Vascular smooth muscle cell phenotype is modulated by ligands of the lymphotoxin β receptor and the tumor necrosis factor receptor | Clínica e Investigación en Arteriosclerosis (English Edition)

array:22 ["pii" => "S2529912323000086" "issn" => "25299123" "doi" => "10.1016/j.artere.2023.02.002" "estado" => "S300" "fechaPublicacion" => "2023-01-01" "aid" => "645" "copyright" => "The Authors" "copyrightAnyo" => "2022" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Clin Investig Arterioscler. 2023;35:1-11" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S2529912323000013" "issn" => "25299123" "doi" => "10.1016/j.artere.2023.01.001" "estado" => "S300" "fechaPublicacion" => "2023-01-01" "aid" => "647" "copyright" => "Sociedad Española de Arteriosclerosis" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Clin Investig Arterioscler. 2023;35:12-20" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Health-related lifestyle assessment among Spanish adults from 22 to 72 years" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "12" "paginaFinal" => "20" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Valoración del estilo de vida saludable adquirido en adultos españoles de 22 a 72 años de edad" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Pedro Luis Rodríguez García, Juan José Pérez Soto, Eliseo García Cantó, Marcos Meseguer Zafra, Raúl Salmerón Ríos, Pedro Juan Tárraga López" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Pedro Luis" "apellidos" => "Rodríguez García" ] 1 => array:2 [ "nombre" => "Juan José" "apellidos" => "Pérez Soto" ] 2 => array:2 [ "nombre" => "Eliseo" "apellidos" => "García Cantó" ] 3 => array:2 [ "nombre" => "Marcos" "apellidos" => "Meseguer Zafra" ] 4 => array:2 [ "nombre" => "Raúl" "apellidos" => "Salmerón Ríos" ] 5 => array:2 [ "nombre" => "Pedro Juan" "apellidos" => "Tárraga López" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000013?idApp=UINPBA00004N" "url" => "/25299123/0000003500000001/v3_202311162141/S2529912323000013/v3_202311162141/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Vascular smooth muscle cell phenotype is modulated by ligands of the lymphotoxin β receptor and the tumor necrosis factor receptor" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "11" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Susana Martín-Vañó, Alejandra Miralles-Abella, Pascual Castaño, Gema Hurtado-Genovés, María Aguilar-Ballester, Andrea Herrero-Cervera, Angela Vinué, Sergio Martínez-Hervás, Herminia González-Navarro" "autores" => array:9 [ 0 => array:3 [ "nombre" => "Susana" "apellidos" => "Martín-Vañó" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Alejandra" "apellidos" => "Miralles-Abella" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Pascual" "apellidos" => "Castaño" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "Gema" "apellidos" => "Hurtado-Genovés" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 4 => array:3 [ "nombre" => "María" "apellidos" => "Aguilar-Ballester" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 5 => array:3 [ "nombre" => "Andrea" "apellidos" => "Herrero-Cervera" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 6 => array:3 [ "nombre" => "Angela" "apellidos" => "Vinué" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 7 => array:3 [ "nombre" => "Sergio" "apellidos" => "Martínez-Hervás" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 8 => array:4 [ "nombre" => "Herminia" "apellidos" => "González-Navarro" "email" => array:1 [ 0 => "herminia.gonzalez@uv.es" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 2 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] 3 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Institute of Health Research-INCLIVA, Valencia, Spain" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Endocrinology and Nutrition Department Clinic Hospital and Department of Medicine, University of Valencia, Valencia, Spain" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "CIBER de Diabetes y Enfermedades Metabólicas (CIBERDEM), Instituto de Salud Carlos III, Madrid, Spain" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Biochemistry and Molecular Biology Department, Faculty of Medicine, University of Valencia, Valencia, Spain" "etiqueta" => "d" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "El fenotipo de las células de músculo liso vascular es modulado por los ligandos del receptor de la linfotoxina β y del receptor del factor de necrosis tumoral" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1977 "Ancho" => 3175 "Tamanyo" => 326809 ] ] "descripcion" => array:1 [ "en" => "Expression analysis of genes related to the acquisition of haVSMC contractile and secretory phenotype. Relative expression levels of (A) ACTA2, (B) COL1A1, (C) TGFB1, (D) MMP2 and (E) MMP9 in ahVSMC treated with vehicle, LTα (5ng/ml), LTα (10ng/ml) and LIGHT (50ng/ml). mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001." ] ] ] "textoCompleto" => "IntroductionCardiovascular disease (CVD) is a clinical manifestation of the atherosclerotic process, currently considered both a metabolic and a chronic inflammatory disease with an active participation of the innate and adaptive immune system.<a class="elsevierStyleCrossRef" href="#bib0140">1</a> Atherosclerosis lesion represents a profound vascular vessel wall remodeling. The lesion initiates with an endothelial dysfunction which progressively leads to the formation of fibroatheromas with an inflammatory core<a class="elsevierStyleCrossRef" href="#bib0145">2</a> containing lipid-loaded macrophages and different T helper (Th) and regulatory T (Treg) cells.<a class="elsevierStyleCrossRef" href="#bib0150">3</a> During the progression of the disease, vascular smooth muscle cells (VSMCs) become migratory and proliferative and undergo a phenotypic-switching process by acquiring characteristics of different cell-types such as myofibroblasts, mesenchymatic cells, macrophages, lymphoid organ organizer cells or osteochondrogenic cells.<a class="elsevierStyleCrossRef" href="#bib0155">4</a> Studies have shown an important role of the cross-talk between the plaque-stress factors and the functional plasticity of VSMC in atheroma instability and acute coronary syndromes.<a class="elsevierStyleCrossRef" href="#bib0160">5</a> Therefore, it is of relevance to understand potential inflammatory mediators that might affect VSMC lesional heterogeneity.The lymphotoxins (LT) and the tumor necrosis factor superfamily 14 (TNFSF14), also called LIGHT, belong to the TNFSF and constitute with their receptors an important interconnected network signaling in immune homeostasis.<a class="elsevierStyleCrossRefs" href="#bib0165">6,7</a> LIGHT is mainly produced by immune cells and mediates its effects through two receptors, the LTβR and the herpes virus entry mediator (HVEM) while its activity is inhibited by the Decoy receptor 3 (DcR3). LIGHT-signaling through LTβR, a receptor mostly expressed in stromal and epithelial cells, activates both canonical and non-canonical nuclear factor kappa B (NFkB) pathways, exerting important functions in immune response and lymphorganogenesis.<a class="elsevierStyleCrossRefs" href="#bib0165">6,7</a> Through HVEM signaling, a receptor characteristic of T and B cells, LIGHT promotes non-canonical NFKB and c-Jun N-terminal Kinase (JNK) pathways increasing cytokine production, cell survival, and proliferation.<a class="elsevierStyleCrossRef" href="#bib0175">8</a> The LIGHT/LTβR-HVEM axis becomes more complex due to interactions with the other LT. Thus, LTα exerts cytotoxic effects and forms the homotrimer LTα3 that binds to TNF receptor 1 (TNFR1) and TNFR2. The homotrimer LTα3 can also bind, with low affinity, to HVEM.<a class="elsevierStyleCrossRef" href="#bib0165">6</a> In addition, LTα and LTβ form the LTα1β2 heterotrimer which is produced by lymphocytic cells, and is essential, through the LTβR/NFKB non-canonical pathway, in lymphoid tissue organogenesis during development.<a class="elsevierStyleCrossRef" href="#bib0170">7</a> In adulthood, the LTα1β2/LTβR/NFKB interaction is important in immune responses against pathogenic insults. Hence LIGHT, LTα3 and LTα1β2 compete for the same receptors and therefore their actions will depend on their relative abundance in the circulation and within tissues.It is not therefore surprising that the study of LIGHT and LT signaling through the LTβR/HVEM-dependent pathways in metabolic diseases have yielded discrepant results. Thus, hepatic T cell production of LIGHT in mouse models induces hypercholesterolemia by modulating hepatic enzymes<a class="elsevierStyleCrossRef" href="#bib0180">9</a> and Light gene inactivation alleviates insulin resistance, steatosis and hepatic inflammation.<a class="elsevierStyleCrossRef" href="#bib0185">10</a> On the other hand, T60N variant of LYMPHOTOXIN ALPHA gene has been associated with type 2 diabetes and other features of the metabolic syndrome.<a class="elsevierStyleCrossRef" href="#bib0190">11</a> However, its deficiency does not affect obesity or insulin resistance in mouse models.<a class="elsevierStyleCrossRef" href="#bib0195">12</a>In CVD, discrepant results have been reported as well. LIGHT levels are elevated in coronary disease,<a class="elsevierStyleCrossRef" href="#bib0200">13</a> clinical heart failure<a class="elsevierStyleCrossRef" href="#bib0205">14</a> and unstable angina,<a class="elsevierStyleCrossRef" href="#bib0210">15</a> while a soluble form of LTβR has been observed in human atherosclerosis.<a class="elsevierStyleCrossRef" href="#bib0215">16</a> In the atherosclerotic Apolipoprotein e-deficient (Apoe-/-) mice, macrophage specific deletion of Ltβr reduced atherosclerosis by augmenting the proresolving Ly6Clow monocytes.<a class="elsevierStyleCrossRef" href="#bib0220">17</a> Consistently, soluble LIGHT acute treatment enhanced proliferant Ly6Chi-monocytes and aggravated atherosclerosis.<a class="elsevierStyleCrossRef" href="#bib0225">18</a> Notwithstanding, in another study, Ltβr specific deletion in VSMCs in Apoe-/- mice accelerated atherosclerosis indicating atheroprotection in a LTβR-dependent manner which was attributed to T-cell homeostasis induced by a proper functionality of the artery lymphoid organs.<a class="elsevierStyleCrossRef" href="#bib0230">19</a> Therefore, these studies unveiled a complex role of the TNFSF ligands in atherosclerosis. Notably, genetic inactivation of Light aggravated abdominal aneurysm vascular lesions.<a class="elsevierStyleCrossRef" href="#bib0235">20</a> Specifically, in vivo and in vitro data indicated that LIGHT/LTβR-signaling disruption provoked dysregulated SOX9, OPN and BMP2 gene expression compatible with an osteochondrogenic phenotype which has been previously associated with vascular dysfunction.<a class="elsevierStyleCrossRef" href="#bib0240">21</a> These results suggest a protective function of LIGHT/LTβR-signaling in vascular injury through the prevention of osteochondrogenic phenotype acquisition.Given the multiple interactions and connections between the TNFSF ligands and their receptors, in the present investigation we sought to investigate the potential role of the LTα, LIGHT and the LTα1β2 heterotrimer in the VSMC phenotype.Materials and methodsHuman aortic VSMC cell culture experimentsHuman aortic (ha)VSMCs were commercially obtained (Invitrogen, C-007-5C, Thermofisher Scientific, Madrid, Spain) and cultured in 231 medium, 20% FBS, 5% of smooth muscle growth factor (Invitrogen, S00725 Thermofisher Scientific) and 2% P/S/A (Lonza, Basel, Switzerland) as described.<a class="elsevierStyleCrossRefs" href="#bib0235">20,22</a> HaVSMCs were kept on a humidified 5% CO2 atmosphere until treatments and were used until passage 6–7. For expression experiments haVSMC were grown in 20% FBS/DMEM-P/S/A medium on 6-well plates up to 70–80% of confluency and then treated for 72h in 0.5% FBS/DMEM-P/S/A medium with vehicle, human soluble LIGHT (20ng/ml, Preprotech, Germany, Hamburg), LTα (at 5 and 10ng/ml Preprotech, Germany, Hamburg) or with LTα1β2 (at 20 and 100ng/ml, R&D systems Biotechne, Minneapolis, Minnesota, USA). For protein analysis of the receptors cells were grown as before until confluency and then treated for 24h in 0.5% FBS/DMEM-P/S/A medium with vehicle or human soluble LIGHT (50ng/ml). After treatments, cells were rinsed with PBS 1×, collected by centrifugation (500×g, 10min) snap-frozen with liquid N2 and stored for gene expression analysis by qPCR.Gene expression analysis by quantitative real-time PCR (qPCR)Total RNA was obtained from cultured haVSMCs treated as indicated above using TRIzol reagent following manufacturer recomendations (Invitrogen, Carlsbad, CA, USA). A total of 500ng of RNA were reverse transcribed with the Maxima First-Strand kit (Fermentas, Waltham, MA, USA). The genes of interest were amplified with Luminaris Color HiGreen High ROX qPCR Master Mix (Fermentas, Waltham, MA, USA) on a 7900 FastSystem thermal cycler and results were analyzed with the formula 2−ΔΔCt. mRNA levels were normalized to the GAPDH mRNA levels and relativized to vehicle-treated cells. The primer sequences were obtained from the PrimerBank data base (Massachusetts General Hospital, Harvard University) and are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Western Blot analysisProtein extracts were obtained by homogenization of haVSMCs in the presence of ice-cold lysis TNG buffer (Tris–HCl 50mM, pH 7.5, NaCl 200mM, Tween-20 1% vol/vol, NP-40 0.2% vol/vol) supplemented with Complete Mini cocktail, PhosSTOP (Roche, Mannheim, Germany), beta-glycerophosphate 50mM (Sigma), 2mM phenylmethylsulfonyl fluoride (PMSF, Roche) and 200μM Na3VO4 (Sigma). For protein analysis, protein extracts (25–50μg) were prepared with Laemmli buffer (5min 95°C) and subjected to 12% w/v polyacrylamide gel electrophoresis and western blot as described.<a class="elsevierStyleCrossRef" href="#bib0185">10</a> The following primary (1/200) and secondary (1/2000) antibodies were used to detect the proteins: HVEM (PA5-20237, ThermoFisher), LTβR (ab70063, Abcam) and β-actin (Sigma), anti-mouse IgG-HRP (P0447, Dako) and goat anti-rabbit IgG-HRP (P0448, Dako). The immunocomplexes were detected with an ECL Plus detection kit (ThermoFisher). All antibodies for western blot were acquired and used after checking that validation was performed by the manufacturer company.Statistical analysisQuantitative data are presented as the mean±the standard error of the mean (SEM) and with the single data points. All samples were randomly treated and analyzed by observers blinded to treatments. Treatments and collection of data were obtained at the same time and order to avoid confounding effects. The exclusion criteria were applied when data was out of range of the standard curve in each experiment, when samples were lost during the experimentation and when the (non-iterative) Grubbs test identified outliers. Statistical tests were applied after the determination of normal distribution (Shapiro–Wilk and D’Agostino–Pearson normality tests) and equality of variances (F test). Differences were evaluated with unpaired Student's t test, Mann–Whitney U test (for nonparametric distribution) and one-way ANOVA followed by Bonferroni multiple comparison test (more than two groups). All statistical tests were run in GraphPad Prism 9.0.0 (GraphPad Prism Software, La Jolla, CA, USA). Differences were considered statistically significant when p-values were below 0.05: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.ResultsAortic human vascular smooth muscle cells express LTβR and HVEMLTβR is expressed mainly in stromal and epithelial cells while HVEM is mainly found in immune cells. However, the expression of LTβR and HVEM in liver and adipose tissue<a class="elsevierStyleCrossRef" href="#bib0185">10</a> and the expression of LTBR gene in haVSMC<a class="elsevierStyleCrossRef" href="#bib0235">20</a> has been previously described. To assess whether the TNFSF ligands can signal in haVSMCs protein analysis was performed. Analysis of both LTβR and HVEM receptors in vehicle- and LIGHT-treated haVSMC indicated the presence of both receptors in these cells with similar levels regardless of the treatment (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A, B).<elsevierMultimedia ident="fig0005"></elsevierMultimedia>LTα and LIGHT but not LTα1β2 decrease myofibroblast markers in aortic human vascular smooth muscle cellsThe potential effect of the LTs and LIGHT in haVSMC phenotype switching was explored by using the expression of different markers for myofibroblast-like cell. Analysis of myofibroblast-like cell genes showed reduced expression of COL1A1 and TGFB1 mRNA levels in haVSMCs treated with LTα at 10ng/ml compared with vehicle-treated cells (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B, C). HaVSMCs treated with LTα at a lower dose of 5ng/ml also displayed reduced mRNA levels of TGFB1 and enhanced expression of MMP9 compared with vehicle-treated haVSMCs (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>C, E). No changes were observed in the expression of ACTA2 or in MMP2 genes (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A, D). Likewise, haVSMCs treated with LIGHT displayed diminished COL1A1 and TGFB1 mRNA gene expression (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B, C) with no changes in ACTA2, MMP2 or MMP9 (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A, D, E). Treatment of haVSMCs with the trimer LTα1β2 did not affect ACTA2, COL1A1, TGFB1 and MMP9 mRNA levels at any of the two doses tested (20 or 100ng/ml) (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A–D).<elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia>Aortic human vascular smooth muscle cells treated with LTα and LIGHT but not display decreased expression of CKIT and KLF4 genesNext, we evaluated a possible effect of LIGHT and LT signaling in genes related with pluripotency and osteochondrogenic phenotypes. Treatment of haVSMCs with LTα at 10ng/ml, but not with LIGHT, significantly decreased the expression of SOX9 (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A). Reduced mRNA levels of CKIT and KLF4 (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>B, C) were also observed in haVSMC treated with LIGHT and with LTα at the both 5 and 10ng/ml doses. Neither LIGHT or LTα affected the gene expression of OCT4 or KLF10 (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>D, E). Similarly, compared with vehicle-treated controls, haVSMCs treated with LTα1β2 did not display altered mRNA levels of SOX9, CKIT, OCT4, KLF4 or KLF10 (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>F–J).<elsevierMultimedia ident="fig0020"></elsevierMultimedia>Aortic human vascular smooth muscle cells treated with LTα, LIGHT and LTα1β2 modulate the expression of lymphorganogenic cytokinesOne of the described effects of LTβR-dependent signaling in VSMCs is the induction of a cellular phenotype secretor of lymphorganogenic cytokines, hence the production of these were studied. The analysis of haVSMC treated with LTα revealed an increase in the gene expression of CCL20 and CXCL16 at the 10ng/ml dose (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A, D) and of CCL20 at 5ng/ml dose (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A) compared with vehicle-treated VSMCs while the mRNA levels of CCL21 were unaffected by LTα (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>C). Unlike LTα, LIGHT did not modify the gene expression of CCL20 and CXCL16 (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A, D) and surprisingly diminished CCL21 mRNA levels (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>B). The mRNA levels of CXCL13 were unaffected by either LTα or LIGHT treatment (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>C). Interestingly, the treatment of haVSMCs with the trimer LTα1β2, at both 20 and 100ng/ml doses, decreased the expression of the CXCL13 gene (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>G) while no changes were observed in the other cytokines (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>E, F, H).<elsevierMultimedia ident="fig0025"></elsevierMultimedia>LTα and LIGHT dependent signaling does not affect the expression of macrophage markers in aortic human vascular smooth muscle cellsPrevious studies have shown a modulation of macrophage-like cell phenotype through upregulation of KLF4.<a class="elsevierStyleCrossRef" href="#bib0250">23</a> Given the lower KLF4 mRNA levels observed in haVSMCs treated with LIGHT and with LTα, the expression of macrophage gene markers were also investigated. Although the treatments with both LIGHT and LTα slightly increased the gene expression of the surface membrane markers of macrophage subtypes including CD14, CD80, CD206 and CD183 (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A–D) and of phagocytic activity, CD68 (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>E) these were no significantly altered. Likewise, no differences were observed in the expression of proinflammatory cytokine genes typically expressed by macrophages, such as MCP1, IL6 and IFNG, between vehicle- and LTα- or LIGHT-treated haVSMCs (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>F–H).<elsevierMultimedia ident="fig0030"></elsevierMultimedia>DiscussionAtheroma plaque instability is strongly affected by VSMC functional transdifferentiation<a class="elsevierStyleCrossRefs" href="#bib0160">5,22</a> in which different risk factors and secreted plaque mediators have been importantly implicated.<a class="elsevierStyleCrossRef" href="#bib0255">24</a> In the present investigation, the potential effect of TNFSF ligands in the modulation of VSMC gene expression associated with functional heterogeneity was explored. Consistent with a preservation of VSMC identity, the treatment of VSMCs with LTα or LIGHT diminished COL1A1 and TGFB1 mRNA levels, LTα incubation augmented the expression of MMP9, without changing ACTA2 mRNA levels. Likewise, genes associated with osteochondrogenesis, pluripotency and transdifferentiation such as SOX9, CKIT, and KLF4 were also repressed by LTα and LIGHT treatments. Notably, all the above genes were not affected by the treatment with the LTα1β2 trimer. VSMC treatment with all three ligands, LTα, LTα1β2 and LIGHT, altered the expression of well-reported lymphorganogenic cytokines<a class="elsevierStyleCrossRefs" href="#bib0165">6,25</a> which included augmented CCL20 and CCL21 gene expression by LTα as well as diminished CCL21 and CXCL13 by LIGHT and LTα1β2, respectively. Altogether, indicates a role of the TNFSF ligands through their interconnected network of signaling, in the preservation of VSMC identity against the acquisition of a genetic expression signature compatible with a functional transdifferentiation process.Studies have shown an important role of the cross-talk between the plaque-stress factors and the functional plasticity of VSMC. Thus, VSMC functionality loss consisting in an acquisition of an inflammatory and apoptotic phenotype promotes plaque instability in insulin resistance states through a CX3CL1-dependet manner.<a class="elsevierStyleCrossRef" href="#bib0245">22</a> More recent investigations using cellular lineage tracing and single-cell RNAseq in plaque have further extended our knowledge about VSMC plasticity during plaque progression.<a class="elsevierStyleCrossRefs" href="#bib0250">23,26</a> Specifically, in vivo VSMC specific deficiency in Oct4 or Klf4 in mouse models resulted in two divergent genomic signatures associated with different VSMC fates and function such as osteochondrocyte-like and macrophage-like gene signatures.<a class="elsevierStyleCrossRefs" href="#bib0250">23,27</a> Notably, protective ACTA2+ myofibroblast-like cells forming the fibrous caps were discovered to originate from endothelial-to-mesenchymal transition and macrophage-to-mesenchymal transition, a process dependent of Pdgfrb gene.<a class="elsevierStyleCrossRef" href="#bib0270">27</a>Our present investigation indicates a gene repression by LTα and LIGHT of COL1A1 and TGFB1, SOX9, CKIT, and KLF4 genes, results that are consistent with the above studies indicating important roles of some of these genes in plaque instability through VSMC phenotype switching. On the other hand, LIGHT/LTβR-dependent signaling has as well been linked to atherosclerosis with discrepant conclusions<a class="elsevierStyleCrossRefs" href="#bib0195">12,13,15–19</a> which we believe might be attributed to the intrincated network signaling of the TFNSF ligands. The present investigation is also in agreement with a study describing a protective function of LIGHT in aneurysm lesion<a class="elsevierStyleCrossRef" href="#bib0235">20</a> and a prevention by LIGHT of SOX9 gene expression which is associated with an osteochondrogenic and proatherogenic phenotype. Consequently, in vivo analysis showed diminished ACTA2+ lesion area and vascular Col1a1 gene expression,<a class="elsevierStyleCrossRef" href="#bib0235">20</a> suggesting a protective role for LIGHT by preventing VSMC de-differentiation and plasticity in vivo during vascular injury. Of note, as in the present investigation, LIGHT did not affect the in vitro gene expression of the ACTA2 contractile marker in haVSMCs which could be due to a high prevalence of ACTA2+ myofibroblast-like cells<a class="elsevierStyleCrossRef" href="#bib0265">26</a> which could difficult the detection of other non-contractile cells originated during the transdifferentiation process. Hence, changes in gene expression were performed in the cell culture probably containing a mixed pool of cells with different cell-type phenotypes which could mask gene expression changes belonging to a less prevalent cell-type.Therefore, a limitation of our results is that our study is based on gene expression techniques and hence future studies would require the detection of active proteins as well as the performance of functional assays to better characterize each cell-type. To avoid the above limitations, future studies should include experimental approaches such as single-cell RNAseq or flow-cytometry analysis using several markers to identify, fractionate and quantify the different cell-types induced by LTα, LTα1β2 and LIGHT.In addition, a modulation by the TNFSF ligands of lymphorganogenic cytokines, including enhanced CCL20 and CCL21 gene expression and diminished CCL21 and CXCL13, has been also observed in the present investigation which suggest a coordinated role of these ligands in cytokine-mediated lymphorganogenesis. In the line of these results, VSMC Ltbr-specific deficiency in mice prevented this cell type to acquire a protective lymphorganogenic PDGFRB+ phenotype,<a class="elsevierStyleCrossRef" href="#bib0230">19</a> and aggravated lesion size, suggesting a role in lymphorganogenesis associated with plaque stability.Altogether, the present investigation indicates a role of the TNFSF ligands in VSMC gene expression of genes relevant for cellular plasticity and reprogramming events during plaque lesion development and stability. Therefore, these data suggest a possible role of these ligands in cellular plasticity during atheroma development.ConclusionsThe TNFSF ligands through its interconnected network signaling modulate haVSMC gene expression signature associated with cellular plasticity. These results suggest a possible role of the TNFSF ligands in plaque stability.FundingThis research was funded by grants from the ISCIII (PI19/00169 to H.G.-N. and S.M.-H. and CIBERDEM CB07/08/0043, CB07/08/0018), the European Regional Development Fund (FEDER), GenT Investigator (CDEI-04-20-B, GVA) and by the Spanish Arteriosclerosis Society (BIB 07-20). MAB received support from a fellowship of ISCIII and the European Regional Development Fund (FEDER) (FI20/00017) and GHG from the Ministerio de Universidades (FPU20/04916).Conflict of interestsThe authors have no conflict of interests to declare." "textoCompletoSecciones" => array:1 [ "secciones" => array:13 [ 0 => array:3 [ "identificador" => "xres2011097" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Material and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1722740" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xpalclavsec1722741" "titulo" => "Abbreviations" ] 3 => array:3 [ "identificador" => "xres2011098" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] 4 => array:2 [ "identificador" => "xpalclavsec1722739" "titulo" => "Palabras clave" ] 5 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 6 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Human aortic VSMC cell culture experiments" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Gene expression analysis by quantitative real-time PCR (qPCR)" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Western Blot analysis" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Statistical analysis" ] ] ] 7 => array:3 [ "identificador" => "sec0035" "titulo" => "Results" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0040" "titulo" => "Aortic human vascular smooth muscle cells express LTβR and HVEM" ] 1 => array:2 [ "identificador" => "sec0045" "titulo" => "LTα and LIGHT but not LTα1β2 decrease myofibroblast markers in aortic human vascular smooth muscle cells" ] 2 => array:2 [ "identificador" => "sec0050" "titulo" => "Aortic human vascular smooth muscle cells treated with LTα and LIGHT but not display decreased expression of CKIT and KLF4 genes" ] 3 => array:2 [ "identificador" => "sec0055" "titulo" => "LTα and LIGHT dependent signaling does not affect the expression of macrophage markers in aortic human vascular smooth muscle cells" ] ] ] 8 => array:2 [ "identificador" => "sec0060" "titulo" => "Discussion" ] 9 => array:2 [ "identificador" => "sec0065" "titulo" => "Conclusions" ] 10 => array:2 [ "identificador" => "sec0070" "titulo" => "Funding" ] 11 => array:2 [ "identificador" => "sec0075" "titulo" => "Conflict of interests" ] 12 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2022-04-06" "fechaAceptado" => "2022-05-22" "PalabrasClave" => array:2 [ "en" => array:2 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1722740" "palabras" => array:4 [ 0 => "Vascular smooth muscle cells" 1 => "Inflammation" 2 => "Lymphotoxin" 3 => "Cellular plasticity" ] ] 1 => array:4 [ "clase" => "abr" "titulo" => "Abbreviations" "identificador" => "xpalclavsec1722741" "palabras" => array:10 [ 0 => "DcR" 1 => "HVEM" 2 => "JNK" 3 => "LT" 4 => "LTβR" 5 => "NFkB" 6 => "Th" 7 => "TNFR" 8 => "TNFSF" 9 => "VSMC" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1722739" "palabras" => array:4 [ 0 => "Células musculares lisas vasculares" 1 => "Inflamación" 2 => "Linfotoxina" 3 => "Plasticidad celular" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "ObjectiveVascular smooth muscle cells (VSMCs) undergo a phenotypic-switching process during the generation of unstable atheroma plaques. In this investigation, the potential implication of the tumor necrosis factor superfamily (TNFSF) ligands, in the gene expression signature associated with VSMC plasticity was studied. Material and methodsHuman aortic (ha)VSMCs were obtained commercially and treated with the cytokine TNFSF14, also called LIGHT, the lymphotoxin alpha (LTα), the heterotrimer LTα1β2 or with vehicle for 72h. The effect of the different treatments on gene expression was analyzed by quantitative PCR and included the study of genes associated with myofibroblast-like cell function, osteochondrogenesis, pluripotency, lymphorganogenesis and macrophage-like cell function. ResultsHaVSMCs displayed a change in myofibroblast-like cell genes which consisted in reduced COL1A1 and TGFB1 mRNA levels when treated with LTα or LIGHT and with augmented MMP9 expression levels when treated with LTα. LTα and LIGHT treatments also diminished the expression of genes associated with osteochondrogenesis and pluripotency SOX9, CKIT, and KLF4. By contrary, all the above genes were no affected by the treatment with the trimer LTα1β2. In addition, haVSMC treatment with LTα, LTα1β2 and LIGHT altered lymphorganogenic cytokine gene expression which consisted of augmented CCL20 and CCL21 mRNA levels by LTα and a reduction in the gene expression of CCL21 and CXCL13 by LIGHT and LTα1β2 respectively. Neither, LTα or LIGHT or LTα1β2 treatments affected the expression of macrophage-like cell markers in haVSMC. ConclusionsAltogether, indicates that the TNFSF ligands through their interconnected network of signaling, are important in the preservation of VSMC identity against the acquisition of a genetic expression signature compatible with functional cellular plasticity." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Material and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "ObjetivoLa transición de placa de ateroma estable a placa inestable implica, entre otros procesos, un cambio fenotípico de las células del músculo liso vascular (CMLVs). En esta investigación, se estudió el posible papel de los ligandos de la superfamilia del factor de necrosis tumoral (TNFSF), en los cambios de expresión génica asociada a la plasticidad de las CMLVs. Materiales y métodosLas CMLVs de aorta humana (CMLVah) se obtuvieron comercialmente y se trataron con la citoquina TNFSF14, también llamada LIGHT, la linfotoxina alfa (LTα), el heterotrímero LTα1β2 o con vehículo durante 72 horas. El efecto de los diferentes tratamientos se analizó mediante el estudio de la expresión génica por PCR cuantitativa e incluyó genes asociados con fenotipo miofibroblástico, osteocondrogénico, genes de pluripotencia, genes de linforganogénesis y genes característicos de macrófagos. ResultadosEl estudio de genes asociados a fenotipo miofibroblástico en las CMLVah reveló una reducción de la expresión génica de COL1A1 y TGFB1 tras el tratamiento con LTα o LIGHT mientras que el tratamiento con LTα aumentó los niveles de mRNA de MMP9. LTα y LIGHT también disminuyeron la expresión de genes de osteocondrogénesis y pluripotencia como SOX9, CKIT y KLF4. Por el contrario, la expresión de los genes anteriores no se vio afectada por el tratamiento con el trímero LTα1β2. El tratamiento de las CMLVah con LTα, LTα1β2 y LIGHT alteró la expresión génica de citoquinas linforganogénicas con una expresión aumentada de los genes CCL20 y CCL21 por LTα y una reducción de los niveles de mRNA de CCL21 y CXCL13 por LIGHT y LTα1β2, respectivamente. Ninguno de los tres tratamientos alteró la expresión de genes típicos de macrófagos en las CMLVah. ConclusionesLa presente investigación indica que los ligandos de la familia de los TNFSF a través de su red de señalización, son importantes en la preservación de la identidad de las CMLVs frente a la adquisición de una expresión génica compatible con una mayor plasticidad celular funcional." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1201 "Ancho" => 1675 "Tamanyo" => 119578 ] ] "descripcion" => array:1 [ "en" => "Analysis of the LTβR and HVEM protein content in haVSMC. Protein quantification in the western blot analysis displayed as (A) LTβR/β-actin and (B) HVEM/β-actin ratios in haVSMC treated with vehicle or LIGHT 20ng/μl overnight. Representative blots are shown for the western blot analysis. Statistical analysis were performed by the Student's t-test." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1977 "Ancho" => 3175 "Tamanyo" => 326809 ] ] "descripcion" => array:1 [ "en" => "Expression analysis of genes related to the acquisition of haVSMC contractile and secretory phenotype. Relative expression levels of (A) ACTA2, (B) COL1A1, (C) TGFB1, (D) MMP2 and (E) MMP9 in ahVSMC treated with vehicle, LTα (5ng/ml), LTα (10ng/ml) and LIGHT (50ng/ml). mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1914 "Ancho" => 2175 "Tamanyo" => 194556 ] ] "descripcion" => array:1 [ "en" => "Expression analysis in haVSMC of genes associated to the acquisition of contractile and secretory phenotype. Relative expression levels of (A) ACTA2, (B) COL1A1, (C) TGFB1 and (D) MMP2 in haVSMC treated with vehicle, LTα1β2 (20ng/ml) and LTα1β2 (100ng/ml). mRNA levels were normalized with the levels of the endogenous gene and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 3748 "Ancho" => 3175 "Tamanyo" => 589627 ] ] "descripcion" => array:1 [ "en" => "Expression analysis of genes of pluripotency and osteochondrogenesis in haVSMC. Relative expression mRNA levels of (A, F) SOX9, (B, G) CKIT, (C, H OCT4, (D, I) KLF4 and (E, J) KLF10 in haVSMC treated with vehicle, LTα (5ng/ml), LTα (10ng/ml) and LIGHT (50ng/ml) (A–) and with vehicle, LTα1β2 (20ng/ml) and LTα1β2 (100ng/ml) (F–J). mRNA levels were normalized with the levels of the endogenous gene and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test. *p<0.05; **p<0.01;****p<0.0001." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 4175 "Ancho" => 2261 "Tamanyo" => 498288 ] ] "descripcion" => array:1 [ "en" => "Gene expression analysis of lymphorganogenic cytokines in haVSMC. Relative expression levels of (A, E) CCL20, (B, F) CCL21, (C, G) CXCL13 and (D, H) CXCL16 in ahVSMC treated with vehicle, LTα (5ng/ml), LTα (10ng/ml) and LIGHT (50ng/ml) (A–D) and with vehicle, LTα1β2 (20ng/ml) and LTα1β2 (100ng/ml) (E–H). mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test. *p<0.05; **p<0.01; ***p<0.001;****p<0.0001." ] ] 5 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1488 "Ancho" => 2508 "Tamanyo" => 319073 ] ] "descripcion" => array:1 [ "en" => "Expression analysis of genes related to macrophage-like cell haVSMC. Relative expression levels of (A) CD14, (B) CD80, (C) CD206, (D) CD163, (E) CD68, (F) MCP1, (G) IL6 and (H) IFNG in haVSMC treated with vehicle, LTα (5ng/ml), LTα (10ng/ml) and LIGHT (50ng/ml). mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels. Statistical analysis was performed by one-way ANOVA followed by Tukey's multiple comparisons test." ] ] 6 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gen \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACTA2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AAAAGACAGCTACGTGGGTGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCCATGTTCTATCGGGTACTTC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCL20 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGCTGTACCAAGAGTTTGCTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGCACACAGACAACTTTTTCTTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCL21 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTTGCCTCAAGTACAGCCAAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGAACAGGATAGCTGGGATGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CD14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGCTCCGACATGCATGTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGCCCAGCGAACGACAGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CD68 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGAAATGCCACGGTTCATCCA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGGGGTTCAGTACAGAGATGC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CD80 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGGGAACATCACCATCCAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGCCAGTAGATGCGACTTTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CD163 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCTGCATGAATTGCACAGATAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGGGATGAGCGACCTGTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CD206 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGCTACTAGGCAATGCCAATG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCGTGCAATCTGCGTACCA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">COL1A1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAGGGCCAAGACGAAGACATC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAGATCACGTCATCGCACAAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CXCL13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCTTGAGGTGTAGATGTGTCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCACGGGGCAAGATTTGAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CXCL16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCGCCATCGGTTCAGTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCCGAGTAAGCATGTCCAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGTGGGCATCAATGGATTTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACACCATGTATTCCGGGTCAAT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IFNG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCAACGCAAGCAATACATGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTTTCGCTTCCCTGTTTTAGCT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCAGGAGCCCAGCTATGAAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCAGGGAGAAGGCAACTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">KIT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGTTCTGCTCCTACTGCTTCG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCACGCGGACTATTAAGTCT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">KLF4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCACATGAAGCGACTTCCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAGGTCCAGGAGATCGTTGAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">KLF10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCAACAAGTGTGATTCGTCATAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAGCCTCAACATTTAGGTGGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MCP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTCGCCTCCAGCATGAAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGGAATGAGGGTGGCTGCTA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MMP9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGTACCGCTATGGTTACACTCG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGCAGGGACAGTTGCTTCT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MMP2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TACAGGATCATTGGCTACACACC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGTCACATCGCTCCAGACT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OCT4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTGGGTTGATCCTCGGACCT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCATCGGAGTTGCTCTCCA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SOX9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGCGAACGCACATCAAGAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTGTAGGCGATCTGTTGGGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGFB1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGCCAGATCCTGTCCAAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTGGGTTTCCACCATTAGCAC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3338285.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Sequences of primers used for qPCR expression studies." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:27 [ 0 => array:3 [ "identificador" => "bib0140" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immune cell profiling in atherosclerosis: role in research and precision medicine" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.M. Fernandez" 1 => "C. Giannarelli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41569-021-00589-2" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Cardiol" "fecha" => "2021" "volumen" => "19" "paginaInicial" => "43" "paginaFinal" => "58" "itemHostRev" => array:3 [ "pii" => "S0967586813006851" "estado" => "S300" "issn" => "09675868" ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0145" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "T cell subsets and functions in atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Saigusa" 1 => "H. Winkels" 2 => "K. Ley" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41569-020-0352-5" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Cardiol" "fecha" => "2020" "volumen" => "17" "paginaInicial" => "387" "paginaFinal" => "401" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32203286" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0150" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A change in inflammatory footprint precedes plaque instability: a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.A. van Dijk" 1 => "A.J.F. Duinisveld" 2 => "A.F. Schaapherder" 3 => "A. Mulder-Stapel" 4 => "J.F. Hamming" 5 => "J. Kuiper" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/JAHA.114.001403" "Revista" => array:3 [ "tituloSerie" => "J Am Heart Assoc" "fecha" => "2015" "volumen" => "4" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0155" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Smooth muscle cell phenotypic switching in atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D. Gomez" 1 => "G.K. Owens" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/cvr/cvs115" "Revista" => array:5 [ "tituloSerie" => "Cardiovasc Res" "fecha" => "2012" "paginaInicial" => "156" "paginaFinal" => "164" "itemHostRev" => array:3 [ "pii" => "S1529943015018185" "estado" => "S300" "issn" => "15299430" ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0160" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vascular smooth muscle cell death, autophagy and senescence in atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.O.J. Grootaert" 1 => "M. Moulis" 2 => "L. Roth" 3 => "W. Martinet" 4 => "C. Vindis" 5 => "M.R. Bennett" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/CVR/CVY007" "Revista" => array:7 [ "tituloSerie" => "Cardiovasc Res" "fecha" => "2018" "volumen" => "114" "paginaInicial" => "622" "paginaFinal" => "634" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29360955" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0967586814003749" "estado" => "S300" "issn" => "09675868" ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0165" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lymphotoxin signalling in immune homeostasis and the control of microorganisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "V. Upadhyay" 1 => "Y.X. Fu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nri3406" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Immunol" "fecha" => "2013" "volumen" => "13" "paginaInicial" => "270" "paginaFinal" => "279" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23524463" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0170" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Original ligand for LTβR is LIGHT: insight into evolution of the LT/LTβR system" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T. Maeda" 1 => "H. Suetake" 2 => "T. Odaka" 3 => "T. Miyadai" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4049/jimmunol.1700900" "Revista" => array:5 [ "tituloSerie" => "J Immunol" "fecha" => "2018" "volumen" => "201" "paginaInicial" => "202" "paginaFinal" => "214" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0175" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The signaling networks of the herpesvirus entry mediator (TNFRSF14) in immune regulation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.W. Steinberg" 1 => "T.C. Cheung" 2 => "C.F. Ware" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1600-065X. 2011.01064.x" "Revista" => array:6 [ "tituloSerie" => "Immunol Rev" "fecha" => "2011" "volumen" => "244" "paginaInicial" => "169" "paginaFinal" => "187" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22017438" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0180" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lymphotoxin beta receptor-dependent control of lipid homeostasis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.C. Lo" 1 => "Y. Wang" 2 => "A.V. Tumanov" 3 => "M. Bamji" 4 => "Z. Yao" 5 => "C.A. Reardon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1126/science.1137221" "Revista" => array:5 [ "tituloSerie" => "Science" "fecha" => "2007" "volumen" => "316" "paginaInicial" => "285" "paginaFinal" => "288" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0185" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic inactivation of the LIGHT (TNFSF14) cytokine in mice restores glucose homeostasis and diminishes hepatic steatosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Herrero-Cervera" 1 => "Á. Vinué" 2 => "D.J. Burks" 3 => "H. González-Navarro" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00125-019-4962-6" "Revista" => array:6 [ "tituloSerie" => "Diabetologia" "fecha" => "2019" "volumen" => "62" "paginaInicial" => "2143" "paginaFinal" => "2157" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31388695" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0190" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The common T60N polymorphism of the lymphotoxin-alpha gene is associated with type 2 diabetes and other phenotypes of the metabolic syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.H. Hamid" 1 => "S.A. Urhammer" 2 => "C. Glümer" 3 => "K. Borch-Johnsen" 4 => "T. Jørgensen" 5 => "T. Hansen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/S00125-004-1659-1" "Revista" => array:7 [ "tituloSerie" => "Diabetologia" "fecha" => "2005" "volumen" => "48" "paginaInicial" => "445" "paginaFinal" => "451" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15729581" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1878875018328559" "estado" => "S300" "issn" => "18788750" ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0195" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Deficiency of lymphotoxin-does not exacerbate high-fat diet-induced obesity but does enhance inflammation in mice. Deficiency of lymphotoxin-does not exacerbate high-fat diet-in-duced obesity but does enhance inflammation in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "N. Pamir" 1 => "T.S. McMillen" 2 => "K.A. Edgel" 3 => "F. Kim" 4 => "R.C. LeBoeuf" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpendo.00447.2011-Lymphotoxin-(LT)" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Endocrinol Metab" "fecha" => "2012" "volumen" => "302" "paginaInicial" => "961" "paginaFinal" => "971" "itemHostRev" => array:3 [ "pii" => "S1878875015013005" "estado" => "S300" "issn" => "18788750" ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0200" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LIGHT is increased in patients with coronary disease and regulates inflammatory response and lipid metabolism in oxLDL-induced THP-1 macrophages" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "X. Yuan" 1 => "Y. Gu" 2 => "X. Lai" 3 => "Q. Gu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2017.06.110" "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2017" "volumen" => "490" "paginaInicial" => "732" "paginaFinal" => "738" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28642135" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0205" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased expression of LIGHT/TNFSF14 and its receptors in experimental and clinical heart failure" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.P. Dahl" 1 => "L. Gullestad" 2 => "B. Fevang" 3 => "A.M. Holm" 4 => "L. Landrø" 5 => "L.E. Vinge" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejheart.2008.02.010" "Revista" => array:6 [ "tituloSerie" => "Eur J Heart Fail" "fecha" => "2008" "volumen" => "10" "paginaInicial" => "352" "paginaFinal" => "359" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18353719" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0210" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Enhanced plasma levels of LIGHT in unstable angina" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Scholz" 1 => "W. Sandberg" 2 => "J.K. Damas" 3 => "C. Smith" 4 => "A.K. Andreassen" 5 => "L. Gullestad" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.105.544676" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2005" "volumen" => "112" "paginaInicial" => "2121" "paginaFinal" => "2129" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16186421" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0215" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circulating lymphotoxin β receptor and atherosclerosis: observations from the Dallas Heart Study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.W. Owens" 1 => "S. Matulevicius" 2 => "A. Rohatgi" 3 => "C.R. Ayers" 4 => "S.R. Das" 5 => "A. Khera" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.atherosclerosis.2010.06.003" "Revista" => array:5 [ "tituloSerie" => "Atherosclerosis" "fecha" => "2010" "volumen" => "212" "paginaInicial" => "601" "paginaFinal" => "606" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0220" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Deficiency in lymphotoxin β receptor protects from atherosclerosis in apoE-deficient mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Grandoch" 1 => "K. Feldmann" 2 => "J.R. Göthert" 3 => "L.S. Dick" 4 => "S. Homann" 5 => "C. Klatt" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCRESAHA.116.305723" "Revista" => array:6 [ "tituloSerie" => "Circ Res" "fecha" => "2015" "volumen" => "116" "paginaInicial" => "e57" "paginaFinal" => "e68" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25740843" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0225" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatic lipase inactivation decreases atherosclerosis in insulin resistance by reducing LIGHT/lymphotoxin β-receptor pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Andrés-Blasco" 1 => "A. Vinué" 2 => "A. Herrero-Cervera" 3 => "S. Martinez-Hervás" 4 => "L. Nuñez" 5 => "L. Piqueras" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1160/TH15-10-0773/BIB" "Revista" => array:7 [ "tituloSerie" => "Thromb Haemost" "fecha" => "2016" "volumen" => "116" "paginaInicial" => "379" "paginaFinal" => "393" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27172975" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0967586817316302" "estado" => "S300" "issn" => "09675868" ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0230" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Artery tertiary lymphoid organs control aorta immunity and protect against atherosclerosis via vascular smooth muscle cell lymphotoxin β receptors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Hu" 1 => "S.K. Mohanta" 2 => "C. Yin" 3 => "L. Peng" 4 => "Z. Ma" 5 => "P. Srikakulapu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.immuni.2015.05.015" "Revista" => array:6 [ "tituloSerie" => "Immunity" "fecha" => "2015" "volumen" => "42" "paginaInicial" => "1100" "paginaFinal" => "1115" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26084025" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0235" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dissecting abdominal aortic aneurysm is aggravated by genetic inactivation of light (Tnfsf14)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Herrero-Cervera" 1 => "C. Espinós-Estévez" 2 => "S. Martín-Vañó" 3 => "A. Taberner-Cortés" 4 => "M. Aguilar-Ballester" 5 => "Á. Vinué" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/BIOMEDICINES9111518" "Revista" => array:4 [ "tituloSerie" => "Biomedicines" "fecha" => "2021" "volumen" => "9" "itemHostRev" => array:3 [ "pii" => "S1529943015011560" "estado" => "S300" "issn" => "15299430" ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0240" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sox9 is increased in arterial plaque and stenosis, associated with synthetic phenotype of vascular smooth muscle cells and causes alterations in extracellular matrix and calcification" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Augstein" 1 => "J. Mierke" 2 => "D.M. Poitz" 3 => "R.H. Strasser" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbadis.2018.05.009" "Revista" => array:6 [ "tituloSerie" => "Biochim Biophys Acta - Mol Basis Dis" "fecha" => "2018" "volumen" => "1864" "paginaInicial" => "2526" "paginaFinal" => "2537" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29777903" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0245" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Insulin resistance aggravates atherosclerosis by reducing vascular smoothmuscle cell survival and increasing CX3CL1/CX3CR1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Martínez-Hervás" 1 => "Á. Vinué" 2 => "L. Núñez" 3 => "I. Andrés-Blasco" 4 => "L. Piqueras" 5 => "J. TomásReal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/cvr/cvu115" "Revista" => array:6 [ "tituloSerie" => "Cardiovasc Res" "fecha" => "2014" "volumen" => "103" "paginaInicial" => "324" "paginaFinal" => "336" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24788416" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0250" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Stem cell pluripotency genes Klf4 and Oct4 regulate complex SMC phenotypic changes critical in late-stage atherosclerotic lesion pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G.F. Alencar" 1 => "K.M. Owsiany" 2 => "S. Karnewar" 3 => "K. Sukhavasi" 4 => "G. Mocci" 5 => "A.T. Nguyen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.120.046672" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2020" "volumen" => "142" "paginaInicial" => "2045" "paginaFinal" => "2059" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32674599" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0255" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vascular smooth muscle cells in atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G.L. Basatemur" 1 => "H.F. Jørgensen" 2 => "M.C.H. Clarke" 3 => "M.R. Bennett" 4 => "Z. Mallat" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41569-019-0227-9" "Revista" => array:4 [ "tituloSerie" => "Nat Rev Cardiol" "fecha" => "2019" "paginaInicial" => "727" "paginaFinal" => "744" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0260" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CXCL13 and its receptor CXCR5 in cancer: inflammation, immune response, and beyond" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.G. Kazanietz" 1 => "M. Durando" 2 => "M. Cooke" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fendo.2019.00471" "Revista" => array:7 [ "tituloSerie" => "Front Endocrinol (Lausanne)" "fecha" => "2019" "volumen" => "10" "numero" => "July" "paginaInicial" => "1" "paginaFinal" => "15" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30723457" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0265" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "KLF4-dependent phenotypic modulation of smooth muscle cells has a key role in atherosclerotic plaque pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L.S. Shankman" 1 => "D. Gomez" 2 => "O.A. Cherepanova" 3 => "M. Salmon" 4 => "G.F. Alencar" 5 => "R.M. Haskins" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nm.3866" "Revista" => array:6 [ "tituloSerie" => "Nat Med" "fecha" => "2015" "volumen" => "21" "paginaInicial" => "628" "paginaFinal" => "637" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25985364" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0270" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiple cell types contribute to the atherosclerotic lesion fibrous cap by PDGFRβ and bioenergetic mechanisms" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.A.C. Newman" 1 => "V. Serbulea" 2 => "R.A. Baylis" 3 => "L.S. Shankman" 4 => "X. Bradley" 5 => "G.F. Alencar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s42255-020-00338-8" "Revista" => array:6 [ "tituloSerie" => "Nat Metab" "fecha" => "2021" "volumen" => "3" "paginaInicial" => "166" "paginaFinal" => "181" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33619382" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/25299123/0000003500000001/v3_202311162141/S2529912323000086/v3_202311162141/en/main.assets" "Apartado" => array:4 [ "identificador" => "63721" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/25299123/0000003500000001/v3_202311162141/S2529912323000086/v3_202311162141/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000086?idApp=UINPBA00004N"]

Statistics

Original article

Vascular smooth muscle cell phenotype is modulated by ligands of the lymphotoxin β receptor and the tumor necrosis factor receptor

El fenotipo de las células de músculo liso vascular es modulado por los ligandos del receptor de la linfotoxina β y del receptor del factor de necrosis tumoral

Susana Martín-Vañóa, Alejandra Miralles-Abellaa, Pascual Castañoa, Gema Hurtado-Genovésa, María Aguilar-Ballestera, Andrea Herrero-Cerveraa, Angela Vinuéa, Sergio Martínez-Hervása,b,c, Herminia González-Navarroa,c,d,

Corresponding author

herminia.gonzalez@uv.es

Corresponding author.

a Institute of Health Research-INCLIVA, Valencia, Spain

b Endocrinology and Nutrition Department Clinic Hospital and Department of Medicine, University of Valencia, Valencia, Spain

c CIBER de Diabetes y Enfermedades Metabólicas (CIBERDEM), Instituto de Salud Carlos III, Madrid, Spain

d Biochemistry and Molecular Biology Department, Faculty of Medicine, University of Valencia, Valencia, Spain

Read

273

Times
was read the article

Total PDF

211

Total HTML

Share statistics

 array:22 [
  "pii" => "S2529912323000086"
  "issn" => "25299123"
  "doi" => "10.1016/j.artere.2023.02.002"
  "estado" => "S300"
  "fechaPublicacion" => "2023-01-01"
  "aid" => "645"
  "copyright" => "The Authors"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Clin Investig Arterioscler. 2023;35:1-11"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S2529912323000013"
    "issn" => "25299123"
    "doi" => "10.1016/j.artere.2023.01.001"
    "estado" => "S300"
    "fechaPublicacion" => "2023-01-01"
    "aid" => "647"
    "copyright" => "Sociedad Espa&#241;ola de Arteriosclerosis"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Clin Investig Arterioscler. 2023;35:12-20"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Health-related lifestyle assessment among Spanish adults from 22 to 72 years"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "12"
          "paginaFinal" => "20"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Valoraci&#243;n del estilo de vida saludable adquirido en adultos espa&#241;oles de 22 a 72 a&#241;os de edad"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Pedro Luis Rodr&#237;guez Garc&#237;a, Juan Jos&#233; P&#233;rez Soto, Eliseo Garc&#237;a Cant&#243;, Marcos Meseguer Zafra, Ra&#250;l Salmer&#243;n R&#237;os, Pedro Juan T&#225;rraga L&#243;pez"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Pedro Luis"
              "apellidos" => "Rodr&#237;guez Garc&#237;a"
            ]
            1 => array:2 [
              "nombre" => "Juan Jos&#233;"
              "apellidos" => "P&#233;rez Soto"
            ]
            2 => array:2 [
              "nombre" => "Eliseo"
              "apellidos" => "Garc&#237;a Cant&#243;"
            ]
            3 => array:2 [
              "nombre" => "Marcos"
              "apellidos" => "Meseguer Zafra"
            ]
            4 => array:2 [
              "nombre" => "Ra&#250;l"
              "apellidos" => "Salmer&#243;n R&#237;os"
            ]
            5 => array:2 [
              "nombre" => "Pedro Juan"
              "apellidos" => "T&#225;rraga L&#243;pez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000013?idApp=UINPBA00004N"
    "url" => "/25299123/0000003500000001/v3_202311162141/S2529912323000013/v3_202311162141/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Vascular smooth muscle cell phenotype is modulated by ligands of the lymphotoxin &#946; receptor and the tumor necrosis factor receptor"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "1"
        "paginaFinal" => "11"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Susana Mart&#237;n-Va&#241;&#243;, Alejandra Miralles-Abella, Pascual Casta&#241;o, Gema Hurtado-Genov&#233;s, Mar&#237;a Aguilar-Ballester, Andrea Herrero-Cervera, Angela Vinu&#233;, Sergio Mart&#237;nez-Herv&#225;s, Herminia Gonz&#225;lez-Navarro"
        "autores" => array:9 [
          0 => array:3 [
            "nombre" => "Susana"
            "apellidos" => "Mart&#237;n-Va&#241;&#243;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Alejandra"
            "apellidos" => "Miralles-Abella"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Pascual"
            "apellidos" => "Casta&#241;o"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Gema"
            "apellidos" => "Hurtado-Genov&#233;s"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Mar&#237;a"
            "apellidos" => "Aguilar-Ballester"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Andrea"
            "apellidos" => "Herrero-Cervera"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Angela"
            "apellidos" => "Vinu&#233;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Sergio"
            "apellidos" => "Mart&#237;nez-Herv&#225;s"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          8 => array:4 [
            "nombre" => "Herminia"
            "apellidos" => "Gonz&#225;lez-Navarro"
            "email" => array:1 [
              0 => "herminia.gonzalez@uv.es"
            ]
            "referencia" => array:4 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              3 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Institute of Health Research-INCLIVA&#44; Valencia&#44; Spain"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Endocrinology and Nutrition Department Clinic Hospital and Department of Medicine&#44; University of Valencia&#44; Valencia&#44; Spain"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "CIBER de Diabetes y Enfermedades Metab&#243;licas &#40;CIBERDEM&#41;&#44; Instituto de Salud Carlos III&#44; Madrid&#44; Spain"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Biochemistry and Molecular Biology Department&#44; Faculty of Medicine&#44; University of Valencia&#44; Valencia&#44; Spain"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "El fenotipo de las c&#233;lulas de m&#250;sculo liso vascular es modulado por los ligandos del receptor de la linfotoxina &#946; y del receptor del factor de necrosis tumoral"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1977
            "Ancho" => 3175
            "Tamanyo" => 326809
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Expression analysis of genes related to the acquisition of haVSMC contractile and secretory phenotype&#46; Relative expression levels of &#40;A&#41; <span class="elsevierStyleItalic">ACTA2</span>&#44; &#40;B&#41; <span class="elsevierStyleItalic">COL1A1</span>&#44; &#40;C&#41; <span class="elsevierStyleItalic">TGFB1</span>&#44; &#40;D&#41; <span class="elsevierStyleItalic">MMP2</span> and &#40;E&#41; <span class="elsevierStyleItalic">MMP9</span> in ahVSMC treated with vehicle&#44; LT&#945; &#40;5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#44; LT&#945; &#40;10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#46; mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Cardiovascular disease &#40;CVD&#41; is a clinical manifestation of the atherosclerotic process&#44; currently considered both a metabolic and a chronic inflammatory disease with an active participation of the innate and adaptive immune system&#46;<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">1</span></a> Atherosclerosis lesion represents a profound vascular vessel wall remodeling&#46; The lesion initiates with an endothelial dysfunction which progressively leads to the formation of fibroatheromas with an inflammatory core<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">2</span></a> containing lipid-loaded macrophages and different T helper &#40;Th&#41; and regulatory T &#40;Treg&#41; cells&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">3</span></a> During the progression of the disease&#44; vascular smooth muscle cells &#40;VSMCs&#41; become migratory and proliferative and undergo a phenotypic-switching process by acquiring characteristics of different cell-types such as myofibroblasts&#44; mesenchymatic cells&#44; macrophages&#44; lymphoid organ organizer cells or osteochondrogenic cells&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">4</span></a> Studies have shown an important role of the cross-talk between the plaque-stress factors and the functional plasticity of VSMC in atheroma instability and acute coronary syndromes&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">5</span></a> Therefore&#44; it is of relevance to understand potential inflammatory mediators that might affect VSMC lesional heterogeneity&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">The lymphotoxins &#40;LT&#41; and the tumor necrosis factor superfamily 14 &#40;TNFSF14&#41;&#44; also called LIGHT&#44; belong to the TNFSF and constitute with their receptors an important interconnected network signaling in immune homeostasis&#46;<a class="elsevierStyleCrossRefs" href="#bib0165"><span class="elsevierStyleSup">6&#44;7</span></a> LIGHT is mainly produced by immune cells and mediates its effects through two receptors&#44; the LT&#946;R and the herpes virus entry mediator &#40;HVEM&#41; while its activity is inhibited by the Decoy receptor 3 &#40;DcR3&#41;&#46; LIGHT-signaling through LT&#946;R&#44; a receptor mostly expressed in stromal and epithelial cells&#44; activates both canonical and non-canonical nuclear factor kappa B &#40;NFkB&#41; pathways&#44; exerting important functions in immune response and lymphorganogenesis&#46;<a class="elsevierStyleCrossRefs" href="#bib0165"><span class="elsevierStyleSup">6&#44;7</span></a> Through HVEM signaling&#44; a receptor characteristic of T and B cells&#44; LIGHT promotes non-canonical NFKB and c-Jun N-terminal Kinase &#40;JNK&#41; pathways increasing cytokine production&#44; cell survival&#44; and proliferation&#46;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">8</span></a> The LIGHT&#47;LT&#946;R-HVEM axis becomes more complex due to interactions with the other LT&#46; Thus&#44; LT&#945; exerts cytotoxic effects and forms the homotrimer LT&#945;<span class="elsevierStyleInf">3</span> that binds to TNF receptor 1 &#40;TNFR1&#41; and TNFR2&#46; The homotrimer LT&#945;<span class="elsevierStyleInf">3</span> can also bind&#44; with low affinity&#44; to HVEM&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">6</span></a> In addition&#44; LT&#945; and LT&#946; form the LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> heterotrimer which is produced by lymphocytic cells&#44; and is essential&#44; through the LT&#946;R&#47;NFKB non-canonical pathway&#44; in lymphoid tissue organogenesis during development&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">7</span></a> In adulthood&#44; the LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span>&#47;LT&#946;R&#47;NFKB interaction is important in immune responses against pathogenic insults&#46; Hence LIGHT&#44; LT&#945;<span class="elsevierStyleInf">3</span> and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> compete for the same receptors and therefore their actions will depend on their relative abundance in the circulation and within tissues&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">It is not therefore surprising that the study of LIGHT and LT signaling through the LT&#946;R&#47;HVEM-dependent pathways in metabolic diseases have yielded discrepant results&#46; Thus&#44; hepatic T cell production of LIGHT in mouse models induces hypercholesterolemia by modulating hepatic enzymes<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">9</span></a> and <span class="elsevierStyleItalic">Light</span> gene inactivation alleviates insulin resistance&#44; steatosis and hepatic inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">10</span></a> On the other hand&#44; T60N variant of <span class="elsevierStyleItalic">LYMPHOTOXIN ALPHA</span> gene has been associated with type 2 diabetes and other features of the metabolic syndrome&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">11</span></a> However&#44; its deficiency does not affect obesity or insulin resistance in mouse models&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">12</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">In CVD&#44; discrepant results have been reported as well&#46; LIGHT levels are elevated in coronary disease&#44;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">13</span></a> clinical heart failure<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">14</span></a> and unstable angina&#44;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">15</span></a> while a soluble form of LT&#946;R has been observed in human atherosclerosis&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">16</span></a> In the atherosclerotic <span class="elsevierStyleItalic">Apolipoprotein e</span>-deficient &#40;<span class="elsevierStyleItalic">Apoe</span>-&#47;-&#41; mice&#44; macrophage specific deletion of <span class="elsevierStyleItalic">Lt</span>&#946;<span class="elsevierStyleItalic">r</span> reduced atherosclerosis by augmenting the proresolving Ly6C<span class="elsevierStyleSup">low</span> monocytes&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">17</span></a> Consistently&#44; soluble LIGHT acute treatment enhanced proliferant Ly6C<span class="elsevierStyleSup">hi</span>-monocytes and aggravated atherosclerosis&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">18</span></a> Notwithstanding&#44; in another study&#44; <span class="elsevierStyleItalic">Lt</span>&#946;<span class="elsevierStyleItalic">r</span> specific deletion in VSMCs in <span class="elsevierStyleItalic">Apoe-&#47;-</span> mice accelerated atherosclerosis indicating atheroprotection in a LT&#946;R-dependent manner which was attributed to T-cell homeostasis induced by a proper functionality of the artery lymphoid organs&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">19</span></a> Therefore&#44; these studies unveiled a complex role of the TNFSF ligands in atherosclerosis&#46; Notably&#44; genetic inactivation of <span class="elsevierStyleItalic">Light</span> aggravated abdominal aneurysm vascular lesions&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">20</span></a> Specifically&#44; <span class="elsevierStyleItalic">in vivo</span> and <span class="elsevierStyleItalic">in vitro</span> data indicated that LIGHT&#47;LT&#946;R-signaling disruption provoked dysregulated <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">OPN</span> and <span class="elsevierStyleItalic">BMP2</span> gene expression compatible with an osteochondrogenic phenotype which has been previously associated with vascular dysfunction&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">21</span></a> These results suggest a protective function of LIGHT&#47;LT&#946;R-signaling in vascular injury through the prevention of osteochondrogenic phenotype acquisition&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">Given the multiple interactions and connections between the TNFSF ligands and their receptors&#44; in the present investigation we sought to investigate the potential role of the LT&#945;&#44; LIGHT and the LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> heterotrimer in the VSMC phenotype&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Human aortic VSMC cell culture experiments</span><p id="par0030" class="elsevierStylePara elsevierViewall">Human aortic &#40;ha&#41;VSMCs were commercially obtained &#40;Invitrogen&#44; C-007-5C&#44; Thermofisher Scientific&#44; Madrid&#44; Spain&#41; and cultured in 231 medium&#44; 20&#37; FBS&#44; 5&#37; of smooth muscle growth factor &#40;Invitrogen&#44; S00725 Thermofisher Scientific&#41; and 2&#37; P&#47;S&#47;A &#40;Lonza&#44; Basel&#44; Switzerland&#41; as described&#46;<a class="elsevierStyleCrossRefs" href="#bib0235"><span class="elsevierStyleSup">20&#44;22</span></a> HaVSMCs were kept on a humidified 5&#37; CO<span class="elsevierStyleInf">2</span> atmosphere until treatments and were used until passage 6&#8211;7&#46; For expression experiments haVSMC were grown in 20&#37; FBS&#47;DMEM-P&#47;S&#47;A medium on 6-well plates up to 70&#8211;80&#37; of confluency and then treated for 72<span class="elsevierStyleHsp" style=""></span>h in 0&#46;5&#37; FBS&#47;DMEM-P&#47;S&#47;A medium with vehicle&#44; human soluble LIGHT &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#44; Preprotech&#44; Germany&#44; Hamburg&#41;&#44; LT&#945; &#40;at 5 and 10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml Preprotech&#44; Germany&#44; Hamburg&#41; or with LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;at 20 and 100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#44; R&#38;D systems Biotechne&#44; Minneapolis&#44; Minnesota&#44; USA&#41;&#46; For protein analysis of the receptors cells were grown as before until confluency and then treated for 24<span class="elsevierStyleHsp" style=""></span>h in 0&#46;5&#37; FBS&#47;DMEM-P&#47;S&#47;A medium with vehicle or human soluble LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#46; After treatments&#44; cells were rinsed with PBS 1&#215;&#44; collected by centrifugation &#40;500<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span>&#44; 10<span class="elsevierStyleHsp" style=""></span>min&#41; snap-frozen with liquid N<span class="elsevierStyleInf">2</span> and stored for gene expression analysis by qPCR&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Gene expression analysis by quantitative real-time PCR &#40;qPCR&#41;</span><p id="par0035" class="elsevierStylePara elsevierViewall">Total RNA was obtained from cultured haVSMCs treated as indicated above using TRIzol reagent following manufacturer recomendations &#40;Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41;&#46; A total of 500<span class="elsevierStyleHsp" style=""></span>ng of RNA were reverse transcribed with the Maxima First-Strand kit &#40;Fermentas&#44; Waltham&#44; MA&#44; USA&#41;&#46; The genes of interest were amplified with Luminaris Color HiGreen High ROX qPCR Master Mix &#40;Fermentas&#44; Waltham&#44; MA&#44; USA&#41; on a 7900 FastSystem thermal cycler and results were analyzed with the formula 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span>&#46; mRNA levels were normalized to the GAPDH mRNA levels and relativized to vehicle-treated cells&#46; The primer sequences were obtained from the PrimerBank data base &#40;Massachusetts General Hospital&#44; Harvard University&#41; and are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Western Blot analysis</span><p id="par0040" class="elsevierStylePara elsevierViewall">Protein extracts were obtained by homogenization of haVSMCs in the presence of ice-cold lysis TNG buffer &#40;Tris&#8211;HCl 50<span class="elsevierStyleHsp" style=""></span>mM&#44; pH 7&#46;5&#44; NaCl 200<span class="elsevierStyleHsp" style=""></span>mM&#44; Tween-20 1&#37; vol&#47;vol&#44; NP-40 0&#46;2&#37; vol&#47;vol&#41; supplemented with Complete Mini cocktail&#44; PhosSTOP &#40;Roche&#44; Mannheim&#44; Germany&#41;&#44; beta-glycerophosphate 50<span class="elsevierStyleHsp" style=""></span>mM &#40;Sigma&#41;&#44; 2<span class="elsevierStyleHsp" style=""></span>mM phenylmethylsulfonyl fluoride &#40;PMSF&#44; Roche&#41; and 200<span class="elsevierStyleHsp" style=""></span>&#956;M Na<span class="elsevierStyleInf">3</span>VO<span class="elsevierStyleInf">4</span> &#40;Sigma&#41;&#46; For protein analysis&#44; protein extracts &#40;25&#8211;50<span class="elsevierStyleHsp" style=""></span>&#956;g&#41; were prepared with Laemmli buffer &#40;5<span class="elsevierStyleHsp" style=""></span>min 95<span class="elsevierStyleHsp" style=""></span>&#176;C&#41; and subjected to 12&#37; w&#47;v polyacrylamide gel electrophoresis and western blot as described&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">10</span></a> The following primary &#40;1&#47;200&#41; and secondary &#40;1&#47;2000&#41; antibodies were used to detect the proteins&#58; HVEM &#40;PA5-20237&#44; ThermoFisher&#41;&#44; LT&#946;R &#40;ab70063&#44; Abcam&#41; and &#946;-actin &#40;Sigma&#41;&#44; anti-mouse IgG-HRP &#40;P0447&#44; Dako&#41; and goat anti-rabbit IgG-HRP &#40;P0448&#44; Dako&#41;&#46; The immunocomplexes were detected with an ECL Plus detection kit &#40;ThermoFisher&#41;&#46; All antibodies for western blot were acquired and used after checking that validation was performed by the manufacturer company&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Statistical analysis</span><p id="par0045" class="elsevierStylePara elsevierViewall">Quantitative data are presented as the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>the standard error of the mean &#40;SEM&#41; and with the single data points&#46; All samples were randomly treated and analyzed by observers blinded to treatments&#46; Treatments and collection of data were obtained at the same time and order to avoid confounding effects&#46; The exclusion criteria were applied when data was out of range of the standard curve in each experiment&#44; when samples were lost during the experimentation and when the &#40;non-iterative&#41; Grubbs test identified outliers&#46; Statistical tests were applied after the determination of normal distribution &#40;Shapiro&#8211;Wilk and D&#8217;Agostino&#8211;Pearson normality tests&#41; and equality of variances &#40;<span class="elsevierStyleItalic">F</span> test&#41;&#46; Differences were evaluated with unpaired Student&#39;s t test&#44; Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test &#40;for nonparametric distribution&#41; and one-way ANOVA followed by Bonferroni multiple comparison test &#40;more than two groups&#41;&#46; All statistical tests were run in GraphPad Prism 9&#46;0&#46;0 &#40;GraphPad Prism Software&#44; La Jolla&#44; CA&#44; USA&#41;&#46; Differences were considered statistically significant when <span class="elsevierStyleItalic">p</span>-values were below 0&#46;05&#58; &#42;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p></span></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Results</span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Aortic human vascular smooth muscle cells express LT&#946;R and HVEM</span><p id="par0050" class="elsevierStylePara elsevierViewall">LT&#946;R is expressed mainly in stromal and epithelial cells while HVEM is mainly found in immune cells&#46; However&#44; the expression of LT&#946;R and HVEM in liver and adipose tissue<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">10</span></a> and the expression of <span class="elsevierStyleItalic">LTBR</span> gene in haVSMC<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">20</span></a> has been previously described&#46; To assess whether the TNFSF ligands can signal in haVSMCs protein analysis was performed&#46; Analysis of both LT&#946;R and HVEM receptors in vehicle- and LIGHT-treated haVSMC indicated the presence of both receptors in these cells with similar levels regardless of the treatment &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#44; B&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">LT&#945; and LIGHT but not LT&#945;1&#946;2 decrease myofibroblast markers in aortic human vascular smooth muscle cells</span><p id="par0055" class="elsevierStylePara elsevierViewall">The potential effect of the LTs and LIGHT in haVSMC phenotype switching was explored by using the expression of different markers for myofibroblast-like cell&#46; Analysis of myofibroblast-like cell genes showed reduced expression of <span class="elsevierStyleItalic">COL1A1</span> and <span class="elsevierStyleItalic">TGFB1</span> mRNA levels in haVSMCs treated with LT&#945; at 10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml compared with vehicle-treated cells &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#44; C&#41;&#46; HaVSMCs treated with LT&#945; at a lower dose of 5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml also displayed reduced mRNA levels of <span class="elsevierStyleItalic">TGFB1</span> and enhanced expression of <span class="elsevierStyleItalic">MMP9</span> compared with vehicle-treated haVSMCs &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C&#44; E&#41;&#46; No changes were observed in the expression of <span class="elsevierStyleItalic">ACTA2</span> or in <span class="elsevierStyleItalic">MMP2</span> genes &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#44; D&#41;&#46; Likewise&#44; haVSMCs treated with LIGHT displayed diminished <span class="elsevierStyleItalic">COL1A1</span> and <span class="elsevierStyleItalic">TGFB1</span> mRNA gene expression &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#44; C&#41; with no changes in <span class="elsevierStyleItalic">ACTA2</span>&#44; <span class="elsevierStyleItalic">MMP2</span> or <span class="elsevierStyleItalic">MMP9</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A&#44; D&#44; E&#41;&#46; Treatment of haVSMCs with the trimer LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> did not affect <span class="elsevierStyleItalic">ACTA2</span>&#44; <span class="elsevierStyleItalic">COL1A1</span>&#44; <span class="elsevierStyleItalic">TGFB1</span> and <span class="elsevierStyleItalic">MMP9</span> mRNA levels at any of the two doses tested &#40;20 or 100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#8211;D&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Aortic human vascular smooth muscle cells treated with LT&#945; and LIGHT but not display decreased expression of CKIT and KLF4 genes</span><p id="par0060" class="elsevierStylePara elsevierViewall">Next&#44; we evaluated a possible effect of LIGHT and LT signaling in genes related with pluripotency and osteochondrogenic phenotypes&#46; Treatment of haVSMCs with LT&#945; at 10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#44; but not with LIGHT&#44; significantly decreased the expression of <span class="elsevierStyleItalic">SOX9</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>A&#41;&#46; Reduced mRNA levels of <span class="elsevierStyleItalic">CKIT</span> and <span class="elsevierStyleItalic">KLF4</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>B&#44; C&#41; were also observed in haVSMC treated with LIGHT and with LT&#945; at the both 5 and 10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml doses&#46; Neither LIGHT or LT&#945; affected the gene expression of <span class="elsevierStyleItalic">OCT4</span> or <span class="elsevierStyleItalic">KLF10</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>D&#44; E&#41;&#46; Similarly&#44; compared with vehicle-treated controls&#44; haVSMCs treated with LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> did not display altered mRNA levels of <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">CKIT</span>&#44; <span class="elsevierStyleItalic">OCT4</span>&#44; <span class="elsevierStyleItalic">KLF4</span> or <span class="elsevierStyleItalic">KLF10</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>F&#8211;J&#41;&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><p id="par0065" class="elsevierStylePara elsevierViewall">Aortic human vascular smooth muscle cells treated with LT&#945;&#44; LIGHT and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> modulate the expression of lymphorganogenic cytokines</p><p id="par0070" class="elsevierStylePara elsevierViewall">One of the described effects of LT&#946;R-dependent signaling in VSMCs is the induction of a cellular phenotype secretor of lymphorganogenic cytokines&#44; hence the production of these were studied&#46; The analysis of haVSMC treated with LT&#945; revealed an increase in the gene expression of <span class="elsevierStyleItalic">CCL20</span> and <span class="elsevierStyleItalic">CXCL16</span> at the 10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml dose &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A&#44; D&#41; and of <span class="elsevierStyleItalic">CCL20</span> at 5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml dose &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A&#41; compared with vehicle-treated VSMCs while the mRNA levels of <span class="elsevierStyleItalic">CCL21</span> were unaffected by LT&#945; &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>C&#41;&#46; Unlike LT&#945;&#44; LIGHT did not modify the gene expression of <span class="elsevierStyleItalic">CCL20</span> and <span class="elsevierStyleItalic">CXCL16</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A&#44; D&#41; and surprisingly diminished <span class="elsevierStyleItalic">CCL21</span> mRNA levels &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>B&#41;&#46; The mRNA levels of <span class="elsevierStyleItalic">CXCL13</span> were unaffected by either LT&#945; or LIGHT treatment &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>C&#41;&#46; Interestingly&#44; the treatment of haVSMCs with the trimer LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span>&#44; at both 20 and 100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml doses&#44; decreased the expression of the <span class="elsevierStyleItalic">CXCL13</span> gene &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>G&#41; while no changes were observed in the other cytokines &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>E&#44; F&#44; H&#41;&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">LT&#945; and LIGHT dependent signaling does not affect the expression of macrophage markers in aortic human vascular smooth muscle cells</span><p id="par0075" class="elsevierStylePara elsevierViewall">Previous studies have shown a modulation of macrophage-like cell phenotype through upregulation of <span class="elsevierStyleItalic">KLF4&#46;</span><a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">23</span></a> Given the lower <span class="elsevierStyleItalic">KLF4</span> mRNA levels observed in haVSMCs treated with LIGHT and with LT&#945;&#44; the expression of macrophage gene markers were also investigated&#46; Although the treatments with both LIGHT and LT&#945; slightly increased the gene expression of the surface membrane markers of macrophage subtypes including <span class="elsevierStyleItalic">CD14</span>&#44; <span class="elsevierStyleItalic">CD80</span>&#44; <span class="elsevierStyleItalic">CD206</span> and <span class="elsevierStyleItalic">CD183</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>A&#8211;D&#41; and of phagocytic activity&#44; <span class="elsevierStyleItalic">CD68</span> &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>E&#41; these were no significantly altered&#46; Likewise&#44; no differences were observed in the expression of proinflammatory cytokine genes typically expressed by macrophages&#44; such as <span class="elsevierStyleItalic">MCP1</span>&#44; <span class="elsevierStyleItalic">IL6</span> and <span class="elsevierStyleItalic">IFNG&#44;</span> between vehicle- and LT&#945;- or LIGHT-treated haVSMCs &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>F&#8211;H&#41;&#46;</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Discussion</span><p id="par0080" class="elsevierStylePara elsevierViewall">Atheroma plaque instability is strongly affected by VSMC functional transdifferentiation<a class="elsevierStyleCrossRefs" href="#bib0160"><span class="elsevierStyleSup">5&#44;22</span></a> in which different risk factors and secreted plaque mediators have been importantly implicated&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">24</span></a> In the present investigation&#44; the potential effect of TNFSF ligands in the modulation of VSMC gene expression associated with functional heterogeneity was explored&#46; Consistent with a preservation of VSMC identity&#44; the treatment of VSMCs with LT&#945; or LIGHT diminished <span class="elsevierStyleItalic">COL1A1</span> and <span class="elsevierStyleItalic">TGFB1</span> mRNA levels&#44; LT&#945; incubation augmented the expression of <span class="elsevierStyleItalic">MMP9</span>&#44; without changing <span class="elsevierStyleItalic">ACTA2</span> mRNA levels&#46; Likewise&#44; genes associated with osteochondrogenesis&#44; pluripotency and transdifferentiation such as <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">CKIT</span>&#44; and <span class="elsevierStyleItalic">KLF4</span> were also repressed by LT&#945; and LIGHT treatments&#46; Notably&#44; all the above genes were not affected by the treatment with the LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> trimer&#46; VSMC treatment with all three ligands&#44; LT&#945;&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> and LIGHT&#44; altered the expression of well-reported lymphorganogenic cytokines<a class="elsevierStyleCrossRefs" href="#bib0165"><span class="elsevierStyleSup">6&#44;25</span></a> which included augmented <span class="elsevierStyleItalic">CCL20</span> and <span class="elsevierStyleItalic">CCL21</span> gene expression by LT&#945; as well as diminished <span class="elsevierStyleItalic">CCL21</span> and <span class="elsevierStyleItalic">CXCL13</span> by LIGHT and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span>&#44; respectively&#46; Altogether&#44; indicates a role of the TNFSF ligands through their interconnected network of signaling&#44; in the preservation of VSMC identity against the acquisition of a genetic expression signature compatible with a functional transdifferentiation process&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">Studies have shown an important role of the cross-talk between the plaque-stress factors and the functional plasticity of VSMC&#46; Thus&#44; VSMC functionality loss consisting in an acquisition of an inflammatory and apoptotic phenotype promotes plaque instability in insulin resistance states through a CX3CL1-dependet manner&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">22</span></a> More recent investigations using cellular lineage tracing and single-cell RNAseq in plaque have further extended our knowledge about VSMC plasticity during plaque progression&#46;<a class="elsevierStyleCrossRefs" href="#bib0250"><span class="elsevierStyleSup">23&#44;26</span></a> Specifically&#44; <span class="elsevierStyleItalic">in vivo</span> VSMC specific deficiency in <span class="elsevierStyleItalic">Oct4</span> or <span class="elsevierStyleItalic">Klf4</span> in mouse models resulted in two divergent genomic signatures associated with different VSMC fates and function such as osteochondrocyte-like and macrophage-like gene signatures&#46;<a class="elsevierStyleCrossRefs" href="#bib0250"><span class="elsevierStyleSup">23&#44;27</span></a> Notably&#44; protective ACTA2&#43; myofibroblast-like cells forming the fibrous caps were discovered to originate from endothelial-to-mesenchymal transition and macrophage-to-mesenchymal transition&#44; a process dependent of <span class="elsevierStyleItalic">Pdgfrb</span> gene&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">27</span></a></p><p id="par0090" class="elsevierStylePara elsevierViewall">Our present investigation indicates a gene repression by LT&#945; and LIGHT of <span class="elsevierStyleItalic">COL1A1</span> and <span class="elsevierStyleItalic">TGFB1</span>&#44; <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">CKIT</span>&#44; and <span class="elsevierStyleItalic">KLF4</span> genes&#44; results that are consistent with the above studies indicating important roles of some of these genes in plaque instability through VSMC phenotype switching&#46; On the other hand&#44; LIGHT&#47;LT&#946;R-dependent signaling has as well been linked to atherosclerosis with discrepant conclusions<a class="elsevierStyleCrossRefs" href="#bib0195"><span class="elsevierStyleSup">12&#44;13&#44;15&#8211;19</span></a> which we believe might be attributed to the intrincated network signaling of the TFNSF ligands&#46; The present investigation is also in agreement with a study describing a protective function of LIGHT in aneurysm lesion<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">20</span></a> and a prevention by LIGHT of <span class="elsevierStyleItalic">SOX9</span> gene expression which is associated with an osteochondrogenic and proatherogenic phenotype&#46; Consequently&#44; <span class="elsevierStyleItalic">in vivo</span> analysis showed diminished ACTA2&#43; lesion area and vascular <span class="elsevierStyleItalic">Col1a1</span> gene expression&#44;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">20</span></a> suggesting a protective role for LIGHT by preventing VSMC de-differentiation and plasticity <span class="elsevierStyleItalic">in vivo</span> during vascular injury&#46; Of note&#44; as in the present investigation&#44; LIGHT did not affect the <span class="elsevierStyleItalic">in vitro</span> gene expression of the <span class="elsevierStyleItalic">ACTA2</span> contractile marker in haVSMCs which could be due to a high prevalence of ACTA2&#43; myofibroblast-like cells<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">26</span></a> which could difficult the detection of other non-contractile cells originated during the transdifferentiation process&#46; Hence&#44; changes in gene expression were performed in the cell culture probably containing a mixed pool of cells with different cell-type phenotypes which could mask gene expression changes belonging to a less prevalent cell-type&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Therefore&#44; a limitation of our results is that our study is based on gene expression techniques and hence future studies would require the detection of active proteins as well as the performance of functional assays to better characterize each cell-type&#46; To avoid the above limitations&#44; future studies should include experimental approaches such as single-cell RNAseq or flow-cytometry analysis using several markers to identify&#44; fractionate and quantify the different cell-types induced by LT&#945;&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> and LIGHT&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">In addition&#44; a modulation by the TNFSF ligands of lymphorganogenic cytokines&#44; including enhanced <span class="elsevierStyleItalic">CCL20</span> and <span class="elsevierStyleItalic">CCL21</span> gene expression and diminished <span class="elsevierStyleItalic">CCL21</span> and <span class="elsevierStyleItalic">CXCL13</span>&#44; has been also observed in the present investigation which suggest a coordinated role of these ligands in cytokine-mediated lymphorganogenesis&#46; In the line of these results&#44; VSMC <span class="elsevierStyleItalic">Ltbr</span>-specific deficiency in mice prevented this cell type to acquire a protective lymphorganogenic PDGFRB&#43; phenotype&#44;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">19</span></a> and aggravated lesion size&#44; suggesting a role in lymphorganogenesis associated with plaque stability&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">Altogether&#44; the present investigation indicates a role of the TNFSF ligands in VSMC gene expression of genes relevant for cellular plasticity and reprogramming events during plaque lesion development and stability&#46; Therefore&#44; these data suggest a possible role of these ligands in cellular plasticity during atheroma development&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Conclusions</span><p id="par0110" class="elsevierStylePara elsevierViewall">The TNFSF ligands through its interconnected network signaling modulate haVSMC gene expression signature associated with cellular plasticity&#46; These results suggest a possible role of the TNFSF ligands in plaque stability&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Funding</span><p id="par0115" class="elsevierStylePara elsevierViewall">This research was funded by grants from the <span class="elsevierStyleGrantSponsor" id="gs1">ISCIII</span> &#40;PI19&#47;00169 to H&#46;G&#46;-N&#46; and S&#46;M&#46;-H&#46; and CIBERDEM CB07&#47;08&#47;0043&#44; CB07&#47;08&#47;0018&#41;&#44; the <span class="elsevierStyleGrantSponsor" id="gs2">European Regional Development Fund</span> &#40;FEDER&#41;&#44; <span class="elsevierStyleGrantSponsor" id="gs3">GenT Investigator</span> &#40;CDEI-04-20-B&#44; GVA&#41; and by the <span class="elsevierStyleGrantSponsor" id="gs4">Spanish Arteriosclerosis Society</span> &#40;BIB 07-20&#41;&#46; MAB received support from a fellowship of ISCIII and the European Regional Development Fund &#40;FEDER&#41; &#40;FI20&#47;00017&#41; and GHG from the <span class="elsevierStyleGrantSponsor" id="gs5">Ministerio de Universidades</span> &#40;FPU20&#47;04916&#41;&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conflict of interests</span><p id="par0120" class="elsevierStylePara elsevierViewall">The authors have no conflict of interests to declare&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres2011097"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Objective"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Material and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1722740"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1722741"
          "titulo" => "Abbreviations"
        ]
        3 => array:3 [
          "identificador" => "xres2011098"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Objetivo"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Materiales y m&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusiones"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1722739"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        6 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Human aortic VSMC cell culture experiments"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Gene expression analysis by quantitative real-time PCR &#40;qPCR&#41;"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Western Blot analysis"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0035"
          "titulo" => "Results"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Aortic human vascular smooth muscle cells express LT&#946;R and HVEM"
            ]
            1 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "LT&#945; and LIGHT but not LT&#945;1&#946;2 decrease myofibroblast markers in aortic human vascular smooth muscle cells"
            ]
            2 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Aortic human vascular smooth muscle cells treated with LT&#945; and LIGHT but not display decreased expression of CKIT and KLF4 genes"
            ]
            3 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "LT&#945; and LIGHT dependent signaling does not affect the expression of macrophage markers in aortic human vascular smooth muscle cells"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Conclusions"
        ]
        10 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Funding"
        ]
        11 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conflict of interests"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-04-06"
    "fechaAceptado" => "2022-05-22"
    "PalabrasClave" => array:2 [
      "en" => array:2 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1722740"
          "palabras" => array:4 [
            0 => "Vascular smooth muscle cells"
            1 => "Inflammation"
            2 => "Lymphotoxin"
            3 => "Cellular plasticity"
          ]
        ]
        1 => array:4 [
          "clase" => "abr"
          "titulo" => "Abbreviations"
          "identificador" => "xpalclavsec1722741"
          "palabras" => array:10 [
            0 => "DcR"
            1 => "HVEM"
            2 => "JNK"
            3 => "LT"
            4 => "LT&#946;R"
            5 => "NFkB"
            6 => "Th"
            7 => "TNFR"
            8 => "TNFSF"
            9 => "VSMC"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1722739"
          "palabras" => array:4 [
            0 => "C&#233;lulas musculares lisas vasculares"
            1 => "Inflamaci&#243;n"
            2 => "Linfotoxina"
            3 => "Plasticidad celular"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Vascular smooth muscle cells &#40;VSMCs&#41; undergo a phenotypic-switching process during the generation of unstable atheroma plaques&#46; In this investigation&#44; the potential implication of the tumor necrosis factor superfamily &#40;TNFSF&#41; ligands&#44; in the gene expression signature associated with VSMC plasticity was studied&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Material and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Human aortic &#40;ha&#41;VSMCs were obtained commercially and treated with the cytokine TNFSF14&#44; also called LIGHT&#44; the lymphotoxin alpha &#40;LT&#945;&#41;&#44; the heterotrimer LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> or with vehicle for 72<span class="elsevierStyleHsp" style=""></span>h&#46; The effect of the different treatments on gene expression was analyzed by quantitative PCR and included the study of genes associated with myofibroblast-like cell function&#44; osteochondrogenesis&#44; pluripotency&#44; lymphorganogenesis and macrophage-like cell function&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">HaVSMCs displayed a change in myofibroblast-like cell genes which consisted in reduced <span class="elsevierStyleItalic">COL1A1</span> and <span class="elsevierStyleItalic">TGFB1</span> mRNA levels when treated with LT&#945; or LIGHT and with augmented <span class="elsevierStyleItalic">MMP9</span> expression levels when treated with LT&#945;&#46; LT&#945; and LIGHT treatments also diminished the expression of genes associated with osteochondrogenesis and pluripotency <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">CKIT</span>&#44; and <span class="elsevierStyleItalic">KLF4&#46;</span> By contrary&#44; all the above genes were no affected by the treatment with the trimer LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span>&#46; In addition&#44; haVSMC treatment with LT&#945;&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> and LIGHT altered lymphorganogenic cytokine gene expression which consisted of augmented <span class="elsevierStyleItalic">CCL20</span> and <span class="elsevierStyleItalic">CCL21</span> mRNA levels by LT&#945; and a reduction in the gene expression of <span class="elsevierStyleItalic">CCL21</span> and <span class="elsevierStyleItalic">CXCL13</span> by LIGHT and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> respectively&#46; Neither&#44; LT&#945; or LIGHT or LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> treatments affected the expression of macrophage-like cell markers in haVSMC&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Altogether&#44; indicates that the TNFSF ligands through their interconnected network of signaling&#44; are important in the preservation of VSMC identity against the acquisition of a genetic expression signature compatible with functional cellular plasticity&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Objective"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Material and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusions"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Objetivo</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La transici&#243;n de placa de ateroma estable a placa inestable implica&#44; entre otros procesos&#44; un cambio fenot&#237;pico de las c&#233;lulas del m&#250;sculo liso vascular &#40;CMLVs&#41;&#46; En esta investigaci&#243;n&#44; se estudi&#243; el posible papel de los ligandos de la superfamilia del factor de necrosis tumoral &#40;TNFSF&#41;&#44; en los cambios de expresi&#243;n g&#233;nica asociada a la plasticidad de las CMLVs&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Materiales y m&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Las CMLVs de aorta humana &#40;CMLVah&#41; se obtuvieron comercialmente y se trataron con la citoquina TNFSF14&#44; tambi&#233;n llamada LIGHT&#44; la linfotoxina alfa &#40;LT&#945;&#41;&#44; el heterotr&#237;mero LT&#945;1&#946;2 o con veh&#237;culo durante 72 horas&#46; El efecto de los diferentes tratamientos se analiz&#243; mediante el estudio de la expresi&#243;n g&#233;nica por PCR cuantitativa e incluy&#243; genes asociados con fenotipo miofibrobl&#225;stico&#44; osteocondrog&#233;nico&#44; genes de pluripotencia&#44; genes de linforganog&#233;nesis y genes caracter&#237;sticos de macr&#243;fagos&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El estudio de genes asociados a fenotipo miofibrobl&#225;stico en las CMLVah revel&#243; una reducci&#243;n de la expresi&#243;n g&#233;nica de <span class="elsevierStyleItalic">COL1A1</span> y <span class="elsevierStyleItalic">TGFB1</span> tras el tratamiento con LT&#945; o LIGHT mientras que el tratamiento con LT&#945; aument&#243; los niveles de mRNA de <span class="elsevierStyleItalic">MMP9</span>&#46; LT&#945; y LIGHT tambi&#233;n disminuyeron la expresi&#243;n de genes de osteocondrog&#233;nesis y pluripotencia como <span class="elsevierStyleItalic">SOX9</span>&#44; <span class="elsevierStyleItalic">CKIT</span> y <span class="elsevierStyleItalic">KLF4</span>&#46; Por el contrario&#44; la expresi&#243;n de los genes anteriores no se vio afectada por el tratamiento con el tr&#237;mero LT&#945;1&#946;2&#46; El tratamiento de las CMLVah con LT&#945;&#44; LT&#945;1&#946;2 y LIGHT alter&#243; la expresi&#243;n g&#233;nica de citoquinas linforganog&#233;nicas con una expresi&#243;n aumentada de los genes <span class="elsevierStyleItalic">CCL20</span> y <span class="elsevierStyleItalic">CCL21</span> por LT&#945; y una reducci&#243;n de los niveles de mRNA de <span class="elsevierStyleItalic">CCL21</span> y <span class="elsevierStyleItalic">CXCL13</span> por LIGHT y LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span>&#44; respectivamente&#46; Ninguno de los tres tratamientos alter&#243; la expresi&#243;n de genes t&#237;picos de macr&#243;fagos en las CMLVah&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusiones</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La presente investigaci&#243;n indica que los ligandos de la familia de los TNFSF a trav&#233;s de su red de se&#241;alizaci&#243;n&#44; son importantes en la preservaci&#243;n de la identidad de las CMLVs frente a la adquisici&#243;n de una expresi&#243;n g&#233;nica compatible con una mayor plasticidad celular funcional&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Objetivo"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Materiales y m&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusiones"
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1201
            "Ancho" => 1675
            "Tamanyo" => 119578
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Analysis of the LT&#946;R and HVEM protein content in haVSMC&#46; Protein quantification in the western blot analysis displayed as &#40;A&#41; LT&#946;R&#47;&#946;-actin and &#40;B&#41; HVEM&#47;&#946;-actin ratios in haVSMC treated with vehicle or LIGHT 20<span class="elsevierStyleHsp" style=""></span>ng&#47;&#956;l overnight&#46; Representative blots are shown for the western blot analysis&#46; Statistical analysis were performed by the Student&#39;s <span class="elsevierStyleItalic">t</span>-test&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1977
            "Ancho" => 3175
            "Tamanyo" => 326809
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Expression analysis of genes related to the acquisition of haVSMC contractile and secretory phenotype&#46; Relative expression levels of &#40;A&#41; <span class="elsevierStyleItalic">ACTA2</span>&#44; &#40;B&#41; <span class="elsevierStyleItalic">COL1A1</span>&#44; &#40;C&#41; <span class="elsevierStyleItalic">TGFB1</span>&#44; &#40;D&#41; <span class="elsevierStyleItalic">MMP2</span> and &#40;E&#41; <span class="elsevierStyleItalic">MMP9</span> in ahVSMC treated with vehicle&#44; LT&#945; &#40;5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#44; LT&#945; &#40;10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#46; mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1914
            "Ancho" => 2175
            "Tamanyo" => 194556
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Expression analysis in haVSMC of genes associated to the acquisition of contractile and secretory phenotype&#46; Relative expression levels of &#40;A&#41; <span class="elsevierStyleItalic">ACTA2</span>&#44; &#40;B&#41; <span class="elsevierStyleItalic">COL1A1</span>&#44; &#40;C&#41; <span class="elsevierStyleItalic">TGFB1</span> and &#40;D&#41; <span class="elsevierStyleItalic">MMP2</span> in haVSMC treated with vehicle&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#46; mRNA levels were normalized with the levels of the endogenous gene and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 3748
            "Ancho" => 3175
            "Tamanyo" => 589627
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Expression analysis of genes of pluripotency and osteochondrogenesis in haVSMC&#46; Relative expression mRNA levels of &#40;A&#44; F&#41; <span class="elsevierStyleItalic">SOX9</span>&#44; &#40;B&#44; G&#41; <span class="elsevierStyleItalic">CKIT</span>&#44; &#40;C&#44; H <span class="elsevierStyleItalic">OCT4</span>&#44; &#40;D&#44; I&#41; <span class="elsevierStyleItalic">KLF4</span> and &#40;E&#44; J&#41; <span class="elsevierStyleItalic">KLF10</span> in haVSMC treated with vehicle&#44; LT&#945; &#40;5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#44; LT&#945; &#40;10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; &#40;A&#8211;&#41; and with vehicle&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; &#40;F&#8211;J&#41;&#46; mRNA levels were normalized with the levels of the endogenous gene and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59;&#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 4175
            "Ancho" => 2261
            "Tamanyo" => 498288
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Gene expression analysis of lymphorganogenic cytokines in haVSMC&#46; Relative expression levels of &#40;A&#44; E&#41; <span class="elsevierStyleItalic">CCL20</span>&#44; &#40;B&#44; F&#41; <span class="elsevierStyleItalic">CCL21</span>&#44; &#40;C&#44; G&#41; <span class="elsevierStyleItalic">CXCL13</span> and &#40;D&#44; H&#41; <span class="elsevierStyleItalic">CXCL16</span> in ahVSMC treated with vehicle&#44; LT&#945; &#40;5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#44; LT&#945; &#40;10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; &#40;A&#8211;D&#41; and with vehicle&#44; LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LT&#945;<span class="elsevierStyleInf">1</span>&#946;<span class="elsevierStyleInf">2</span> &#40;100<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; &#40;E&#8211;H&#41;&#46; mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59;&#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "fig0030"
        "etiqueta" => "Figure 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1488
            "Ancho" => 2508
            "Tamanyo" => 319073
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Expression analysis of genes related to macrophage-like cell haVSMC&#46; Relative expression levels of &#40;A&#41; <span class="elsevierStyleItalic">CD14</span>&#44; &#40;B&#41; <span class="elsevierStyleItalic">CD80</span>&#44; &#40;C&#41; <span class="elsevierStyleItalic">CD206</span>&#44; &#40;D&#41; <span class="elsevierStyleItalic">CD163</span>&#44; &#40;E&#41; <span class="elsevierStyleItalic">CD68</span>&#44; &#40;F&#41; <span class="elsevierStyleItalic">MCP1</span>&#44; &#40;G&#41; <span class="elsevierStyleItalic">IL6</span> and &#40;H&#41; <span class="elsevierStyleItalic">IFNG</span> in haVSMC treated with vehicle&#44; LT&#945; &#40;5<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#44; LT&#945; &#40;10<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; and LIGHT &#40;50<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41;&#46; mRNA levels were normalized with the endogenous gene levels and relativized to the vehicle-treated VSMC mRNA levels&#46; Statistical analysis was performed by one-way ANOVA followed by Tukey&#39;s multiple comparisons test&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gen&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACTA2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AAAAGACAGCTACGTGGGTGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCATGTTCTATCGGGTACTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCL20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCTGTACCAAGAGTTTGCTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCACACAGACAACTTTTTCTTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCL21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTTGCCTCAAGTACAGCCAAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGAACAGGATAGCTGGGATGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CD14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCTCCGACATGCATGTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGCCCAGCGAACGACAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CD68&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGAAATGCCACGGTTCATCCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGGGTTCAGTACAGAGATGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CD80&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGGGAACATCACCATCCAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCCAGTAGATGCGACTTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CD163&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCTGCATGAATTGCACAGATAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGGGATGAGCGACCTGTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CD206&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCTACTAGGCAATGCCAATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCGTGCAATCTGCGTACCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">COL1A1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAGGGCCAAGACGAAGACATC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAGATCACGTCATCGCACAAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CXCL13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCTTGAGGTGTAGATGTGTCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCACGGGGCAAGATTTGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CXCL16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCGCCATCGGTTCAGTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCCGAGTAAGCATGTCCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTGGGCATCAATGGATTTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACACCATGTATTCCGGGTCAAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IFNG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAACGCAAGCAATACATGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTTTCGCTTCCCTGTTTTAGCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAGGAGCCCAGCTATGAAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCAGGGAGAAGGCAACTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">KIT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGTTCTGCTCCTACTGCTTCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCACGCGGACTATTAAGTCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">KLF4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCACATGAAGCGACTTCCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAGGTCCAGGAGATCGTTGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">KLF10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCAACAAGTGTGATTCGTCATAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAGCCTCAACATTTAGGTGGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MCP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTCGCCTCCAGCATGAAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGGAATGAGGGTGGCTGCTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MMP9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTACCGCTATGGTTACACTCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCAGGGACAGTTGCTTCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MMP2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TACAGGATCATTGGCTACACACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGTCACATCGCTCCAGACT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OCT4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTGGGTTGATCCTCGGACCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCATCGGAGTTGCTCTCCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SOX9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGCGAACGCACATCAAGAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTGTAGGCGATCTGTTGGGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGFB1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCCAGATCCTGTCCAAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTGGGTTTCCACCATTAGCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3338285.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Sequences of primers used for qPCR expression studies&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:27 [
            0 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immune cell profiling in atherosclerosis&#58; role in research and precision medicine"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;M&#46; Fernandez"
                            1 => "C&#46; Giannarelli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41569-021-00589-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Cardiol"
                        "fecha" => "2021"
                        "volumen" => "19"
                        "paginaInicial" => "43"
                        "paginaFinal" => "58"
                        "itemHostRev" => array:3 [
                          "pii" => "S0967586813006851"
                          "estado" => "S300"
                          "issn" => "09675868"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "T cell subsets and functions in atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46; Saigusa"
                            1 => "H&#46; Winkels"
                            2 => "K&#46; Ley"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41569-020-0352-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Cardiol"
                        "fecha" => "2020"
                        "volumen" => "17"
                        "paginaInicial" => "387"
                        "paginaFinal" => "401"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32203286"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A change in inflammatory footprint precedes plaque instability&#58; a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;A&#46; van Dijk"
                            1 => "A&#46;J&#46;F&#46; Duinisveld"
                            2 => "A&#46;F&#46; Schaapherder"
                            3 => "A&#46; Mulder-Stapel"
                            4 => "J&#46;F&#46; Hamming"
                            5 => "J&#46; Kuiper"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/JAHA.114.001403"
                      "Revista" => array:3 [
                        "tituloSerie" => "J Am Heart Assoc"
                        "fecha" => "2015"
                        "volumen" => "4"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Smooth muscle cell phenotypic switching in atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Gomez"
                            1 => "G&#46;K&#46; Owens"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/cvr/cvs115"
                      "Revista" => array:5 [
                        "tituloSerie" => "Cardiovasc Res"
                        "fecha" => "2012"
                        "paginaInicial" => "156"
                        "paginaFinal" => "164"
                        "itemHostRev" => array:3 [
                          "pii" => "S1529943015018185"
                          "estado" => "S300"
                          "issn" => "15299430"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vascular smooth muscle cell death&#44; autophagy and senescence in atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;O&#46;J&#46; Grootaert"
                            1 => "M&#46; Moulis"
                            2 => "L&#46; Roth"
                            3 => "W&#46; Martinet"
                            4 => "C&#46; Vindis"
                            5 => "M&#46;R&#46; Bennett"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/CVR/CVY007"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cardiovasc Res"
                        "fecha" => "2018"
                        "volumen" => "114"
                        "paginaInicial" => "622"
                        "paginaFinal" => "634"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29360955"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0967586814003749"
                          "estado" => "S300"
                          "issn" => "09675868"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lymphotoxin signalling in immune homeostasis and the control of microorganisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "V&#46; Upadhyay"
                            1 => "Y&#46;X&#46; Fu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nri3406"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Immunol"
                        "fecha" => "2013"
                        "volumen" => "13"
                        "paginaInicial" => "270"
                        "paginaFinal" => "279"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23524463"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Original ligand for LT&#946;R is LIGHT&#58; insight into evolution of the LT&#47;LT&#946;R system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; Maeda"
                            1 => "H&#46; Suetake"
                            2 => "T&#46; Odaka"
                            3 => "T&#46; Miyadai"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4049/jimmunol.1700900"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Immunol"
                        "fecha" => "2018"
                        "volumen" => "201"
                        "paginaInicial" => "202"
                        "paginaFinal" => "214"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The signaling networks of the herpesvirus entry mediator &#40;TNFRSF14&#41; in immune regulation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;W&#46; Steinberg"
                            1 => "T&#46;C&#46; Cheung"
                            2 => "C&#46;F&#46; Ware"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1600-065X. 2011.01064.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immunol Rev"
                        "fecha" => "2011"
                        "volumen" => "244"
                        "paginaInicial" => "169"
                        "paginaFinal" => "187"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22017438"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lymphotoxin beta receptor-dependent control of lipid homeostasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;C&#46; Lo"
                            1 => "Y&#46; Wang"
                            2 => "A&#46;V&#46; Tumanov"
                            3 => "M&#46; Bamji"
                            4 => "Z&#46; Yao"
                            5 => "C&#46;A&#46; Reardon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.1137221"
                      "Revista" => array:5 [
                        "tituloSerie" => "Science"
                        "fecha" => "2007"
                        "volumen" => "316"
                        "paginaInicial" => "285"
                        "paginaFinal" => "288"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic inactivation of the LIGHT &#40;TNFSF14&#41; cytokine in mice restores glucose homeostasis and diminishes hepatic steatosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46; Herrero-Cervera"
                            1 => "&#193;&#46; Vinu&#233;"
                            2 => "D&#46;J&#46; Burks"
                            3 => "H&#46; Gonz&#225;lez-Navarro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00125-019-4962-6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetologia"
                        "fecha" => "2019"
                        "volumen" => "62"
                        "paginaInicial" => "2143"
                        "paginaFinal" => "2157"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31388695"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The common T60N polymorphism of the lymphotoxin-alpha gene is associated with type 2 diabetes and other phenotypes of the metabolic syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;H&#46; Hamid"
                            1 => "S&#46;A&#46; Urhammer"
                            2 => "C&#46; Gl&#252;mer"
                            3 => "K&#46; Borch-Johnsen"
                            4 => "T&#46; J&#248;rgensen"
                            5 => "T&#46; Hansen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/S00125-004-1659-1"
                      "Revista" => array:7 [
                        "tituloSerie" => "Diabetologia"
                        "fecha" => "2005"
                        "volumen" => "48"
                        "paginaInicial" => "445"
                        "paginaFinal" => "451"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15729581"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1878875018328559"
                          "estado" => "S300"
                          "issn" => "18788750"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Deficiency of lymphotoxin-does not exacerbate high-fat diet-induced obesity but does enhance inflammation in mice&#46; Deficiency of lymphotoxin-does not exacerbate high-fat diet-in-duced obesity but does enhance inflammation in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "N&#46; Pamir"
                            1 => "T&#46;S&#46; McMillen"
                            2 => "K&#46;A&#46; Edgel"
                            3 => "F&#46; Kim"
                            4 => "R&#46;C&#46; LeBoeuf"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpendo.00447.2011-Lymphotoxin-(LT)"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Endocrinol Metab"
                        "fecha" => "2012"
                        "volumen" => "302"
                        "paginaInicial" => "961"
                        "paginaFinal" => "971"
                        "itemHostRev" => array:3 [
                          "pii" => "S1878875015013005"
                          "estado" => "S300"
                          "issn" => "18788750"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LIGHT is increased in patients with coronary disease and regulates inflammatory response and lipid metabolism in oxLDL-induced THP-1 macrophages"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46; Yuan"
                            1 => "Y&#46; Gu"
                            2 => "X&#46; Lai"
                            3 => "Q&#46; Gu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2017.06.110"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2017"
                        "volumen" => "490"
                        "paginaInicial" => "732"
                        "paginaFinal" => "738"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28642135"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased expression of LIGHT&#47;TNFSF14 and its receptors in experimental and clinical heart failure"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;P&#46; Dahl"
                            1 => "L&#46; Gullestad"
                            2 => "B&#46; Fevang"
                            3 => "A&#46;M&#46; Holm"
                            4 => "L&#46; Landr&#248;"
                            5 => "L&#46;E&#46; Vinge"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejheart.2008.02.010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Heart Fail"
                        "fecha" => "2008"
                        "volumen" => "10"
                        "paginaInicial" => "352"
                        "paginaFinal" => "359"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18353719"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Enhanced plasma levels of LIGHT in unstable angina"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Scholz"
                            1 => "W&#46; Sandberg"
                            2 => "J&#46;K&#46; Damas"
                            3 => "C&#46; Smith"
                            4 => "A&#46;K&#46; Andreassen"
                            5 => "L&#46; Gullestad"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.105.544676"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2005"
                        "volumen" => "112"
                        "paginaInicial" => "2121"
                        "paginaFinal" => "2129"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16186421"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circulating lymphotoxin &#946; receptor and atherosclerosis&#58; observations from the Dallas Heart Study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;W&#46; Owens"
                            1 => "S&#46; Matulevicius"
                            2 => "A&#46; Rohatgi"
                            3 => "C&#46;R&#46; Ayers"
                            4 => "S&#46;R&#46; Das"
                            5 => "A&#46; Khera"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.atherosclerosis.2010.06.003"
                      "Revista" => array:5 [
                        "tituloSerie" => "Atherosclerosis"
                        "fecha" => "2010"
                        "volumen" => "212"
                        "paginaInicial" => "601"
                        "paginaFinal" => "606"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Deficiency in lymphotoxin &#946; receptor protects from atherosclerosis in apoE-deficient mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Grandoch"
                            1 => "K&#46; Feldmann"
                            2 => "J&#46;R&#46; G&#246;thert"
                            3 => "L&#46;S&#46; Dick"
                            4 => "S&#46; Homann"
                            5 => "C&#46; Klatt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCRESAHA.116.305723"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circ Res"
                        "fecha" => "2015"
                        "volumen" => "116"
                        "paginaInicial" => "e57"
                        "paginaFinal" => "e68"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25740843"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatic lipase inactivation decreases atherosclerosis in insulin resistance by reducing LIGHT&#47;lymphotoxin &#946;-receptor pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Andr&#233;s-Blasco"
                            1 => "A&#46; Vinu&#233;"
                            2 => "A&#46; Herrero-Cervera"
                            3 => "S&#46; Martinez-Herv&#225;s"
                            4 => "L&#46; Nu&#241;ez"
                            5 => "L&#46; Piqueras"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1160/TH15-10-0773/BIB"
                      "Revista" => array:7 [
                        "tituloSerie" => "Thromb Haemost"
                        "fecha" => "2016"
                        "volumen" => "116"
                        "paginaInicial" => "379"
                        "paginaFinal" => "393"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27172975"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0967586817316302"
                          "estado" => "S300"
                          "issn" => "09675868"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Artery tertiary lymphoid organs control aorta immunity and protect against atherosclerosis via vascular smooth muscle cell lymphotoxin &#946; receptors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Hu"
                            1 => "S&#46;K&#46; Mohanta"
                            2 => "C&#46; Yin"
                            3 => "L&#46; Peng"
                            4 => "Z&#46; Ma"
                            5 => "P&#46; Srikakulapu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.immuni.2015.05.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immunity"
                        "fecha" => "2015"
                        "volumen" => "42"
                        "paginaInicial" => "1100"
                        "paginaFinal" => "1115"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26084025"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dissecting abdominal aortic aneurysm is aggravated by genetic inactivation of light &#40;Tnfsf14&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Herrero-Cervera"
                            1 => "C&#46; Espin&#243;s-Est&#233;vez"
                            2 => "S&#46; Mart&#237;n-Va&#241;&#243;"
                            3 => "A&#46; Taberner-Cort&#233;s"
                            4 => "M&#46; Aguilar-Ballester"
                            5 => "&#193;&#46; Vinu&#233;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/BIOMEDICINES9111518"
                      "Revista" => array:4 [
                        "tituloSerie" => "Biomedicines"
                        "fecha" => "2021"
                        "volumen" => "9"
                        "itemHostRev" => array:3 [
                          "pii" => "S1529943015011560"
                          "estado" => "S300"
                          "issn" => "15299430"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sox9 is increased in arterial plaque and stenosis&#44; associated with synthetic phenotype of vascular smooth muscle cells and causes alterations in extracellular matrix and calcification"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46; Augstein"
                            1 => "J&#46; Mierke"
                            2 => "D&#46;M&#46; Poitz"
                            3 => "R&#46;H&#46; Strasser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbadis.2018.05.009"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochim Biophys Acta - Mol Basis Dis"
                        "fecha" => "2018"
                        "volumen" => "1864"
                        "paginaInicial" => "2526"
                        "paginaFinal" => "2537"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29777903"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Insulin resistance aggravates atherosclerosis by reducing vascular smoothmuscle cell survival and increasing CX3CL1&#47;CX3CR1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Mart&#237;nez-Herv&#225;s"
                            1 => "&#193;&#46; Vinu&#233;"
                            2 => "L&#46; N&#250;&#241;ez"
                            3 => "I&#46; Andr&#233;s-Blasco"
                            4 => "L&#46; Piqueras"
                            5 => "J&#46; Tom&#225;sReal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/cvr/cvu115"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cardiovasc Res"
                        "fecha" => "2014"
                        "volumen" => "103"
                        "paginaInicial" => "324"
                        "paginaFinal" => "336"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24788416"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Stem cell pluripotency genes Klf4 and Oct4 regulate complex SMC phenotypic changes critical in late-stage atherosclerotic lesion pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46;F&#46; Alencar"
                            1 => "K&#46;M&#46; Owsiany"
                            2 => "S&#46; Karnewar"
                            3 => "K&#46; Sukhavasi"
                            4 => "G&#46; Mocci"
                            5 => "A&#46;T&#46; Nguyen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.120.046672"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2020"
                        "volumen" => "142"
                        "paginaInicial" => "2045"
                        "paginaFinal" => "2059"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32674599"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vascular smooth muscle cells in atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46;L&#46; Basatemur"
                            1 => "H&#46;F&#46; J&#248;rgensen"
                            2 => "M&#46;C&#46;H&#46; Clarke"
                            3 => "M&#46;R&#46; Bennett"
                            4 => "Z&#46; Mallat"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41569-019-0227-9"
                      "Revista" => array:4 [
                        "tituloSerie" => "Nat Rev Cardiol"
                        "fecha" => "2019"
                        "paginaInicial" => "727"
                        "paginaFinal" => "744"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CXCL13 and its receptor CXCR5 in cancer&#58; inflammation&#44; immune response&#44; and beyond"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;G&#46; Kazanietz"
                            1 => "M&#46; Durando"
                            2 => "M&#46; Cooke"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fendo.2019.00471"
                      "Revista" => array:7 [
                        "tituloSerie" => "Front Endocrinol &#40;Lausanne&#41;"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "numero" => "July"
                        "paginaInicial" => "1"
                        "paginaFinal" => "15"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30723457"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "KLF4-dependent phenotypic modulation of smooth muscle cells has a key role in atherosclerotic plaque pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;S&#46; Shankman"
                            1 => "D&#46; Gomez"
                            2 => "O&#46;A&#46; Cherepanova"
                            3 => "M&#46; Salmon"
                            4 => "G&#46;F&#46; Alencar"
                            5 => "R&#46;M&#46; Haskins"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nm.3866"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Med"
                        "fecha" => "2015"
                        "volumen" => "21"
                        "paginaInicial" => "628"
                        "paginaFinal" => "637"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25985364"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multiple cell types contribute to the atherosclerotic lesion fibrous cap by PDGFR&#946; and bioenergetic mechanisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;A&#46;C&#46; Newman"
                            1 => "V&#46; Serbulea"
                            2 => "R&#46;A&#46; Baylis"
                            3 => "L&#46;S&#46; Shankman"
                            4 => "X&#46; Bradley"
                            5 => "G&#46;F&#46; Alencar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s42255-020-00338-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Metab"
                        "fecha" => "2021"
                        "volumen" => "3"
                        "paginaInicial" => "166"
                        "paginaFinal" => "181"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33619382"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/25299123/0000003500000001/v3_202311162141/S2529912323000086/v3_202311162141/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "63721"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/25299123/0000003500000001/v3_202311162141/S2529912323000086/v3_202311162141/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000086?idApp=UINPBA00004N"
]

Article information

ISSN: 25299123
Original language: English

DOI:10.1016/j.artere.2023.02.002

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	3	0	3
2024 October	15	8	23
2024 September	27	10	37
2024 August	29	10	39
2024 July	19	7	26
2024 June	20	3	23
2024 May	16	10	26
2024 April	19	4	23
2024 March	25	2	27
2024 February	16	5	21
2024 January	16	1	17
2023 November	5	0	5
2023 March	1	2	3

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter