The status of FOXP3 gene methylation in pediatric systemic lupus erythematosus

array:23 ["pii" => "S0301054620300811" "issn" => "03010546" "doi" => "10.1016/j.aller.2020.03.014" "estado" => "S300" "fechaPublicacion" => "2020-07-01" "aid" => "1159" "copyright" => "SEICAP" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2020;48:332-8" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S0301054619300424" "issn" => "03010546" "doi" => "10.1016/j.aller.2019.02.003" "estado" => "S300" "fechaPublicacion" => "2020-07-01" "aid" => "1040" "copyright" => "SEICAP" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2020;48:339-47" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 6 "PDF" => 6 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "Serum soluble Fas ligand levels and peripheral blood lymphocyte subsets in patients with drug-induced maculopapular rashes, dress, and viral exanthemas" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "339" "paginaFinal" => "347" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "M. Yazicioglu, P. Gokmirza Ozdemir, B. Turgut, N. Sut" "autores" => array:4 [ 0 => array:2 [ "nombre" => "M." "apellidos" => "Yazicioglu" ] 1 => array:2 [ "nombre" => "P." "apellidos" => "Gokmirza Ozdemir" ] 2 => array:2 [ "nombre" => "B." "apellidos" => "Turgut" ] 3 => array:2 [ "nombre" => "N." "apellidos" => "Sut" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054619300424?idApp=UINPBA00004N" "url" => "/03010546/0000004800000004/v2_202012180835/S0301054619300424/v2_202012180835/en/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S0301054620300574" "issn" => "03010546" "doi" => "10.1016/j.aller.2020.03.002" "estado" => "S300" "fechaPublicacion" => "2020-07-01" "aid" => "1136" "copyright" => "SEICAP" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Allergol Immunopathol (Madr). 2020;48:323-31" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "Atopy patch test in children with cow's milk and hen's egg allergy: Do clinical symptoms matter?" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "323" "paginaFinal" => "331" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "S. Sirin Kose, S. Asilsoy, D. Tezcan, G. Atakul, S. Al, O. Atay, O. Kangalli Boyacioglu, N. Uzuner, O. Anal, O. Karaman" "autores" => array:10 [ 0 => array:2 [ "nombre" => "S." "apellidos" => "Sirin Kose" ] 1 => array:2 [ "nombre" => "S." "apellidos" => "Asilsoy" ] 2 => array:2 [ "nombre" => "D." "apellidos" => "Tezcan" ] 3 => array:2 [ "nombre" => "G." "apellidos" => "Atakul" ] 4 => array:2 [ "nombre" => "S." "apellidos" => "Al" ] 5 => array:2 [ "nombre" => "O." "apellidos" => "Atay" ] 6 => array:2 [ "nombre" => "O." "apellidos" => "Kangalli Boyacioglu" ] 7 => array:2 [ "nombre" => "N." "apellidos" => "Uzuner" ] 8 => array:2 [ "nombre" => "O." "apellidos" => "Anal" ] 9 => array:2 [ "nombre" => "O." "apellidos" => "Karaman" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054620300574?idApp=UINPBA00004N" "url" => "/03010546/0000004800000004/v2_202012180835/S0301054620300574/v2_202012180835/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "The status of FOXP3 gene methylation in pediatric systemic lupus erythematosus" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "332" "paginaFinal" => "338" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "S. Hanaei, G. Sanati, S. Zoghi, S. Gharibzadeh, V. Ziaee, N. Rezaei" "autores" => array:6 [ 0 => array:3 [ "nombre" => "S." "apellidos" => "Hanaei" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "G." "apellidos" => "Sanati" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "S." "apellidos" => "Zoghi" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] 2 => array:2 [ "etiqueta" => "f" "identificador" => "aff0030" ] ] ] 3 => array:3 [ "nombre" => "S." "apellidos" => "Gharibzadeh" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "h" "identificador" => "aff0040" ] ] ] 4 => array:3 [ "nombre" => "V." "apellidos" => "Ziaee" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 5 => array:4 [ "nombre" => "N." "apellidos" => "Rezaei" "email" => array:1 [ 0 => "rezaei_nima@tums.ac.ir" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "f" "identificador" => "aff0030" ] 2 => array:2 [ "etiqueta" => "g" "identificador" => "aff0035" ] 3 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:8 [ 0 => array:3 [ "entidad" => "Research Center for Immunodeficiencies, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Tehran, Iran" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Molecular Immunology Research Center, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Vienna, Austria" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Division of Pediatric Rheumatology, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran" "etiqueta" => "f" "identificador" => "aff0030" ] 6 => array:3 [ "entidad" => "Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Stockholm, Sweden" "etiqueta" => "g" "identificador" => "aff0035" ] 7 => array:3 [ "entidad" => "Department of Epidemiology and Biostatistics, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Tehran, Iran" "etiqueta" => "h" "identificador" => "aff0040" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1730 "Ancho" => 2177 "Tamanyo" => 114908 ] ] "descripcion" => array:1 [ "en" => "Comparison of changes in CpG island methylation status at the FOXP3 gene promoter region in peripheral blood samples of patients with pediatric SLE and healthy control. Error bars mean±SD (*P<0.05)." ] ] ] "textoCompleto" => "BackgroundConsidered as a multi-organ auto-immune disease, systemic lupus erythematosus (SLE) affects several body organs such as kidney, joints, lung, nervous system and skin through the production of auto-antibodies against self-antigens.<a class="elsevierStyleCrossRef" href="#bib0005">1</a> Although not clearly understood, loss of tolerance to self-antigens could possibly play a causative role in the pathophysiology of SLE.<a class="elsevierStyleCrossRef" href="#bib0005">1</a> The causative risk factors for SLE could be categorized as genetic and environmental factors in general. While the genes encoding human leukocyte antigen (HLA), cytokines, cell surface antigens and some other genes consistute the genetic arm of SLE risk factors, sex hormones, viral infections, UV radiation, and some medications play causative roles as environmental risk factors.<a class="elsevierStyleCrossRef" href="#bib0010">2</a>Considering the undeniable role of immunity in the pathogenesis of SLE, both B cell and T cell-related immunities actively participate in autoimmunity to self-antigens, leading to systemic organ damage in SLE. As the role of CD4+ T cells in the regulation of B-cell function and production of antibodies, any dysregulation in the process could possibly cause autoimmunity.<a class="elsevierStyleCrossRef" href="#bib0005">1</a> The Forkhead Box P3 (FOXP3) gene is a member of fork-winged helix family of transcription factors with the crucial role in normal maturation and activity of CD4+/CD25+ regulatory T cells (Treg), which are responsible for maintaining tolerance against self-antigens in the body.<a class="elsevierStyleCrossRef" href="#bib0015">3</a> The animal studies have shown different expression levels of FOXP3 gene in different immune cells such as regulatory T cells, CD4+/CD25− T cells, or CD4-/CD8+ T cells, which were closely associated with the function of these cells in production of immune-related molecules, inhibition of autoimmunity and inflammation, or intercellular contacts.<a class="elsevierStyleCrossRef" href="#bib0020">4</a> The three conserved noncoding DNA sequences in FOXP3 gene participate in the FOXP3 expression pattern, which is important in Treg production, division, and differentiation in immune tissues.<a class="elsevierStyleCrossRef" href="#bib0025">5</a> Therefore, the methylation status of FOXP3 gene, especially in the conserved noncoding sequences would influence the phenotype of natural CD4+ Tregs.<a class="elsevierStyleCrossRef" href="#bib0030">6</a>Accordingly, as the undeniable role of Tregs in autoimmunity and the role of FOXP3 gene in phenotype and function of Tregs, the structural and epigenetic changes in this gene could play a role in the pathophysiology of autoimmune diseases such as SLE. One of interesting study involved the evaluation of FOXP3 gene methylation in this disease. To our knowledge, two separate studies, in China and South Africa respectively, demonstrated hypomethylation of this gene in SLE patients.<a class="elsevierStyleCrossRefs" href="#bib0030">6,7</a> On the other hand, another investigation among SLE patients indicated that the methylation status of FOXP3 gene was remarkably higher in active cases, whilst inactive cases and healthy subjects had lower levels of DNA methylation in this gene.<a class="elsevierStyleCrossRef" href="#bib0040">8</a>Despite the rich investigations in elucidating the role of autoimmunity in SLE, there is still a lack of evidence regarding the role of the FOXP3 gene structure and function in the pathophysiology of this disease. Therefore, the current case-control study was designed to investigate and compare DNA methylation levels in the FOXP3 promoter between children affected with SLE and healthy controls.Materials and methodsStudy designBased on the STROBE guidelines for observational studies and in order to investigate the difference between DNA methylation of the FOXP3 promoter in pediatric SLE and healthy controls, this case-control study was designed. The study was conducted in the Research Center for Immunodeficiencies (RCID), Children's Medical Center; and was approved by the Ethics Committee of Tehran University of Medical Sciences (TUMS).Patient selectionIn the 18-month period of study, pediatric patients who were referred to the Rheumatology Clinic of Children's Medical Center with confirmed diagnosis of pediatric SLE by pediatric rheumatologist were screened for eligibility criteria. Patients under 18 years of age, with no self-history or family history of immunodeficiency or autoimmunity diseases other than SLE were eligible for the study and included. The patients who were either suspicious for SLE or had other concomitant diseases were excluded. The control subjects included healthy subjects with no history of autoimmunity in them or their families, who were not matched by age with the patients. The parents or legal guardians of study subjects were requested to fill in the written informed consent form prior to recruitment and laboratory tests.Blood sampling and DNA extractionIn brief, 5cc of peripheral blood from all study subjects was stored in −20°C prior to DNA extraction. The DNA from whole blood cells was then extracted using Phenol-Chloroform method as described before.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> The quality of the extracted DNA was evaluated through measurement of optical density and the 260/280 ratio.DNA treatment and bisulfite conversionPrior to DNA methylation assessment, the extracted genomic DNA was treated though the Bisulfite method using MethylEdge™ Bisulfite Conversion System (Promega, Madison, WI, USA) according to the instructions provided by the manufacturer and was stored at −20°C before PCR. In brief, in the sodium bisulfite treatment method, the unmethylated cytosine residues would be converted to uracil, which would be converted to thiamine following PCR amplification. In this method, the 5-methylcytosine (5mC) of genomic DNA would not be influenced.DNA methylation assessment using methyl specific PCR (MSP)The real-time quantitative multiplex methylation specific PCR (QM-MSP) method was used to assess the FOXP3 promoter methylation<a class="elsevierStyleCrossRef" href="#bib0050">10</a> in the bisulfite-treated genomic DNA. With considerable sensitivity and specificity, the MethySYBR procedure includes two steps of PCR reactions in general:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">1)The multiplex step: in this pre-amplification step, paired external primers (external forward primer and external reverse primer) (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) were designed in order to amplify a distinction containing different target alleles. Accordingly, each reaction-well contained a total amount of 25μl mixture including 1μl of converted DNA and other reaction materials. This sequence of reactions included one cycle of 95°C for 5min, and then 30 cycles of 94°C for 30s, 56°C for 30s, and 72°C for 30s. The final cycle of this step was 72°C for 5min.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia></li><li class="elsevierStyleListItem" id="lsti0010">2)In the second step, the products of the previous step were used to quantify specific methylated targets. In this phase, nested paired primers, independent and specific for methylation, were used. The sequences of nested methylation-specific primers (forward and reverse) are mentioned in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. The UCSC database was used to determine the methylation status of CpG islands in the FOXP3 promoter; and the MethBlast tool was used for primer blasting as well. Each reaction-well contained a total amount of 10μl mixture including 5μl SYBR® Green Master Mix, 0.25μl Forward Primer, 0.25μl Reverse Primer, 3.5μl DDW, and 1μl bisulfite-treated DNA. These reactions started with one cycle of 95°C for one minute, and then 30 cycles of 94°C for 30s, 60°C for 1min, 72°C for 30s, and the final extension of 72°C for 5min.</li></ul>In order to determine the methylation percentage of DNA samples, a positive MSP control was used in each run which was 100% methylated. For this purpose, fully converted methylated human plasmid DNA was used and therefore, no negative untreated controls were used in this study.As explained elsewhere, the unmethylated DNA was calculated though the following formulae:<a class="elsevierStyleCrossRefs" href="#bib0055">11,12</a><elsevierMultimedia ident="eq0005"></elsevierMultimedia><elsevierMultimedia ident="eq0010"></elsevierMultimedia><elsevierMultimedia ident="eq0015"></elsevierMultimedia>where MSP: methyl specific PCR; BSP: bisulfite specific PCR.Meanwhile, the Demethylation Index (DI) was also calculated as follows, in order to determine the efficiency of the PCR:<a class="elsevierStyleCrossRef" href="#bib0065">13</a><elsevierMultimedia ident="eq0020"></elsevierMultimedia>Statistical analysisThe PASS 11 software (version 11.0.4 with serial number 2365456856) was used to calculate the sample size and study power. Group sample sizes of 25 achieve 91% power to detect equivalence when the margin of equivalence is from −1.0 to 1.0 and the actual mean difference is 0.0. The significance level (alpha) is 0.050 using two one-sided Mann–Whitney tests. The amount of unmethylated DNA in each group was reported as median±RIQ; and the difference between groups was assessed using the Mann–Whitney test.ResultsTwenty-five children with SLE and 25 healthy controls were recruited in this study. After DNA extraction and treatment, the data from 24 patients and 25 controls were analyzable (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>).<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>In the quantitative PCR method, the melting curves of target amplicons were analyzed in order to indicate the methylation status of the FOXP3 promoter (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).<elsevierMultimedia ident="fig0005"></elsevierMultimedia>The methylation status of the FOXP3 promoter in patients and controls are shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>. Promoter methylation of the FOXP3 gene was significantly higher in SLE patients; as the median of unmethylated DNA was 0.57±0.43 in the patients, while it was 0.97±0.83 in controls (P=0.012) (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>).<elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia>Moreover, the DI in the patient group was 0.007±0.003, which was significantly lower than the controls (0.014±0.013; P=0.012) (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>).DiscussionIn order to elucidate the association between promoter methylation of the FOXP3 gene and pediatric SLE, the current investigation was performed to compare the methylation difference between pediatric SLE patients and controls through the Quantitative MSP method.The results of this investigation indicated significant difference between methylation status of the FOXP3 promoter and SLE as the median of unmethylated DNA was 0.57±0.43 in the patients, while it was 0.97±0.83 in controls (P=0.012).As a member of the fork-winged helix family (Forkhead), FOXP3 is located at chromosome Xp11.23 and plays an important role in appropriate activity of Tregs, which are important arms in preventing autoimmune reactions. The dysfunction in CD4+/CD25+ T cells, as well as low expression and mutation of the FOXP3 gene were found in association with some autoimmune diseases such as autoimmune hepatitis (AIH), autoimmune thyroid diseases, SLE, rheumatoid arthritis (RA), particular immunodeficiencies, autoimmune diabetes, inflammatory bowel disease (IBD) and many other diseases.<a class="elsevierStyleCrossRef" href="#bib0070">14</a>Several studies investigated the association between this gene and SLE. According to one of these studies, the expression level of two FOXP3 isoforms would be dramatically decreased in patients with SLE and RA.<a class="elsevierStyleCrossRef" href="#bib0075">15</a> On the other hand, another study indicated a significant increase in the FOXP3 presentation level in SLE, with a P-value of 0.012.<a class="elsevierStyleCrossRef" href="#bib0080">16</a> Moreover, the expression of this gene was found associated with renal involvement in SLE and also expression level of anti-dsDNA in these patients as well.<a class="elsevierStyleCrossRef" href="#bib0085">17</a> Playing an important role in the regulation of immune tolerance, the FOXP3+/Helios+ types of regulatory T cells were remarkably more frequent in the blood samples of patients with active SLE (11%) when compared to control subjects (5%) (P<0.001). Importantly, this increase was specifically found in SLE patients and this change was not seen in other autoimmune diseases.<a class="elsevierStyleCrossRef" href="#bib0090">18</a>In addition to an alteration in the expression level of FOXP3 in SLE, different mutations and single nucleotide polymorphisms (SNPs) of this gene were found in association with this disease as well, such as a significant association of rs12843496 of this gene and SLE.<a class="elsevierStyleCrossRef" href="#bib0095">19</a>Similar to the results of association between SLE and expression or mutation of FOXP3, methylation alteration of this gene was also closely associated with SLE and some other autoimmune diseases. Accordingly, in one of these studies, the FOXP3 gene was hypomethylated in SLE patients.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> As investigated among black ethnicity of South Africans, there was a remarkable difference between global methylation in SLE patients and healthy individuals. According to that study, the global methylation was 22.2±5% in patients while it was 33.9±11% in healthy people.<a class="elsevierStyleCrossRef" href="#bib0035">7</a> However, the results of that study were not in concordance with the results of our study, as FOXP3 gene was hypermethylated in the aforementioned patient population.<a class="elsevierStyleCrossRef" href="#bib0035">7</a> However, in another study the mean melting temperature was considered as a criterion for methylation, with a higher mean melting temperature showing higher methylation level. In this study, patients with active SLE disease had a significantly higher methylation level in the FOXP3 gene when compared to both inactive SLE patients and also healthy subjects (79.00±0.28 vs. 78.49±0.29 vs. 78.44±0.25 respectively; P<0.001).<a class="elsevierStyleCrossRef" href="#bib0040">8</a> This result was similar to the findings of the current study.Moreover, and as primarily described by Akirav et al., the demethylation index mainly compares the relative frequency of unmethylated DNA in cells, which is calculated through subtracting the methylation-specific from bisulfite-specific PCRs.<a class="elsevierStyleCrossRefs" href="#bib0060">12,13</a> Accordingly, the difference in the demethylation index between SLE patients and controls was statistically significant, showing lower levels in patients than in controls (P=0.012).Importantly, the promoter of this gene was demethylated in some other diseases such as IPEX-like syndrome, AIH and RA, resulting in a higher gene expression of FOXP3.<a class="elsevierStyleCrossRefs" href="#bib0100">20–23</a> On the other hand, in some other diseases including systemic sclerosis and Sjogren, the promoter of this gene was hypermethylated.<a class="elsevierStyleCrossRefs" href="#bib0120">24,25</a>In addition to FOXP3, the methylation alterations of some other genes were also associated with SLE. While demethylation of TNFSF7 was associated with SLE, hypomethylation of some other genes was significantly associated with SLE clinical presentations. Accordingly, hypomethylation of MIR886 and TRIM69 genes were associated with malar rashes, while hypomethylation of PSMB8, RHOJ, and TAP1 were associated with discoid rashes in SLE.<a class="elsevierStyleCrossRef" href="#bib0130">26</a> On the other hand, hypermethylation of some genes such as RUNX3, MHC2TA, RFC1, MBD2, DNMT1, and GR were found correlated to disease as well.<a class="elsevierStyleCrossRefs" href="#bib0135">27–35</a>Although the current study provided valuable results in elucidating the pathophysiology of SLE, there were several limitations which shall be considered. First of all was the small sample size, therefore, epidemiologic studies with large sample sizes could be conducted in the future, in order to reduce the possible random error and increase the power. As the clinical and demographic data were not available in this study, several useful analyses measuring the difference between active and inactive phases of disease were not applicable. Therefore, a new prospective study, considering patients’ characteristics is recommended. Meanwhile, the co-effect of other etiologic factors including other genes, age, sex, and environmental factors could be considered as well. As the crucial role of DNA methylation and epigenetics in the expression level and therefore, function of genes, future studies investigating both methylation status and expression level of FOXP3 could more precisely elucidate the role of FOXP3 methylation in the pathophysiology of SLE.In conclusion, promoter methylation of the FOXP3 gene was significantly higher in pediatric patients with SLE when compared to healthy controls. Therefore, the possible lower expression level of the FOXP3 gene resulted from this hypermethylation could be one of the causes of increased immune response in the pathophysiology of this disease.Conflict of interestThe authors have no conflict of interest to declare." "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:3 [ "identificador" => "xres1437434" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Method" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1312166" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Background" ] 3 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Study design" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Patient selection" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Blood sampling and DNA extraction" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "DNA treatment and bisulfite conversion" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "DNA methylation assessment using methyl specific PCR (MSP)" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical analysis" ] ] ] 4 => array:2 [ "identificador" => "sec0045" "titulo" => "Results" ] 5 => array:2 [ "identificador" => "sec0050" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "sec0055" "titulo" => "Conflict of interest" ] 7 => array:2 [ "identificador" => "xack501512" "titulo" => "Acknowledgment" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2018-06-07" "fechaAceptado" => "2020-03-17" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1312166" "palabras" => array:5 [ 0 => "Systemic lupus erythematosus" 1 => "FOXP3" 2 => "Epigenetics" 3 => "Methylation" 4 => "Autoimmunity" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundSystemic lupus erythematosus (SLE) is an autoimmune disease caused by interaction of genetic, epigenetic, and environmental factors. One of the important epigenetic factors in SLE would be methylation of immune-related genes, such as FOXP3, which plays a role in activating the regulation and also the function of T cells. To date, the relationship between levels of serum bio-markers and the susceptibility to lupus in children has not been well-understood. In this study, the involvement of etiologic factors, such as methylation of FOXP3 gene, was investigated in children with SLE. MethodTwenty-four female children with SLE and 25 female healthy subjects without any history of autoimmune and inflammatory diseases were included in this study. Blood samples were obtained and DNA was extracted from the blood cells. The bisulphite method was used to convert the DNA using the MethylEdge™ Bisulfite Conversion System Kit. Then, methylation of the gene was investigated using Real Time methylation specific PCR. ResultsThe FOXP3 DNA methylation in patients and healthy subjects was significantly different. While the median unmethylated DNA in patients was 0.57±0.43, it was 0.97±0.83 in healthy subjects (P=0.012). The Demethylation Index in patients was 0.007±0.003, significantly lower than in controls (0.014±0.013; P=0.012). ConclusionsThe FOXP3 gene methylation in children with SLE was significantly higher than healthy subjects, which could possibly affect the level of gene expression. Therefore, one of the causes of increased immune response in SLE can be the lower expression of FOXP3 by hypermethylation of this gene." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Method" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] ] "multimedia" => array:9 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1598 "Ancho" => 2173 "Tamanyo" => 167321 ] ] "descripcion" => array:1 [ "en" => "The fluorescent melting peaks for the promoter CpG island of the FOXP3 gene. DNA melt curve analysis of changes in CpG methylation status was analyzed based on amplification of unmethylated bisulfite-treated DNA from peripheral blood of pediatric SLE cases." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1730 "Ancho" => 2177 "Tamanyo" => 114908 ] ] "descripcion" => array:1 [ "en" => "Comparison of changes in CpG island methylation status at the FOXP3 gene promoter region in peripheral blood samples of patients with pediatric SLE and healthy control. Error bars mean±SD (*P<0.05)." ] ] 2 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">External forward primer \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTAGGGAGGTGACGAGGTAGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">External reverse primer \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACAAAATAACCCCGAACAACC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nested methylation-specific forward \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGAGATTTTAGGTTTTCGGAATATTTC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nested methylation-specific reverse \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCGAAACTACCTAAACGCCG \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2472555.png" ] ] ] ] "descripcion" => array:1 [ "en" => "FOXP3 primer sequences for methylation assessment." ] ] 3 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable (n=24) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Median \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 years \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Range \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5–16 years \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SLEDAI score<a class="elsevierStyleCrossRef" href="#tblfn0005">a</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Median \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Range \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13–29 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2472553.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "SLEDAI (SLE Disease Activity Index), done in only 15 cases" ] ] ] "descripcion" => array:1 [ "en" => "General description of patients with pediatric systemic lupus erythematosus." ] ] 4 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Group (N=49) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean unmethylated DNA±SD \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean DI±SD \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SLE (N=24) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.57±0.43 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.006696±0.003151 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Control (N=25) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.97±0.83 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.013955±0.013492 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">P-value \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.012 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.012 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2472554.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Comparison of median unmethylated DNA and mean DI in SLE and controls." ] ] 5 => array:5 [ "identificador" => "eq0005" "tipo" => "MULTIMEDIAFORMULA" "mostrarFloat" => false "mostrarDisplay" => true "Formula" => array:5 [ "Matematica" => "ΔΔCq=ΔCq sample−ΔCq plasmid," "Fichero" => "STRIPIN_si1.jpeg" "Tamanyo" => 1879 "Alto" => 15 "Ancho" => 217 ] ] 6 => array:5 [ "identificador" => "eq0010" "tipo" => "MULTIMEDIAFORMULA" "mostrarFloat" => false "mostrarDisplay" => true "Formula" => array:5 [ "Matematica" => "ΔCq sample=Cq MSP−Cq BSP," "Fichero" => "STRIPIN_si2.jpeg" "Tamanyo" => 1435 "Alto" => 15 "Ancho" => 166 ] ] 7 => array:5 [ "identificador" => "eq0015" "tipo" => "MULTIMEDIAFORMULA" "mostrarFloat" => false "mostrarDisplay" => true "Formula" => array:5 [ "Matematica" => "ΔCq plasmid=Cq MSP−Cq BSP," "Fichero" => "STRIPIN_si3.jpeg" "Tamanyo" => 1484 "Alto" => 15 "Ancho" => 169 ] ] 8 => array:5 [ "identificador" => "eq0020" "tipo" => "MULTIMEDIAFORMULA" "mostrarFloat" => false "mostrarDisplay" => true "Formula" => array:5 [ "Matematica" => "DI=2Cq BSP-Cq MSP." "Fichero" => "STRIPIN_si4.jpeg" "Tamanyo" => 844 "Alto" => 13 "Ancho" => 107 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:35 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Systemic lupus erythematosus: epidemiology, pathophysiology, manifestations, and management" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G. Fortuna" 1 => "M.T. Brennan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Dental Clin" "fecha" => "2013" "volumen" => "57" "paginaInicial" => "631" "paginaFinal" => "655" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biomarkers for systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.M. Ahearn" 1 => "C.-C. Liu" 2 => "A.H. Kao" 3 => "S. Manzi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.trsl.2012.01.021" "Revista" => array:6 [ "tituloSerie" => "Transl Res" "fecha" => "2012" "volumen" => "159" "paginaInicial" => "326" "paginaFinal" => "342" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22424435" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anti tumour necrosis-α therapy increases the number of FOXP3+ regulatory T cells in children affected by Crohn's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "I. Ricciardelli" 1 => "K.J. Lindley" 2 => "M. Londei" 3 => "S. Quaratino" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2567.2008.02839.x" "Revista" => array:6 [ "tituloSerie" => "Immunology" "fecha" => "2008" "volumen" => "125" "paginaInicial" => "178" "paginaFinal" => "183" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18422560" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Control of regulatory T cell development by the transcription factor Foxp3" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S. Hori" 1 => "T. Nomura" 2 => "S. Sakaguchi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1126/science.1079490" "Revista" => array:6 [ "tituloSerie" => "Science" "fecha" => "2003" "volumen" => "299" "paginaInicial" => "1057" "paginaFinal" => "1061" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12522256" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Zheng" 1 => "S. Josefowicz" 2 => "A. Chaudhry" 3 => "X.P. Peng" 4 => "K Forbush" 5 => "A.Y. Rudensky" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nature08750" "Revista" => array:5 [ "tituloSerie" => "Nature" "fecha" => "2010" "volumen" => "463" "paginaInicial" => "808" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20072126" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genome-wide DNA methylation analysis identifies hypomethylated genes regulated by FOXP3 in human regulatory T cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Zhang" 1 => "J. Maksimovic" 2 => "G. Naselli" 3 => "J. Qian" 4 => "M. Chopin" 5 => "M.E. Blewitt" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Blood" "fecha" => "2013" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7949091" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA methylation similarities in genes of black South Africans with systemic lupus erythematosus and systemic sclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "P. Matatiele" 1 => "M. Tikly" 2 => "G. Tarr" 3 => "M. Gulumian" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Biomed Sci" "fecha" => "2015" "volumen" => "22" "paginaInicial" => "34" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Peripheral whole blood FOXP3 TSDR methylation: a potential marker in severity assessment of autoimmune diseases and chronic infections" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "O. Ngalamika" 1 => "G. Liang" 2 => "M. Zhao" 3 => "X. Yu" 4 => "Y. Yang" 5 => "H. Yin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/08820139.2014.938165" "Revista" => array:6 [ "tituloSerie" => "Immunol Invest" "fecha" => "2015" "volumen" => "44" "paginaInicial" => "126" "paginaFinal" => "136" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25083793" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An efficient and simple method of DNA extraction from whole blood and cell lines to identify infectious agents" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "V.N. Loparev" 1 => "M.A. Cartas" 2 => "C.E. Monken" 3 => "A. Velpandi" 4 => "A. Srinivasan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/0166-0934(91)90126-k" "Revista" => array:6 [ "tituloSerie" => "J Virol Methods" "fecha" => "1991 Sep" "volumen" => "34" "paginaInicial" => "105" "paginaFinal" => "112" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1955487" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MethySYBR, a novel quantitative PCR assay for the dual analysis of DNA methylation and CpG methylation density" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.-K. Lo" 1 => "H. Watanabe" 2 => "P.-C. Cheng" 3 => "W.W. Teo" 4 => "X. Liang" 5 => "P. Argani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2353/jmoldx.2009.080126" "Revista" => array:6 [ "tituloSerie" => "J Mol Diagn" "fecha" => "2009" "volumen" => "11" "paginaInicial" => "400" "paginaFinal" => "414" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19710398" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analyzing real-time PCR data by the comparative CT method" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "T.D. Schmittgen" 1 => "K.J. Livak" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nprot.2008.73" "Revista" => array:5 [ "tituloSerie" => "Nat Protoc" "fecha" => "2008" "volumen" => "3" "paginaInicial" => "1101" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18546601" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development of a quantitative methylation-specific polymerase chain reaction method for monitoring beta cell death in type 1 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.I. Husseiny" 1 => "A. Kuroda" 2 => "A.N. Kaye" 3 => "I. Nair" 4 => "F. Kandeel" 5 => "K. Ferreri" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0047942" "Revista" => array:5 [ "tituloSerie" => "PLoS ONE" "fecha" => "2012" "volumen" => "7" "paginaInicial" => "e47942" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23144715" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of β cell death in diabetes using differentially methylated circulating DNA" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.M. Akirav" 1 => "J. Lebastchi" 2 => "E.M. Galvan" 3 => "O. Henegariu" 4 => "M. Akirav" 5 => "V. Ablamunits" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.1111008108" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2011" "volumen" => "108" "paginaInicial" => "19018" "paginaFinal" => "19023" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22074781" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Deficient CD4+ CD25+ T regulatory cell function in patients with abdominal aortic aneurysms" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Yin" 1 => "J. Zhang" 2 => "Y. Wang" 3 => "S. Wang" 4 => "D. Bockler" 5 => "Z. Duan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/ATVBAHA.109.200303" "Revista" => array:6 [ "tituloSerie" => "Arterioscler Thromb Vasc Biol" "fecha" => "2010" "volumen" => "30" "paginaInicial" => "1825" "paginaFinal" => "1831" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20448211" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Decreased mRNA expression of two FOXP3 isoforms in peripheral blood mononuclear cells from patients with rheumatoid arthritis and systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "K. Suzuki" 1 => "Y. Setoyama" 2 => "K. Yoshimoto" 3 => "K. Tsuzaka" 4 => "T. Abe" 5 => "T. Takeuchi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/03946320110240S402" "Revista" => array:6 [ "tituloSerie" => "Int J Immunopathol Pharmacol" "fecha" => "2011" "volumen" => "24" "paginaInicial" => "7" "paginaFinal" => "14" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22032779" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Direct role of antibody-secreting B cells in the severity of chronic hepatitis B" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A.K. Zgair" 1 => "J.A. Ghafil" 2 => "R.H. Al-Sayidi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jmv.24067" "Revista" => array:6 [ "tituloSerie" => "J Med Virol" "fecha" => "2015" "volumen" => "87" "paginaInicial" => "407" "paginaFinal" => "416" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25163843" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of single-nucleotide polymorphisms in FoxP 3 gene with systemic lupus erythematosus susceptibility: a case–control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Lin" 1 => "J. Lee" 2 => "A.S. Wu" 3 => "C.Y. Tsai" 4 => "H.H. Yu" 5 => "L.C. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/0961203310382428" "Revista" => array:6 [ "tituloSerie" => "Lupus" "fecha" => "2011" "volumen" => "20" "paginaInicial" => "137" "paginaFinal" => "143" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21078762" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Foxp3+ Helios+ regulatory T cells are expanded in active systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Alexander" 1 => "A. Sattler" 2 => "L. Templin" 3 => "S. Kohler" 4 => "C. Groß" 5 => "A. Meisel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/annrheumdis-2012-202216" "Revista" => array:6 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2013" "volumen" => "72" "paginaInicial" => "1549" "paginaFinal" => "1558" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23264341" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "FOXP3 gene polymorphisms in preeclampsia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T.D. Metz" 1 => "L.M. Nelson" 2 => "G.J. Stoddard" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Am J Obstet Gynecol" "fecha" => "2012" "volumen" => "206" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Demethylation analysis of the FOXP3 locus shows quantitative defects of regulatory T cells in IPEX-like syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Barzaghi" 1 => "L. Passerini" 2 => "E. Gambineri" 3 => "S.C. Mannurita" 4 => "T. Cornu" 5 => "E.S. Kang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jaut.2011.12.009" "Revista" => array:6 [ "tituloSerie" => "J Autoimmun" "fecha" => "2012" "volumen" => "38" "paginaInicial" => "49" "paginaFinal" => "58" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22264504" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulatory T cells and autoimmune hepatitis: defective cells or a hostile environment?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y.H. Oo" 1 => "D.H. Adams" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2012.04.005" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2012" "volumen" => "57" "paginaInicial" => "6" "paginaFinal" => "8" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22522382" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "FOXP3+ regulatory T cells in autoimmune hepatitis are fully functional and not reduced in frequency" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Peiseler" 1 => "M. Sebode" 2 => "B. Franke" 3 => "F. Wortmann" 4 => "D. Schwinge" 5 => "A. Quaas" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2012.02.029" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2012" "volumen" => "57" "paginaInicial" => "125" "paginaFinal" => "132" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22425700" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epigenetic dynamics in immunity and autoimmunity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Zhao" 1 => "Z. Wang" 2 => "S. Yung" 3 => "Q. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.biocel.2015.05.022" "Revista" => array:6 [ "tituloSerie" => "Int J Biochem Cell Biol" "fecha" => "2015" "volumen" => "67" "paginaInicial" => "65" "paginaFinal" => "74" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26026281" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA hypermethylation of the forkhead box protein 3 (FOXP3) promoter in CD4+ T cells of patients with systemic sclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Wang" 1 => "Q. Wang" 2 => "X. Sun" 3 => "R.Z. Liu" 4 => "Y. Shu" 5 => "T. Kanekura" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/bjd.12913" "Revista" => array:6 [ "tituloSerie" => "Br J Dermatol" "fecha" => "2014" "volumen" => "171" "paginaInicial" => "39" "paginaFinal" => "47" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24641670" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA hypermethylation leads to lower FOXP3 expression in CD4+ T cells of patients with primary Sjögren's syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X. Yu" 1 => "G. Liang" 2 => "H. Yin" 3 => "O. Ngalamika" 4 => "F. Li" 5 => "M. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Immunol" "fecha" => "2013" "volumen" => "2" "paginaInicial" => "254" "paginaFinal" => "257" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA methylation patterns in naive CD4+ T cells identify epigenetic susceptibility loci for malar rash and discoid rash in systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Renauer" 1 => "P. Coit" 2 => "M.A. Jeffries" 3 => "J.T. Merrill" 4 => "W.J. McCune" 5 => "K. Maksimowicz-McKinnon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/lupus-2015-000101" "Revista" => array:5 [ "tituloSerie" => "Lupus Sci Med" "fecha" => "2015" "volumen" => "2" "paginaInicial" => "e000101" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26405558" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hypermethylation of glucocorticoid receptor gene promoter results in glucocorticoid receptor gene low expression in peripheral blood mononuclear cells of patients with systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Chen" 1 => "J. Fan" 2 => "Q. Shou" 3 => "L. Zhang" 4 => "H. Ma" 5 => "F. Fan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00296-015-3266-5" "Revista" => array:6 [ "tituloSerie" => "Rheumatol Int" "fecha" => "2015" "volumen" => "35" "paginaInicial" => "1335" "paginaFinal" => "1342" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25899090" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genome-wide DNA methylation study suggests epigenetic accessibility and transcriptional poising of interferon-regulated genes in naive CD4+ T cells from lupus patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Coit" 1 => "M. Jeffries" 2 => "N. Altorok" 3 => "M.G. Dozmorov" 4 => "K.A. Koelsch" 5 => "J.D. Wren" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jaut.2013.04.003" "Revista" => array:6 [ "tituloSerie" => "J Autoimmun" "fecha" => "2013" "volumen" => "43" "paginaInicial" => "78" "paginaFinal" => "84" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23623029" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA methylation modulates HRES1/p28 expression in B cells from patients with lupus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Fali" 1 => "C. Le Dantec" 2 => "Y. Thabet" 3 => "S. Jousse" 4 => "C. Hanrotel" 5 => "P. Youinou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/08916934.2013.826207" "Revista" => array:6 [ "tituloSerie" => "Autoimmunity" "fecha" => "2014" "volumen" => "47" "paginaInicial" => "265" "paginaFinal" => "271" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24117194" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hypomethylation of long interspersed nucleotide element-1 in peripheral mononuclear cells of juvenile systemic lupus erythematosus patients in China" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X. Huang" 1 => "G. Su" 2 => "Z. Wang" 3 => "S. Shangguan" 4 => "X. Cui" 5 => "J. Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/1756-185X.12239" "Revista" => array:6 [ "tituloSerie" => "Int J Rheum Dis" "fecha" => "2014" "volumen" => "17" "paginaInicial" => "280" "paginaFinal" => "290" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24330152" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A possible role of HMGB1 in DNA demethylation in CD4+" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Li" 1 => "C. Huang" 2 => "M. Zhao" 3 => "G. Liang" 4 => "R. Xiao" 5 => "S. Yung" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Clin Dev Immunol" "fecha" => "2013" "paginaInicial" => "2013" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The immunopathogenesis and immunopathology of systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D.S. Pisetsky" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "fecha" => "2012" "paginaInicial" => "13" "paginaFinal" => "26" "editorial" => "Springer" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Associations between aberrant DNA methylation and transcript levels of DNMT1 and MBD2 in CD4+ T cells from patients with systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H.H. Qin" 1 => "X.H. Zhu" 2 => "J. Liang" 3 => "Y.S. Yang" 4 => "S.S Wang" 5 => "W.M. Shi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1440-0960.2012.00968.x" "Revista" => array:6 [ "tituloSerie" => "Australas J Dermatol" "fecha" => "2013" "volumen" => "54" "paginaInicial" => "90" "paginaFinal" => "95" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23127209" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epigenetic modulation of RFC1, MHC2TA and HLA-DR in systemic lupus erythematosus: association with serological markers and six functional polymorphisms of one-carbon metabolic pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Rupasree" 1 => "S.M. Naushad" 2 => "L. Rajasekhar" 3 => "V.K. Kutala" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.gene.2013.11.094" "Revista" => array:6 [ "tituloSerie" => "Gene" "fecha" => "2014" "volumen" => "536" "paginaInicial" => "45" "paginaFinal" => "52" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24333266" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analysis of associations between the patterns of global DNA hypomethylation and expression of DNA methyltransferase in patients with systemic lupus erythematosus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "X. Zhu" 1 => "J. Liang" 2 => "F. Li" 3 => "Y. Yang" 4 => "L. Xiang" 5 => "J. Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-4632.2010.04804.x" "Revista" => array:6 [ "tituloSerie" => "Int J Dermatol" "fecha" => "2011" "volumen" => "50" "paginaInicial" => "697" "paginaFinal" => "704" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21595664" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack501512" "titulo" => "Acknowledgment" "texto" => "The study was supported by a grant from Tehran University of Medical Sciences (95-03-154-32732)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03010546/0000004800000004/v2_202012180835/S0301054620300811/v2_202012180835/en/main.assets" "Apartado" => array:4 [ "identificador" => "5554" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03010546/0000004800000004/v2_202012180835/S0301054620300811/v2_202012180835/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054620300811?idApp=UINPBA00004N"]

Statistics

Original Article

S. Hanaeia,b, G. Sanatib,c, S. Zoghia,d,f, S. Gharibzadehh, V. Ziaeee, N. Rezaeia,f,g,

Corresponding author

rezaei_nima@tums.ac.ir

Corresponding author.

a Research Center for Immunodeficiencies, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran

b Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Tehran, Iran

c Molecular Immunology Research Center, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran

d Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Vienna, Austria

e Division of Pediatric Rheumatology, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran

f Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

g Network of Immunity in Infection, Malignancy and Autoimmunity (NIIMA), Universal Scientific Education and Research Network (USERN), Stockholm, Sweden

h Department of Epidemiology and Biostatistics, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Tehran, Iran

Read

1853

Times
was read the article

553

Total PDF

1300

Total HTML

Share statistics

 array:23 [
  "pii" => "S0301054620300811"
  "issn" => "03010546"
  "doi" => "10.1016/j.aller.2020.03.014"
  "estado" => "S300"
  "fechaPublicacion" => "2020-07-01"
  "aid" => "1159"
  "copyright" => "SEICAP"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2020;48:332-8"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0301054619300424"
    "issn" => "03010546"
    "doi" => "10.1016/j.aller.2019.02.003"
    "estado" => "S300"
    "fechaPublicacion" => "2020-07-01"
    "aid" => "1040"
    "copyright" => "SEICAP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2020;48:339-47"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 6
      "PDF" => 6
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Serum soluble Fas ligand levels and peripheral blood lymphocyte subsets in patients with drug-induced maculopapular rashes&#44; dress&#44; and viral exanthemas"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "339"
          "paginaFinal" => "347"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "M&#46; Yazicioglu, P&#46; Gokmirza Ozdemir, B&#46; Turgut, N&#46; Sut"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "M&#46;"
              "apellidos" => "Yazicioglu"
            ]
            1 => array:2 [
              "nombre" => "P&#46;"
              "apellidos" => "Gokmirza Ozdemir"
            ]
            2 => array:2 [
              "nombre" => "B&#46;"
              "apellidos" => "Turgut"
            ]
            3 => array:2 [
              "nombre" => "N&#46;"
              "apellidos" => "Sut"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054619300424?idApp=UINPBA00004N"
    "url" => "/03010546/0000004800000004/v2_202012180835/S0301054619300424/v2_202012180835/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0301054620300574"
    "issn" => "03010546"
    "doi" => "10.1016/j.aller.2020.03.002"
    "estado" => "S300"
    "fechaPublicacion" => "2020-07-01"
    "aid" => "1136"
    "copyright" => "SEICAP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Allergol  Immunopathol &#40;Madr&#41;. 2020;48:323-31"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Atopy patch test in children with cow&#39;s milk and hen&#39;s egg allergy&#58; Do clinical symptoms matter&#63;"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "323"
          "paginaFinal" => "331"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "S&#46; Sirin Kose, S&#46; Asilsoy, D&#46; Tezcan, G&#46; Atakul, S&#46; Al, O&#46; Atay, O&#46; Kangalli Boyacioglu, N&#46; Uzuner, O&#46; Anal, O&#46; Karaman"
          "autores" => array:10 [
            0 => array:2 [
              "nombre" => "S&#46;"
              "apellidos" => "Sirin Kose"
            ]
            1 => array:2 [
              "nombre" => "S&#46;"
              "apellidos" => "Asilsoy"
            ]
            2 => array:2 [
              "nombre" => "D&#46;"
              "apellidos" => "Tezcan"
            ]
            3 => array:2 [
              "nombre" => "G&#46;"
              "apellidos" => "Atakul"
            ]
            4 => array:2 [
              "nombre" => "S&#46;"
              "apellidos" => "Al"
            ]
            5 => array:2 [
              "nombre" => "O&#46;"
              "apellidos" => "Atay"
            ]
            6 => array:2 [
              "nombre" => "O&#46;"
              "apellidos" => "Kangalli Boyacioglu"
            ]
            7 => array:2 [
              "nombre" => "N&#46;"
              "apellidos" => "Uzuner"
            ]
            8 => array:2 [
              "nombre" => "O&#46;"
              "apellidos" => "Anal"
            ]
            9 => array:2 [
              "nombre" => "O&#46;"
              "apellidos" => "Karaman"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054620300574?idApp=UINPBA00004N"
    "url" => "/03010546/0000004800000004/v2_202012180835/S0301054620300574/v2_202012180835/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "The status of <span class="elsevierStyleItalic">FOXP3</span> gene methylation in pediatric systemic lupus erythematosus"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "332"
        "paginaFinal" => "338"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "S&#46; Hanaei, G&#46; Sanati, S&#46; Zoghi, S&#46; Gharibzadeh, V&#46; Ziaee, N&#46; Rezaei"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "S&#46;"
            "apellidos" => "Hanaei"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "G&#46;"
            "apellidos" => "Sanati"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "S&#46;"
            "apellidos" => "Zoghi"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "S&#46;"
            "apellidos" => "Gharibzadeh"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">h</span>"
                "identificador" => "aff0040"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "V&#46;"
            "apellidos" => "Ziaee"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "N&#46;"
            "apellidos" => "Rezaei"
            "email" => array:1 [
              0 => "rezaei_nima@tums.ac.ir"
            ]
            "referencia" => array:4 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
              3 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:8 [
          0 => array:3 [
            "entidad" => "Research Center for Immunodeficiencies&#44; Children&#39;s Medical Center&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Network of Immunity in Infection&#44; Malignancy and Autoimmunity &#40;NIIMA&#41;&#44; Universal Scientific Education and Research Network &#40;USERN&#41;&#44; Tehran&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Molecular Immunology Research Center&#44; Children&#39;s Medical Center&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Network of Immunity in Infection&#44; Malignancy and Autoimmunity &#40;NIIMA&#41;&#44; Universal Scientific Education and Research Network &#40;USERN&#41;&#44; Vienna&#44; Austria"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Division of Pediatric Rheumatology&#44; Pediatrics Center of Excellence&#44; Children&#39;s Medical Center&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Department of Immunology&#44; School of Medicine&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Network of Immunity in Infection&#44; Malignancy and Autoimmunity &#40;NIIMA&#41;&#44; Universal Scientific Education and Research Network &#40;USERN&#41;&#44; Stockholm&#44; Sweden"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
          7 => array:3 [
            "entidad" => "Department of Epidemiology and Biostatistics&#44; Research Centre for Emerging and Reemerging Infectious Diseases&#44; Pasteur Institute of Iran&#44; Tehran&#44; Iran"
            "etiqueta" => "h"
            "identificador" => "aff0040"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1730
            "Ancho" => 2177
            "Tamanyo" => 114908
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Comparison of changes in CpG island methylation status at the FOXP3 gene promoter region in peripheral blood samples of patients with pediatric SLE and healthy control&#46; Error bars mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD &#40;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Background</span><p id="par0005" class="elsevierStylePara elsevierViewall">Considered as a multi-organ auto-immune disease&#44; systemic lupus erythematosus &#40;SLE&#41; affects several body organs such as kidney&#44; joints&#44; lung&#44; nervous system and skin through the production of auto-antibodies against self-antigens&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Although not clearly understood&#44; loss of tolerance to self-antigens could possibly play a causative role in the pathophysiology of SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> The causative risk factors for SLE could be categorized as genetic and environmental factors in general&#46; While the genes encoding human leukocyte antigen &#40;HLA&#41;&#44; cytokines&#44; cell surface antigens and some other genes consistute the genetic arm of SLE risk factors&#44; sex hormones&#44; viral infections&#44; UV radiation&#44; and some medications play causative roles as environmental risk factors&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Considering the undeniable role of immunity in the pathogenesis of SLE&#44; both B cell and T cell-related immunities actively participate in autoimmunity to self-antigens&#44; leading to systemic organ damage in SLE&#46; As the role of CD4&#43; T cells in the regulation of B-cell function and production of antibodies&#44; any dysregulation in the process could possibly cause autoimmunity&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> The Forkhead Box P3 &#40;<span class="elsevierStyleItalic">FOXP3</span>&#41; gene is a member of fork-winged helix family of transcription factors with the crucial role in normal maturation and activity of CD4&#43;&#47;CD25&#43; regulatory T cells &#40;Treg&#41;&#44; which are responsible for maintaining tolerance against self-antigens in the body&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> The animal studies have shown different expression levels of <span class="elsevierStyleItalic">FOXP3</span> gene in different immune cells such as regulatory T cells&#44; CD4&#43;&#47;CD25&#8722; T cells&#44; or CD4-&#47;CD8&#43; T cells&#44; which were closely associated with the function of these cells in production of immune-related molecules&#44; inhibition of autoimmunity and inflammation&#44; or intercellular contacts&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> The three conserved noncoding DNA sequences in <span class="elsevierStyleItalic">FOXP3</span> gene participate in the FOXP3 expression pattern&#44; which is important in Treg production&#44; division&#44; and differentiation in immune tissues&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Therefore&#44; the methylation status of <span class="elsevierStyleItalic">FOXP3</span> gene&#44; especially in the conserved noncoding sequences would influence the phenotype of natural CD4&#43; Tregs&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Accordingly&#44; as the undeniable role of Tregs in autoimmunity and the role of <span class="elsevierStyleItalic">FOXP3</span> gene in phenotype and function of Tregs&#44; the structural and epigenetic changes in this gene could play a role in the pathophysiology of autoimmune diseases such as SLE&#46; One of interesting study involved the evaluation of <span class="elsevierStyleItalic">FOXP3</span> gene methylation in this disease&#46; To our knowledge&#44; two separate studies&#44; in China and South Africa respectively&#44; demonstrated hypomethylation of this gene in SLE patients&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;7</span></a> On the other hand&#44; another investigation among SLE patients indicated that the methylation status of <span class="elsevierStyleItalic">FOXP3</span> gene was remarkably higher in active cases&#44; whilst inactive cases and healthy subjects had lower levels of DNA methylation in this gene&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Despite the rich investigations in elucidating the role of autoimmunity in SLE&#44; there is still a lack of evidence regarding the role of the <span class="elsevierStyleItalic">FOXP3</span> gene structure and function in the pathophysiology of this disease&#46; Therefore&#44; the current case-control study was designed to investigate and compare DNA methylation levels in the <span class="elsevierStyleItalic">FOXP3</span> promoter between children affected with SLE and healthy controls&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Study design</span><p id="par0025" class="elsevierStylePara elsevierViewall">Based on the STROBE guidelines for observational studies and in order to investigate the difference between DNA methylation of the <span class="elsevierStyleItalic">FOXP3</span> promoter in pediatric SLE and healthy controls&#44; this case-control study was designed&#46; The study was conducted in the Research Center for Immunodeficiencies &#40;RCID&#41;&#44; Children&#39;s Medical Center&#59; and was approved by the Ethics Committee of Tehran University of Medical Sciences &#40;TUMS&#41;&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Patient selection</span><p id="par0030" class="elsevierStylePara elsevierViewall">In the 18-month period of study&#44; pediatric patients who were referred to the Rheumatology Clinic of Children&#39;s Medical Center with confirmed diagnosis of pediatric SLE by pediatric rheumatologist were screened for eligibility criteria&#46; Patients under 18 years of age&#44; with no self-history or family history of immunodeficiency or autoimmunity diseases other than SLE were eligible for the study and included&#46; The patients who were either suspicious for SLE or had other concomitant diseases were excluded&#46; The control subjects included healthy subjects with no history of autoimmunity in them or their families&#44; who were not matched by age with the patients&#46; The parents or legal guardians of study subjects were requested to fill in the written informed consent form prior to recruitment and laboratory tests&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Blood sampling and DNA extraction</span><p id="par0035" class="elsevierStylePara elsevierViewall">In brief&#44; 5cc of peripheral blood from all study subjects was stored in &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C prior to DNA extraction&#46; The DNA from whole blood cells was then extracted using Phenol-Chloroform method as described before&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> The quality of the extracted DNA was evaluated through measurement of optical density and the 260&#47;280 ratio&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">DNA treatment and bisulfite conversion</span><p id="par0040" class="elsevierStylePara elsevierViewall">Prior to DNA methylation assessment&#44; the extracted genomic DNA was treated though the Bisulfite method using MethylEdge&#8482; Bisulfite Conversion System &#40;Promega&#44; Madison&#44; WI&#44; USA&#41; according to the instructions provided by the manufacturer and was stored at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C before PCR&#46; In brief&#44; in the sodium bisulfite treatment method&#44; the unmethylated cytosine residues would be converted to uracil&#44; which would be converted to thiamine following PCR amplification&#46; In this method&#44; the 5-methylcytosine &#40;5mC&#41; of genomic DNA would not be influenced&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">DNA methylation assessment using methyl specific PCR &#40;MSP&#41;</span><p id="par0045" class="elsevierStylePara elsevierViewall">The real-time quantitative multiplex methylation specific PCR &#40;QM-MSP&#41; method was used to assess the <span class="elsevierStyleItalic">FOXP3</span> promoter methylation<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> in the bisulfite-treated genomic DNA&#46; With considerable sensitivity and specificity&#44; the MethySYBR procedure includes two steps of PCR reactions in general&#58;<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">1&#41;</span><p id="par0050" class="elsevierStylePara elsevierViewall">The multiplex step&#58; in this pre-amplification step&#44; paired external primers &#40;external forward primer and external reverse primer&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; were designed in order to amplify a distinction containing different target alleles&#46; Accordingly&#44; each reaction-well contained a total amount of 25<span class="elsevierStyleHsp" style=""></span>&#956;l mixture including 1<span class="elsevierStyleHsp" style=""></span>&#956;l of converted DNA and other reaction materials&#46; This sequence of reactions included one cycle of 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#44; and then 30 cycles of 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; 56<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; and 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#46; The final cycle of this step was 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">2&#41;</span><p id="par0055" class="elsevierStylePara elsevierViewall">In the second step&#44; the products of the previous step were used to quantify specific methylated targets&#46; In this phase&#44; nested paired primers&#44; independent and specific for methylation&#44; were used&#46; The sequences of nested methylation-specific primers &#40;forward and reverse&#41; are mentioned in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; The UCSC database was used to determine the methylation status of CpG islands in the <span class="elsevierStyleItalic">FOXP3</span> promoter&#59; and the MethBlast tool was used for primer blasting as well&#46; Each reaction-well contained a total amount of 10<span class="elsevierStyleHsp" style=""></span>&#956;l mixture including 5<span class="elsevierStyleHsp" style=""></span>&#956;l SYBR&#174; Green Master Mix&#44; 0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;l Forward Primer&#44; 0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;l Reverse Primer&#44; 3&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;l DDW&#44; and 1<span class="elsevierStyleHsp" style=""></span>&#956;l bisulfite-treated DNA&#46; These reactions started with one cycle of 95<span class="elsevierStyleHsp" style=""></span>&#176;C for one minute&#44; and then 30 cycles of 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; 60<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>min&#44; 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; and the final extension of 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#46;</p></li></ul></p><p id="par0060" class="elsevierStylePara elsevierViewall">In order to determine the methylation percentage of DNA samples&#44; a positive MSP control was used in each run which was 100&#37; methylated&#46; For this purpose&#44; fully converted methylated human plasmid DNA was used and therefore&#44; no negative untreated controls were used in this study&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">As explained elsewhere&#44; the unmethylated DNA was calculated though the following formulae&#58;<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11&#44;12</span></a><elsevierMultimedia ident="eq0005"></elsevierMultimedia><elsevierMultimedia ident="eq0010"></elsevierMultimedia><elsevierMultimedia ident="eq0015"></elsevierMultimedia>where MSP&#58; methyl specific PCR&#59; BSP&#58; bisulfite specific PCR&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">Meanwhile&#44; the Demethylation Index &#40;DI&#41; was also calculated as follows&#44; in order to determine the efficiency of the PCR&#58;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a><elsevierMultimedia ident="eq0020"></elsevierMultimedia></p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Statistical analysis</span><p id="par0075" class="elsevierStylePara elsevierViewall">The PASS 11 software &#40;version 11&#46;0&#46;4 with serial number 2365456856&#41; was used to calculate the sample size and study power&#46; Group sample sizes of 25 achieve 91&#37; power to detect equivalence when the margin of equivalence is from &#8722;1&#46;0 to 1&#46;0 and the actual mean difference is 0&#46;0&#46; The significance level &#40;alpha&#41; is 0&#46;050 using two one-sided Mann&#8211;Whitney tests&#46; The amount of unmethylated DNA in each group was reported as median<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>RIQ&#59; and the difference between groups was assessed using the Mann&#8211;Whitney test&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><p id="par0080" class="elsevierStylePara elsevierViewall">Twenty-five children with SLE and 25 healthy controls were recruited in this study&#46; After DNA extraction and treatment&#44; the data from 24 patients and 25 controls were analyzable &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">In the quantitative PCR method&#44; the melting curves of target amplicons were analyzed in order to indicate the methylation status of the <span class="elsevierStyleItalic">FOXP3</span> promoter &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0090" class="elsevierStylePara elsevierViewall">The methylation status of the <span class="elsevierStyleItalic">FOXP3</span> promoter in patients and controls are shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#46; Promoter methylation of the <span class="elsevierStyleItalic">FOXP3</span> gene was significantly higher in SLE patients&#59; as the median of unmethylated DNA was 0&#46;57<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;43 in the patients&#44; while it was 0&#46;97<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;83 in controls &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0095" class="elsevierStylePara elsevierViewall">Moreover&#44; the DI in the patient group was 0&#46;007<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;003&#44; which was significantly lower than the controls &#40;0&#46;014<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;013&#59; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Discussion</span><p id="par0100" class="elsevierStylePara elsevierViewall">In order to elucidate the association between promoter methylation of the <span class="elsevierStyleItalic">FOXP3</span> gene and pediatric SLE&#44; the current investigation was performed to compare the methylation difference between pediatric SLE patients and controls through the Quantitative MSP method&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">The results of this investigation indicated significant difference between methylation status of the <span class="elsevierStyleItalic">FOXP3</span> promoter and SLE as the median of unmethylated DNA was 0&#46;57<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;43 in the patients&#44; while it was 0&#46;97<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;83 in controls &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41;&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">As a member of the fork-winged helix family &#40;Forkhead&#41;&#44; <span class="elsevierStyleItalic">FOXP3</span> is located at chromosome Xp11&#46;23 and plays an important role in appropriate activity of Tregs&#44; which are important arms in preventing autoimmune reactions&#46; The dysfunction in CD4&#43;&#47;CD25&#43; T cells&#44; as well as low expression and mutation of the <span class="elsevierStyleItalic">FOXP3</span> gene were found in association with some autoimmune diseases such as autoimmune hepatitis &#40;AIH&#41;&#44; autoimmune thyroid diseases&#44; SLE&#44; rheumatoid arthritis &#40;RA&#41;&#44; particular immunodeficiencies&#44; autoimmune diabetes&#44; inflammatory bowel disease &#40;IBD&#41; and many other diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a></p><p id="par0115" class="elsevierStylePara elsevierViewall">Several studies investigated the association between this gene and SLE&#46; According to one of these studies&#44; the expression level of two FOXP3 isoforms would be dramatically decreased in patients with SLE and RA&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> On the other hand&#44; another study indicated a significant increase in the FOXP3 presentation level in SLE&#44; with a <span class="elsevierStyleItalic">P</span>-value of 0&#46;012&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> Moreover&#44; the expression of this gene was found associated with renal involvement in SLE and also expression level of anti-dsDNA in these patients as well&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Playing an important role in the regulation of immune tolerance&#44; the FOXP3&#43;&#47;Helios&#43; types of regulatory T cells were remarkably more frequent in the blood samples of patients with active SLE &#40;11&#37;&#41; when compared to control subjects &#40;5&#37;&#41; &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46; Importantly&#44; this increase was specifically found in SLE patients and this change was not seen in other autoimmune diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">In addition to an alteration in the expression level of FOXP3 in SLE&#44; different mutations and single nucleotide polymorphisms &#40;SNPs&#41; of this gene were found in association with this disease as well&#44; such as a significant association of rs12843496 of this gene and SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a></p><p id="par0125" class="elsevierStylePara elsevierViewall">Similar to the results of association between SLE and expression or mutation of <span class="elsevierStyleItalic">FOXP3</span>&#44; methylation alteration of this gene was also closely associated with SLE and some other autoimmune diseases&#46; Accordingly&#44; in one of these studies&#44; the <span class="elsevierStyleItalic">FOXP3</span> gene was hypomethylated in SLE patients&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> As investigated among black ethnicity of South Africans&#44; there was a remarkable difference between global methylation in SLE patients and healthy individuals&#46; According to that study&#44; the global methylation was 22&#46;2<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>5&#37; in patients while it was 33&#46;9<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#37; in healthy people&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> However&#44; the results of that study were not in concordance with the results of our study&#44; as <span class="elsevierStyleItalic">FOXP3</span> gene was hypermethylated in the aforementioned patient population&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> However&#44; in another study the mean melting temperature was considered as a criterion for methylation&#44; with a higher mean melting temperature showing higher methylation level&#46; In this study&#44; patients with active SLE disease had a significantly higher methylation level in the <span class="elsevierStyleItalic">FOXP3</span> gene when compared to both inactive SLE patients and also healthy subjects &#40;79&#46;00<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;28 vs&#46; 78&#46;49<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;29 vs&#46; 78&#46;44<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;25 respectively&#59; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> This result was similar to the findings of the current study&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Moreover&#44; and as primarily described by Akirav et al&#46;&#44; the demethylation index mainly compares the relative frequency of unmethylated DNA in cells&#44; which is calculated through subtracting the methylation-specific from bisulfite-specific PCRs&#46;<a class="elsevierStyleCrossRefs" href="#bib0060"><span class="elsevierStyleSup">12&#44;13</span></a> Accordingly&#44; the difference in the demethylation index between SLE patients and controls was statistically significant&#44; showing lower levels in patients than in controls &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41;&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Importantly&#44; the promoter of this gene was demethylated in some other diseases such as IPEX-like syndrome&#44; AIH and RA&#44; resulting in a higher gene expression of <span class="elsevierStyleItalic">FOXP3</span>&#46;<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">20&#8211;23</span></a> On the other hand&#44; in some other diseases including systemic sclerosis and Sjogren&#44; the promoter of this gene was hypermethylated&#46;<a class="elsevierStyleCrossRefs" href="#bib0120"><span class="elsevierStyleSup">24&#44;25</span></a></p><p id="par0140" class="elsevierStylePara elsevierViewall">In addition to <span class="elsevierStyleItalic">FOXP3</span>&#44; the methylation alterations of some other genes were also associated with SLE&#46; While demethylation of <span class="elsevierStyleItalic">TNFSF7</span> was associated with SLE&#44; hypomethylation of some other genes was significantly associated with SLE clinical presentations&#46; Accordingly&#44; hypomethylation of <span class="elsevierStyleItalic">MIR886</span> and <span class="elsevierStyleItalic">TRIM69</span> genes were associated with malar rashes&#44; while hypomethylation of <span class="elsevierStyleItalic">PSMB8</span>&#44; <span class="elsevierStyleItalic">RHOJ</span>&#44; and <span class="elsevierStyleItalic">TAP1</span> were associated with discoid rashes in SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> On the other hand&#44; hypermethylation of some genes such as <span class="elsevierStyleItalic">RUNX3</span>&#44; <span class="elsevierStyleItalic">MHC2TA</span>&#44; <span class="elsevierStyleItalic">RFC1</span>&#44; <span class="elsevierStyleItalic">MBD2</span>&#44; <span class="elsevierStyleItalic">DNMT1</span>&#44; and <span class="elsevierStyleItalic">GR</span> were found correlated to disease as well&#46;<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">27&#8211;35</span></a></p><p id="par0145" class="elsevierStylePara elsevierViewall">Although the current study provided valuable results in elucidating the pathophysiology of SLE&#44; there were several limitations which shall be considered&#46; First of all was the small sample size&#44; therefore&#44; epidemiologic studies with large sample sizes could be conducted in the future&#44; in order to reduce the possible random error and increase the power&#46; As the clinical and demographic data were not available in this study&#44; several useful analyses measuring the difference between active and inactive phases of disease were not applicable&#46; Therefore&#44; a new prospective study&#44; considering patients&#8217; characteristics is recommended&#46; Meanwhile&#44; the co-effect of other etiologic factors including other genes&#44; age&#44; sex&#44; and environmental factors could be considered as well&#46; As the crucial role of DNA methylation and epigenetics in the expression level and therefore&#44; function of genes&#44; future studies investigating both methylation status and expression level of FOXP3 could more precisely elucidate the role of <span class="elsevierStyleItalic">FOXP3</span> methylation in the pathophysiology of SLE&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">In conclusion&#44; promoter methylation of the <span class="elsevierStyleItalic">FOXP3</span> gene was significantly higher in pediatric patients with SLE when compared to healthy controls&#46; Therefore&#44; the possible lower expression level of the <span class="elsevierStyleItalic">FOXP3</span> gene resulted from this hypermethylation could be one of the causes of increased immune response in the pathophysiology of this disease&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Conflict of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">The authors have no conflict of interest to declare&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:3 [
          "identificador" => "xres1437434"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Method"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1312166"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Background"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study design"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Patient selection"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Blood sampling and DNA extraction"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "DNA treatment and bisulfite conversion"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "DNA methylation assessment using methyl specific PCR &#40;MSP&#41;"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "sec0045"
          "titulo" => "Results"
        ]
        5 => array:2 [
          "identificador" => "sec0050"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Conflict of interest"
        ]
        7 => array:2 [
          "identificador" => "xack501512"
          "titulo" => "Acknowledgment"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2018-06-07"
    "fechaAceptado" => "2020-03-17"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1312166"
          "palabras" => array:5 [
            0 => "Systemic lupus erythematosus"
            1 => "FOXP3"
            2 => "Epigenetics"
            3 => "Methylation"
            4 => "Autoimmunity"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Systemic lupus erythematosus &#40;SLE&#41; is an autoimmune disease caused by interaction of genetic&#44; epigenetic&#44; and environmental factors&#46; One of the important epigenetic factors in SLE would be methylation of immune-related genes&#44; such as <span class="elsevierStyleItalic">FOXP3</span>&#44; which plays a role in activating the regulation and also the function of T cells&#46; To date&#44; the relationship between levels of serum bio-markers and the susceptibility to lupus in children has not been well-understood&#46; In this study&#44; the involvement of etiologic factors&#44; such as methylation of <span class="elsevierStyleItalic">FOXP3</span> gene&#44; was investigated in children with SLE&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Method</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Twenty-four female children with SLE and 25 female healthy subjects without any history of autoimmune and inflammatory diseases were included in this study&#46; Blood samples were obtained and DNA was extracted from the blood cells&#46; The bisulphite method was used to convert the DNA using the MethylEdge&#8482; Bisulfite Conversion System Kit&#46; Then&#44; methylation of the gene was investigated using Real Time methylation specific PCR&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The <span class="elsevierStyleItalic">FOXP3</span> DNA methylation in patients and healthy subjects was significantly different&#46; While the median unmethylated DNA in patients was 0&#46;57<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;43&#44; it was 0&#46;97<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;83 in healthy subjects &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41;&#46; The Demethylation Index in patients was 0&#46;007<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;003&#44; significantly lower than in controls &#40;0&#46;014<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;013&#59; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The <span class="elsevierStyleItalic">FOXP3</span> gene methylation in children with SLE was significantly higher than healthy subjects&#44; which could possibly affect the level of gene expression&#46; Therefore&#44; one of the causes of increased immune response in SLE can be the lower expression of <span class="elsevierStyleItalic">FOXP3</span> by hypermethylation of this gene&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Method"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusions"
          ]
        ]
      ]
    ]
    "multimedia" => array:9 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1598
            "Ancho" => 2173
            "Tamanyo" => 167321
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">The fluorescent melting peaks for the promoter CpG island of the FOXP3 gene&#46; DNA melt curve analysis of changes in CpG methylation status was analyzed based on amplification of unmethylated bisulfite-treated DNA from peripheral blood of pediatric SLE cases&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1730
            "Ancho" => 2177
            "Tamanyo" => 114908
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Comparison of changes in CpG island methylation status at the FOXP3 gene promoter region in peripheral blood samples of patients with pediatric SLE and healthy control&#46; Error bars mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD &#40;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">External forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTAGGGAGGTGACGAGGTAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">External reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACAAAATAACCCCGAACAACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nested methylation-specific forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGAGATTTTAGGTTTTCGGAATATTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nested methylation-specific reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCGAAACTACCTAAACGCCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2472555.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">FOXP3 primer sequences for methylation assessment&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8211;16 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SLEDAI score<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#8211;29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2472553.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">SLEDAI &#40;SLE Disease Activity Index&#41;&#44; done in only 15 cases</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">General description of patients with pediatric systemic lupus erythematosus&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Group &#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>49&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean unmethylated DNA<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean DI<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SLE &#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;57<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;43&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;006696<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;003151&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Control &#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;97<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;013955<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;013492&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">P</span>-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;012&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;012&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2472554.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Comparison of median unmethylated DNA and mean DI in SLE and controls&#46;</p>"
        ]
      ]
      5 => array:5 [
        "identificador" => "eq0005"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "&#916;&#916;Cq&#61;&#916;Cq&#8239;sample&#8722;&#916;Cq&#8239;plasmid&#44;"
          "Fichero" => "STRIPIN_si1.jpeg"
          "Tamanyo" => 1879
          "Alto" => 15
          "Ancho" => 217
        ]
      ]
      6 => array:5 [
        "identificador" => "eq0010"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "&#916;Cq&#8239;sample&#61;Cq&#8239;MSP&#8722;Cq&#8239;BSP&#44;"
          "Fichero" => "STRIPIN_si2.jpeg"
          "Tamanyo" => 1435
          "Alto" => 15
          "Ancho" => 166
        ]
      ]
      7 => array:5 [
        "identificador" => "eq0015"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "&#916;Cq&#8239;plasmid&#61;Cq&#8239;MSP&#8722;Cq&#8239;BSP&#44;"
          "Fichero" => "STRIPIN_si3.jpeg"
          "Tamanyo" => 1484
          "Alto" => 15
          "Ancho" => 169
        ]
      ]
      8 => array:5 [
        "identificador" => "eq0020"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "DI&#61;2Cq&#8239;BSP-Cq&#8239;MSP&#46;"
          "Fichero" => "STRIPIN_si4.jpeg"
          "Tamanyo" => 844
          "Alto" => 13
          "Ancho" => 107
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:35 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Systemic lupus erythematosus&#58; epidemiology&#44; pathophysiology&#44; manifestations&#44; and management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46; Fortuna"
                            1 => "M&#46;T&#46; Brennan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Dental Clin"
                        "fecha" => "2013"
                        "volumen" => "57"
                        "paginaInicial" => "631"
                        "paginaFinal" => "655"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biomarkers for systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46;M&#46; Ahearn"
                            1 => "C&#46;-C&#46; Liu"
                            2 => "A&#46;H&#46; Kao"
                            3 => "S&#46; Manzi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.trsl.2012.01.021"
                      "Revista" => array:6 [
                        "tituloSerie" => "Transl Res"
                        "fecha" => "2012"
                        "volumen" => "159"
                        "paginaInicial" => "326"
                        "paginaFinal" => "342"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22424435"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anti tumour necrosis-&#945; therapy increases the number of FOXP3&#43; regulatory T cells in children affected by Crohn&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "I&#46; Ricciardelli"
                            1 => "K&#46;J&#46; Lindley"
                            2 => "M&#46; Londei"
                            3 => "S&#46; Quaratino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2567.2008.02839.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immunology"
                        "fecha" => "2008"
                        "volumen" => "125"
                        "paginaInicial" => "178"
                        "paginaFinal" => "183"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18422560"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Control of regulatory T cell development by the transcription factor Foxp3"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46; Hori"
                            1 => "T&#46; Nomura"
                            2 => "S&#46; Sakaguchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.1079490"
                      "Revista" => array:6 [
                        "tituloSerie" => "Science"
                        "fecha" => "2003"
                        "volumen" => "299"
                        "paginaInicial" => "1057"
                        "paginaFinal" => "1061"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12522256"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46; Zheng"
                            1 => "S&#46; Josefowicz"
                            2 => "A&#46; Chaudhry"
                            3 => "X&#46;P&#46; Peng"
                            4 => "K Forbush"
                            5 => "A&#46;Y&#46; Rudensky"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nature08750"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2010"
                        "volumen" => "463"
                        "paginaInicial" => "808"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20072126"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide DNA methylation analysis identifies hypomethylated genes regulated by FOXP3 in human regulatory T cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Zhang"
                            1 => "J&#46; Maksimovic"
                            2 => "G&#46; Naselli"
                            3 => "J&#46; Qian"
                            4 => "M&#46; Chopin"
                            5 => "M&#46;E&#46; Blewitt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Blood"
                        "fecha" => "2013"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7949091"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA methylation similarities in genes of black South Africans with systemic lupus erythematosus and systemic sclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Matatiele"
                            1 => "M&#46; Tikly"
                            2 => "G&#46; Tarr"
                            3 => "M&#46; Gulumian"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "J Biomed Sci"
                        "fecha" => "2015"
                        "volumen" => "22"
                        "paginaInicial" => "34"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Peripheral whole blood FOXP3 TSDR methylation&#58; a potential marker in severity assessment of autoimmune diseases and chronic infections"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "O&#46; Ngalamika"
                            1 => "G&#46; Liang"
                            2 => "M&#46; Zhao"
                            3 => "X&#46; Yu"
                            4 => "Y&#46; Yang"
                            5 => "H&#46; Yin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/08820139.2014.938165"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immunol Invest"
                        "fecha" => "2015"
                        "volumen" => "44"
                        "paginaInicial" => "126"
                        "paginaFinal" => "136"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25083793"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An efficient and simple method of DNA extraction from whole blood and cell lines to identify infectious agents"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "V&#46;N&#46; Loparev"
                            1 => "M&#46;A&#46; Cartas"
                            2 => "C&#46;E&#46; Monken"
                            3 => "A&#46; Velpandi"
                            4 => "A&#46; Srinivasan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/0166-0934(91)90126-k"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Virol Methods"
                        "fecha" => "1991 Sep"
                        "volumen" => "34"
                        "paginaInicial" => "105"
                        "paginaFinal" => "112"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1955487"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MethySYBR&#44; a novel quantitative PCR assay for the dual analysis of DNA methylation and CpG methylation density"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;-K&#46; Lo"
                            1 => "H&#46; Watanabe"
                            2 => "P&#46;-C&#46; Cheng"
                            3 => "W&#46;W&#46; Teo"
                            4 => "X&#46; Liang"
                            5 => "P&#46; Argani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2353/jmoldx.2009.080126"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Mol Diagn"
                        "fecha" => "2009"
                        "volumen" => "11"
                        "paginaInicial" => "400"
                        "paginaFinal" => "414"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19710398"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analyzing real-time PCR data by the comparative CT method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T&#46;D&#46; Schmittgen"
                            1 => "K&#46;J&#46; Livak"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nprot.2008.73"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Protoc"
                        "fecha" => "2008"
                        "volumen" => "3"
                        "paginaInicial" => "1101"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18546601"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Development of a quantitative methylation-specific polymerase chain reaction method for monitoring beta cell death in type 1 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;I&#46; Husseiny"
                            1 => "A&#46; Kuroda"
                            2 => "A&#46;N&#46; Kaye"
                            3 => "I&#46; Nair"
                            4 => "F&#46; Kandeel"
                            5 => "K&#46; Ferreri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0047942"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS ONE"
                        "fecha" => "2012"
                        "volumen" => "7"
                        "paginaInicial" => "e47942"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23144715"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of &#946; cell death in diabetes using differentially methylated circulating DNA"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;M&#46; Akirav"
                            1 => "J&#46; Lebastchi"
                            2 => "E&#46;M&#46; Galvan"
                            3 => "O&#46; Henegariu"
                            4 => "M&#46; Akirav"
                            5 => "V&#46; Ablamunits"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1111008108"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2011"
                        "volumen" => "108"
                        "paginaInicial" => "19018"
                        "paginaFinal" => "19023"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22074781"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Deficient CD4&#43; CD25&#43; T regulatory cell function in patients with abdominal aortic aneurysms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Yin"
                            1 => "J&#46; Zhang"
                            2 => "Y&#46; Wang"
                            3 => "S&#46; Wang"
                            4 => "D&#46; Bockler"
                            5 => "Z&#46; Duan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/ATVBAHA.109.200303"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arterioscler Thromb Vasc Biol"
                        "fecha" => "2010"
                        "volumen" => "30"
                        "paginaInicial" => "1825"
                        "paginaFinal" => "1831"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20448211"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Decreased mRNA expression of two FOXP3 isoforms in peripheral blood mononuclear cells from patients with rheumatoid arthritis and systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "K&#46; Suzuki"
                            1 => "Y&#46; Setoyama"
                            2 => "K&#46; Yoshimoto"
                            3 => "K&#46; Tsuzaka"
                            4 => "T&#46; Abe"
                            5 => "T&#46; Takeuchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1177/03946320110240S402"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Immunopathol Pharmacol"
                        "fecha" => "2011"
                        "volumen" => "24"
                        "paginaInicial" => "7"
                        "paginaFinal" => "14"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22032779"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Direct role of antibody-secreting B cells in the severity of chronic hepatitis B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;K&#46; Zgair"
                            1 => "J&#46;A&#46; Ghafil"
                            2 => "R&#46;H&#46; Al-Sayidi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jmv.24067"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Med Virol"
                        "fecha" => "2015"
                        "volumen" => "87"
                        "paginaInicial" => "407"
                        "paginaFinal" => "416"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25163843"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of single-nucleotide polymorphisms in FoxP 3 gene with systemic lupus erythematosus susceptibility&#58; a case&#8211;control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Lin"
                            1 => "J&#46; Lee"
                            2 => "A&#46;S&#46; Wu"
                            3 => "C&#46;Y&#46; Tsai"
                            4 => "H&#46;H&#46; Yu"
                            5 => "L&#46;C&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1177/0961203310382428"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lupus"
                        "fecha" => "2011"
                        "volumen" => "20"
                        "paginaInicial" => "137"
                        "paginaFinal" => "143"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21078762"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Foxp3&#43; Helios&#43; regulatory T cells are expanded in active systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Alexander"
                            1 => "A&#46; Sattler"
                            2 => "L&#46; Templin"
                            3 => "S&#46; Kohler"
                            4 => "C&#46; Gro&#223;"
                            5 => "A&#46; Meisel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/annrheumdis-2012-202216"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Rheum Dis"
                        "fecha" => "2013"
                        "volumen" => "72"
                        "paginaInicial" => "1549"
                        "paginaFinal" => "1558"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23264341"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "FOXP3 gene polymorphisms in preeclampsia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46;D&#46; Metz"
                            1 => "L&#46;M&#46; Nelson"
                            2 => "G&#46;J&#46; Stoddard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Am J Obstet Gynecol"
                        "fecha" => "2012"
                        "volumen" => "206"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Demethylation analysis of the FOXP3 locus shows quantitative defects of regulatory T cells in IPEX-like syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Barzaghi"
                            1 => "L&#46; Passerini"
                            2 => "E&#46; Gambineri"
                            3 => "S&#46;C&#46; Mannurita"
                            4 => "T&#46; Cornu"
                            5 => "E&#46;S&#46; Kang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2011.12.009"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Autoimmun"
                        "fecha" => "2012"
                        "volumen" => "38"
                        "paginaInicial" => "49"
                        "paginaFinal" => "58"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22264504"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Regulatory T cells and autoimmune hepatitis&#58; defective cells or a hostile environment&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46;H&#46; Oo"
                            1 => "D&#46;H&#46; Adams"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2012.04.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2012"
                        "volumen" => "57"
                        "paginaInicial" => "6"
                        "paginaFinal" => "8"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22522382"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "FOXP3&#43; regulatory T cells in autoimmune hepatitis are fully functional and not reduced in frequency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Peiseler"
                            1 => "M&#46; Sebode"
                            2 => "B&#46; Franke"
                            3 => "F&#46; Wortmann"
                            4 => "D&#46; Schwinge"
                            5 => "A&#46; Quaas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2012.02.029"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2012"
                        "volumen" => "57"
                        "paginaInicial" => "125"
                        "paginaFinal" => "132"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22425700"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic dynamics in immunity and autoimmunity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Zhao"
                            1 => "Z&#46; Wang"
                            2 => "S&#46; Yung"
                            3 => "Q&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biocel.2015.05.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Biochem Cell Biol"
                        "fecha" => "2015"
                        "volumen" => "67"
                        "paginaInicial" => "65"
                        "paginaFinal" => "74"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26026281"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA hypermethylation of the forkhead box protein 3 &#40;FOXP3&#41; promoter in CD4&#43; T cells of patients with systemic sclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Wang"
                            1 => "Q&#46; Wang"
                            2 => "X&#46; Sun"
                            3 => "R&#46;Z&#46; Liu"
                            4 => "Y&#46; Shu"
                            5 => "T&#46; Kanekura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/bjd.12913"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Dermatol"
                        "fecha" => "2014"
                        "volumen" => "171"
                        "paginaInicial" => "39"
                        "paginaFinal" => "47"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24641670"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA hypermethylation leads to lower FOXP3 expression in CD4&#43; T cells of patients with primary Sj&#246;gren&#39;s syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46; Yu"
                            1 => "G&#46; Liang"
                            2 => "H&#46; Yin"
                            3 => "O&#46; Ngalamika"
                            4 => "F&#46; Li"
                            5 => "M&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Immunol"
                        "fecha" => "2013"
                        "volumen" => "2"
                        "paginaInicial" => "254"
                        "paginaFinal" => "257"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA methylation patterns in naive CD4&#43; T cells identify epigenetic susceptibility loci for malar rash and discoid rash in systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46; Renauer"
                            1 => "P&#46; Coit"
                            2 => "M&#46;A&#46; Jeffries"
                            3 => "J&#46;T&#46; Merrill"
                            4 => "W&#46;J&#46; McCune"
                            5 => "K&#46; Maksimowicz-McKinnon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/lupus-2015-000101"
                      "Revista" => array:5 [
                        "tituloSerie" => "Lupus Sci Med"
                        "fecha" => "2015"
                        "volumen" => "2"
                        "paginaInicial" => "e000101"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26405558"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hypermethylation of glucocorticoid receptor gene promoter results in glucocorticoid receptor gene low expression in peripheral blood mononuclear cells of patients with systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Chen"
                            1 => "J&#46; Fan"
                            2 => "Q&#46; Shou"
                            3 => "L&#46; Zhang"
                            4 => "H&#46; Ma"
                            5 => "F&#46; Fan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00296-015-3266-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rheumatol Int"
                        "fecha" => "2015"
                        "volumen" => "35"
                        "paginaInicial" => "1335"
                        "paginaFinal" => "1342"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25899090"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide DNA methylation study suggests epigenetic accessibility and transcriptional poising of interferon-regulated genes in naive CD4&#43; T cells from lupus patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46; Coit"
                            1 => "M&#46; Jeffries"
                            2 => "N&#46; Altorok"
                            3 => "M&#46;G&#46; Dozmorov"
                            4 => "K&#46;A&#46; Koelsch"
                            5 => "J&#46;D&#46; Wren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2013.04.003"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Autoimmun"
                        "fecha" => "2013"
                        "volumen" => "43"
                        "paginaInicial" => "78"
                        "paginaFinal" => "84"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23623029"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA methylation modulates HRES1&#47;p28 expression in B cells from patients with lupus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Fali"
                            1 => "C&#46; Le Dantec"
                            2 => "Y&#46; Thabet"
                            3 => "S&#46; Jousse"
                            4 => "C&#46; Hanrotel"
                            5 => "P&#46; Youinou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/08916934.2013.826207"
                      "Revista" => array:6 [
                        "tituloSerie" => "Autoimmunity"
                        "fecha" => "2014"
                        "volumen" => "47"
                        "paginaInicial" => "265"
                        "paginaFinal" => "271"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24117194"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hypomethylation of long interspersed nucleotide element-1 in peripheral mononuclear cells of juvenile systemic lupus erythematosus patients in China"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46; Huang"
                            1 => "G&#46; Su"
                            2 => "Z&#46; Wang"
                            3 => "S&#46; Shangguan"
                            4 => "X&#46; Cui"
                            5 => "J&#46; Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/1756-185X.12239"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Rheum Dis"
                        "fecha" => "2014"
                        "volumen" => "17"
                        "paginaInicial" => "280"
                        "paginaFinal" => "290"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24330152"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A possible role of HMGB1 in DNA demethylation in CD4&#43;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Li"
                            1 => "C&#46; Huang"
                            2 => "M&#46; Zhao"
                            3 => "G&#46; Liang"
                            4 => "R&#46; Xiao"
                            5 => "S&#46; Yung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Clin Dev Immunol"
                        "fecha" => "2013"
                        "paginaInicial" => "2013"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The immunopathogenesis and immunopathology of systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "D&#46;S&#46; Pisetsky"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "2012"
                        "paginaInicial" => "13"
                        "paginaFinal" => "26"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Associations between aberrant DNA methylation and transcript levels of DNMT1 and MBD2 in CD4&#43; T cells from patients with systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46;H&#46; Qin"
                            1 => "X&#46;H&#46; Zhu"
                            2 => "J&#46; Liang"
                            3 => "Y&#46;S&#46; Yang"
                            4 => "S&#46;S Wang"
                            5 => "W&#46;M&#46; Shi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1440-0960.2012.00968.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Australas J Dermatol"
                        "fecha" => "2013"
                        "volumen" => "54"
                        "paginaInicial" => "90"
                        "paginaFinal" => "95"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23127209"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic modulation of RFC1&#44; MHC2TA and HLA-DR in systemic lupus erythematosus&#58; association with serological markers and six functional polymorphisms of one-carbon metabolic pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Rupasree"
                            1 => "S&#46;M&#46; Naushad"
                            2 => "L&#46; Rajasekhar"
                            3 => "V&#46;K&#46; Kutala"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.gene.2013.11.094"
                      "Revista" => array:6 [
                        "tituloSerie" => "Gene"
                        "fecha" => "2014"
                        "volumen" => "536"
                        "paginaInicial" => "45"
                        "paginaFinal" => "52"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24333266"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of associations between the patterns of global DNA hypomethylation and expression of DNA methyltransferase in patients with systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "X&#46; Zhu"
                            1 => "J&#46; Liang"
                            2 => "F&#46; Li"
                            3 => "Y&#46; Yang"
                            4 => "L&#46; Xiang"
                            5 => "J&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-4632.2010.04804.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Dermatol"
                        "fecha" => "2011"
                        "volumen" => "50"
                        "paginaInicial" => "697"
                        "paginaFinal" => "704"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21595664"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack501512"
        "titulo" => "Acknowledgment"
        "texto" => "<p id="par0160" class="elsevierStylePara elsevierViewall">The study was supported by a grant from <span class="elsevierStyleGrantSponsor" id="gs0005">Tehran University of Medical Sciences</span> &#40;<span class="elsevierStyleGrantNumber" refid="gs0005">95-03-154-32732</span>&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03010546/0000004800000004/v2_202012180835/S0301054620300811/v2_202012180835/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "5554"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03010546/0000004800000004/v2_202012180835/S0301054620300811/v2_202012180835/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0301054620300811?idApp=UINPBA00004N"
]

Article information

ISSN: 03010546
Original language: English

DOI:10.1016/j.aller.2020.03.014

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	6	0	6
2024 October	25	4	29
2024 September	31	10	41
2024 August	38	4	42
2024 July	24	0	24
2024 June	16	2	18
2024 May	21	19	40
2024 April	22	6	28
2024 March	37	5	42
2024 February	32	4	36
2024 January	25	8	33
2023 December	26	5	31
2023 November	33	14	47
2023 October	39	15	54
2023 September	34	5	39
2023 August	29	11	40
2023 July	39	11	50
2023 June	20	6	26
2023 May	39	3	42
2023 April	29	11	40
2023 March	19	8	27
2023 February	36	10	46
2023 January	31	8	39
2022 December	27	5	32
2022 November	29	9	38
2022 October	42	13	55
2022 September	35	11	46
2022 August	25	11	36
2022 July	25	9	34
2022 June	16	9	25
2022 May	27	12	39
2022 April	25	18	43
2022 March	39	18	57
2022 February	19	21	40
2022 January	25	27	52
2021 December	17	26	43
2021 November	27	26	53
2021 October	31	31	62
2021 September	44	29	73
2021 August	10	16	26
2021 July	23	21	44
2021 June	27	7	34
2021 May	28	9	37
2021 April	48	16	64
2021 March	25	21	46
2021 February	17	8	25
2021 January	15	10	25
2020 December	1	0	1
2020 July	2	1	3

Show all

Allergologia et Immunopathologia is no longer published on Elsevier since the 2021 year.Transferred to Codon Publications

Indexed in:

Follow us:

Statistics

Allergologia et Immunopathologia is no longer published on Elsevier since the 2021 year.Transferred to Codon Publications

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter