Original article
Animal model of corneal ectasia in rabbits by intrastromal injection of type II collagenase
Modelo animal de ectasia corneal en conejo mediante inyección intraestromal de colagenasa tipo II
L.E. Cano-Gómeza, E. Casillas-Casillasb, P. Andrade-Lozanoa, J. Ventura-Juárezc, L.F. Barba-Gallardob,
Corresponding author
a Maestría en Investigación Biomédica, Centro de Ciencias de la Salud, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
b Departamento de Optometría, Centro de Ciencias de la Salud, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
c Departamento de Morfología, Centro de Ciencias Básicas, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
Read
236
Timeswas read the article
42
Total PDF
194
Total HTML
Share statistics
array:24 [ "pii" => "S2173579423000300" "issn" => "21735794" "doi" => "10.1016/j.oftale.2023.03.005" "estado" => "S300" "fechaPublicacion" => "2023-04-01" "aid" => "2078" "copyright" => "The Author(s)" "copyrightAnyo" => "2023" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Soc Esp Oftalmol. 2023;98:206-12" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0365669123000205" "issn" => "03656691" "doi" => "10.1016/j.oftal.2023.01.003" "estado" => "S300" "fechaPublicacion" => "2023-04-01" "aid" => "2078" "copyright" => "The Authors" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Soc Esp Oftalmol. 2023;98:206-12" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Artículo original</span>" "titulo" => "Modelo animal de ectasia corneal en conejo mediante inyección intraestromal de colagenasa tipo <span class="elsevierStyleSmallCaps">ii</span>" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "206" "paginaFinal" => "212" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Animal model of corneal ectasia in rabbits by intrastromal injection of type II collagenase" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1286 "Ancho" => 2946 "Tamanyo" => 393244 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Alteraciones morfológicas después de la administración de colagenasa <span class="elsevierStyleSmallCaps">ii</span>. Los cambios morfológicos de las córneas expuestas a colagenasa <span class="elsevierStyleSmallCaps">ii</span> muestran cambios característicos de un proceso inflamatorio y de regeneración, además de pérdida de integridad en la capa de Bowman, en comparación con los controles. (A-C) Controles. (D-F) Queratocono. Ambos con los objetivos 5x, 10x y 20x, respectivamente (aumento 500, 1000 y 2000, barra de escala 200<span class="elsevierStyleHsp" style=""></span>μm, 100<span class="elsevierStyleHsp" style=""></span>μm y 50<span class="elsevierStyleHsp" style=""></span>μm, respectivamente).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "L.E. Cano-Gómez, E. Casillas-Casillas, P. Andrade-Lozano, J. Ventura-Juárez, L.F. Barba-Gallardo" "autores" => array:5 [ 0 => array:2 [ "nombre" => "L.E." "apellidos" => "Cano-Gómez" ] 1 => array:2 [ "nombre" => "E." "apellidos" => "Casillas-Casillas" ] 2 => array:2 [ "nombre" => "P." "apellidos" => "Andrade-Lozano" ] 3 => array:2 [ "nombre" => "J." "apellidos" => "Ventura-Juárez" ] 4 => array:2 [ "nombre" => "L.F." "apellidos" => "Barba-Gallardo" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2173579423000300" "doi" => "10.1016/j.oftale.2023.03.005" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173579423000300?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365669123000205?idApp=UINPBA00004N" "url" => "/03656691/0000009800000004/v2_202304071613/S0365669123000205/v2_202304071613/es/main.assets" ] ] "itemSiguiente" => array:18 [ "pii" => "S2173579423000294" "issn" => "21735794" "doi" => "10.1016/j.oftale.2023.03.004" "estado" => "S300" "fechaPublicacion" => "2023-04-01" "aid" => "2079" "copyright" => "The Author(s)" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Soc Esp Oftalmol. 2023;98:213-9" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "IMPULSE Study: Impact of COVID-19 in the present of ophthalmology focusing on ocular surface and future trends" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "213" "paginaFinal" => "219" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Estudio IMPULSO: impacto de la COVID-19 en el presente de la oftalmología centrada en superficie ocular y tendencias de futuro" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1153 "Ancho" => 2925 "Tamanyo" => 287845 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0110" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Impact of lack of presence on ophthalmic patient follow-up and diagnostic accuracy during the pandemic. Percentages of agreement according to an ordinal Likert-type scale from 1 to 9.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "J.M Benítez del Castillo, N. Alejandre Alba, I. Henares, M.P. Ferraris, M. Águila" "autores" => array:5 [ 0 => array:2 [ "nombre" => "J.M" "apellidos" => "Benítez del Castillo" ] 1 => array:2 [ "nombre" => "N." "apellidos" => "Alejandre Alba" ] 2 => array:2 [ "nombre" => "I." "apellidos" => "Henares" ] 3 => array:2 [ "nombre" => "M.P." "apellidos" => "Ferraris" ] 4 => array:2 [ "nombre" => "M." "apellidos" => "Águila" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173579423000294?idApp=UINPBA00004N" "url" => "/21735794/0000009800000004/v2_202304071550/S2173579423000294/v2_202304071550/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S2173579423000129" "issn" => "21735794" "doi" => "10.1016/j.oftale.2023.02.002" "estado" => "S300" "fechaPublicacion" => "2023-04-01" "aid" => "2075" "copyright" => "Sociedad Española de Oftalmología" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Soc Esp Oftalmol. 2023;98:199-205" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Normative exophthalmometry values in Hispanic individuals" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "199" "paginaFinal" => "205" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Valores normativos de exoftalmometría en individuos hispanos" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1221 "Ancho" => 1675 "Tamanyo" => 79464 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Exophthalmometry Values (EV) in Hispanic patients. The box-and-whisker plot above denotes the median, interquartile range, spread, and outliers for EV (mm) in males vs. females.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "T. Cheng, F. Wang, K. Denisova, A. Barmettler" "autores" => array:4 [ 0 => array:2 [ "nombre" => "T." "apellidos" => "Cheng" ] 1 => array:2 [ "nombre" => "F." "apellidos" => "Wang" ] 2 => array:2 [ "nombre" => "K." "apellidos" => "Denisova" ] 3 => array:2 [ "nombre" => "A." "apellidos" => "Barmettler" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0365669123000163" "doi" => "10.1016/j.oftal.2022.12.007" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365669123000163?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173579423000129?idApp=UINPBA00004N" "url" => "/21735794/0000009800000004/v2_202304071550/S2173579423000129/v2_202304071550/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Animal model of corneal ectasia in rabbits by intrastromal injection of type II collagenase" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "206" "paginaFinal" => "212" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "L.E. Cano-Gómez, E. Casillas-Casillas, P. Andrade-Lozano, J. Ventura-Juárez, L.F. Barba-Gallardo" "autores" => array:5 [ 0 => array:3 [ "nombre" => "L.E." "apellidos" => "Cano-Gómez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "E." "apellidos" => "Casillas-Casillas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "P." "apellidos" => "Andrade-Lozano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "J." "apellidos" => "Ventura-Juárez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 4 => array:4 [ "nombre" => "L.F." "apellidos" => "Barba-Gallardo" "email" => array:1 [ 0 => "barbaluis@yahoo.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Maestría en Investigación Biomédica, Centro de Ciencias de la Salud, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Departamento de Optometría, Centro de Ciencias de la Salud, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Departamento de Morfología, Centro de Ciencias Básicas, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "<span class="elsevierStyleItalic">Corresponding author</span>." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Modelo animal de ectasia corneal en conejo mediante inyección intraestromal de colagenasa tipo II" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1555 "Ancho" => 2508 "Tamanyo" => 542715 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0135" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Collagen fiber change in keratoconus animal model. The alteration in corneal collagen fibers with collagenase II indicates a process of corneal stroma regeneration by the action of collagenase II, mainly collagen type I synthesis. (A–B) Controls. (D–E) Keratoconus. Both with 10× objectives (magnification 1000, scale bar 100<span class="elsevierStyleHsp" style=""></span>μm).</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Keratoconus is a corneal ectasia characterised by the thinning and conical protrusion of the cornea with myopia and astigmatism development.<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1,2</span></a> It has been classified as a non-inflammatory disease; however, recent research has found proinflammatory cytokine expression and inflammatory cell infiltrate in tears of keratoconus patients.<a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3–5</span></a> It usually occurs in adolescence, from the second decade of life onwards, possibly following refractive surgery. Worldwide prevalence is estimated at 138/100,000 people.<a class="elsevierStyleCrossRefs" href="#bib0010"><span class="elsevierStyleSup">2,6</span></a> Some of the risk factors for its development are atopy, eye rubbing, congenital diseases, connective tissue disorders and the expression of genes such as VSX1 and SOD1.<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1,7–12</span></a> There are several physiological alterations in the corneal stroma and epithelium, giving rise to a production imbalance of proinflammatory and anti-inflammatory molecules, proteases and their inhibitors, oxidative stress and cellular hypersensitivity.<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> Recently published literature describes different proteins found in tears and corneas with keratoconus such as IL-1, IL-6, TNF-α, some metalloproteinases, TGF-β and reactive oxygen species,<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14–16</span></a> indicating the simultaneous activation of different signaling pathways that could establish an inflammatory profile.</p><p id="par0010" class="elsevierStylePara elsevierViewall">Treatment depends on severity and aims to address structural corneal alterations and is not intended to directly treat the pathophysiology of the disease.<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14,17–19</span></a> Developing an animal model with collagenase application to induce the evolution of keratoconus in mice generates knowledge for future development of treatment mechanisms based on pathophysiological examination.<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> There are models developed with type II collagenase eye drops in rabbits and several studies have demonstrated inflammation in keratoconus pathophysiology.<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> The aim of this study was to develop an animal model in rabbits using intrastromal injection of collagenase type II that simulates the altered curvature, expression of inflammatory factors, oxidative stress and histopathology of keratoconus.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Material and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Animals and collagenase type <span class="elsevierStyleSmallCaps">ii</span></span><p id="par0015" class="elsevierStylePara elsevierViewall">This study used Six New Zealand rabbits of 3.0–4.0<span class="elsevierStyleHsp" style=""></span>kg obtained from the Bioterio de Ciencias Básicas of the Autonomous University of Aguascalientes (Aguascalientes, Mexico). The experimental protocol was approved by the Ethics Committee for the Use of Animals in Teaching and Research of the Autonomous University of Aguascalientes (CEADI-UAA-001/003/2021). Rabbits were kept in a controlled environment of 12<span class="elsevierStyleHsp" style=""></span>h light/12<span class="elsevierStyleHsp" style=""></span>h dark cycles. Food and water were available ad libitum. Care was provided throughout the 7 days of the study. Animals were anaesthetized via intraperitoneal 6<span class="elsevierStyleHsp" style=""></span>mL/kg of sodium pentobarbital 1:10 and for topical anesthesia 5<span class="elsevierStyleHsp" style=""></span>mg/mL tetracaine hydrochloride eye drops (Lab. Sofia, Guadalajara, Mexico) were used. Animals were treated according to the ARRIVE (V 2.0) guidelines protocol (National Center for the Replacement, Refinement & and Reduction of Animals Research) for the use of animals in experimental research. Collagenase type II (Sigma-Aldrich) powder was dissolved in a dextran balanced salt solution (15%) at a concentration of 2.5<span class="elsevierStyleHsp" style=""></span>mg/mL.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Intervention</span><p id="par0020" class="elsevierStylePara elsevierViewall">Twelve eyes of six rabbits were divided into two groups. The right eyes were the experimental group, the left eyes the control group. Once anaesthetized, the cornea was injected using an ultrafine needle with an inverted microscope under the corneal epithelium. In the experimental group, 5<span class="elsevierStyleHsp" style=""></span>μL of collagenase type II 2.5<span class="elsevierStyleHsp" style=""></span>mg/mL was injected at room temperature. Subsequently, ophthalmic chloramphenicol antibiotic was administered to prevent possible infection. The same procedure was performed on the control eyes, administering balanced salt solution with 4% dextran.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Keratometry</span><p id="par0025" class="elsevierStylePara elsevierViewall">With a one-position keratometer (Bausch and Lomb, NY, USA), the main meridians were obtained from 3<span class="elsevierStyleHsp" style=""></span>mm in the center of the cornea one day before the application of intrastromal collagenase and 7 days after the intervention. The 2 principal meridians' keratometry average, minor curve (K1), major curve (K2) and the average of the 2 meridians (Km) were recorded with results being expressed in diopters (D).</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Histology</span><p id="par0030" class="elsevierStylePara elsevierViewall">Corneas were fixed in 4% paraformaldehyde for 3 days and embedded in paraffin. Slices of 8<span class="elsevierStyleHsp" style=""></span>μm thick were cut from limbus to limbus for hematoxylin-eosin and sirius red staining. Corneas stained with hematoxylin-eosin were observed in brightfield and those stained with sirius red with polarized light. In order not to induce an evaluation bias, one researcher performed the histochemistry technique until the staining phase was completed and another researcher with greater experienced with light microscopy and pathology assessment evaluated the histological sections without knowing their origin, in order to avoid influencing the examination.</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">RNA extraction and RT-PCR</span><p id="par0035" class="elsevierStylePara elsevierViewall">Total RNA was extracted using a purification kit (cat. no. 12183555; Thermo Fisher, Inc., California, USA). RNA concentration and purity was quantified with a NanoDrop 2000 spectrophotometer. cDNA synthesis was performed with the iScript kit (cat. 1708891; Bio-Rad Laboratories, Hercules, California, USA) and a thermal cycler (Thermo Fisher, Inc., California, USA). Taq DNA Polymerase, Recombinant (cat. no. 11615-050; Thermo Fisher Scientific, Inc., California, USA) was used for PCR. We worked with 1<span class="elsevierStyleHsp" style=""></span>μg/μL of cDNA in a final volume of 25<span class="elsevierStyleHsp" style=""></span>μL. The oligonucleotides are shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Relative expression of collagen I mRNA was normalized against GAPDH expression. It was analyzed using ImageJ software from Fiji. Experiments were repeated in duplicate.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0040" class="elsevierStylePara elsevierViewall">Values were expressed as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>standard error. Data analysis was performed using the GraphPad Prism 8 software (GraphPad Software, Inc., La Jolla, CA, USA). Group results were compared using Student's t for paired samples. A p<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 was considered statistically significant.</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Results</span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Corneal surface alteration by collagenase II action</span><p id="par0045" class="elsevierStylePara elsevierViewall">Keratometry was measured before collagenase II administration by intrastromal injection in the experimentation group or a balanced salt solution for the control group; 7 days after application, keratometry was measured again in both meridians and in the average of the 2 meridians. The values of collagenase II corneas in K1, K2 and KM, respectively, are described below (K1ED0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,50<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,08; K1ED7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>48,58<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4,29); (K2ED0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,42<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,28; K2ED7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>49,50<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2,75); (KMED0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,60<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,17; KMED7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>49,04<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>3,45); all differences were statistically significant (p<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05); with respect to controls, they are presented in the same order; (K1CD0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46.42<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.23; K1CD7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,38<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,09); (K2CD0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,33<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,29; K2CD7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>45,50<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0,89); (KMCD0<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>46,38<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1,20; KMCD7<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>45,94<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0,95), (p<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>0,05) (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Corneal morphological changes due to collagenase II action</span><p id="par0050" class="elsevierStylePara elsevierViewall">The results obtained from hematoxylin-eosin staining indicate that control corneas maintained normal morphology at 7 days manifested by collagen fiber parallelism with respect to the epithelium (arrows) (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A–C). However, in the keratoconus group, the epithelium's irregular arrangement and loss of collagen fiber parallelism (arrows) was observed in Bowman's layer. There was a mild inflammatory reaction with high keratocytes density, which led to an increase in stromal thickness due to the formation of extracellular matrix (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>D–F), indicating a process of keratocyte activation and stromal regeneration (stromal scarring).</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Collagen type I expression</span><p id="par0055" class="elsevierStylePara elsevierViewall">To evaluate type I collagen expression, sirius red staining of tissue and semi-quantitative PCR were performed. With sirius red staining, changes in collagen fiber arrangement were observed in the experimental group compared to the control group; and in control corneas, the presence of type I collagen was observed in the red fibers and type III collagen in the green fibers (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A–B). In contrast, experimental corneas show a greater presence of type I and III collagen in the lesion and these fibers are thicker, indicating the development of stromal regeneration by extracellular matrix synthesis (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C–D). Regarding type I collagen gene expression, no statistically significant changes were observed between the control and experimental groups (p<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.77) (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>). However, the trend in the graph demonstrates a slight increase in type I collagen expression in the experimental group over the control group which, with a larger corneal sample, could increase the difference between the groups.</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Discussion</span><p id="par0060" class="elsevierStylePara elsevierViewall">According to the described background of keratoconus animal models, this work was developed highlighting the following findings: (1) collagenase II has the ability to alter the cornea and corneal stroma's curvature, (2) there is a process of corneal stroma regeneration at the lesion site.</p><p id="par0065" class="elsevierStylePara elsevierViewall">Collagenase II is a protease used in keratoconus animal models to degrade type I collagen and produce thinning and corneal surface alteration. Qiao previously reported a keratoconus animal model administrating collagenase II in eye drops at a concentration of 5<span class="elsevierStyleHsp" style=""></span>mg/mL, with prior corneal debridement.<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> However, although this methodology had already been published by other authors, our results did not replicate the effect they found. Qiao reported an increase in keratometry at day 7 and 14 with respect to the control, but we found no changes in the rabbits' corneas with the same eye drop procedure. In contrast, with the intrastromal injection procedure we did obtain numerical differences in the 3 keratometry values (K1, K2 and Km), being statistically significant in all 3 measurements, which is a similar result to that found in the human keratoconus model, so we attribute this result to the fact that the response we evaluated is due to the collagenase effect.<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> The arrangement of collagenase entry in the direction in which it flows could be modifying the stromal lamellae, causing the meridian to weaken and become more curved, leading the biomechanical forces of the perpendicular posterior fibers to exert greater pressure on the more curved meridian.<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> Regarding the decrease in collagen fibers, irregular fiber arrangement and clefts in Qiao's study, we found in contrast a different pattern, i.e., an increase in the number of keratocytes with possible activation in a stromal regeneration process with formation of a stromal scar by keratocyte activation, agreeing with Song et al.<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> In Moghadam's study in rats he used collagenase by intrastromal injection, reporting corneal opacity and deformity and severe damage to collagen fibers, epithelial thinning and corneal stroma.<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> We replicated this injection model and obtained similar results, mainly corneal opacity and deformity, which confirmed the surface alteration through keratometry with severe damage to the collagen fibers and corneal epithelium irregularity. These changes were attributed to the cornea's healing process by collagenase II, and after 3 days the opacity disappeared.</p><p id="par0070" class="elsevierStylePara elsevierViewall">The cornea is made up of type I and V collagen, but type III, IV and VII collagen can be found in smaller quantities as well. During corneal regeneration, quiescent keratocytes are activated and transdifferentiate into myofibroblasts in order to restore the extracellular matrix by synthesizing collagen type I, III, IV and V.<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> Collagen III is expressed in the regeneration and disorganization of type I collagen fibers, and is a marker of fibrosis.<a class="elsevierStyleCrossRefs" href="#bib0120"><span class="elsevierStyleSup">24,25</span></a> Sirius red staining results show that control corneas have regularly arranged collagen III fibers; sirius red dye binds specifically to collagen I, II and III fibers, and due to its birefringent effects it can be analyzed under a polarization microscope. This procedure allows quantitative analysis of tissue content in collagen fibers using Fiji software, which is more specific than trichrome histological techniques, that indicate that the damage caused by the needle when injecting the balanced salt solution is regenerated with new collagen fibers. Regarding corneas with keratoconus, there is a greater presence of irregularly arranged type I collagen fibers, indicating that they are in a regeneration process. Our results contrast with the research of Lorenzo-Martín et al. where stromal composition during regeneration using the sirius red technique was evaluated, and a lower presence of type III collagen in the injured cornea is demonstrated. It is important to note that there is controversy in the interpretation of results of this technique, as some authors claim that the color is due to the type of collagen and others attribute the color to the arrangement and thickness of the collagen, indicating that it is a test that only determines collagen fiber regularity. In the study by Lorenzo-Martín et al. gene overexpression of collagen I and III was found, concurring with our results of collagen II gene expression.<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a></p><p id="par0075" class="elsevierStylePara elsevierViewall">In the present study the effect of various concentrations of collagenase II was not evaluated, nor was the long-term model studied, limiting our research. It is important to evaluate different concentrations in order to develop a more moderate degradation process, as well as to evaluate the long-term corneal regeneration time with immunohistochemical histological tests and longitudinal gene expression to determine the animal model duration and determine its viability. Therefore, we suggest that further research should be carried out on this model to determine the term time, as well as to further understand the damage process induced by this enzyme.</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Conclusions</span><p id="par0080" class="elsevierStylePara elsevierViewall">Our study presents a keratoconus animal model with a less invasive and faster method, additionally showing the degradative effects of collagenase II on tissue. Further research is needed to determine whether this model is viable for studying the pathophysiology and possible treatments of keratoconus.</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Funding</span><p id="par0085" class="elsevierStylePara elsevierViewall">Project funded by the <span class="elsevierStyleGrantSponsor" id="gs0005">Autonomous University of Aguascalientes</span>: <span class="elsevierStyleGrantNumber" refid="gs0005">DGIyP- PIBB18-1</span>.</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conflict of interest</span><p id="par0090" class="elsevierStylePara elsevierViewall">None.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1876901" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1628159" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1876902" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Método" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1628160" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Material and methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Animals and collagenase type ii" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Intervention" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Keratometry" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Histology" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "RNA extraction and RT-PCR" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0045" "titulo" => "Results" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0050" "titulo" => "Corneal surface alteration by collagenase II action" ] 1 => array:2 [ "identificador" => "sec0055" "titulo" => "Corneal morphological changes due to collagenase II action" ] 2 => array:2 [ "identificador" => "sec0060" "titulo" => "Collagen type I expression" ] ] ] 7 => array:2 [ "identificador" => "sec0065" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0070" "titulo" => "Conclusions" ] 9 => array:2 [ "identificador" => "sec0075" "titulo" => "Funding" ] 10 => array:2 [ "identificador" => "sec0080" "titulo" => "Conflict of interest" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2022-06-17" "fechaAceptado" => "2023-01-17" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1628159" "palabras" => array:3 [ 0 => "Keratoconus" 1 => "Collagenase II" 2 => "Intrastromal injection" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1628160" "palabras" => array:3 [ 0 => "Queratocono" 1 => "Colagenasa II" 2 => "Inyección intraestromal" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Collagenase II has been used to induce experimental keratoconus in animal models. However, its effect when administered by intrastromal injection has not been studied, so the purpose of this study was to study the effects of intrastromal injection of collagenase II on corneal surface and corneal morphology.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Six New Zealand rabbits were used, collagenase II was administered by intrastromal injection (5<span class="elsevierStyleHsp" style=""></span>μL of 2.5<span class="elsevierStyleHsp" style=""></span>mg/mL) in the right eyes and balanced salt solution in the left eyes. Keratometry was performed to evaluate curvature alteration, also at day 7 corneas were obtained and Hematoxylin-Eosin staining was performed to examine morphologic changes. Likewise, changes in type I collagen expression were investigated by Sirius Red staining and semiquantitative PCR.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">K1, K2 and Km presented differences in the means with statistically significant changes. The morphological changes that were demonstrated were degradation and irregular arrangement of the corneal stroma, increase in the cellular density of keratocytes and slight cellular infiltration. Finally, it was demonstrated that there is greater expression of type I collagen fibers in the experimental group as opposed to the controls and the thickness of the fibers also increased due to the action of collagenase II, however, in terms of genetics there were no changes in the expression of type I collagen at molecular level between the control and experimental groups.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Collagenase II administered by intrastromal injection is able to induce changes in the corneal surface and stroma, being able to simulate a model of keratoconus.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducción</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">La colagenasa II ha sido utilizado para inducir Queratocono experimental en modelos animales. Sin embargo, no ha sido estudiado su efecto cuando se administra por inyección intraestromal, por lo que el propósito de este estudio fue estudiar los efectos de la inyección intraestromal de colagenasa II sobre la superficie corneal y la morfología de la córnea.</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Método</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Se trabajó con 6 conejos Nueva Zelanda, se administró colagenasa II por inyección intraestromal (5<span class="elsevierStyleHsp" style=""></span>μL de 2.5<span class="elsevierStyleHsp" style=""></span>mg/mL) en los ojos derechos y solución salina balanceada en los ojos izquierdos. Se realizaron queratometrías para evaluar la alteración de la curvatura, también al día 7 se obtuvieron las córneas y se realizó tinción Hematoxilina-Eosina para examinar los cambios morfológicos. Así mismo, se investigaron los cambios en la expresión de colágeno tipo I por tinción Rojo Sirio y PCR semicuantitativa.</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">K1, K2 y Km presentaron diferencias en los promedios con cambios estadísticamente significativos. Los cambios morfológicos que se demostraron fueron degradación y disposición irregular del estroma corneal, incremento en la densidad celular de queratocitos y ligera infiltración celular. Finalmente se demostró que hay mayor expresión de fibras de colágeno tipo I en el grupo experimental a diferencia de los controles y el grosor de las fibras también incrementó por acción de la colagenasa II, sin embargo, en cuestión génica no hubo cambios en la expresión de colágeno tipo I a nivel molecular entre el grupo control y experimental.</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusiones</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">La colagenasa II administrada por inyección intraestromal es capaz de inducir cambios en la superficie corneal y el estroma, pudiendo simular un modelo de queratocono.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Método" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] ] "multimedia" => array:5 [ 0 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3576 "Ancho" => 3008 "Tamanyo" => 448322 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0125" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Keratometric values before and after administration of collagenase II. Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>standard error. * Statistically significant p-value<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05.</p>" ] ] 1 => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1286 "Ancho" => 2946 "Tamanyo" => 416318 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0130" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Morphological alterations after collagenase II administration. Morphological changes of corneas exposed to collagenase II show changes characteristic of an inflammatory and regenerative process and loss of integrity in Bowman's layer, compared to controls. (A–C) Controls. (D–F) Keratoconus. Both with 5×, 10× and 20× objectives, respectively (magnification 500, 1000 and 2000, scale bar 200<span class="elsevierStyleHsp" style=""></span>μm, 100<span class="elsevierStyleHsp" style=""></span>μm and 50<span class="elsevierStyleHsp" style=""></span>μm, respectively).</p>" ] ] 2 => array:8 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1555 "Ancho" => 2508 "Tamanyo" => 542715 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0135" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Collagen fiber change in keratoconus animal model. The alteration in corneal collagen fibers with collagenase II indicates a process of corneal stroma regeneration by the action of collagenase II, mainly collagen type I synthesis. (A–B) Controls. (D–E) Keratoconus. Both with 10× objectives (magnification 1000, scale bar 100<span class="elsevierStyleHsp" style=""></span>μm).</p>" ] ] 3 => array:8 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 760 "Ancho" => 2175 "Tamanyo" => 77503 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0140" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Collagen I gene expression in the keratoconus animal model. Although there is no significant change, a trend towards increased expression of type I collagen in the keratoconus group is evidenced. Data are presented as mean<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>standard error; n<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>6 per group. bp: base pairs; COL1A2: collagen type I alpha chain 2; QTC: keratoconus.</p>" ] ] 4 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0145" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">COL1A2: collagen type I alpha 2 chain.</p>" "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Direct sequence (5′→3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse sequence (5′→3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">COL1A2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAAATCGGACCTGTTGGTAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AACCAGGACTACCTCTCAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGAGCTGAACGGGAAACTCA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCAGCATCGAAGGTAGAGG \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Genetic markers and corresponding oligonucleotides.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:26 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Y.S. Rabinowitz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0039-6257(97)00119-7" "Revista" => array:6 [ "tituloSerie" => "Surv Ophthalmol" "fecha" => "1998" "volumen" => "42" "paginaInicial" => "297" "paginaFinal" => "319" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9493273" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The keratoconus enigma: a review with emphasis on pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G. Ferrari" 1 => "P. Rama" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jtos.2020.03.006" "Revista" => array:6 [ "tituloSerie" => "Ocul Surf" "fecha" => "2020" "volumen" => "18" "paginaInicial" => "363" "paginaFinal" => "373" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32234342" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Subclinical keratoconus and inflammatory molecules from tears" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "I. Lema" 1 => "T. Sobrino" 2 => "J.A. Durán" 3 => "D. Brea" 4 => "E. Díez-Feijoo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/bjo.2008.144253" "Revista" => array:6 [ "tituloSerie" => "Br J Ophthalmol" "fecha" => "2009" "volumen" => "93" "paginaInicial" => "820" "paginaFinal" => "824" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19304583" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An immunohistochemical study of inflammatory cell changes and matrix remodeling with and without acute hydrops in keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.C. Fan Gaskin" 1 => "I.P. Loh" 2 => "C.N.J. McGhee" 3 => "T. Sherwin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Investig Ophthalmol Vis Sci" "fecha" => "2015" "volumen" => "56" "paginaInicial" => "5831" "paginaFinal" => "5837" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Is keratoconus an inflammatory disease? The implication of inflammatory pathways" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "I.P. Loh" 1 => "T. Sherwin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Ocul Immunol Inflamm" "fecha" => "2020" "paginaInicial" => "1" "paginaFinal" => "9" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The prevalence and risk factors for keratoconus: a systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Hashemi" 1 => "S. Heydarian" 2 => "E. Hooshmand" 3 => "M. Saatchi" 4 => "A. Yekta" 5 => "M. Aghamirsalim" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Cornea" "fecha" => "2020" "volumen" => "00" "paginaInicial" => "263" "paginaFinal" => "270" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic and environmental risk factors for keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.E.M. Lucas" 1 => "K.P. Burdon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Annu Rev Vis Sci" "fecha" => "2020" "volumen" => "6" "paginaInicial" => "5.1" "paginaFinal" => "5.22" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The association between sociodemographic factors, common systemic diseases, and keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.A. Woodward" 1 => "T.S. Blachley" 2 => "J.D. Stein" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Ophthalmology" "fecha" => "2015" "volumen" => "123" "paginaInicial" => "1" "paginaFinal" => "9.e2" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Gordon-Shaag A, Millodot M, Shneor E, Liu Y. The genetic and environmental factors for keratoconus. 2015;2015:1–19." ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Corneal morphologic characteristics in patients with down syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.L. Alio" 1 => "A. Vega-Estrada" 2 => "P. Sanz" 3 => "A.A. Osman" 4 => "A.M. Kamal" 5 => "A. Mamoon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/jamaophthalmol.2018.2373" "Revista" => array:6 [ "tituloSerie" => "JAMA Ophthalmol" "fecha" => "2018" "volumen" => "136" "paginaInicial" => "971" "paginaFinal" => "978" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29931124" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "VSX1: a gene for posterior polymorphous dystrophy and keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "E. Heon" 1 => "A. Greenberg" 2 => "K. Kopp" 3 => "D. Rootman" 4 => "A. Vincent" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/hmg/11.9.1029" "Revista" => array:6 [ "tituloSerie" => "Hum Mol Genet" "fecha" => "2002" "volumen" => "11" "paginaInicial" => "1029" "paginaFinal" => "1036" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11978762" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "SOD1: a candidate gene for keratoconus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Udar" 1 => "S.R. Atilano" 2 => "D.J. Brown" 3 => "B. Holguin" 4 => "K. Small" 5 => "A.B. Nesburn" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Investig Ophthalmol Vis Sci" "fecha" => "2006" "volumen" => "47" "paginaInicial" => "3345" "paginaFinal" => "3351" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratoconus: an inflammatory disorder" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "V. Galvis" 1 => "T. Sherwin" 2 => "A. Tello" 3 => "J. Merayo" 4 => "R. Barrera" 5 => "A. Acera" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/eye.2015.63" "Revista" => array:6 [ "tituloSerie" => "Eye." "fecha" => "2015" "volumen" => "29" "paginaInicial" => "843" "paginaFinal" => "859" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25931166" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratoconus at a molecular level: a review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T.L.A. Volatier" 1 => "F.C. Figueiredo" 2 => "C.J. Connon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Anat Rec" "fecha" => "2020" "volumen" => "303" "paginaInicial" => "1680" "paginaFinal" => "1688" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Are proteinases the reason for keratoconus?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.A. Balasubramanian" 1 => "D.C. Pye" 2 => "M.D.P. Willcox" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/02713680903477824" "Revista" => array:6 [ "tituloSerie" => "Curr Eye Res" "fecha" => "2010" "volumen" => "35" "paginaInicial" => "185" "paginaFinal" => "191" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20373876" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oxidative stress induces dysregulated autophagy in corneal epithelium of keratoconus patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Shetty" 1 => "A. Sharma" 2 => "N. Pahuja" 3 => "P. Chevour" 4 => "N. Padmajan" 5 => "K. Dhamodaran" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0184628" "Revista" => array:5 [ "tituloSerie" => "PLoS One" "fecha" => "2017" "volumen" => "12" "paginaInicial" => "e0184628" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28902914" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Corneal collagen crosslinking with riboflavin and ultraviolet-A light in progressive keratoconus: ten-year results" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "F. Raiskup" 1 => "A. Theuring" 2 => "L.E. Pillunat" 3 => "E. Spoerl" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jcrs.2014.09.033" "Revista" => array:6 [ "tituloSerie" => "J Cataract Refract Surg" "fecha" => "2015" "volumen" => "41" "paginaInicial" => "41" "paginaFinal" => "46" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25532633" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratoconus progression after intrastromal corneal ring segment implantation in young patients: five-year follow-up" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A. Vega-Estrada" 1 => "J.L. Alió" 2 => "A.B. Plaza-Puche" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jcrs.2014.08.045" "Revista" => array:6 [ "tituloSerie" => "J Cataract Refract Surg" "fecha" => "2015" "volumen" => "41" "paginaInicial" => "1145" "paginaFinal" => "1152" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26189375" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Management of keratoconus: current scenario" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "V. Jhanji" 1 => "N. Sharma" 2 => "R.B. Vajpayee" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Br J Ophthalmol" "fecha" => "2011" "volumen" => "95" "paginaInicial" => "1044" "paginaFinal" => "1050" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Induction of experimental keratoconus in mice using collagenase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F.A. Moghadam" 1 => "M.H. Jahromy" 2 => "S. Fazelipour" 3 => "S. Khakpour" 4 => "M. Younesian" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Physiol Pharmacol" "fecha" => "2009" "volumen" => "13" "paginaInicial" => "209" "paginaFinal" => "215" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A rabbit model of corneal Ectasia generated by treatment with collagenase type II" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Qiao" 1 => "H. Li" 2 => "Y. Tang" 3 => "W. Song" 4 => "B. Rong" 5 => "S. Yang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12886-018-0760-z" "Revista" => array:5 [ "tituloSerie" => "BMC Ophthalmol" "fecha" => "2018" "volumen" => "18" "paginaInicial" => "94" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29653563" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Three-dimensional arrangement of elastic fibers in the human corneal stroma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "P.N. Lewis" 1 => "T.L. White" 2 => "R.D. Young" 3 => "J.S. Bell" 4 => "C.P. Winlove" 5 => "K.M. Meek" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.exer.2015.12.006" "Revista" => array:6 [ "tituloSerie" => "Exp Eye Res" "fecha" => "2016" "volumen" => "146" "paginaInicial" => "43" "paginaFinal" => "53" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26704458" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The superficial stroma scar formation mechanism in keratoconus: a study using laser scanning in vivo confocal microscopy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Song" 1 => "S. Wang" 2 => "P. Zhang" 3 => "W. Sui" 4 => "Y. Zhang" 5 => "T. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:2 [ "tituloSerie" => "BioMed Res Int" "fecha" => "2016" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Wound-healing studies in cornea and skin: parallels, differences and opportunities" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Bukowiecki" 1 => "D. Hos" 2 => "C. Cursiefen" 3 => "S.A. Eming" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/ijms18010001" "Revista" => array:6 [ "tituloSerie" => "Int J Mol Sci" "fecha" => "2017" "volumen" => "18" "paginaInicial" => "1" "paginaFinal" => "24" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28025478" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Collagens and proteoglycans of the cornea: importance in transparency and visual disorders" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D. Massoudi" 1 => "F. Malecaze" 2 => "S.D. Galiacy" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00441-015-2233-5" "Revista" => array:6 [ "tituloSerie" => "Cell Tissue Res" "fecha" => "2016" "volumen" => "363" "paginaInicial" => "337" "paginaFinal" => "349" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26205093" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dynamic changes of the extracellular matrix during corneal wound healing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "E. Lorenzo-Martín" 1 => "P. Gallego-Muñoz" 2 => "S. Mar" 3 => "I. Fernández" 4 => "P. Cidad" 5 => "M.C. Martínez-García" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Exp Eye Res" "fecha" => "2019" "volumen" => "186" "paginaInicial" => "1" "paginaFinal" => "10" ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/21735794/0000009800000004/v2_202304071550/S2173579423000300/v2_202304071550/en/main.assets" "Apartado" => array:4 [ "identificador" => "5816" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/21735794/0000009800000004/v2_202304071550/S2173579423000300/v2_202304071550/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173579423000300?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 6 | 0 | 6 |
| 2024 October | 35 | 4 | 39 |
| 2024 September | 28 | 5 | 33 |
| 2024 August | 29 | 11 | 40 |
| 2024 July | 32 | 8 | 40 |
| 2024 June | 28 | 10 | 38 |
| 2024 May | 35 | 4 | 39 |
| 2024 April | 1 | 0 | 1 |
