct vasorelaxation through endothelial cells.<a class="elsevierStyleCrossRef" href="#bib30">30</a> Immunohistochemistry researches show that NOS and HO, which are major rate-limited enzymes of NO and CO respectively, are mainly located in cytoplasm of endothelial cells.<a class="elsevierStyleCrossRef" href="#bib31">31</a> But the expression of H2S-generating enzyme was identified in vascular SMC, not in endothelium<a class="elsevierStyleCrossRef" href="#bib27">27</a> and it was shown that the vasorelaxant effect of H2S might mainly mediate by an interaction of the gas with smooth muscles.<a class="elsevierStyleCrossRef" href="#bib24">24</a> Thus, H2S seems to have a unique action mechanism among vasodilator gases in nasal mucosa. The gas signals among NO, CO and H2S may be a self-balancing regulation of endothelial cells and muscle cells in nasal mucosa of allergic inflammation. Vasorelaxation of H2S may be influenced by NO or CO, a recent study also suggests that low doses of H2S may induce vasoconstriction by scavenging endothelial NO.<a class="elsevierStyleCrossRefs" href="#bib32">32,33</a> Perhaps the roles of H2S are regulated by NO or CO in the pathogenesis of AR, although further research is needed.ConclusionsOur findings have shown that down-regulation of endogenous H2S pathway in AR, and the level of H2S was positively correlated with the expression of CSE in nasal mucosa. It indicated that endogenous H2S had latent roles in the pathogenesis of AR. Furthermore, the roles of H2S in pathogenesis of AR appear so complex, and more new lines of research are needed, and might have potential benefit for the investigation of AR." "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:2 [ "identificador" => "xres85636" "titulo" => array:5 [ 0 => "Abstract" 1 => "Background" 2 => "Methods" 3 => "Results" 4 => "Conclusion" ] ] 1 => array:2 [ "identificador" => "xpalclavsec73915" "titulo" => "Keywords" ] 2 => array:1 [ "titulo" => "Introduction" ] 3 => array:2 [ "titulo" => "Materials and methods" "secciones" => array:6 [ 0 => array:1 [ "titulo" => "Material and animal model" ] 1 => array:1 [ "titulo" => "Observation of sneezing and nose rubbing and assessment of leukocyte infiltration" ] 2 => array:1 [ "titulo" => "Measurement of plasma HS concentration" ] 3 => array:1 [ "titulo" => "Total RNA extraction and cDNA synthesis" ] 4 => array:1 [ "titulo" => "Real time reverse transcriptase-polymerase chain reaction for CBS and CSE mRNA expressions" ] 5 => array:1 [ "titulo" => "Statistical analysis" ] ] ] 4 => array:2 [ "titulo" => "Results" "secciones" => array:3 [ 0 => array:1 [ "titulo" => "Concentration of HS in plasma" ] 1 => array:1 [ "titulo" => "Sneezing, nose rubbing and leukocyte infiltration" ] 2 => array:1 [ "titulo" => "Expressions of CBS and CSE by real-time RT-PCR" ] ] ] 5 => array:1 [ "titulo" => "Discussion" ] 6 => array:1 [ "titulo" => "Conclusions" ] 7 => array:2 [ "identificador" => "xack31655" "titulo" => "Acknowledgments" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2008-12-13" "fechaAceptado" => "2009-03-02" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec73915" "palabras" => array:7 [ 0 => "Hydrogen sulphide" 1 => "Allergic rhinitis" 2 => "Cystathionine β-synthase" 3 => "Cystathionine γ-lyase" 4 => "Guinea pig" 5 => "Real time RT-PCR" 6 => "Nasal mucosa" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "BackgroundThe present study was designed to explore the possible changes in endogenous hydrogen sulphide (H2S), a novel gasotransmitter, on the pathogenesis of allergic rhinitis (AR). MethodsAR guinea pig model was established by nasal ovalbumin sensitisation. Guinea pigs were divided into four groups: Saline control, AR sensitised, sodium hydrosulphide (NaHS) treated, and propargylglycine (PPG) treated group. The frequency of sneezing and nose rubbing was recorded. Leukocyte infiltration in nasal lavage fluid (NLF) and plasma H2S level were measured. Expression of Cystathionine-β-synthase (CBS) and Cystathionine-γ-lyase (CSE) mRNA as H2S-producing enzymes in nasal mucosa was determined by real time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). ResultsThe frequency of sneezing and nose rubbing, and levels of leukocyte infiltration in NLF were higher than those of control (P<0.01), but plasma H2S in sensitised guinea pigs was lower than those of control (P<0.05). From the results of RT-PCR, it was found that the expression of CSE was higher than CBS in nasal mucosa, and in sensitised guinea pigs it was lower than that of control (P<0.05). NaHS successfully increased the level of H2S and alleviated the symptoms of AR accompanied by up-regulation of CSE as compared with AR group (P<0.05). PPG significantly suppressed the expression of CSE and decreased the H2S level, yet also aggravated the symptoms of AR. ConclusionH2S level may be negatively correlated with the process of inflammation and positively correlated with expression of CSE in nasal mucosa. The endogenous H2S pathway is down-regulated in AR." ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3158 "Ancho" => 2500 "Tamanyo" => 204540 ] ] "descripcion" => array:1 [ "en" => "The typical amplification and melting curves of real-time RT-PCR for CSE(A), CBS(B) and β-actin(C).The figure shows a sharp peak with a melting temperature of CSE(Tm A) of 84°C,CBS(Tm B) of 86°C and β-actin (Tm C) of 90°C." ] ] 1 => array:7 [ "identificador" => "fig2" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3393 "Ancho" => 2500 "Tamanyo" => 242438 ] ] "descripcion" => array:1 [ "en" => "Cycles of CSE(A), CBS(B) and β-actin(C).For the four curves: control group(a), NaHS group(b), AR group(c) and PPG group(d).The vertical axis represents the degree of amplification by SYBR-Green fluorescence and the horizontal axis represents the number of amplification cycles. With the same cycle number, the groups have similar amplification of β-actin and CBS but different amplification of CSE." ] ] 2 => array:7 [ "identificador" => "fig3" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1060 "Ancho" => 1625 "Tamanyo" => 102279 ] ] "descripcion" => array:1 [ "en" => "The Sneezing and nose rubbing of guinea pigs. Each column and vertical bar represents the mean±S.D. *,**: Significantly different from the control group (p<0.05 and p<0.01, respectively). ♯,♯♯ Significantly different from the AR group (p<0.05 and p<0.01, respectively)." ] ] 3 => array:7 [ "identificador" => "fig4" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1319 "Ancho" => 1627 "Tamanyo" => 92479 ] ] "descripcion" => array:1 [ "en" => "Expressions of CSE and CBS mRNA. Each column and vertical bar represents the mean±S.D. *,**: Significantly different from the control group (p<0.05 and p<0.01, respectively). ♯,♯♯ Significantly different from the AR group (p<0.05 and p<0.01, respectively)." ] ] 4 => array:7 [ "identificador" => "fig5" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 717 "Ancho" => 2916 "Tamanyo" => 88833 ] ] "descripcion" => array:1 [ "en" => "Image of gel of RT-PCR for CSE(A),CBS(B) and β-actin(C) mRNA from nasal mucosa of guinea pigs. Sizes of PCR products were 400bp(CSE),155bp(CBS) and 240bp(β-actin).Lanes 1–5 (from left to right) were products of AR, control, PPG, NaHS groups and DNA marker (100∼600bp).There was a decrease in CSE cDNA in AR group compare with control, and it increased after NaSH treated and decreases after PPG treated, whereas there was no change in β-actin mRNA. The expressions of CBS mRNA were so weak that no significant difference between groups was found." ] ] 5 => array:7 [ "identificador" => "fig6" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1067 "Ancho" => 1635 "Tamanyo" => 97134 ] ] "descripcion" => array:1 [ "en" => "Correlation between concentration of H2S in plasma and CSE mRNA expression level in nasal mucosa. Pearson Correlation was used to analyse the relationship between the level of H2S and expression of CSE mRNA. There was a highly significant direct relationship between them (r=0.87, P=0.001)." ] ] 6 => array:6 [ "identificador" => "tbl1" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "The concentration of H2S of Plasma, eotaxin of nasal lavage fluid, expression of mRNA of CSE and CBS of nasal mucosa. All data represent as mean±S.D.*,**: Significantly different from the control group (p<0.05 and p<0.01, respectively). ♯,♯♯ Significantly different from the AR group (p<0.05 and p<0.01, respectively)." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Normal group \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">AR group \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">NaHS group \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">PGG group \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H2S (umol/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18.9±1.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13.9±0.9* \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16.8±1.1♯ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8.8±1.6**♯ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CSE (×10−2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9.2±1.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.4±0.8* \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.0±0.2*♯ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.57±0.16**♯ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CBS (×10−4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6.4±1.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7.1±1.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6.5±2.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.8±1.1 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab164390.png" ] ] ] ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:1 [ "bibliografiaReferencia" => array:33 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nitric oxide in allergic rhinitis and asthma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Frieri" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Allergy Asthma Proc" "fecha" => "1998" "volumen" => "19" "paginaInicial" => "349" "paginaFinal" => "351" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9876773" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Localisation of heme oxygenase isoforms in allergic human nasal mucosa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S. Lo" 1 => "S. Di Palma" 2 => "L. Pitkin" 3 => "A.W. McCombe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00405-004-0873-2" "Revista" => array:6 [ "tituloSerie" => "Eur Arch Otorhinolaryngol" "fecha" => "2005" "volumen" => "262" "paginaInicial" => "595" "paginaFinal" => "598" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15592935" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide (H2S)-the third gas of interest for pharmacologists" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E. Lowicka" 1 => "J. Beltowski" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pharmacol Rep" "fecha" => "2007" "volumen" => "59" "paginaInicial" => "4" "paginaFinal" => "24" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17377202" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reaction mechanism and regulation of cystathionine beta-synthase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R. Banerjee" 1 => "R. Evande" 2 => "O. Kabil" 3 => "S. Ojha" 4 => "S. Taoka" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biochim Biophys Acta" "fecha" => "2003" "volumen" => "1647" "paginaInicial" => "30" "paginaFinal" => "35" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12686104" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Murine cystathionine gamma-lyase: complete cDNA and genomic sequences, promoter activity, tissue distribution and developmental expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Ishii" 1 => "N. Akahoshi" 2 => "X.N. Yu" 3 => "Y. Kobayashi" 4 => "K. Namekata" 5 => "G. Komaki" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BJ20040243" "Revista" => array:6 [ "tituloSerie" => "Biochem J" "fecha" => "2004" "volumen" => "381" "paginaInicial" => "113" "paginaFinal" => "123" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15038791" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "H2S generated by heart in rat and its effects on cardiac function" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Geng" 1 => "J.H. Yang" 2 => "Y.F. Qi" 3 => "J. Zhao" 4 => "Y.Z. Pang" 5 => "J.B. Du" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2004" "volumen" => "313" "paginaInicial" => "362" "paginaFinal" => "368" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14684169" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The vasorelaxant effect of H2S as a novel endogenous gaseous KATP channel opener" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W.M. Zhao" 1 => "J. Zhang" 2 => "Y.J. Lu" 3 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/emboj/20.21.6008" "Revista" => array:6 [ "tituloSerie" => "EMBO J" "fecha" => "2001" "volumen" => "20" "paginaInicial" => "6008" "paginaFinal" => "6016" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11689441" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The possible role of hydrogen sulfide as an endogenous smooth muscle relaxant in synergy with nitric oxide" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Hosoki" 1 => "N. Matsuki" 2 => "H. Kimura" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "1997" "volumen" => "273" "paginaInicial" => "527" "paginaFinal" => "531" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide: neurochemistry and neurobiology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "K. Qu" 1 => "S.W. Lee" 2 => "J.S. Bian" 3 => "C.M. Low" 4 => "P.T. Wong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.neuint.2007.05.016" "Revista" => array:6 [ "tituloSerie" => "Neurochem Int" "fecha" => "2008" "volumen" => "52" "paginaInicial" => "155" "paginaFinal" => "165" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17629356" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Estimation of hydrogen sulphide in the human lymphocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S. Barathi" 1 => "P. Vadhana" 2 => "N. Angayarkanni" 3 => "S. Ramakrishnan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Indian J Biochem Biophys" "fecha" => "2007" "volumen" => "44" "paginaInicial" => "179" "paginaFinal" => "182" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17650588" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The regulatory effect of endogenous hydrogen sulfide on acute asthma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R. Wu" 1 => "W.Z. Yao" 2 => "Y.H. Chen" 3 => "B. Geng" 4 => "M. Lu" 5 => "C.S. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Zhonghua Jie He He Hu Xi Za Zhi" "fecha" => "2007" "volumen" => "30" "paginaInicial" => "522" "paginaFinal" => "526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17961407" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of hydrogen sulfide in acute pancreatitis and associated lung injury" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Bhatia" 1 => "F.L. Wong" 2 => "D. Fu" 3 => "H.Y. Lau" 4 => "S.M. Moochhala" 5 => "P.K. Moore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.04-3023fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2005" "volumen" => "19" "paginaInicial" => "623" "paginaFinal" => "625" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15671155" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide is a novel mediator of lipopolysaccharide-induced inflammation in the mouse" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Li" 1 => "M. Bhatia" 2 => "Y.Z. Zhu" 3 => "Y.C. Zhu" 4 => "R.D. Ramnath" 5 => "Z.J. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.04-3583fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2005" "volumen" => "19" "paginaInicial" => "1196" "paginaFinal" => "1198" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15863703" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Endogenous hydrogen sulfide in patients with COPD" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.H. Chen" 1 => "W.Z. Yao" 2 => "B. Geng" 3 => "Y.L. Ding" 4 => "M. Lu" 5 => "M.W. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.128.5.3205" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2005" "volumen" => "128" "paginaInicial" => "3205" "paginaFinal" => "3211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16304263" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide induces calcium waves in astrocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Nagai" 1 => "M. Tsugane" 2 => "J. Oka" 3 => "H. Kimura" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.03-1052fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2004" "volumen" => "18" "paginaInicial" => "557" "paginaFinal" => "559" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14734631" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Modulation of endogenous production of H2S in rat tissues" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "W. Zhao" 1 => "J.F. Ndisang" 2 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1139/y03-077" "Revista" => array:6 [ "tituloSerie" => "Can J Physiol Pharmacol" "fecha" => "2003" "volumen" => "81" "paginaInicial" => "848" "paginaFinal" => "853" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14614520" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A comprehensive model of allergic rhinitis in guinea pigs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Al Suleimani" 1 => "D. Ying" 2 => "M.J. Walker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vascn.2006.05.005" "Revista" => array:6 [ "tituloSerie" => "J Pharmacol Toxicol Methods" "fecha" => "2007" "volumen" => "55" "paginaInicial" => "127" "paginaFinal" => "134" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16829141" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nasal nitric oxide and nasal allergy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "V.M. Struben" 1 => "M.H. Wieringa" 2 => "L. Feenstra" 3 => "J.C. de Jongste" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1398-9995.2006.01096.x" "Revista" => array:6 [ "tituloSerie" => "Allergy" "fecha" => "2006" "volumen" => "61" "paginaInicial" => "665" "paginaFinal" => "670" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16677234" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Heme oxygenase (HO)-1 is upregulated in the nasal mucosa with allergic rhinitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A. Elhini" 1 => "S. Abdelwahab" 2 => "K. Ikeda" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/01.mlg.0000194692.51979.d1" "Revista" => array:6 [ "tituloSerie" => "Laryngoscope" "fecha" => "2006" "volumen" => "116" "paginaInicial" => "446" "paginaFinal" => "450" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16540907" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib20" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Endogenous production of hydrogen sulfide in mammals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "P. Kamoun" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00726-004-0072-x" "Revista" => array:6 [ "tituloSerie" => "Amino Acids" "fecha" => "2004" "volumen" => "26" "paginaInicial" => "243" "paginaFinal" => "254" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15221504" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib21" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The gasotransmitter role of hydrogen sulfide" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/152308603768295249" "Revista" => array:6 [ "tituloSerie" => "Antioxid Redox Signal" "fecha" => "2003" "volumen" => "5" "paginaInicial" => "493" "paginaFinal" => "501" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/13678538" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib22" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An overview of the biological significance of endogenous gases: new roles for old molecules" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L. Li" 1 => "P.K. Moore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BST0351138" "Revista" => array:6 [ "tituloSerie" => "Biochem Soc Trans" "fecha" => "2007" "volumen" => "35" "paginaInicial" => "1138" "paginaFinal" => "1141" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17956296" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib23" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pro-apoptotic effect of endogenous H2S on human aorta smooth muscle cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G. Yang" 1 => "L. Wu" 2 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.05-4712fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2006" "volumen" => "20" "paginaInicial" => "553" "paginaFinal" => "555" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16507767" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib24" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "H(2)S-induced vasorelaxation and underlying cellular and molecular mechanisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "W. Zhao" 1 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpheart.00013.2002" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Heart Circ Physiol" "fecha" => "2002" "volumen" => "283" "paginaInicial" => "H474" "paginaFinal" => "H480" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12124191" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib25" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The possible role of hydrogen sulfide as a smooth muscle cell proliferation inhibitor in rat cultured cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.B. Du" 1 => "H. Yan" 2 => "Ch.Y. Zhang" 3 => "B. Geng" 4 => "H. Jiang" 5 => "X.B. Ch" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00380-003-0743-7" "Revista" => array:6 [ "tituloSerie" => "Heart Vessels" "fecha" => "2004" "volumen" => "19" "paginaInicial" => "75" "paginaFinal" => "80" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15042391" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib26" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The possible role of hydrogen sulfide as a smooth muscle cell proliferation inhibitor in rat cultured cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Du" 1 => "Y. Hui" 2 => "Y. Cheung" 3 => "G. Bin" 4 => "H. Jiang" 5 => "X. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00380-003-0743-7" "Revista" => array:6 [ "tituloSerie" => "Heart Vessels" "fecha" => "2004" "volumen" => "19" "paginaInicial" => "75" "paginaFinal" => "80" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15042391" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib27" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The smooth muscle relaxant effect of hydrogen sulphide in vitro: evidence for a physiological role to control intestinal contractility" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B. Teague" 1 => "S. Asiedu" 2 => "P.K. Moore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjp.0704858" "Revista" => array:6 [ "tituloSerie" => "Br J Pharmacol" "fecha" => "2002" "volumen" => "137" "paginaInicial" => "139" "paginaFinal" => "145" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12208769" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib28" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide is an endogenous modulator of leukocyte-mediated inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R.C. Zanardo" 1 => "V. Brancaleone" 2 => "E. Distrutti" 3 => "S. Fiorucci" 4 => "G. Cirino" 5 => "J.L. Wallace" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.06-6270fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2006" "volumen" => "20" "paginaInicial" => "2118" "paginaFinal" => "2120" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16912151" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib29" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hydrogen sulfide as a vasodilator" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Bhatia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/15216540500217875" "Revista" => array:6 [ "tituloSerie" => "IUBMB Life" "fecha" => "2005" "volumen" => "57" "paginaInicial" => "603" "paginaFinal" => "606" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16203678" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib30" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Different mechanisms underlying the stimulation of K(Ca) channels by nitric oxide and carbon monoxide" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L. Wu" 1 => "K. Cao" 2 => "Y. Lu" 3 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI15316" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "2002" "volumen" => "110" "paginaInicial" => "691" "paginaFinal" => "700" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12208870" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib31" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evidence for a possible inhibitory interaction between the HO-1/CO- and Akt/NO-pathways in human endothelial cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C.A. Batzlsperger" 1 => "S. Achatz" 2 => "J. Spreng" 3 => "G.A. Riegger" 4 => "D.P. Griese" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10557-007-6051-1" "Revista" => array:6 [ "tituloSerie" => "Cardiovasc Drugs Ther" "fecha" => "2007" "volumen" => "21" "paginaInicial" => "347" "paginaFinal" => "355" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17896171" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib32" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulation of vascular nitric oxide in vitro and in vivo; a new role for endogenous hydrogen sulphide?" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.Y. Ali" 1 => "C.Y. Ping" 2 => "Y.Y. Mok" 3 => "L. Ling" 4 => "M. Whiteman" 5 => "M. Bhatia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjp.0706906" "Revista" => array:6 [ "tituloSerie" => "Br J Pharmacol." "fecha" => "2006" "volumen" => "149" "paginaInicial" => "625" "paginaFinal" => "634" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17016507" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib33" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interaction between hydrogen sulfide/cystathionine gamma-lyase and carbon monoxide/heme oxygenase pathways in aortic smooth muscle cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H.F. Jin" 1 => "J.B. Du" 2 => "X.H. Li" 3 => "Y.F. Wang" 4 => "Y.F. Liang" 5 => "C.S. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1745-7254.2006.00425.x" "Revista" => array:6 [ "tituloSerie" => "Acta Pharmacol Sin" "fecha" => "2006" "volumen" => "27" "paginaInicial" => "1561" "paginaFinal" => "1566" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17112409" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "identificador" => "xack31655" "titulo" => "Acknowledgments" "texto" => "This study was supported by the National Science Foundation of China (No. 30400494) and National Science Foundation of Shandong province (No. Y2006C03)." ] ] ] "idiomaDefecto" => "en" "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000196/v1_201304101017/en/main.assets" "Apartado" => array:4 [ "identificador" => "5554" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03010546/0000003700000004/v1_201304101017/S0301054609000196/v1_201304101017/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000196?idApp=UINPBA00004N"]

Statistics

Original article

Y. Shaoqinga, Z. Ruxinb,

Corresponding author

profrxzhang@163.com
rxzhang@x263.com

Corresponding autor.

, C. Yinjianc, C. Jianqiua, Y. Zhiqiangd, L. Genhonga

a Department of Otolaryngology, Jinan General Hospital of PLA, Shandong, China

b Department of Otolaryngology, Huadong Hospital, Fudan University, Shanghai, China

c Department of Laboratory Medicine, Jinan General Hospital of PLA, Shandong, China

d Department of Otolaryngology, Xuzhou 97th Hospital of PLA, Jiangshu, China

Read

3937

Times
was read the article

619

Total PDF

3318

Total HTML

Share statistics

 array:23 [
  "pii" => "S0301054609000196"
  "issn" => "03010546"
  "doi" => "10.1016/j.aller.2009.03.002"
  "estado" => "S300"
  "fechaPublicacion" => "2009-07-01"
  "aid" => "18"
  "copyright" => "SEICAP"
  "copyrightAnyo" => "2008"
  "documento" => "article"
  "crossmark" => 0
  "subdocumento" => "fla"
  "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2009;37:180-7"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:2 [
    "total" => 2863
    "formatos" => array:3 [
      "EPUB" => 7
      "HTML" => 2543
      "PDF" => 313
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0301054609000287"
    "issn" => "03010546"
    "doi" => "10.1016/j.aller.2009.02.005"
    "estado" => "S300"
    "fechaPublicacion" => "2009-07-01"
    "aid" => "27"
    "copyright" => "SEICAP"
    "documento" => "article"
    "crossmark" => 0
    "subdocumento" => "fla"
    "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2009;37:188-92"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 2635
      "formatos" => array:3 [
        "EPUB" => 6
        "HTML" => 2265
        "PDF" => 364
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Production of interleukin-10 in asthmatic children after Beta-1-3-glucan"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "188"
          "paginaFinal" => "192"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig3"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1340
              "Ancho" => 1629
              "Tamanyo" => 113426
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Mean diary symptom score of the fourth week of run-in period and the 12th week of Beta1-3-glucan administration&#46; There was an improvement in wheezing &#40;p&#61;0&#46;022&#41;&#44; day coughing &#40;p&#61;0&#46;018&#41;&#44; nocturnal coughing &#40;p&#61;0&#46;044&#41; and there was no significant decrease in Salbutamol Sulphate rescue use &#40;p&#61;0&#46;722&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "E&#46; Sarinho, D&#46; Medeiros, D&#46; Schor, A&#46; Rego Silva, V&#46; Sales, M&#46;E&#46; Motta, A&#46; Costa, A&#46; Azoubel, J&#46;A&#46; Rizzo"
          "autores" => array:9 [
            0 => array:2 [
              "nombre" => "E&#46;"
              "apellidos" => "Sarinho"
            ]
            1 => array:2 [
              "nombre" => "D&#46;"
              "apellidos" => "Medeiros"
            ]
            2 => array:2 [
              "nombre" => "D&#46;"
              "apellidos" => "Schor"
            ]
            3 => array:2 [
              "nombre" => "A&#46;"
              "apellidos" => "Rego Silva"
            ]
            4 => array:2 [
              "nombre" => "V&#46;"
              "apellidos" => "Sales"
            ]
            5 => array:2 [
              "nombre" => "M&#46;E&#46;"
              "apellidos" => "Motta"
            ]
            6 => array:2 [
              "nombre" => "A&#46;"
              "apellidos" => "Costa"
            ]
            7 => array:2 [
              "nombre" => "A&#46;"
              "apellidos" => "Azoubel"
            ]
            8 => array:2 [
              "nombre" => "J&#46;A&#46;"
              "apellidos" => "Rizzo"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000287?idApp=UINPBA00004N"
    "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000287/v1_201304101017/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0301054609000184"
    "issn" => "03010546"
    "doi" => "10.1016/j.aller.2009.03.001"
    "estado" => "S300"
    "fechaPublicacion" => "2009-07-01"
    "aid" => "17"
    "copyright" => "SEICAP"
    "documento" => "article"
    "crossmark" => 0
    "subdocumento" => "fla"
    "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2009;37:175-9"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 2242
      "formatos" => array:3 [
        "EPUB" => 6
        "HTML" => 1878
        "PDF" => 358
      ]
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Exercise-induced bronchospasm in obese adolescents"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "175"
          "paginaFinal" => "179"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "W&#46;A&#46; Lopes, R&#46;B&#46; Radominski, N&#46;A&#46; Ros&#225;rio Filho, N&#46; Leite"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "W&#46;A&#46;"
              "apellidos" => "Lopes"
            ]
            1 => array:2 [
              "nombre" => "R&#46;B&#46;"
              "apellidos" => "Radominski"
            ]
            2 => array:2 [
              "nombre" => "N&#46;A&#46;"
              "apellidos" => "Ros&#225;rio Filho"
            ]
            3 => array:2 [
              "nombre" => "N&#46;"
              "apellidos" => "Leite"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000184?idApp=UINPBA00004N"
    "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000184/v1_201304101017/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Down-regulation of endogenous hydrogen sulphide pathway in nasal mucosa of allergic rhinitis in guinea pigs"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "180"
        "paginaFinal" => "187"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Y&#46; Shaoqing, Z&#46; Ruxin, C&#46; Yinjian, C&#46; Jianqiu, Y&#46; Zhiqiang, L&#46; Genhong"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Y&#46;"
            "apellidos" => "Shaoqing"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff1"
              ]
            ]
          ]
          1 => array:4 [
            "nombre" => "Z&#46;"
            "apellidos" => "Ruxin"
            "email" => array:2 [
              0 => "profrxzhang&#64;163&#46;com"
              1 => "rxzhang&#64;x263&#46;com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff2"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">¿</span>"
                "identificador" => "cor1"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "C&#46;"
            "apellidos" => "Yinjian"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff3"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "C&#46;"
            "apellidos" => "Jianqiu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff1"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Y&#46;"
            "apellidos" => "Zhiqiang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff4"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "L&#46;"
            "apellidos" => "Genhong"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff1"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Department of Otolaryngology&#44; Jinan General Hospital of PLA&#44; Shandong&#44; China"
            "etiqueta" => "<span class="elsevierStyleSup">a</span>"
            "identificador" => "aff1"
          ]
          1 => array:3 [
            "entidad" => "Department of Otolaryngology&#44; Huadong Hospital&#44; Fudan University&#44; Shanghai&#44; China"
            "etiqueta" => "<span class="elsevierStyleSup">b</span>"
            "identificador" => "aff2"
          ]
          2 => array:3 [
            "entidad" => "Department of Laboratory Medicine&#44; Jinan General Hospital of PLA&#44; Shandong&#44; China"
            "etiqueta" => "<span class="elsevierStyleSup">c</span>"
            "identificador" => "aff3"
          ]
          3 => array:3 [
            "entidad" => "Department of Otolaryngology&#44; Xuzhou 97th Hospital of PLA&#44; Jiangshu&#44; China"
            "etiqueta" => "<span class="elsevierStyleSup">d</span>"
            "identificador" => "aff4"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor1"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding autor&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig6"
        "etiqueta" => "Figure 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1067
            "Ancho" => 1635
            "Tamanyo" => 97134
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Correlation between concentration of H<span class="elsevierStyleInf">2</span>S in plasma and CSE mRNA expression level in nasal mucosa&#46; Pearson Correlation was used to analyse the relationship between the level of H<span class="elsevierStyleInf">2</span>S and expression of CSE mRNA&#46; There was a highly significant direct relationship between them &#40;r&#61;0&#46;87&#44; P&#61;0&#46;001&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Introduction</span><p class="elsevierStylePara elsevierViewall">Rhinitis&#44; especially allergic rhinitis &#40;AR&#41;&#44; continues to be a major health problem and although some treatments are available&#44; none is ideal&#46; Research on the role of the gas signal messenger such as nitric oxide &#40;NO&#41; and carbon monoxide &#40;CO&#41; in allergy medicine is a rapidly emerging field&#46;<a class="elsevierStyleCrossRefs" href="#bib1"><span class="elsevierStyleSup">1&#44;2</span></a> However&#44; the molecular mechanisms of AR are still poorly understood&#44; and researchers are seeking novel endogenously produced gasotransmitters to investigate their possible roles in the pathogenesis of allergic inflammation&#46; Recently&#44; hydrogen sulphide &#40;H<span class="elsevierStyleInf">2</span>S&#41; was found to be the third endogenous signalling gasotransmitter because of its endogenous metabolism and physiologic functions&#46;<a class="elsevierStyleCrossRef" href="#bib3"><span class="elsevierStyleSup">3</span></a> Now H<span class="elsevierStyleInf">2</span>S is increasingly recognised as a member of a growing family of &#8220;gasotransmitters&#8221;&#44; together with its two counterparts&#44; NO and CO&#46;</p><p class="elsevierStylePara elsevierViewall">H<span class="elsevierStyleInf">2</span>S was only recognised as a kind of toxic gas in contaminated environments with a strong odour of rotten eggs for a long time&#44; and its major effects were intoxication of the central nervous system and inhibition of respiratory system&#46; Endogenous H<span class="elsevierStyleInf">2</span>S may be generated by two pyridoxal-5&#8242;-phosphate-dependent enzymes&#58; cystathionine &#946;-synthase &#40;CBS&#41; and cystathionine &#947;-lyase &#40;CSE&#41; in mammalian tissues&#44; which use L-cysteine as the main substrate&#46; The expressions of these two enzymes are tissue-type specific&#46;<a class="elsevierStyleCrossRefs" href="#bib4"><span class="elsevierStyleSup">4&#44;5</span></a> H<span class="elsevierStyleInf">2</span>S is directly produced in myocardial tissues&#44; arterial and venous tissues by CSE&#44;<a class="elsevierStyleCrossRefs" href="#bib6"><span class="elsevierStyleSup">6&#8211;8</span></a> and in some tissues such as the nervous system&#44; CBS is only needed for the generation of H<span class="elsevierStyleInf">2</span>S&#46;<a class="elsevierStyleCrossRef" href="#bib9"><span class="elsevierStyleSup">9</span></a> Otherwise&#44; the expressions of CBS and CSE are both identified in several mammalian tissues&#44; including liver&#44; kidney&#44; brain&#44; ileum&#44; and blood lymphocytes&#46;<a class="elsevierStyleCrossRefs" href="#bib3"><span class="elsevierStyleSup">3&#44;10</span></a></p><p class="elsevierStylePara elsevierViewall">Recent data suggest that H<span class="elsevierStyleInf">2</span>S may contribute to many inflammatory processes such as asthma&#44;<a class="elsevierStyleCrossRef" href="#bib11"><span class="elsevierStyleSup">11</span></a> acute pancreatitis&#44;<a class="elsevierStyleCrossRef" href="#bib12"><span class="elsevierStyleSup">12</span></a> endotoxaemia&#44;<a class="elsevierStyleCrossRef" href="#bib13"><span class="elsevierStyleSup">13</span></a> and COPD&#46;<a class="elsevierStyleCrossRef" href="#bib14"><span class="elsevierStyleSup">14</span></a> This demonstrated that H<span class="elsevierStyleInf">2</span>S plays a key role in modulating leukocyte adhesion to vascular endothelium&#44; leukocyte infiltration&#44; and oedema formation&#44; which are characters of inflammation&#46;</p><p class="elsevierStylePara elsevierViewall">To clarify the role of endogenous H<span class="elsevierStyleInf">2</span>S in the pathogenesis of AR&#44; we investigated the level of plasma H<span class="elsevierStyleInf">2</span>S in guinea pigs with AR&#46; Clinical symptoms of animals such as sneezing and nose rubbing&#44; and leukocyte infiltration in nasal lavage fluid &#40;NLF&#41; were studied as non-invasive markers of inflammation&#46; The expressions of CBS and CSE of nasal mucosa were also studied by real time RT-PCR&#46; Sodium hydrosulphide &#40;NaHS&#41; and propargylglycine &#40;PPG&#41; were used as donor and inhibitor of H<span class="elsevierStyleInf">2</span>S respectively in our study&#44;<a class="elsevierStyleCrossRef" href="#bib15"><span class="elsevierStyleSup">15</span></a> and PPG is a specific inhibitor of CSE&#44; which can suppress H<span class="elsevierStyleInf">2</span>S production in tissues&#46;<a class="elsevierStyleCrossRef" href="#bib16"><span class="elsevierStyleSup">16</span></a> Through regulated H<span class="elsevierStyleInf">2</span>S level by NaHS and PPG&#44; we investigated the changes of H<span class="elsevierStyleInf">2</span>S on the inflammation process of AR&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Materials and methods</span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Material and animal model</span><p class="elsevierStylePara elsevierViewall">Twenty-four aged healthy male Hartley guinea pigs&#44; weight 230&#8211;280<span class="elsevierStyleHsp" style=""></span>g &#40;National rodent laboratory animal resources&#44; Shanghai branch&#44; China&#41; were taken and divided into four groups&#58; Saline control group&#44; AR sensitised group&#44; NaHS treated group&#44; and PPG treated group&#46; The animal models of allergic rhinitis were prepared according to the methods made by Al Suleimani M et al&#46;<a class="elsevierStyleCrossRef" href="#bib17"><span class="elsevierStyleSup">17</span></a> Guinea pigs &#40;n&#61;18&#41; were initially exposed to 1&#37; ovalbumin &#40;10mg&#47;kg&#44; Sigma Inc&#46;MD &#41; in saline given as a 1&#37; aerosol twice for 10<span class="elsevierStyleHsp" style=""></span>min each&#44; 7 days apart&#46; On days 14&#44; 15 and 16&#44; a booster of 1&#37; ovalbumin in saline was instilled intranasally at a volume of 20<span class="elsevierStyleHsp" style=""></span>&#956;l&#47;nostril&#47;day into both nostrils&#46; On day 21 guinea pigs were challenged with 2&#37; ovalbumin in saline instilled intranasally at a volume of 20<span class="elsevierStyleHsp" style=""></span>&#956;l&#47;nostril in each nostril&#46; Eighteen sensitised guinea pigs were divided into three groups&#44; one was continually treated with OVA as AR group&#46; In the second group&#44; named as NaHS group&#44; animals &#40;n&#61;6&#41; were intraperitoneally administered NaHS &#40;Sigma Inc&#46; MD&#41; at a dose of 14<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;kg&#47;day&#44; 12<span class="elsevierStyleHsp" style=""></span>h after every nose inspiration with ovalbumin and continually for two weeks&#46; In the third group&#44; named as PPG group&#44; animals &#40;n&#61;6&#41; were intraperitoneally administered PPG &#40;Sigma Inc&#46;MD&#41; at a dose of 30<span class="elsevierStyleHsp" style=""></span>mg&#47;kg&#47;day immediately after every nose inspiration with ovalbumin continually for two weeks too&#46; Control animals &#40;n&#61;6&#41; were challenged in a similar manner by using saline&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Observation of sneezing and nose rubbing and assessment of leukocyte infiltration</span><p class="elsevierStylePara elsevierViewall">Frequency of sneezing and nose rubbing were assessed as previously described by Al Suleimani M et al&#46; with modifications&#46;<a class="elsevierStyleCrossRef" href="#bib17"><span class="elsevierStyleSup">17</span></a> They were counted directly following nasal challenge&#44; and for 30<span class="elsevierStyleHsp" style=""></span>min thereafter&#46; A sneeze was characterized by an explosive expiration just after deep inspiration and an external perinasal scratch with the animal&#39;s forelimbs characterized a nose rub&#46; NLF was collected from guinea pigs 1<span class="elsevierStyleHsp" style=""></span>h post-challenge as follows<a class="elsevierStyleCrossRef" href="#bib17"><span class="elsevierStyleSup">17</span></a>&#58; nasal cavities were washed with 2<span class="elsevierStyleHsp" style=""></span>ml of pre-warmed saline infused from the tracheal side&#46; NLF was collected from the anterior naris and total cell count was assessed using a standard haemocytometer&#46; Leukocytes were counted under light microscope at power 40&#215;&#44; and the following formula was used&#58;</p><p class="elsevierStylePara elsevierViewall">Number of cells&#47;ml&#61;total number of cells counted&#215;dilution factor&#215;1000&#47;total volume counted &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>mm<span class="elsevierStyleSup">3</span>&#41;&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Measurement of plasma H<span class="elsevierStyleInf">2</span>S concentration</span><p class="elsevierStylePara elsevierViewall">Guinea pigs were anaesthetised by intraperitoneal administration of pentobarbital &#40;40<span class="elsevierStyleHsp" style=""></span>mg&#47;Kg&#41;&#46; 1<span class="elsevierStyleHsp" style=""></span>ml blood was collected from heart through direct cardiac puncturation&#44; avoiding air contact&#46; A sample of plasma &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>ml&#41; was added to a test tube containing 0&#46;5<span class="elsevierStyleHsp" style=""></span>ml of 1&#37; zinc acetate and 2&#46;5<span class="elsevierStyleHsp" style=""></span>ml of distilled water&#44; then 0&#46;5<span class="elsevierStyleHsp" style=""></span>ml of 20<span class="elsevierStyleHsp" style=""></span>mmol&#47;L N&#44;N-dimethyl-p-phenylenediamine dihydrochloride in 7&#46;2<span class="elsevierStyleHsp" style=""></span>mol&#47;L HCl and 0&#46;4<span class="elsevierStyleHsp" style=""></span>ml of 30<span class="elsevierStyleHsp" style=""></span>mmol&#47;L FeCl<span class="elsevierStyleInf">3</span> in 1&#46;2<span class="elsevierStyleHsp" style=""></span>mol&#47;L HCl were also added to the same test tube for 20<span class="elsevierStyleHsp" style=""></span>min of incubation at room temperature&#46; The protein in the plasma was removed by adding 1<span class="elsevierStyleHsp" style=""></span>ml of 10&#37; trichloroacetic acid to the solution and centrifuging it&#46; The optical absorbance of the resulting solution at 670<span class="elsevierStyleHsp" style=""></span>nm was measured with a spectrometer &#40;Lambda Bio&#44; Perkin Elmer Inc&#44; MD&#41;&#46; H<span class="elsevierStyleInf">2</span>S concentration in the solution was calculated against the calibration curve of the standard NaHS solution&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Total RNA extraction and cDNA synthesis</span><p class="elsevierStylePara elsevierViewall">The guinea pigs were sacrificed by rapid decapitation&#46; Biopsies of nasal mucosa were taken from the inferior turbinate and put in liquid nitrogen immediately&#46; They were then minced with a scalpel on dry ice and transferred immediately to 2<span class="elsevierStyleHsp" style=""></span>ml polypropylene tubes&#44; homogenised and total RNA was extracted using Trizol&#8482; reagent &#40;Invitrogen Inc&#44; MD&#41; following the manufacturer&#39;s instructions&#46; The concentration and purity of RNA were determined spectrophotometrically&#46; Then the synthesis of cDNA was performed according to a cDNA synthesis kit &#40;PrimeScript RTase&#44; TaKaRa Inc&#44; Japan&#41;&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Real time reverse transcriptase-polymerase chain reaction for CBS and CSE mRNA expressions</span><p class="elsevierStylePara elsevierViewall">To determine the expressions of the CBS and CSE gene in nasal mucosa&#44; fluorescent quantitative real time RT-PCR assay was performed&#46; The sequences of the primers &#40;TaKaRa Inc&#44; Japan&#41; specific for CBS and CSE were performed with sense &#40;CBS&#58; CCAGGACTTGGAGGTACAGC&#44; CSE&#58; TCCGGATGGAGAAACACTTC&#41; and antisense &#40;CBS&#58; TCGGCACTGTGTGGTAATGT&#44;CSE&#58;GCTGCCTTTAAAGCTTGACC&#41; primers&#44; with an expected size of the amplified sequence of 155<span class="elsevierStyleHsp" style=""></span>bp for CBS and 400<span class="elsevierStyleHsp" style=""></span>bp for CSE&#46; &#946;-actin was used as control &#40;sense&#58; ACCCTTAAGGCCAACCGTGAAAAG&#44; antisense&#58; TCATGAGGTAGTCTGTC AGGT&#44; 240<span class="elsevierStyleHsp" style=""></span>bp&#41;&#46; Then the incubation of cDNA and primer was performed at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min and the PCR reaction proceeded for 45 cycles&#58; 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#44; 57<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#44; and 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s in a programmable thermal cycler &#40;Line-Gene real-time PCR detection system&#44; bioer Inc&#44; China&#41; using a thermostable Taq DNA polymerase &#40;SYBR PrimeScript Ex Taq&#44; TaKaRa Inc&#44; Japan&#41; final incubation at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 7<span class="elsevierStyleHsp" style=""></span>min&#46; Fluorescent product was measured by a single acquisition mode at 86<span class="elsevierStyleHsp" style=""></span>&#176;C after each cycle&#46; After the completion of PCR amplification&#44; a melting curve analysis was performed&#46; <a class="elsevierStyleCrossRef" href="#fig1">Fig&#46; 1</a> shows a sharp peak with a melting temperature &#40;Tm&#41; of CBS&#40;Tm A&#41; of 86<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; CSE&#40;Tm B&#41; of 84<span class="elsevierStyleHsp" style=""></span>&#176;C and &#946;-actin &#40;Tm C&#41; of 90<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; For each sample&#44; the amount of both target and endogenous control &#40;&#946;-actin&#44; a housekeeping gene&#41; were determined&#46; The typical amplification curves of real-time RT-PCR for CBS&#44; CSE and &#946;-actin mRNA are shown in <a class="elsevierStyleCrossRef" href="#fig2">Fig&#46; 2</a>&#46; The amount of the target molecule was then divided by the amount of the endogenous reference&#44; to obtain a normalised target value&#46; The PCR products were also run on 1&#46;5&#37; agarose gel and visualised by ultraviolet light&#46;</p><elsevierMultimedia ident="fig1"></elsevierMultimedia><elsevierMultimedia ident="fig2"></elsevierMultimedia></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Statistical analysis</span><p class="elsevierStylePara elsevierViewall">All data were expressed as mean&#177;S&#46;D&#46; Statistical analyses of data were performed using ANOVA for multiple comparison and LSD for comparison among groups&#44; and Pearson Correlation for the two-variable correlation analysis&#46; P&#60;0&#46;05 was considered to be statistically significant&#46;</p></span></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Results</span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Concentration of H<span class="elsevierStyleInf">2</span>S in plasma</span><p class="elsevierStylePara elsevierViewall">The blood H<span class="elsevierStyleInf">2</span>S level of the AR group was lower than that of the non-sensitised group &#40;p&#60;0&#46;01&#41;&#46; H<span class="elsevierStyleInf">2</span>S level increased significantly after being treated with H<span class="elsevierStyleInf">2</span>S donor NaHS&#44; and decreased after PPG was administrated&#44; as compared with AR group &#40;p&#60;0&#46;05&#41; &#40;see <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>&#41;&#46; It indicated that down-regulation of H<span class="elsevierStyleInf">2</span>S level existed in AR&#44; and NaHS increased H<span class="elsevierStyleInf">2</span>S level and PPG decreased it successfully&#46;</p><elsevierMultimedia ident="tbl1"></elsevierMultimedia></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Sneezing&#44; nose rubbing and leukocyte infiltration</span><p class="elsevierStylePara elsevierViewall">The results are shown in <a class="elsevierStyleCrossRef" href="#fig3">Fig&#46; 3</a>&#46; Sneezing frequency and number of nose rubbings in sensitised AR group were significantly increased &#40;p&#60;0&#46;01&#41; as compared with a non-sensitised group&#44; and increased further in PPG treated group as compared with AR group &#40;p&#60;0&#46;05&#41;&#44; but significantly decreased in NaSH treated group &#40;p&#60;0&#46;05&#41;&#46; In AR group&#44; there was a significant increase of total cell count in NLF &#40;p&#60;0&#46;01&#41;&#44; especially eosinophils and neutrophils as compared with non-sensitised groups&#46; Total cell count significantly increased after PPG treated&#44; and decreased after NaHS treated &#40;p&#60;0&#46;05&#41;&#44; as compared with AR group&#46; It indicated that NaHS increased the H<span class="elsevierStyleInf">2</span>S level but reduced the inflammatory response of allergy e&#46;g&#46; inhibited leukocyte infiltration in nasal mucosa&#44; but PPG had the opposite effect on allergy&#46;</p><elsevierMultimedia ident="fig3"></elsevierMultimedia></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Expressions of CBS and CSE by real-time RT-PCR</span><p class="elsevierStylePara elsevierViewall">The cumulative data for mRNA expressions of CBS and CSE are presented in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a> and <a class="elsevierStyleCrossRef" href="#fig4">Fig&#46; 4</a>&#46; CSE mRNA expression was down-regulated significantly in AR group as compared with control &#40;p&#60;0&#46;05&#41; and the expression was increased significantly after being stimulated by NaHS &#40;p&#60;0&#46;05&#41;&#44; and decreased significantly with PPG administration as compared with AR group &#40;p&#60;0&#46;05&#41;&#46; The expression of CBS in nasal mucosa was very weak and no significant changes of CBS mRNA levels were observed between groups &#40;p&#62;0&#46;05&#41;&#46; To verify the amplification curve results&#44; representative samples of the PCR products were run on 1&#46;5&#37; agarose gels&#46; Electrophoresis results showed that the order of CSE mRNA expression levels from high to low was control&#44; NaHS&#44; AR and PPG group &#40;<a class="elsevierStyleCrossRef" href="#fig5">Fig&#46; 5</a>&#41;&#46; Moreover&#44; correlation between the level of CSE mRNA and concentration of H<span class="elsevierStyleInf">2</span>S was also analysed&#46; There was a high significant direct relationship between them &#40;r&#61;0&#46;87&#44; P&#61;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig6">Fig&#46; 6</a>&#41;&#46; It suggested that the level of H<span class="elsevierStyleInf">2</span>S was positively correlated with CSE of nasal mucosa through a concentration-dependent manner and that the NaHS and PPG regulated the level and might have a relationship with the expression of CSE of nasal mucosa in AR&#46; The CBS of nasal mucosa perhaps had little effect on level of H<span class="elsevierStyleInf">2</span>S in AR&#46;</p><elsevierMultimedia ident="fig4"></elsevierMultimedia><elsevierMultimedia ident="fig5"></elsevierMultimedia><elsevierMultimedia ident="fig6"></elsevierMultimedia></span></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Discussion</span><p class="elsevierStylePara elsevierViewall">After nasal provocation with ovalbumin&#44; the AR was evaluated from the occurrence of typical clinical symptoms with respect to nose and eyes irritation&#44; like sneezing&#44; conjunctival and nasal secretion&#46; In comparison to saline&#44; ovalbumin sensitisation increased sneezing frequency and numbers of nasal rubs&#46; Nasal cellular infiltration &#40;extravasation of leukocytes&#41; is a characteristic hallmark of AR&#46; Following nasal allergen challenge in sensitised guinea pigs&#44; there was a significant increase in total cell count &#40;p&#60;0&#46;01&#41; as compared with non-sensitised groups&#46; Furthermore&#44; both eosinophils and neutrophils were significantly induced&#46; Sneezing frequency&#44; number of nasal rubs&#44; and total cell counts in nasal washings can be used as indices of allergic response&#46;</p><p class="elsevierStylePara elsevierViewall">This study was the first to show down-regulation of endogenous H<span class="elsevierStyleInf">2</span>S in sensitised AR guinea pigs&#46; Previous studies had shown that gaseous transmitters&#44; NO and CO&#44; played important roles in the pathogenesis of AR&#46;<a class="elsevierStyleCrossRefs" href="#bib18"><span class="elsevierStyleSup">18&#44;19</span></a> H<span class="elsevierStyleInf">2</span>S is a colourless and flammable gas with a small molecular weight&#44; and now is increasingly recognised as a member of a growing family of &#8220;gasotransmitters&#8221;&#44; together with its two counterparts&#44; NO and CO&#46; It was only recently that researchers came to understand H<span class="elsevierStyleInf">2</span>S as a novel gasotransmitter playing an important biological role&#44; especially in airway inflammation such as in asthma&#44; COPD&#44; or lung injury&#46;<a class="elsevierStyleCrossRefs" href="#bib12"><span class="elsevierStyleSup">12&#44;14</span></a></p><p class="elsevierStylePara elsevierViewall">H<span class="elsevierStyleInf">2</span>S is produced mainly by two pyridoxal-5&#8217;phosphate-dependent enzymes responsible for the metabolism of L-cysteine&#44; CBS and CSE&#46; It should be noted that H<span class="elsevierStyleInf">2</span>S generation is closely associated with the catabolism of cysteine and methionine as well as with glutathione metabolism&#46; Both CBS and CSE are responsible for the metabolism of methionine into cysteine&#44; which is in turn used for the generation of H<span class="elsevierStyleInf">2</span>S&#44;<a class="elsevierStyleCrossRef" href="#bib20"><span class="elsevierStyleSup">20</span></a> but the two enzymes differ in the specific mechanism of H<span class="elsevierStyleInf">2</span>S formation&#46; CSE catalyses the conversion of cystine &#40;a cysteine disulphide&#41; to thiocysteine&#44; pyruvate and ammonia&#44; thiocysteine then non-enzymatically decomposes to cysteine and H<span class="elsevierStyleInf">2</span>S&#46; The major mechanism of H<span class="elsevierStyleInf">2</span>S produced by CBS probably involves the condensation of homocysteine with cysteine to yield cystathionine&#44; and H<span class="elsevierStyleInf">2</span>S is released during this reaction&#46;<a class="elsevierStyleCrossRefs" href="#bib21"><span class="elsevierStyleSup">21&#44;22</span></a> The expressions of CBS and CSE had been identified in many human and other mammalian cells&#44; including those from liver&#44; kidney&#44; brain&#44; skin fibroblasts&#44; and blood lymphocytes&#46; In some tissues CBS and CSE are both needed for generation of H<span class="elsevierStyleInf">2</span>S&#44; whereas in others only one enzyme is needed&#46;<a class="elsevierStyleCrossRefs" href="#bib4"><span class="elsevierStyleSup">4&#8211;8</span></a> Thus&#44; it has come to be known that the expression of CBS and&#47;or CSE is tissue specific&#46; In nasal mucosa&#44; more expression of CSE was found but not of CBS&#44; and the mRNA expression of CSE was positively correlated with the concentration of H<span class="elsevierStyleInf">2</span>S by concentration-dependent manner&#44; so the CSE was maybe the major H<span class="elsevierStyleInf">2</span>S-producing enzyme in nasal mucosa and it was positively correlated with the level of H<span class="elsevierStyleInf">2</span>S in AR&#44; because CSE mainly exists in vascular smooth muscle cells &#40;SMC&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib23"><span class="elsevierStyleSup">23</span></a> and expressed in nasal mucosa might be attributed to the rich distribution of vascular SMC&#46;</p><p class="elsevierStylePara elsevierViewall">In order to investigate the influence of H<span class="elsevierStyleInf">2</span>S level on symptoms of AR&#44; NaHS was used as H<span class="elsevierStyleInf">2</span>S donor&#46; NaHS can be dissociated to Na<span class="elsevierStyleSup">&#43;</span> and HS<span class="elsevierStyleSup">&#8722;</span> in solution&#44; and then HS<span class="elsevierStyleSup">&#8722;</span> associates with H<span class="elsevierStyleSup">&#43;</span> and produces H<span class="elsevierStyleInf">2</span>S&#46;<a class="elsevierStyleCrossRef" href="#bib24"><span class="elsevierStyleSup">24</span></a> In the experiment after NaHS treatment&#44; H<span class="elsevierStyleInf">2</span>S level was successfully up-regulated in plasma as compared with the AR group &#40;p&#60;0&#46;05&#41;&#44; and it alleviated the symptoms of AR&#46; PPG was used as an inhibitor of H<span class="elsevierStyleInf">2</span>S&#46; Our observations had shown that PPG significantly attenuated the expression of CSE&#44; and in the PGG group the level of H<span class="elsevierStyleInf">2</span>S was decreased significantly as compared with the AR group&#46; PPG can suppress the production of H<span class="elsevierStyleInf">2</span>S by inhibited CSE&#44; and symptoms of AR were aggravated after PPG treatment&#44; accompanied by enhanced leukocyte adhesion&#44; leukocyte infiltration&#44; perhaps with oedema formation&#46; All these suggested that the level of H<span class="elsevierStyleInf">2</span>S has a negative effect on symptoms of AR&#46;</p><p class="elsevierStylePara elsevierViewall">In mammalian tissues H<span class="elsevierStyleInf">2</span>S may be a physiological regulator with its vascular effect possibly mediated by the opening of the KATP channel of vascular tissue&#44;<a class="elsevierStyleCrossRef" href="#bib25"><span class="elsevierStyleSup">25</span></a> and H<span class="elsevierStyleInf">2</span>S could also inhibit vascular SMC proliferation&#44;<a class="elsevierStyleCrossRef" href="#bib26"><span class="elsevierStyleSup">26</span></a> and CSE mRNA was expressed mainly by the SMC of the vascular cells but not by the endothelial cells&#46;<a class="elsevierStyleCrossRef" href="#bib27"><span class="elsevierStyleSup">27</span></a> A potentially critical role for CSE-derived H<span class="elsevierStyleInf">2</span>S in allergic response is its ability to regulate airway smooth muscle associated with the tone of vascular&#46; H<span class="elsevierStyleInf">2</span>S can also suppress leukocyte adherence to the vascular endothelium and reduce leukocyte infiltration and oedema formation&#46;<a class="elsevierStyleCrossRef" href="#bib28"><span class="elsevierStyleSup">28</span></a> We speculated that the down-regulation of the H<span class="elsevierStyleInf">2</span>S&#47;CSE pathway in the nasal mucosa of AR was associated with the change of blood flow&#46; The release of H<span class="elsevierStyleInf">2</span>S was decreased as CSE was suppressed by PPG leading to increased vasodilatation&#44; and increased permeability of the nasal mucosa epithelium and vascular endothelium&#44; and rapidly generated mediators of inflammation &#40;leukotrienes&#44; chemokines&#41;&#44; associated with the allergic response&#44; including rhinorrhoea&#44; mucosal oedema&#44; neutrophil and eosinophil chemotactic effects&#46; The level of H<span class="elsevierStyleInf">2</span>S increased by NaHS had the opposite results with vasoconstrictor effects and was accompanied by the inhibition of inflammatory mediator release&#46;</p><p class="elsevierStylePara elsevierViewall">As mentioned above&#44; H<span class="elsevierStyleInf">2</span>S is also an important modulator of vascular tone like NO and CO&#44; and plays an anti-oxidant role in inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib29"><span class="elsevierStyleSup">29</span></a> It should be noted that NO and CO may have direct vasorelaxation through endothelial cells&#46;<a class="elsevierStyleCrossRef" href="#bib30"><span class="elsevierStyleSup">30</span></a> Immunohistochemistry researches show that NOS and HO&#44; which are major rate-limited enzymes of NO and CO respectively&#44; are mainly located in cytoplasm of endothelial cells&#46;<a class="elsevierStyleCrossRef" href="#bib31"><span class="elsevierStyleSup">31</span></a> But the expression of H<span class="elsevierStyleInf">2</span>S-generating enzyme was identified in vascular SMC&#44; not in endothelium<a class="elsevierStyleCrossRef" href="#bib27"><span class="elsevierStyleSup">27</span></a> and it was shown that the vasorelaxant effect of H<span class="elsevierStyleInf">2</span>S might mainly mediate by an interaction of the gas with smooth muscles&#46;<a class="elsevierStyleCrossRef" href="#bib24"><span class="elsevierStyleSup">24</span></a> Thus&#44; H<span class="elsevierStyleInf">2</span>S seems to have a unique action mechanism among vasodilator gases in nasal mucosa&#46; The gas signals among NO&#44; CO and H<span class="elsevierStyleInf">2</span>S may be a self-balancing regulation of endothelial cells and muscle cells in nasal mucosa of allergic inflammation&#46; Vasorelaxation of H<span class="elsevierStyleInf">2</span>S may be influenced by NO or CO&#44; a recent study also suggests that low doses of H<span class="elsevierStyleInf">2</span>S may induce vasoconstriction by scavenging endothelial NO&#46;<a class="elsevierStyleCrossRefs" href="#bib32"><span class="elsevierStyleSup">32&#44;33</span></a> Perhaps the roles of H<span class="elsevierStyleInf">2</span>S are regulated by NO or CO in the pathogenesis of AR&#44; although further research is needed&#46;</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Conclusions</span><p class="elsevierStylePara elsevierViewall">Our findings have shown that down-regulation of endogenous H<span class="elsevierStyleInf">2</span>S pathway in AR&#44; and the level of H<span class="elsevierStyleInf">2</span>S was positively correlated with the expression of CSE in nasal mucosa&#46; It indicated that endogenous H<span class="elsevierStyleInf">2</span>S had latent roles in the pathogenesis of AR&#46; Furthermore&#44; the roles of H<span class="elsevierStyleInf">2</span>S in pathogenesis of AR appear so complex&#44; and more new lines of research are needed&#44; and might have potential benefit for the investigation of AR&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:2 [
          "identificador" => "xres85636"
          "titulo" => array:5 [
            0 => "Abstract"
            1 => "Background"
            2 => "Methods"
            3 => "Results"
            4 => "Conclusion"
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec73915"
          "titulo" => "Keywords"
        ]
        2 => array:1 [
          "titulo" => "Introduction"
        ]
        3 => array:2 [
          "titulo" => "Materials and methods"
          "secciones" => array:6 [
            0 => array:1 [
              "titulo" => "Material and animal model"
            ]
            1 => array:1 [
              "titulo" => "Observation of sneezing and nose rubbing and assessment of leukocyte infiltration"
            ]
            2 => array:1 [
              "titulo" => "Measurement of plasma HS concentration"
            ]
            3 => array:1 [
              "titulo" => "Total RNA extraction and cDNA synthesis"
            ]
            4 => array:1 [
              "titulo" => "Real time reverse transcriptase-polymerase chain reaction for CBS and CSE mRNA expressions"
            ]
            5 => array:1 [
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:1 [
              "titulo" => "Concentration of HS in plasma"
            ]
            1 => array:1 [
              "titulo" => "Sneezing&#44; nose rubbing and leukocyte infiltration"
            ]
            2 => array:1 [
              "titulo" => "Expressions of CBS and CSE by real-time RT-PCR"
            ]
          ]
        ]
        5 => array:1 [
          "titulo" => "Discussion"
        ]
        6 => array:1 [
          "titulo" => "Conclusions"
        ]
        7 => array:2 [
          "identificador" => "xack31655"
          "titulo" => "Acknowledgments"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2008-12-13"
    "fechaAceptado" => "2009-03-02"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec73915"
          "palabras" => array:7 [
            0 => "Hydrogen sulphide"
            1 => "Allergic rhinitis"
            2 => "Cystathionine &#946;-synthase"
            3 => "Cystathionine &#947;-lyase"
            4 => "Guinea pig"
            5 => "Real time RT-PCR"
            6 => "Nasal mucosa"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span class="elsevierStyleSectionTitle">Background</span><p class="elsevierStyleSimplePara elsevierViewall">The present study was designed to explore the possible changes in endogenous hydrogen sulphide &#40;H<span class="elsevierStyleInf">2</span>S&#41;&#44; a novel gasotransmitter&#44; on the pathogenesis of allergic rhinitis &#40;AR&#41;&#46;</p> <span class="elsevierStyleSectionTitle">Methods</span><p class="elsevierStyleSimplePara elsevierViewall">AR guinea pig model was established by nasal ovalbumin sensitisation&#46; Guinea pigs were divided into four groups&#58; Saline control&#44; AR sensitised&#44; sodium hydrosulphide &#40;NaHS&#41; treated&#44; and propargylglycine &#40;PPG&#41; treated group&#46; The frequency of sneezing and nose rubbing was recorded&#46; Leukocyte infiltration in nasal lavage fluid &#40;NLF&#41; and plasma H<span class="elsevierStyleInf">2</span>S level were measured&#46; Expression of Cystathionine-&#946;-synthase &#40;CBS&#41; and Cystathionine-&#947;-lyase &#40;CSE&#41; mRNA as H<span class="elsevierStyleInf">2</span>S-producing enzymes in nasal mucosa was determined by real time Reverse Transcriptase-Polymerase Chain Reaction &#40;RT-PCR&#41;&#46;</p> <span class="elsevierStyleSectionTitle">Results</span><p class="elsevierStyleSimplePara elsevierViewall">The frequency of sneezing and nose rubbing&#44; and levels of leukocyte infiltration in NLF were higher than those of control &#40;P&#60;0&#46;01&#41;&#44; but plasma H<span class="elsevierStyleInf">2</span>S in sensitised guinea pigs was lower than those of control &#40;P&#60;0&#46;05&#41;&#46; From the results of RT-PCR&#44; it was found that the expression of CSE was higher than CBS in nasal mucosa&#44; and in sensitised guinea pigs it was lower than that of control &#40;P&#60;0&#46;05&#41;&#46; NaHS successfully increased the level of H<span class="elsevierStyleInf">2</span>S and alleviated the symptoms of AR accompanied by up-regulation of CSE as compared with AR group &#40;P&#60;0&#46;05&#41;&#46; PPG significantly suppressed the expression of CSE and decreased the H<span class="elsevierStyleInf">2</span>S level&#44; yet also aggravated the symptoms of AR&#46;</p> <span class="elsevierStyleSectionTitle">Conclusion</span><p class="elsevierStyleSimplePara elsevierViewall">H<span class="elsevierStyleInf">2</span>S level may be negatively correlated with the process of inflammation and positively correlated with expression of CSE in nasal mucosa&#46; The endogenous H<span class="elsevierStyleInf">2</span>S pathway is down-regulated in AR&#46;</p>"
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig1"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 3158
            "Ancho" => 2500
            "Tamanyo" => 204540
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">The typical amplification and melting curves of real-time RT-PCR for CSE&#40;A&#41;&#44; CBS&#40;B&#41; and &#946;-actin&#40;C&#41;&#46;The figure shows a sharp peak with a melting temperature of CSE&#40;Tm A&#41; of 84<span class="elsevierStyleHsp" style=""></span>&#176;C&#44;CBS&#40;Tm B&#41; of 86<span class="elsevierStyleHsp" style=""></span>&#176;C and &#946;-actin &#40;Tm C&#41; of 90<span class="elsevierStyleHsp" style=""></span>&#176;C&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig2"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3393
            "Ancho" => 2500
            "Tamanyo" => 242438
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Cycles of CSE&#40;A&#41;&#44; CBS&#40;B&#41; and &#946;-actin&#40;C&#41;&#46;For the four curves&#58; control group&#40;a&#41;&#44; NaHS group&#40;b&#41;&#44; AR group&#40;c&#41; and PPG group&#40;d&#41;&#46;The vertical axis represents the degree of amplification by SYBR-Green fluorescence and the horizontal axis represents the number of amplification cycles&#46; With the same cycle number&#44; the groups have similar amplification of &#946;-actin and CBS but different amplification of CSE&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig3"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1060
            "Ancho" => 1625
            "Tamanyo" => 102279
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">The Sneezing and nose rubbing of guinea pigs&#46; Each column and vertical bar represents the mean&#177;S&#46;D&#46; &#42;&#44;&#42;&#42;&#58; Significantly different from the control group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46; <span class="elsevierStyleSup">&#9839;</span>&#44;<span class="elsevierStyleSup">&#9839;&#9839;</span> Significantly different from the AR group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig4"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1319
            "Ancho" => 1627
            "Tamanyo" => 92479
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Expressions of CSE and CBS mRNA&#46; Each column and vertical bar represents the mean&#177;S&#46;D&#46; &#42;&#44;&#42;&#42;&#58; Significantly different from the control group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46; <span class="elsevierStyleSup">&#9839;</span>&#44;<span class="elsevierStyleSup">&#9839;&#9839;</span> Significantly different from the AR group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig5"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 717
            "Ancho" => 2916
            "Tamanyo" => 88833
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Image of gel of RT-PCR for CSE&#40;A&#41;&#44;CBS&#40;B&#41; and &#946;-actin&#40;C&#41; mRNA from nasal mucosa of guinea pigs&#46; Sizes of PCR products were 400<span class="elsevierStyleHsp" style=""></span>bp&#40;CSE&#41;&#44;155<span class="elsevierStyleHsp" style=""></span>bp&#40;CBS&#41; and 240<span class="elsevierStyleHsp" style=""></span>bp&#40;&#946;-actin&#41;&#46;Lanes 1&#8211;5 &#40;from left to right&#41; were products of AR&#44; control&#44; PPG&#44; NaHS groups and DNA marker &#40;100&#8764;600<span class="elsevierStyleHsp" style=""></span>bp&#41;&#46;There was a decrease in CSE cDNA in AR group compare with control&#44; and it increased after NaSH treated and decreases after PPG treated&#44; whereas there was no change in &#946;-actin mRNA&#46; The expressions of CBS mRNA were so weak that no significant difference between groups was found&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "fig6"
        "etiqueta" => "Figure 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1067
            "Ancho" => 1635
            "Tamanyo" => 97134
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Correlation between concentration of H<span class="elsevierStyleInf">2</span>S in plasma and CSE mRNA expression level in nasal mucosa&#46; Pearson Correlation was used to analyse the relationship between the level of H<span class="elsevierStyleInf">2</span>S and expression of CSE mRNA&#46; There was a highly significant direct relationship between them &#40;r&#61;0&#46;87&#44; P&#61;0&#46;001&#41;&#46;</p>"
        ]
      ]
      6 => array:6 [
        "identificador" => "tbl1"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p class="elsevierStyleSimplePara elsevierViewall">The concentration of H<span class="elsevierStyleInf">2</span>S of Plasma&#44; eotaxin of nasal lavage fluid&#44; expression of mRNA of CSE and CBS of nasal mucosa&#46; All data represent as mean&#177;S&#46;D&#46;&#42;&#44;&#42;&#42;&#58; Significantly different from the control group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46; <span class="elsevierStyleSup">&#9839;&#44;&#9839;&#9839;</span> Significantly different from the AR group &#40;p&#60;0&#46;05 and p&#60;0&#46;01&#44; respectively&#41;&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Normal group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">AR group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">NaHS group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">PGG group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H<span class="elsevierStyleInf">2</span>S &#40;umol&#47;L&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&#46;9&#177;1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#46;9&#177;0&#46;9&#42;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#46;8&#177;1&#46;1<span class="elsevierStyleSup">&#9839;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;8&#177;1&#46;6&#42;&#42;<span class="elsevierStyleSup">&#9839;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CSE &#40;&#215;10<span class="elsevierStyleSup">&#8722;2</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;2&#177;1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;4&#177;0&#46;8&#42;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;0&#177;0&#46;2&#42;<span class="elsevierStyleSup">&#9839;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;57&#177;0&#46;16&#42;&#42;<span class="elsevierStyleSup">&#9839;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CBS &#40;&#215;10<span class="elsevierStyleSup">&#8722;4</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;4&#177;1&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&#46;1&#177;1&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;5&#177;2&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;8&#177;1&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab164390.png"
              ]
            ]
          ]
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:1 [
          "bibliografiaReferencia" => array:33 [
            0 => array:3 [
              "identificador" => "bib1"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nitric oxide in allergic rhinitis and asthma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Frieri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Allergy Asthma Proc"
                        "fecha" => "1998"
                        "volumen" => "19"
                        "paginaInicial" => "349"
                        "paginaFinal" => "351"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9876773"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib2"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Localisation of heme oxygenase isoforms in allergic human nasal mucosa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Lo"
                            1 => "S&#46; Di Palma"
                            2 => "L&#46; Pitkin"
                            3 => "A&#46;W&#46; McCombe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00405-004-0873-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Arch Otorhinolaryngol"
                        "fecha" => "2005"
                        "volumen" => "262"
                        "paginaInicial" => "595"
                        "paginaFinal" => "598"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15592935"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib3"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide &#40;H2S&#41;-the third gas of interest for pharmacologists"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "E&#46; Lowicka"
                            1 => "J&#46; Beltowski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pharmacol Rep"
                        "fecha" => "2007"
                        "volumen" => "59"
                        "paginaInicial" => "4"
                        "paginaFinal" => "24"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17377202"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib4"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reaction mechanism and regulation of cystathionine beta-synthase"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "R&#46; Banerjee"
                            1 => "R&#46; Evande"
                            2 => "O&#46; Kabil"
                            3 => "S&#46; Ojha"
                            4 => "S&#46; Taoka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochim Biophys Acta"
                        "fecha" => "2003"
                        "volumen" => "1647"
                        "paginaInicial" => "30"
                        "paginaFinal" => "35"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12686104"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib5"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Murine cystathionine gamma-lyase&#58; complete cDNA and genomic sequences&#44; promoter activity&#44; tissue distribution and developmental expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Ishii"
                            1 => "N&#46; Akahoshi"
                            2 => "X&#46;N&#46; Yu"
                            3 => "Y&#46; Kobayashi"
                            4 => "K&#46; Namekata"
                            5 => "G&#46; Komaki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BJ20040243"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "2004"
                        "volumen" => "381"
                        "paginaInicial" => "113"
                        "paginaFinal" => "123"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15038791"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib6"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "H2S generated by heart in rat and its effects on cardiac function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Geng"
                            1 => "J&#46;H&#46; Yang"
                            2 => "Y&#46;F&#46; Qi"
                            3 => "J&#46; Zhao"
                            4 => "Y&#46;Z&#46; Pang"
                            5 => "J&#46;B&#46; Du"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2004"
                        "volumen" => "313"
                        "paginaInicial" => "362"
                        "paginaFinal" => "368"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14684169"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib7"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The vasorelaxant effect of H2S as a novel endogenous gaseous KATP channel opener"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "W&#46;M&#46; Zhao"
                            1 => "J&#46; Zhang"
                            2 => "Y&#46;J&#46; Lu"
                            3 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/emboj/20.21.6008"
                      "Revista" => array:6 [
                        "tituloSerie" => "EMBO J"
                        "fecha" => "2001"
                        "volumen" => "20"
                        "paginaInicial" => "6008"
                        "paginaFinal" => "6016"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11689441"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib8"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The possible role of hydrogen sulfide as an endogenous smooth muscle relaxant in synergy with nitric oxide"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46; Hosoki"
                            1 => "N&#46; Matsuki"
                            2 => "H&#46; Kimura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "1997"
                        "volumen" => "273"
                        "paginaInicial" => "527"
                        "paginaFinal" => "531"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib9"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide&#58; neurochemistry and neurobiology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "K&#46; Qu"
                            1 => "S&#46;W&#46; Lee"
                            2 => "J&#46;S&#46; Bian"
                            3 => "C&#46;M&#46; Low"
                            4 => "P&#46;T&#46; Wong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.neuint.2007.05.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "Neurochem Int"
                        "fecha" => "2008"
                        "volumen" => "52"
                        "paginaInicial" => "155"
                        "paginaFinal" => "165"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17629356"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib10"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Estimation of hydrogen sulphide in the human lymphocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Barathi"
                            1 => "P&#46; Vadhana"
                            2 => "N&#46; Angayarkanni"
                            3 => "S&#46; Ramakrishnan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Indian J Biochem Biophys"
                        "fecha" => "2007"
                        "volumen" => "44"
                        "paginaInicial" => "179"
                        "paginaFinal" => "182"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17650588"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib11"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The regulatory effect of endogenous hydrogen sulfide on acute asthma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "R&#46; Wu"
                            1 => "W&#46;Z&#46; Yao"
                            2 => "Y&#46;H&#46; Chen"
                            3 => "B&#46; Geng"
                            4 => "M&#46; Lu"
                            5 => "C&#46;S&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Zhonghua Jie He He Hu Xi Za Zhi"
                        "fecha" => "2007"
                        "volumen" => "30"
                        "paginaInicial" => "522"
                        "paginaFinal" => "526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17961407"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib12"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of hydrogen sulfide in acute pancreatitis and associated lung injury"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Bhatia"
                            1 => "F&#46;L&#46; Wong"
                            2 => "D&#46; Fu"
                            3 => "H&#46;Y&#46; Lau"
                            4 => "S&#46;M&#46; Moochhala"
                            5 => "P&#46;K&#46; Moore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.04-3023fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2005"
                        "volumen" => "19"
                        "paginaInicial" => "623"
                        "paginaFinal" => "625"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15671155"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib13"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide is a novel mediator of lipopolysaccharide-induced inflammation in the mouse"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Li"
                            1 => "M&#46; Bhatia"
                            2 => "Y&#46;Z&#46; Zhu"
                            3 => "Y&#46;C&#46; Zhu"
                            4 => "R&#46;D&#46; Ramnath"
                            5 => "Z&#46;J&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.04-3583fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2005"
                        "volumen" => "19"
                        "paginaInicial" => "1196"
                        "paginaFinal" => "1198"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15863703"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib14"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Endogenous hydrogen sulfide in patients with COPD"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;H&#46; Chen"
                            1 => "W&#46;Z&#46; Yao"
                            2 => "B&#46; Geng"
                            3 => "Y&#46;L&#46; Ding"
                            4 => "M&#46; Lu"
                            5 => "M&#46;W&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.128.5.3205"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2005"
                        "volumen" => "128"
                        "paginaInicial" => "3205"
                        "paginaFinal" => "3211"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16304263"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib15"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide induces calcium waves in astrocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Nagai"
                            1 => "M&#46; Tsugane"
                            2 => "J&#46; Oka"
                            3 => "H&#46; Kimura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.03-1052fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2004"
                        "volumen" => "18"
                        "paginaInicial" => "557"
                        "paginaFinal" => "559"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14734631"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib16"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Modulation of endogenous production of H2S in rat tissues"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "W&#46; Zhao"
                            1 => "J&#46;F&#46; Ndisang"
                            2 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1139/y03-077"
                      "Revista" => array:6 [
                        "tituloSerie" => "Can J Physiol Pharmacol"
                        "fecha" => "2003"
                        "volumen" => "81"
                        "paginaInicial" => "848"
                        "paginaFinal" => "853"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14614520"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib17"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A comprehensive model of allergic rhinitis in guinea pigs"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Al Suleimani"
                            1 => "D&#46; Ying"
                            2 => "M&#46;J&#46; Walker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vascn.2006.05.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Pharmacol Toxicol Methods"
                        "fecha" => "2007"
                        "volumen" => "55"
                        "paginaInicial" => "127"
                        "paginaFinal" => "134"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16829141"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib18"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nasal nitric oxide and nasal allergy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "V&#46;M&#46; Struben"
                            1 => "M&#46;H&#46; Wieringa"
                            2 => "L&#46; Feenstra"
                            3 => "J&#46;C&#46; de Jongste"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1398-9995.2006.01096.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Allergy"
                        "fecha" => "2006"
                        "volumen" => "61"
                        "paginaInicial" => "665"
                        "paginaFinal" => "670"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16677234"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib19"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Heme oxygenase &#40;HO&#41;-1 is upregulated in the nasal mucosa with allergic rhinitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46; Elhini"
                            1 => "S&#46; Abdelwahab"
                            2 => "K&#46; Ikeda"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/01.mlg.0000194692.51979.d1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Laryngoscope"
                        "fecha" => "2006"
                        "volumen" => "116"
                        "paginaInicial" => "446"
                        "paginaFinal" => "450"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16540907"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib20"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Endogenous production of hydrogen sulfide in mammals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "P&#46; Kamoun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00726-004-0072-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Amino Acids"
                        "fecha" => "2004"
                        "volumen" => "26"
                        "paginaInicial" => "243"
                        "paginaFinal" => "254"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15221504"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib21"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The gasotransmitter role of hydrogen sulfide"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/152308603768295249"
                      "Revista" => array:6 [
                        "tituloSerie" => "Antioxid Redox Signal"
                        "fecha" => "2003"
                        "volumen" => "5"
                        "paginaInicial" => "493"
                        "paginaFinal" => "501"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/13678538"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib22"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An overview of the biological significance of endogenous gases&#58; new roles for old molecules"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46; Li"
                            1 => "P&#46;K&#46; Moore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BST0351138"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Soc Trans"
                        "fecha" => "2007"
                        "volumen" => "35"
                        "paginaInicial" => "1138"
                        "paginaFinal" => "1141"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17956296"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib23"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pro-apoptotic effect of endogenous H2S on human aorta smooth muscle cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "G&#46; Yang"
                            1 => "L&#46; Wu"
                            2 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.05-4712fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2006"
                        "volumen" => "20"
                        "paginaInicial" => "553"
                        "paginaFinal" => "555"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16507767"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib24"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "H&#40;2&#41;S-induced vasorelaxation and underlying cellular and molecular mechanisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "W&#46; Zhao"
                            1 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpheart.00013.2002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Heart Circ Physiol"
                        "fecha" => "2002"
                        "volumen" => "283"
                        "paginaInicial" => "H474"
                        "paginaFinal" => "H480"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12124191"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib25"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The possible role of hydrogen sulfide as a smooth muscle cell proliferation inhibitor in rat cultured cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;B&#46; Du"
                            1 => "H&#46; Yan"
                            2 => "Ch&#46;Y&#46; Zhang"
                            3 => "B&#46; Geng"
                            4 => "H&#46; Jiang"
                            5 => "X&#46;B&#46; Ch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00380-003-0743-7"
                      "Revista" => array:6 [
                        "tituloSerie" => "Heart Vessels"
                        "fecha" => "2004"
                        "volumen" => "19"
                        "paginaInicial" => "75"
                        "paginaFinal" => "80"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15042391"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib26"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The possible role of hydrogen sulfide as a smooth muscle cell proliferation inhibitor in rat cultured cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Du"
                            1 => "Y&#46; Hui"
                            2 => "Y&#46; Cheung"
                            3 => "G&#46; Bin"
                            4 => "H&#46; Jiang"
                            5 => "X&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00380-003-0743-7"
                      "Revista" => array:6 [
                        "tituloSerie" => "Heart Vessels"
                        "fecha" => "2004"
                        "volumen" => "19"
                        "paginaInicial" => "75"
                        "paginaFinal" => "80"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15042391"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib27"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The smooth muscle relaxant effect of hydrogen sulphide in vitro&#58; evidence for a physiological role to control intestinal contractility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46; Teague"
                            1 => "S&#46; Asiedu"
                            2 => "P&#46;K&#46; Moore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bjp.0704858"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Pharmacol"
                        "fecha" => "2002"
                        "volumen" => "137"
                        "paginaInicial" => "139"
                        "paginaFinal" => "145"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12208769"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib28"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide is an endogenous modulator of leukocyte-mediated inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "R&#46;C&#46; Zanardo"
                            1 => "V&#46; Brancaleone"
                            2 => "E&#46; Distrutti"
                            3 => "S&#46; Fiorucci"
                            4 => "G&#46; Cirino"
                            5 => "J&#46;L&#46; Wallace"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.06-6270fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2006"
                        "volumen" => "20"
                        "paginaInicial" => "2118"
                        "paginaFinal" => "2120"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16912151"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib29"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hydrogen sulfide as a vasodilator"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Bhatia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/15216540500217875"
                      "Revista" => array:6 [
                        "tituloSerie" => "IUBMB Life"
                        "fecha" => "2005"
                        "volumen" => "57"
                        "paginaInicial" => "603"
                        "paginaFinal" => "606"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16203678"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib30"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Different mechanisms underlying the stimulation of K&#40;Ca&#41; channels by nitric oxide and carbon monoxide"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46; Wu"
                            1 => "K&#46; Cao"
                            2 => "Y&#46; Lu"
                            3 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI15316"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Invest"
                        "fecha" => "2002"
                        "volumen" => "110"
                        "paginaInicial" => "691"
                        "paginaFinal" => "700"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12208870"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib31"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evidence for a possible inhibitory interaction between the HO-1&#47;CO- and Akt&#47;NO-pathways in human endothelial cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46;A&#46; Batzlsperger"
                            1 => "S&#46; Achatz"
                            2 => "J&#46; Spreng"
                            3 => "G&#46;A&#46; Riegger"
                            4 => "D&#46;P&#46; Griese"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10557-007-6051-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cardiovasc Drugs Ther"
                        "fecha" => "2007"
                        "volumen" => "21"
                        "paginaInicial" => "347"
                        "paginaFinal" => "355"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17896171"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib32"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Regulation of vascular nitric oxide in vitro and in vivo&#59; a new role for endogenous hydrogen sulphide&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;Y&#46; Ali"
                            1 => "C&#46;Y&#46; Ping"
                            2 => "Y&#46;Y&#46; Mok"
                            3 => "L&#46; Ling"
                            4 => "M&#46; Whiteman"
                            5 => "M&#46; Bhatia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bjp.0706906"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Pharmacol&#46;"
                        "fecha" => "2006"
                        "volumen" => "149"
                        "paginaInicial" => "625"
                        "paginaFinal" => "634"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17016507"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib33"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interaction between hydrogen sulfide&#47;cystathionine gamma-lyase and carbon monoxide&#47;heme oxygenase pathways in aortic smooth muscle cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46;F&#46; Jin"
                            1 => "J&#46;B&#46; Du"
                            2 => "X&#46;H&#46; Li"
                            3 => "Y&#46;F&#46; Wang"
                            4 => "Y&#46;F&#46; Liang"
                            5 => "C&#46;S&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1745-7254.2006.00425.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Acta Pharmacol Sin"
                        "fecha" => "2006"
                        "volumen" => "27"
                        "paginaInicial" => "1561"
                        "paginaFinal" => "1566"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17112409"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:3 [
        "identificador" => "xack31655"
        "titulo" => "Acknowledgments"
        "texto" => "<p class="elsevierStylePara elsevierViewall">This study was supported by the National Science Foundation of China &#40;No&#46; 30400494&#41; and National Science Foundation of Shandong province &#40;No&#46; Y2006C03&#41;&#46;</p>"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03010546/0000003700000004/v1_201304101017/S0301054609000196/v1_201304101017/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "5554"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03010546/0000003700000004/v1_201304101017/S0301054609000196/v1_201304101017/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054609000196?idApp=UINPBA00004N"
]

Article information

ISSN: 03010546
Original language: English

DOI:10.1016/j.aller.2009.03.002

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 October	17	2	19
2024 September	18	8	26
2024 August	10	2	12
2024 July	10	3	13
2024 June	11	3	14
2024 May	8	2	10
2024 April	12	3	15
2024 March	11	6	17
2024 February	23	3	26
2024 January	12	5	17
2023 December	38	4	42
2023 November	16	6	22
2023 October	13	4	17
2023 September	25	1	26
2023 August	21	5	26
2023 July	41	6	47
2023 June	21	3	24
2023 May	42	1	43
2023 April	47	1	48
2023 March	29	3	32
2023 February	18	3	21
2023 January	20	4	24
2022 December	16	6	22
2022 November	23	5	28
2022 October	18	6	24
2022 September	9	23	32
2022 August	10	7	17
2022 July	13	6	19
2022 June	8	10	18
2022 May	7	7	14
2022 April	11	8	19
2022 March	12	5	17
2022 February	7	4	11
2022 January	15	8	23
2021 December	17	9	26
2021 November	12	7	19
2021 October	16	12	28
2021 September	11	13	24
2021 August	12	5	17
2021 July	9	12	21
2021 June	13	3	16
2021 May	14	8	22
2021 April	24	32	56
2021 March	11	19	30
2021 February	14	5	19
2021 January	9	8	17
2020 December	1	0	1
2018 February	94	2	96
2018 January	35	0	35
2017 December	103	4	107
2017 November	27	1	28
2017 October	7	3	10
2017 September	10	7	17
2017 August	11	2	13
2017 July	12	4	16
2017 June	10	3	13
2017 May	15	2	17
2017 April	14	3	17
2017 March	13	1	14
2017 February	13	1	14
2017 January	9	0	9
2016 December	14	1	15
2016 November	15	1	16
2016 October	27	0	27
2016 September	13	4	17
2016 August	20	1	21
2016 July	10	3	13
2016 June	17	4	21
2016 May	10	12	22
2016 April	15	8	23
2016 March	12	7	19
2016 February	25	9	34
2016 January	16	10	26
2015 December	19	9	28
2015 November	12	11	23
2015 October	19	12	31
2015 September	19	5	24
2015 August	36	2	38
2015 July	28	2	30
2015 June	14	1	15
2015 May	9	5	14
2015 April	5	9	14
2015 March	10	11	21
2015 February	12	10	22
2015 January	18	4	22
2014 December	23	3	26
2014 November	19	3	22
2014 October	25	7	32
2014 September	20	4	24
2014 August	13	3	16
2014 July	11	2	13
2014 June	10	2	12
2014 May	6	0	6
2014 April	4	3	7
2014 March	55	8	63
2014 February	40	3	43
2014 January	38	5	43
2013 December	35	9	44
2013 November	42	5	47
2013 October	49	7	56
2013 September	62	9	71
2013 August	71	5	76
2013 July	55	8	63
2013 June	33	6	39
2013 May	53	12	65
2013 April	36	9	45
2013 March	29	8	37
2013 February	22	6	28
2013 January	16	2	18
2012 December	4	4	8
2012 November	3	5	8
2012 October	2	1	3
2009 June	999	0	999

Show all

Allergologia et Immunopathologia is no longer published on Elsevier since the 2021 year.Transferred to Codon Publications

Indexed in:

Follow us:

Statistics

Allergologia et Immunopathologia is no longer published on Elsevier since the 2021 year.Transferred to Codon Publications

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter