metricas
covid
Buscar en
Clínica e Investigación en Arteriosclerosis (English Edition)
Toda la web
Inicio Clínica e Investigación en Arteriosclerosis (English Edition) Association of rs662799 and rs5070 genetic polymorphisms with hypertriglyceridem...
Journal Information

Statistics

Follow this link to access the full text of the article

Original article
Association of rs662799 and rs5070 genetic polymorphisms with hypertriglyceridemia and atherogenic dyslipidemia in pediatric patients in Southeast Mexico
Valeria Ovando Gómeza, Soraya Amalí Zavaleta Muñizb, Héctor Ochoa-Díaz-Lópezc, José Armando Camilo Hernández Contrerasd, Cesar Antonio Irecta Nájeraa,
Corresponding author
cirecta@ecosur.mx

Corresponding author.
a Health Department, El Colegio de la Frontera Sur, Villahermosa, Tabasco, Mexico
b Health Sciences Faculty, Facultad de Ciencias de la Salud, Universidad Juárez del Estado de Durango, Gómez Palacio, Durango, Mexico
c Health Department, El Colegio de la Frontera Sur, San Cristóbal de las Casas, Chiapas, Mexico
d Pediatric Department, Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado, Comitán de Domínguez, Chiapas, Mexico
Read
206
Times
was read the article
62
Total PDF
144
Total HTML
Share statistics
 array:22 [
  "pii" => "S2529912323000189"
  "issn" => "25299123"
  "doi" => "10.1016/j.artere.2023.05.002"
  "estado" => "S300"
  "fechaPublicacion" => "2023-03-01"
  "aid" => "651"
  "copyright" => "Sociedad Española de Arteriosclerosis"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Clin Investig Arterioscler. 2023;35:53-63"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S2529912323000153"
    "issn" => "25299123"
    "doi" => "10.1016/j.artere.2023.03.002"
    "estado" => "S300"
    "fechaPublicacion" => "2023-03-01"
    "aid" => "652"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Clin Investig Arterioscler. 2023;35:64-74"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Prevalence rates of chronic kidney disease and its association with cardiometabolic factors and cardiovascular diseases&#46; SIMETAP-CKD study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "64"
          "paginaFinal" => "74"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Tasas de prevalencia de enfermedad renal cr&#243;nica y su asociaci&#243;n con factores cardiometab&#243;licos y enfermedades cardiovasculares&#46; Estudio SIMETAP-ERC"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1295
              "Ancho" => 2508
              "Tamanyo" => 198686
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0005"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">CKD prevalence rates by age and sex&#46; CKD&#58; chronic kidney disease&#59; M&#58; male&#59; F&#58; female&#59; n&#58; number of cases&#59; N&#58; sample size&#59; p&#58; p-value of the difference &#40;M&#8211;F&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Antonio Ruiz-Garcia, Ezequiel Arranz-Mart&#237;nez, Nerea Iturmendi-Mart&#237;nez, Teresa Fern&#225;ndez-Vicente, Montserrat Rivera-Teijido, Juan Carlos Garc&#237;a-&#193;lvarez"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Antonio"
              "apellidos" => "Ruiz-Garcia"
            ]
            1 => array:2 [
              "nombre" => "Ezequiel"
              "apellidos" => "Arranz-Mart&#237;nez"
            ]
            2 => array:2 [
              "nombre" => "Nerea"
              "apellidos" => "Iturmendi-Mart&#237;nez"
            ]
            3 => array:2 [
              "nombre" => "Teresa"
              "apellidos" => "Fern&#225;ndez-Vicente"
            ]
            4 => array:2 [
              "nombre" => "Montserrat"
              "apellidos" => "Rivera-Teijido"
            ]
            5 => array:2 [
              "nombre" => "Juan Carlos"
              "apellidos" => "Garc&#237;a-&#193;lvarez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0214916822001024"
        "doi" => "10.1016/j.arteri.2022.07.002"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0214916822001024?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000153?idApp=UINPBA00004N"
    "url" => "/25299123/0000003500000002/v5_202401310708/S2529912323000153/v5_202401310708/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Association of rs662799 and rs5070 genetic polymorphisms with hypertriglyceridemia and atherogenic dyslipidemia in pediatric patients in Southeast Mexico"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "53"
        "paginaFinal" => "63"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Valeria Ovando G&#243;mez, Soraya Amal&#237; Zavaleta Mu&#241;iz, H&#233;ctor Ochoa-D&#237;az-L&#243;pez, Jos&#233; Armando Camilo Hern&#225;ndez Contreras, Cesar Antonio Irecta N&#225;jera"
        "autores" => array:5 [
          0 => array:3 [
            "nombre" => "Valeria"
            "apellidos" => "Ovando G&#243;mez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Soraya Amal&#237;"
            "apellidos" => "Zavaleta Mu&#241;iz"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "H&#233;ctor"
            "apellidos" => "Ochoa-D&#237;az-L&#243;pez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Jos&#233; Armando Camilo"
            "apellidos" => "Hern&#225;ndez Contreras"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:4 [
            "nombre" => "Cesar Antonio"
            "apellidos" => "Irecta N&#225;jera"
            "email" => array:1 [
              0 => "cirecta@ecosur.mx"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Health Department&#44; El Colegio de la Frontera Sur&#44; Villahermosa&#44; Tabasco&#44; Mexico"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Health Sciences Faculty&#44; Facultad de Ciencias de la Salud&#44; Universidad Ju&#225;rez del Estado de Durango&#44; G&#243;mez Palacio&#44; Durango&#44; Mexico"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Health Department&#44; El Colegio de la Frontera Sur&#44; San Crist&#243;bal de las Casas&#44; Chiapas&#44; Mexico"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Pediatric Department&#44; Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado&#44; Comit&#225;n de Dom&#237;nguez&#44; Chiapas&#44; Mexico"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1501
            "Ancho" => 2091
            "Tamanyo" => 272455
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Mechanism of C-HDL biosynthesis and the interaction with rs5070 polymorphism&#46; ABCA1&#58; ATP binding cassette subfamily A member 1&#59; A1&#58; apolipoprotein AI&#59; AII&#59; apolipoprotein AII&#59; HDL-C&#58; high density lipoprotein cholesterol&#59; LCAT&#58; lecithin cholesterol acyl transferase&#59; PL&#58; phospholipids&#59; FC&#59; free cholesterol&#59; LRTG&#58; lipoprotein rich in triglycerides&#46; &#40;a&#41; ApoA1 is predominantly secreted by the liver and intestine as lipid-poor ApoA1&#44; ApoA1 acquires FC and PL&#44; creating nascent HDL-C&#44; as HDL-C travels through the circulation&#44; it also picks up more CL and PL from peripheral tissues&#44; and LRTGs&#44; generating mature HDL-C&#46; &#40;b&#41; Carrying of rs5070 polymorphism manifests hepatic and intestinal overexpression of ApoA1 than increases the levels of nascent HDL-C&#44; overproduction of nascent HDL-C needs to acquire more FC and PL&#44; causing low TG levels and forming more mature HDL-C&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Dyslipidemia is determined by excessive or deficient production of serum lipids and lipoproteins&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">1</span></a> In Mexico&#44; about 70&#37; of children with obesity and 50&#37; without obesity present dyslipidemia&#44; hypertriglyceridemia being the most frequent&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">2</span></a> Triglyceride &#40;TG&#41; levels are not only important because they are a risk factor for atherosclerosis&#44; but also because they are the precursors of metabolic disorders that induce an atherogenic lipoprotein profile&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">3</span></a> Elevated plasma TG levels have been shown to modulate the size and number of some lipoproteins&#44; developing an imbalance that causes the increase of small and dense low-density lipoprotein cholesterol &#40;LDL-C&#41; particles &#40;sd LDL-C&#41; and the decrease of high-density lipoprotein cholesterol &#40;HDL-C&#41; molecules&#44;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">3</span></a> resulting AD&#46; Elements of AD are a crucial risk factor for cardiovascular disease &#40;CVD&#41;&#44; and are part of the leading cause of morbidity and mortality in developed countries&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">4</span></a> These abnormalities have been extensively investigated in adults&#44;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> due to a combination of associated risk factors such as excessive alcohol intake&#44; uncontrolled diabetes mellitus&#44; smoking&#44; and obesity&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">6</span></a> Several studies indicate that components of AD are present from infancy&#44;<a class="elsevierStyleCrossRefs" href="#bib0260"><span class="elsevierStyleSup">7&#44;8</span></a> which justifies the search for these abnormalities in the childhood population and early identification of CVD in children and adolescents&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">9</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Population-based genetic association research has described several genes that could have a direct effect on lipid concentrations&#44;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">10</span></a> most notably the APOA5 and APOA1 genes&#46; The APOA5 gene gives rise to Apolipoprotein A5 &#40;ApoA5&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">11</span></a> ApoA5 has an important function in the regulation of TG levels&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">12</span></a> On the other hand&#44; the APOA1 gene produces Apolipoprotein A1 &#40;ApoA1&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">13</span></a> which is the main protein element of cholesterol high-density lipoproteins &#40;C-HDL&#41; and has an important role in reverse cholesterol transport&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">14</span></a> Studies have shown that SNP&#39;s in APOA5 gene promoter region rs662799&#44;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">15</span></a> and in APOA1 gene intronic region rs5070&#44;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">16</span></a> are significantly associated with lipid concentrations&#44;<a class="elsevierStyleCrossRefs" href="#bib0250"><span class="elsevierStyleSup">5&#44;17</span></a> hypertension&#44;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">18</span></a> obesity or overweight&#44;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">19</span></a> MS&#44;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">15</span></a> and CVD&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">20</span></a> Generally&#44; the genetic association of these polymorphisms has been performed in adult populations&#44; however&#44; the contribution of genetic susceptibility in pediatric patients is less evident&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> Therefore&#44; the purpose of this study was to determine the association between the presence of the genetic polymorphisms rs662799 and rs5070 and the prevalence of hypertriglyceridemia and atherogenic dyslipidemia in a population of pediatric patients insured by the Institute of Social Security and Services for State Workers &#40;ISSSTE&#44; acronym in Spanish&#41; Comit&#225;n de Dom&#237;nguez&#44; Chiapas and Villahermosa&#44; Tabasco&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Case&#8211;control study</span><p id="par0015" class="elsevierStylePara elsevierViewall">This study included minors aged 2&#8211;16 years who attended the ISSSTE in the city of Comit&#225;n de Dom&#237;nguez&#44; Chiapas&#44; and Clinic of Family Medicine Casa Blanca Villahermosa&#44; Tabasco&#44; M&#233;xico who participated in the project &#8220;Factors associated with dyslipidemias in pediatric patients in the south-southeast region of Mexico&#8221;&#46; The case group was defined as children who had the criteria for hypertriglyceridemia &#40;described below&#41;&#44; and the control group was defined as apparently healthy minors who did not meet the criteria&#46; Minors aged 2&#8211;16 years&#44; who meet the criteria for cases or controls and were members of families in which three or more of their generations were born in Mexico&#44; were incorporated into the study&#44;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> children who did not meet the criteria were discarded&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">The sample size calculation was performed for analysis of unpaired cases and controls&#44; for both polymorphisms a confidence level of 95&#37;&#44; a power of 80&#37;&#44; and a 1&#58;1 ratio were considered&#44; for the SNP rs662799 a prevalence of 45&#46;2&#37; in the cases group<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> and 22&#46;8&#37; in the control group&#44;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">21</span></a> obtaining a desirable sample of 142 minors&#46; For the SNP rs5070&#44; a prevalence of 29&#46;6&#37; in the case group<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">17</span></a> and 79&#46;3&#37; in the control group&#44;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">22</span></a> with a sizable sample of 32 individuals&#46; For this study&#44; a final sample of 268 children and adolescents was included&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Anthropometric&#44; clinical&#44; and biochemical profile evaluation</span><p id="par0025" class="elsevierStylePara elsevierViewall">Weight &#40;kg&#41;&#44; height &#40;cm&#41;&#44; BFP &#40;body fat percent&#41;&#44; and WHR &#40;waist-hip ratio&#41; were measured by a professional nutritionist&#46; BFP was determined with the Siri formula &#40;Nutrimind Software&#44; Mexico&#41;&#46; The WHR and BMI &#40;Body Mass Index&#41; &#40;kg&#47;m2&#41; were calculated and classified according to World Health Organization &#40;WHO&#41; and Centers for Disease Control and Prevention &#40;CDC&#41; criteria for children and adolescents&#46; Systolic &#40;SBP&#41; and Diastolic Blood Pressure &#40;DBP&#41; were taken three times with a sphygmomanometer &#40;BEURER BC-32&#41; with 10-min periods between measurements and averaged&#44; categorizations were determined with the blood pressure percentile calculator for minors&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">23</span></a></p><p id="par0030" class="elsevierStylePara elsevierViewall">Five milliliters of blood samples were extracted after 12<span class="elsevierStyleHsp" style=""></span>h of fasting for analysis of TG&#44; Total Cholesterol &#40;TC&#41;&#44; HDL-C&#44; LDL-C by enzymatic colorimetric assay &#40;Spinreact reagents&#44; Girona&#44; Spain&#41; and for determining Apolipoprotein A1 &#40;ApoA1&#41; and Apolipoprotein B &#40;ApoB&#41; by immunoturbidimetry &#40;DiaSys reagents&#44; Diagnostic Systems GmbH&#44; Germany&#41; following the manufacturer&#39;s specifications&#44; using a spectrophotometer &#40;Thermo Fisher Multiskan plate reader&#41;&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall">LDL-C concentrations were determined by Friedewald&#39;s formula only when TG levels &#60;400<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;4&#46;52<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">24</span></a>&#59; the case of TG &#8805;400<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;4&#46;52<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41;&#44; they were directly quantified&#46; Non-HDL cholesterol &#40;non-HDL-C&#41; levels were obtained with the formula non-HDL&#8722;C&#61;TC&#8722;HDL&#8722;C&#44; the sd LDL-C was calculated with the ratio &#40;LDL-C&#47;ApoB&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">25</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Classification of hypertriglyceridemia and atherogenic dyslipidemia</span><p id="par0040" class="elsevierStylePara elsevierViewall">Cases with hypertriglyceridemia were determined in accordance with the guidelines established by the National Cholesterol Education Program &#40;NCEP&#41; for children and adolescents ages 0&#8211;19 years as TG<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>75<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;0&#46;84<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41; &#40;0&#8211;9 years&#41; and &#8805;90<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;1&#46;01<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41; &#40;10&#8211;19 years&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">26</span></a></p><p id="par0045" class="elsevierStylePara elsevierViewall">The AD was defined as high TG levels&#59; 75<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;0&#46;84<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41; &#40;0&#8211;9 years&#41; and &#8805;90<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;1&#46;01<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41; &#40;10&#8211;19 years&#41;&#44; low HDL-C levels&#59; &#60;40<span class="elsevierStyleHsp" style=""></span>mg&#47;dL &#40;1&#46;03<span class="elsevierStyleHsp" style=""></span>mmol&#47;L&#41;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">26</span></a> and the presence of sd LDL-C&#59; &#60;1&#46;3&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">27</span></a></p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">DNA extraction and genotyping of SNPs</span><p id="par0050" class="elsevierStylePara elsevierViewall">Genomic DNA was isolated from peripheral blood &#40;DNAzol&#174; GENOMIC DNA ISOLATION REAGENT&#44; MRC brand&#41;&#46; DNA concentration and purity were measured on a Multiskan GO microplate spectrophotometer &#40;Thermo Fisher Scientific Corporation&#41;&#46; DNA integrity was observed by electrophoresis on agarose gels &#40;0&#46;8&#37;&#41;&#44; stained with SYBR Safe&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">Genotyping of rs662799 and rs5070 SNPs was carried out by Real-Time Polymerase Chain reaction &#40;RT-PCR&#41; technique&#44; with the TaqMan SNP genotyping assay &#40;Applied Biosystems&#44; Foster City&#44; CA&#44; USA&#41; &#40;catalog number 4351379&#59; rs662799 &#40;C&#95;2310403&#95;10&#41; and rs5070 &#40;C&#95;2679584&#95;10&#41;&#41;&#44; in a thermocycler &#40;Rotor-Gene Q&#44; QIAGEN brand&#41;&#44; according to manufacturer specifications&#46; Fluorescence signals were examined in Rotor-Gene Q series software&#44; version 2&#46;1&#46;0&#46;9 for Windows&#46; Sequence contexts of TaqMan probes for each polymorphism are presented in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Evaluation of inheritance models</span><p id="par0060" class="elsevierStylePara elsevierViewall">For the association analysis of polymorphisms with hypertriglyceridemia and AD&#44; logistic regression models were fitted according to inheritance models&#59; codominant&#44; dominant&#44; recessive&#44; overdominant&#44; and additive risk&#44; to select the best fitting inheritance model Akaike&#39;s information criterion &#40;AIC&#41; was applied&#46; The descriptive analysis of the SNPs and their association with the study conditions was carried out with the SNPStats program &#40;<a href="https://www.snpstats.net/start.htm">https&#58;&#47;&#47;www&#46;snpstats&#46;net&#47;start&#46;htm</a>&#41;&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">Descriptive statistics were performed for all variables&#44; using frequencies and proportions for qualitative variables and means and standard deviations &#40;SD&#41; for quantitative variables&#46; For the analysis of the normal distribution of the data&#44; the Kolmogorov&#8211;Smirnov test was used to compare between groups&#59; for quantitative variables&#44; the student&#39;s t-test was used for data with normal distribution and the U-Mann Whitney test for those without normal distribution&#59; for qualitative variables&#44; the Chi<span class="elsevierStyleSup">2</span> test was used&#46; Allelic and genotypic frequencies were calculated&#46; Hardy&#8211;Weinberg equilibrium &#40;HWE&#41; was evaluated&#46; The magnitude of association was measured with OR with a confidence interval &#40;CI&#41; of 95&#37;&#44; the categorical variables of sex&#44; age &#40;2&#8211;4 years&#58; preschool&#44; 5&#8211;9 years&#58; school&#44; and 10&#8211;19 years&#58; adolescent&#41;&#44; and BMI grouped as normal &#40;normal&#47;underweight&#41; and overweight &#40;overweight&#47;obese&#41; were adjusted&#46; Results were taken as significant when a <span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05 was obtained&#46; Data were analyzed with the statistical package IBM SPSS Statistics for Windows&#44; 2013 &#40;Armonk&#44; NY&#59; IBM Corp&#41;&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Ethical considerations</span><p id="par0070" class="elsevierStylePara elsevierViewall">Study participants and parents were provided with the letter of assent and&#47;or informed consent&#46; This research followed the Helsinki declaration of 1975 and the General Health Law on Research for Health &#40;Ley General de Salud en Materia de Investigaci&#243;n Para La Salud&#41; with category II &#8211; research with minimal risk&#44; was approved by COBIOETICA &#40;09-CEI-019-20160729&#41;&#44; the Institutional Biosafety Committee &#40;Comit&#233; Institucional de Bioseguridad&#41; COFEPRIS &#40;16 CB 09 012022&#41; and the Ethics Committee of The College of the South Border &#40;El Colegio de la Frontera Sur&#41; &#40;Ref&#46; 2697&#41;&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Results</span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Anthropometric&#44; clinical&#44; and biochemical parameters of the study population</span><p id="par0075" class="elsevierStylePara elsevierViewall">Two hundred sixty-eight minors were studied&#44; 134 children had high triglyceride levels &#40;47&#46;8&#37; women and 52&#46;2&#37; men&#41; with a mean age of 8&#46;32<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;98&#44; and 134 children with normal triglyceride levels &#40;46&#46;2&#37; women and 53&#46;8&#37; men&#41; at a mean age of 8&#46;86<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>4&#46;03&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">In the analysis of anthropometric variables &#40;height&#44; weight&#44; BMI&#41; by age groups&#44; we found statistical differences between the groups&#44; as part of the phenomenon of natural growth of minors &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; For the biochemical analysis by age group&#44; only differences were found in serum ApoB concentrations &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;022&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; In both age groups&#44; the cases present higher values in cholesterol total&#44; Non-HDL-C and low levels of HDL-c&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Association of polymorphisms rs662799 and rs5070 with hypertriglyceridemia and atherogenic dyslipidemia</span><p id="par0085" class="elsevierStylePara elsevierViewall">Allelic frequency analysis found that both SNP&#8216;s were under the HWE rs662799 &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">0&#46;075</span>&#41; and rs5070 &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">0&#46;86</span>&#41;&#46; The rs662799 &#40;C&#41; polymorphism presented a frequency of 32&#46;8&#37; in hypertriglyceridemia cases&#44; and 17&#46;9&#37; in controls&#44; it was found that carriers of the T&#47;C genotype had a higher risk of hypertriglyceridemia &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#46;92&#44; 95&#37; CI&#58; 2&#46;30&#8211;6&#46;67&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; The over-dominant was the inheritance model that best fitted with cases of hypertriglyceridemia&#44; carriers of the T&#47;C genotype had a higher risk of hypertriglyceridemia than those who had T&#47;T<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>C&#47;C genotype &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#46;89&#44; 95&#37; CI&#58; 2&#46;29&#8211;6&#46;61&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0090" class="elsevierStylePara elsevierViewall">The rs5070 &#40;T&#41; polymorphism showed a prevalence of 45&#46;2&#37; in cases&#44; and 52&#46;2&#37; in the control group&#44; carriers of the T&#47;T genotype have a lower risk of developing hypertriglyceridemia &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;47&#44; 95&#37; CI&#58; 0&#46;22&#8211;0&#46;97&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;11&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; The association analysis based on the inheritance models showed significant protection in the additive risk model&#44; carriers of the T&#47;T genotype were less likely to have hypertriglyceridemia in children &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;68&#44; 95&#37; CI&#58; 0&#46;47&#8211;0&#46;99&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">In this study&#44; 120 individuals with AD&#44; were identified&#46; The rs662799 &#40;C&#41; polymorphism was present in 34&#46;2&#37; of minors with AD &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46; In relation to genotype frequencies&#44; it was found that carriers of the T&#47;C genotype had a higher risk of developing AD &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>4&#46;04&#44; 95&#37; CI&#58; 2&#46;37&#8211;6&#46;88&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46; Genotypic frequency analysis showed a significant risk association with AD in the dominant inheritance model in carriers of the T&#47;C<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>C&#47;C &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>4&#46;01&#44; 95&#37; CI&#58; 2&#46;36&#8211;6&#46;81&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Analysis of polymorphisms rs662799 and rs5070 with the biochemical concentration</span><p id="par0100" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a> represents the means of biochemical parameters and their association with the rs662799 and rs5070 polymorphisms&#46; The data reveal that minors carrying the rs662799 &#40;C&#41; polymorphism had higher concentrations of TG levels in the control group &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;012&#41;&#46; For the group of cases&#44; low HDL-C levels&#44; as well as small sd LDL-C particle sizes were found &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;028&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>a&#41;&#44; TG levels tend to increase in carriers&#44; but no significant differences was found&#46; The data also showed that rs662799 polymorphism carriers had higher concentrations of TG in both age groups &#40;0&#8211;9 years and 10&#8211;16 years&#41; and for both sexes &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>c I and II&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0105" class="elsevierStylePara elsevierViewall">However&#44; these differences were not observed in carriers of the rs5070 &#40;T&#41; polymorphism and the biochemical parameters &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>b&#41;&#46;</p></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Discussion</span><p id="par0110" class="elsevierStylePara elsevierViewall">In Mexico&#44; the most common dyslipidemia is hypertriglyceridemia&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">28</span></a> The lipid triad that makes up AD are present in the pediatric population&#44;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">29</span></a> and these metabolic disorders continue to increase due to related factors such as obesity&#44; poor diet&#44; and sedentary lifestyle&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">30</span></a></p><p id="par0115" class="elsevierStylePara elsevierViewall">The study showed an increase in BMI in both age groups of cases&#46; An increase in values of blood pressure was found in minors with hypertriglyceridemia&#44; these results were expected&#46; Other research has shown that TG values are significantly elevated in infants with obesity&#44;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">22</span></a> and increased blood pressure &#40;BP&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">23</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">Likewise&#44; there were significant differences in almost all lipid parameters except for LDL-C in both age groups&#44; and in ApoB levels in minors between 10 and 16 years&#46; Research work has shown that TG is strongly correlated with undesirable levels of serum lipid levels&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> On the other hand&#44; when comparing the anthropometric variables of infants these presented significant differences as part of the phenomenon of natural growth of minors&#44; however&#44; there were no statistically significant differences in lipid levels among age groups&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Several previous studies in the adult population associate the rs662799 polymorphism with dyslipidemia&#44; and CVD&#46;<a class="elsevierStyleCrossRefs" href="#bib0250"><span class="elsevierStyleSup">5&#44;31</span></a> In this research&#44; it was found that the overdominant model of rs662799 was associated with the risk of hypertriglyceridemia Additionally&#44; this research showed that minors with rs662799&#40;C&#41; polymorphism had higher triglyceride concentrations in both age groups and for both sexes&#46;&#44; Additionally&#44; this research showed that minors with rs662799&#40;C&#41; polymorphism had higher triglyceride concentrations in both age groups and for both sexes&#46; It is necessary to take into account that the sum of other components such as diet&#44; environment&#44; and other genetic polymorphisms that were not analyzed in this study&#44; also can promote the increase in TG concentrations&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">19</span></a> However&#44; this research largely coincides with another study published in a Mexican child population&#44; which revealed that the rs662799 polymorphism modulates TG levels in children and adolescents&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">5</span></a> Furthermore&#44; European and Chinese young populations who have the SNP rs662799 have been shown increased TG plasma concentrations&#46;<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">32</span></a> Some studies have demonstrated that variations in nucleotide bases&#44; result in modifications of the amino acid sequence of the ApoA5 molecule&#44; causing a dysfunctional protein <a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">33</span></a>or decreasing their activity&#46;<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">34</span></a> ApoA5 is produced a majority in the liver&#44;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">12</span></a> and can be secreted together with lipoproteins rich in triglycerides &#40;LRTG&#41;&#44; chylomicrons &#40;QM&#41; and very low density lipoprotein cholesterol &#40;VLDL-C&#41; <a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">35</span></a>&#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>a&#41;&#44; ApoA5 leads the LRTG to lipoprotein lipase &#40;LPL&#41; and initiates TG hydrolysis&#44;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">36</span></a> generating remnant &#40;Rem&#41; particles&#46;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">36</span></a> Also&#44; ApoA5 is coupled to HDL-C to be reserved and it can be translocated and reused by other LRTG&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">12</span></a> It is suggested that carriers of the rs662799 polymorphism&#44; 3A-3G&#44; 751G-T&#44; and 1891T-C &#40;haplotype A5&#42;2&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">37</span></a> present deficiency in ribosomal translation<a class="elsevierStyleCrossRef" href="#bib0415"><span class="elsevierStyleSup">38</span></a> &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>b&#41;&#44; generating reduced ApoA5 levels&#44;<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">34</span></a> decreasing LPL-mediated TG uptake&#44;<a class="elsevierStyleCrossRef" href="#bib0415"><span class="elsevierStyleSup">38</span></a> while the liver continues to steadily secrete LRTG&#44; and promoting the cases of hypertriglyceridemia&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">33</span></a> We illustrate the mechanism of action of ApoA5 on TG modulation and the presence of the rs662799 SNP in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0130" class="elsevierStylePara elsevierViewall">On the other hand&#44; previous research has reported that common APOA1 genetic variants influence dyslipidemia&#46;<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">39</span></a> Studies in Korean population revealed that rs5070 polymorphism was associated with elevated TG levels&#44;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">17</span></a> however&#44; the association of rs5070 with TG has not been yet assessed in the Mexican population&#46; Results found in other populations differ considerably with this investigation&#44; the data presented do not disclose association with hypertriglyceridemia&#44; oppositely the ORs data show a significant protection association in the additive risk model genotype T&#47;T &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;68&#44; 95&#37; CI&#58; 0&#46;47&#8211;0&#46;99&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#41;&#46; It is important to mention that few studies have been done evaluating this polymorphism&#44; and they do not provide a clear answer about the mechanisms related to TG levels&#46; However&#44; it is known that ApoA1 bound to HDL-C works as a surface acceptor of QM and VLDL-C during their catabolism&#44;<a class="elsevierStyleCrossRef" href="#bib0425"><span class="elsevierStyleSup">40</span></a> the protective effect may be involved with the biosynthesis and metabolism of HDL-C&#46; ApoA1 is predominantly secreted by the liver and intestine as lipid-poor ApoA1<a class="elsevierStyleCrossRef" href="#bib0425"><span class="elsevierStyleSup">40</span></a> &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41; and acquires free cholesterol &#40;FC&#41; and phospholipids &#40;PL&#41; from enterocytes and hepatocytes&#44; creating nascent HDL-C&#44;<a class="elsevierStyleCrossRef" href="#bib0430"><span class="elsevierStyleSup">41</span></a> as HDL-C travels through the circulation&#44; it also picks up FC and PL generating mature HDL-C<a class="elsevierStyleCrossRef" href="#bib0430"><span class="elsevierStyleSup">41</span></a> &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>a&#41;&#46; We propose that carriers of the rs5070 polymorphism &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>b&#41; manifest hepatic and intestinal overexpression of ApoA1&#44; high levels of ApoA1&#44; significantly increase nascent HDL-C levels and the overproduction of nascent HDL-C requires more FC and PL from peripheral tissues and LRTG&#44; decreasing TG levels and producing more mature HDL-C&#46; Therefore&#44; this polymorphism acts as protection by being significantly associated with elevated ApoA1 and HDL-C &#40;data not shown&#41; and decreased TG levels&#46; However&#44; studies to test this possible hypothesis have yet to be carried out&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0135" class="elsevierStylePara elsevierViewall">In this research&#44; we also evaluated the magnitude of the association of SNP rs662799 with the presence of AD&#46; It was found that allele C was associated with a higher risk of AD&#44; whereas the dominant model showed a strong association with these lipid disorders&#46; Until now&#44; this is the first work that estimates the association of SNP rs662799 with AD in Mexicans&#46; In addition&#44; there are no studies carried out in the child population&#46; However&#44; the results reported in this work&#44; are similar to other studies carried out in adults&#44; in a multiethnic population&#44; which report that SNP rs662799 predisposes to higher TG levels&#44; more atherogenic LDL-C particles&#44; and decreased HDL-C concentrations&#46;<a class="elsevierStyleCrossRefs" href="#bib0240"><span class="elsevierStyleSup">3&#44;42</span></a> It is assumed that the association of the APOA5 gene with AD is mainly due to the trigger on TG metabolism&#46;<a class="elsevierStyleCrossRef" href="#bib0440"><span class="elsevierStyleSup">43</span></a></p><p id="par0140" class="elsevierStylePara elsevierViewall">Moreover&#44; rs5070 polymorphism has been frequently studied with HDL-C concentrations&#44;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">17</span></a> and to our knowledge&#44; this is the first study to report an interaction between the rs5070 polymorphism and AD&#46; Where the Turkish and Brazilian populations were associated with morbidities related to TG&#44; HDL-C&#44; VLDL-C&#44; and LDL-C&#46;<a class="elsevierStyleCrossRefs" href="#bib0315"><span class="elsevierStyleSup">18&#44;44</span></a> Analyzing the results obtained in rs5070 polymorphism did not show a significant association with AD&#46; The differences observed in these populations can be attributed to the fact that the genetic variations present in the APOA1 gene are under transcriptional regulation in the liver and can be explained by the effect of various factors that may intervene on transcription factors in hepatocellular regulation&#46;<a class="elsevierStyleCrossRef" href="#bib0450"><span class="elsevierStyleSup">45</span></a></p><p id="par0145" class="elsevierStylePara elsevierViewall">One of the main limitations in this study was the lack of adjustment for these genetic polymorphisms related to lifestyle and dietary habits since diet plays an important role in developing dyslipidemia&#46; In addition&#44; we did not assess the parents&#8217; history of dyslipidemia&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Conclusion</span><p id="par0150" class="elsevierStylePara elsevierViewall">This study showed that SNP rs662799 was associated with cases of hypertriglyceridemia and AD in pediatric patients in southeastern Mexico&#46; It was also determined that rs5070 NPS was not associated with cases of hypertriglyceridemia and did not contribute to the risk to present AD in this population&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Data access statement</span><p id="par0155" class="elsevierStylePara elsevierViewall">Data supporting the findings of this study are available from the corresponding author &#91;cirecta&#64;ecosur&#46;mx&#93;&#44; Dr&#46; C&#233;sar Antonio Irecta N&#225;jera&#46; Some information is omitted to protect the privacy of minors&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Author contribution</span><p id="par0160" class="elsevierStylePara elsevierViewall">&#91;C&#233;sar Antonio Irecta N&#225;jera&#93;&#44; and &#91;Armando Camilo Hern&#225;ndez Contreras&#93; conceived and directed the project&#59; &#91;H&#233;ctor Ochoa-D&#237;az-L&#243;pez&#93; designed and planned the study&#46; &#91;C&#233;sar Antonio Irecta N&#225;jera&#93;&#44; &#91;Armando Camilo Hern&#225;ndez Contreras&#93;&#44; and &#91;Valeria Ovando G&#243;mez&#93; supervised data collection&#46; &#91;Valeria Ovando G&#243;mez&#93; performed the statistical analysis&#46; &#91;Soraya Amal&#237; Zavaleta Mu&#241;iz&#93;&#44; and &#91;Valeria Ovando G&#243;mez&#93; contributed to the analysis and interpretation of the results&#46; The first draft of the manuscript was written by &#91;Valeria Ovando G&#243;mez&#93;&#44; and &#91;C&#233;sar Antonio Irecta N&#225;jera&#93;&#46; &#91;H&#233;ctor Ochoa-D&#237;az-L&#243;pez&#93;&#44; and &#91;Soraya Amal&#237; Zavaleta Mu&#241;iz&#93; revised the manuscript with the important contribution of all coauthors&#46; All authors approved the final version&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Funding</span><p id="par0165" class="elsevierStylePara elsevierViewall">This work was supported by the National Council of Science and Technology &#40;<span class="elsevierStyleGrantSponsor" id="gs1">CONACYT</span>&#41;&#44; project number&#58; 2016-01-2697&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Conflict of interests</span><p id="par0170" class="elsevierStylePara elsevierViewall">The authors declare no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:16 [
        0 => array:3 [
          "identificador" => "xres2082379"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background and aims"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1776503"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres2082378"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes y objetivos"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Materiales y m&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1776504"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Case&#8211;control study"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Anthropometric&#44; clinical&#44; and biochemical profile evaluation"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Classification of hypertriglyceridemia and atherogenic dyslipidemia"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "DNA extraction and genotyping of SNPs"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Evaluation of inheritance models"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0045"
          "titulo" => "Ethical considerations"
        ]
        7 => array:3 [
          "identificador" => "sec0050"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Anthropometric&#44; clinical&#44; and biochemical parameters of the study population"
            ]
            1 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Association of polymorphisms rs662799 and rs5070 with hypertriglyceridemia and atherogenic dyslipidemia"
            ]
            2 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Analysis of polymorphisms rs662799 and rs5070 with the biochemical concentration"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conclusion"
        ]
        10 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Data access statement"
        ]
        11 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Author contribution"
        ]
        12 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Funding"
        ]
        13 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Conflict of interests"
        ]
        14 => array:2 [
          "identificador" => "xack725509"
          "titulo" => "Acknowledgements"
        ]
        15 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-05-09"
    "fechaAceptado" => "2022-06-29"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1776503"
          "palabras" => array:4 [
            0 => "Hypertriglyceridemia"
            1 => "Atherogenic dyslipidemia"
            2 => "Minors"
            3 => "Mexican population&#58; single nucleotide polymorphism"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1776504"
          "palabras" => array:4 [
            0 => "Hipertrigliceridemia"
            1 => "Dislipidemia aterog&#233;nica"
            2 => "Menores"
            3 => "Poblaci&#243;n mexicana&#58; polimorfismo de nucle&#243;tido &#250;nico"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background and aims</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Triglycerides are the initiators of the metabolic changes that lead to atherogenic dyslipidemia &#40;AD&#41;&#46; The APOA5 and APOA1 genes are involved in the response and metabolism of serum lipids and lipoproteins&#44; where single nucleotide polymorphisms &#40;SNP&#41; rs662799 &#40;promoter region&#41; and rs5070 &#40;intronic region&#41; have been associated with the susceptibility to dyslipidemia&#46; Until now&#44; few studies evaluate the association of these polymorphisms with the presentation of hypertriglyceridemia and AD among Mexican children&#46; Therefore&#44; the objective was to determine the association between rs662799 and rs5070 with hypertriglyceridemia and AD in a pediatric population of southeastern Mexico&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">A case&#8211;control analysis was performed including 268 infants aged 2&#8211;16 years&#44; anthropometric&#44; clinical variables&#44; and serum lipid profiles were analyzed&#46; DNA was extracted from blood samples and genotyping of polymorphisms was executed with the TaqMan SNP genotyping assay&#46; Allele and genotypic frequencies were calculated&#46; For genetic association analysis&#44; logistic regression models were fitted according to models of inheritance&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The SNP rs662799 &#40;C&#41; was significantly associated with hypertriglyceridemia in the overdominant model &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#46;89&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; and AD in the dominant model &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>4&#46;01&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46; The SNP rs5070 &#40;T&#41; has a protective effect against hypertriglyceridemia in the additive risk model &#40;OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;68&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Polymorphism rs662799 was significantly associated with cases of hypertriglyceridemia and AD in minors in southeastern Mexico&#46; On the other hand&#44; rs5070 polymorphism was not associated with cases of hypertriglyceridemia or AD&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background and aims"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes y objetivos</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Los triglic&#233;ridos son los iniciadores de los cambios metab&#243;licos que conducen a la dislipidemia aterog&#233;nica &#40;DA&#41;&#46; Los genes APOA5 y APOA1 est&#225;n implicados en la respuesta y metabolismo de l&#237;pidos s&#233;ricos y lipoprote&#237;nas&#44; donde los polimorfismos de nucle&#243;tido &#250;nico &#40;SNP&#41; rs662799 &#40;regi&#243;n promotora&#41; y rs5070 &#40;regi&#243;n intr&#243;nica&#41; se han asociado con la susceptibilidad a la dislipidemia&#46; Hasta ahora&#44; pocos estudios eval&#250;an la relaci&#243;n&#160;de estos polimorfismos con la presentaci&#243;n de hipertrigliceridemia y DA entre los ni&#241;os mexicanos&#46; Por lo tanto&#44; el objetivo fue determinar la asociaci&#243;n entre rs662799 y rs5070 con hipertrigliceridemia y DA en una poblaci&#243;n pedi&#225;trica del sureste de M&#233;xico&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Materiales y m&#233;todos</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Se realiz&#243; un an&#225;lisis de casos y controles con 268 ni&#241;os de 2 a 16 a&#241;os&#44; se analizaron variables antropom&#233;tricas&#44; cl&#237;nicas y perfiles de l&#237;pidos s&#233;ricos&#46; Se extrajo ADN de muestras de sangre y se realiz&#243; genotipado de polimorfismos con el ensayo de genotipado TaqMan SNP&#46; Se calcularon las frecuencias al&#233;licas y genot&#237;picas&#46; Para el an&#225;lisis de asociaci&#243;n gen&#233;tica&#44; los modelos de regresi&#243;n log&#237;stica se ajustaron seg&#250;n los modelos de herencia&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">El SNP rs662799 se asoci&#243; significativamente con hipertrigliceridemia en el modelo sobredosis &#40;OR&#61;3&#44;89&#44; p&#61;0&#44;001&#41; y DA en el modelo dominante &#40;OR&#61;4&#44;01&#44; p&#61;0&#44;001&#41;&#46; El SNP rs5070 tiene un efecto protector contra la hipertrigliceridemia en el modelo de riesgo aditivo &#40;OR&#61;0&#44;68&#44; p&#61;0&#44;03&#41;&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">El polimorfismo rs662799 se asoci&#243; significativamente con casos de hipertrigliceridemia y DA en menores del sureste de M&#233;xico&#46; Por otro lado&#44; el polimorfismo rs5070 no se asoci&#243; con casos de hipertrigliceridemia o DA en esta poblaci&#243;n&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes y objetivos"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Materiales y m&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0185" class="elsevierStylePara elsevierViewall">The following are the supplementary data to this article&#58;<elsevierMultimedia ident="upi0005"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0105"
          ]
        ]
      ]
    ]
    "multimedia" => array:8 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 4038
            "Ancho" => 2925
            "Tamanyo" => 636523
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Association graphs between the rs662799&#44; rs5070 polymorphism and biochemical values&#46; &#40;a&#41; Association graphs between the rs662799&#44; and biochemical parameters&#46; &#40;b&#41; Association graphs between the rs5070 polymorphism and biochemical parameters&#46; &#40;c&#41; Association graphs between rs662799 and rs5070 polymorphisms and triglyceride levels by age group and sex&#46; TG&#58; triglycerides&#59; HDL-C&#58; high-density lipoprotein cholesterol&#59; sd LDL-C&#58; small and dense low-density lipoproteins cholesterol&#59; mg&#47;dL&#59; milligram&#47;deciliter&#59; <span class="elsevierStyleItalic">p</span>&#58; significant &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#59; U-Mann Whitney&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1619
            "Ancho" => 2508
            "Tamanyo" => 319714
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Mechanism of action of triglyceride hydrolysis and the interaction with rs662799 polymorphism&#46; LRTG&#59; lipoproteins rich in triglycerides&#59; ApoA5 and A5&#58; apolipoprotein A5&#59; LPL&#58; lipoprotein lipase&#59; REM&#58; remnants&#59; C-HDL&#58; high density lipoprotein cholesterol&#59; FA&#58; fatty acids&#59; GL&#58; glycerol&#46; Modified from Merkel and Heeren&#46;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">36</span></a> &#40;a&#41; ApoA5 is secreted exclusively in the liver and initially&#44; ApoA5 can be secreted together with LRTG&#46; TG are hydrolyzed by the action of LPL&#46; ApoA5 directs LRTG to LPL for hydrolysis&#44; generating Rem particles&#46; ApoA5 is coupled to C-HDL for its reserve so that it can be translocated and reused by other LRTGs&#46; &#40;b&#41; The opposite situation in patients with the rs662799 polymorphism in APOA5&#44; the C variant impairs the efficiency of ribosomal translation&#44; this deficiency generates reduced ApoA5 levels&#44; causing a reduction in LPL-mediated TG uptake activity&#44; while the liver continues to secrete LRTG constantly&#44; manifesting hypertriglyceridemia&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1501
            "Ancho" => 2091
            "Tamanyo" => 272455
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Mechanism of C-HDL biosynthesis and the interaction with rs5070 polymorphism&#46; ABCA1&#58; ATP binding cassette subfamily A member 1&#59; A1&#58; apolipoprotein AI&#59; AII&#59; apolipoprotein AII&#59; HDL-C&#58; high density lipoprotein cholesterol&#59; LCAT&#58; lecithin cholesterol acyl transferase&#59; PL&#58; phospholipids&#59; FC&#59; free cholesterol&#59; LRTG&#58; lipoprotein rich in triglycerides&#46; &#40;a&#41; ApoA1 is predominantly secreted by the liver and intestine as lipid-poor ApoA1&#44; ApoA1 acquires FC and PL&#44; creating nascent HDL-C&#44; as HDL-C travels through the circulation&#44; it also picks up more CL and PL from peripheral tissues&#44; and LRTGs&#44; generating mature HDL-C&#46; &#40;b&#41; Carrying of rs5070 polymorphism manifests hepatic and intestinal overexpression of ApoA1 than increases the levels of nascent HDL-C&#44; overproduction of nascent HDL-C needs to acquire more FC and PL&#44; causing low TG levels and forming more mature HDL-C&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">SNP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Minor &#40;mutant&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Major &#40;wild&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Context sequence &#40;VIC&#47;FAM&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">APOA1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">rs5070&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTGGGCCACGGGGATTTAGGGAGAA &#91;A&#47;G&#93;GCCCCCCGATGGTTGGCTCCCTAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">APOA5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">rs662799&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAGCCCCAGGAACTGGAGCGAAAGT &#91;A&#47;G&#93;AGATTTGCCCCATGAGGAAAAGCTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3448821.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Genes and polymorphisms studied and their context sequence&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Most characteristics are presented as mean and standard deviation &#40;M &#177; SD&#41;&#59; nutritional status is presented as frequencies and percentage n &#40;&#37;&#41;&#46;</p><p id="spar0095" class="elsevierStyleSimplePara elsevierViewall">BMI&#58; body mass index&#59; WHR&#58; waist-hip ratio&#59; BFP&#58; body fat percentage&#59; DBP&#58; diastolic blood pressure&#59; SBP&#58; systolic blood pressure&#59; C-HDL&#58; high-density lipoprotein cholesterol&#59; Non-HDL-C&#58; non-high-density lipoprotein cholesterol&#59; LDL-C&#58; low-density lipoprotein cholesterol&#59; Apo A-I&#58; apolipoprotein A-I&#59; Apo B&#58; apolipoprotein B&#59; n&#58; number of pediatric patients&#58; p&#58; significant &#40;p &#60; 0&#46; 05&#41;&#59; tests&#58; <span class="elsevierStyleSup">&#8224;</span> t Student&#59; <span class="elsevierStyleSup">&#8225;</span> U-Mann Whitney&#59; &#42; Chi<span class="elsevierStyleSup">2</span>&#46;</p>"
          "tablatextoimagen" => array:2 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Characteristics&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">2&#8211;9 years</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleItalic">p</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">10&#8211;16 years</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleItalic">p</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleItalic">P</span> overall &#40;by age group&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Cases &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>84&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Controls &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Cases &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Controls &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Anthropometry</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Weight &#40;kg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;32<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>12&#46;63&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21&#46;46<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>7&#46;68&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&#46;23<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>16&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">49&#46;13<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>15&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;684&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><span class="elsevierStyleSup">&#8224;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Height &#40;cm&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">114&#46;46<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>18&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">111&#46;59<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>15&#46;20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;029</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">152&#46;26<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;82&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">150&#46;90<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>12&#46;67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;861&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><span class="elsevierStyleSup">&#8224;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>BMI &#40;kg&#47;m<span class="elsevierStyleSup">2</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19&#46;04<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>5&#46;35&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#46;72<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;002</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&#46;97<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>4&#46;72&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21&#46;13<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>4&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;027</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>WHR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;94<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;93<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;415&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;87<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;86<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;271&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>BFP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#46;63<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>7&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#46;25<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>7&#46;88&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;708&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29&#46;30<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>9&#46;81&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27&#46;43<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;82&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;175&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;014</span><span class="elsevierStyleSup">&#8224;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>DBP &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#46;27<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>9&#46;71&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&#46;55<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>9&#46;53&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;010</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#46;50<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>12&#46;87&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;52&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;155&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>SBP &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">91&#46;10<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;78&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">85&#46;86<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;58&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;009</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">101&#46;26<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#46;02<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;71&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;628&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;716<span class="elsevierStyleSup">&#8224;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Biochemical tests &#40;mg&#47;dL&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Triglycerides &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">126&#46;13<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>50&#46;14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">57&#46;88<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">137&#46;23<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>52&#46;75&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">69&#46;78<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>14&#46;68&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;329<span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Cholesterol &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">150&#46;49<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>39&#46;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">133&#46;08<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>23&#46;59&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;009</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">147&#46;42<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>34&#46;65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">130&#46;91<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>29&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;008</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;258<span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>HDL-C &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35&#46;85<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>5&#46;40&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40&#46;18<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">34&#46;17<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>6&#46;31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39&#46;66<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;69&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;578<span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Non-HDL-C &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">114&#46;63<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>39&#46;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">92&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>22&#46;80&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">113&#46;44<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>33&#46;54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">91&#46;13<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>28&#46;36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;346<span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>LDL-C &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">84&#46;14<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>32&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">78&#46;22<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>24&#46;66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;065&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">81&#46;88<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>25&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">77&#46;47<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>27&#46;33&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;546&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;281<span class="elsevierStyleSup">&#8224;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Apo A-I &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">132&#46;92<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>24&#46;70&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">147&#46;37<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>29&#46;91&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;002</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">134&#46;06<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>35&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">140&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>24&#46;95&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;053&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;624<span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Apo B &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">95&#46;18<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>35&#46;85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">77&#46;15<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>18&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">86&#46;12<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>25&#46;25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">72&#46;58<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>19&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;002</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;022</span><span class="elsevierStyleSup">&#8225;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3448823.png"
              ]
            ]
            1 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span> overall &#40;by age group&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Nutritional status</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Normal&#47;underweight&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46 &#40;54&#46;80&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">52 &#40;77&#46;60&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;38&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;53&#46;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Overweight&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;20&#46;20&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;13&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;009</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;30&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18 &#40;26&#46;90&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;179&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;012</span>&#42;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Obese&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;25&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;9&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;32&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;19&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3448824.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Anthropometric characteristics&#44; and biochemical analysis of the minor&#39;s with hypertriglyceridemia &#40;cases&#41; by age groups&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">OR&#58; odds ratio&#59; CI&#58; 95&#37; confidence interval&#59; <span class="elsevierStyleItalic">p</span>&#58; <span class="elsevierStyleItalic">p</span>-value&#44; significant &#40;&#60;0&#46;05&#41;&#46; AIC&#58; Akaike&#39;s information criterion&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="6" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Distribution of genotypes</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Dominant</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Recessive</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Overdominant</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Risk additive</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases<span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls<span class="elsevierStyleItalic">n</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs662799</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">47 &#40;35&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">87 &#40;64&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;88 &#40;2&#46;28&#8211;6&#46;59&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;92 &#40;0&#46;04&#8211;20&#46;31&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;96&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;89 &#40;2&#46;29&#8211;6&#46;61&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;64 &#40;2&#46;17&#8211;6&#46;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">86 &#40;64&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46 &#40;34&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;46 &#40;2&#46;09&#8211;5&#46;73&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;92 &#40;2&#46;30&#8211;6&#46;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;0&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;0&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;85 &#40;0&#46;11&#8211;30&#46;27&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;79 &#40;0&#46;07&#8211;43&#46;05&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">180 &#40;67&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">220 &#40;82&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">88 &#40;32&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48 &#40;179&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;24 &#40;1&#46;50&#8211;3&#46;35&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;35 &#40;1&#46;55&#8211;3&#46;57&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>EHW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;075&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>AIC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">342&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">369&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">342&#46;3<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">343&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs5070</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;28&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;23&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;63 &#40;0&#46;35&#8211;1&#46;14&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;57 &#40;0&#46;31&#8211;1&#46;05&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;06 &#40;0&#46;64&#8211;1&#46;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68 &#40;0&#46;47&#8211;0&#46;98&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">71 &#40;53&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66 &#40;49&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;88 &#40;0&#46;49&#8211;1&#46;57&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;73 &#40;0&#46;40&#8211;1&#46;36&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;18&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37 &#40;27&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;55 &#40;0&#46;28&#8211;1&#46;10&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;47 &#40;0&#46;22&#8211;0&#46;97&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">147 &#40;54&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">128 &#40;47&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">121 &#40;45&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">140 &#40;52&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75 &#40;0&#46;53&#8211;1&#46;05&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69 &#40;0&#46;48&#8211;0&#46;98&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>EHW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;49&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;86&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>AIC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">366&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">365&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">369&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">365<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3448825.png"
              ]
            ]
          ]
          "notaPie" => array:3 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Best fit inheritance model&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">OR crude&#46;</p>"
            ]
            2 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">OR adjusted for sex&#44; age&#44; and BMI&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Genotypic association of rs662799 and rs5070 polymorphisms with hypertriglyceridemia as a function of inheritance model&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">AD&#58; atherogenic dyslipidemia&#59; OR&#58; odds ratio&#59; CI&#58; 95&#37; confidence interval&#59; <span class="elsevierStyleItalic">P</span>&#58; <span class="elsevierStyleItalic">P</span>-value&#44; significant &#40;&#60;0&#46;05&#41;&#59; AIC&#58; Akaike&#39;s information criterion&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="6" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Distribution of genotypes</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Dominant</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Recessive</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Overdominant</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Risk additive</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">With AD &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Without AD &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0025"><span class="elsevierStyleSup">b</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0025"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a> &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs662799</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39 &#40;32&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">95 &#40;64&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;01 &#40;2&#46;36&#8211;6&#46;81&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;14 &#40;0&#46;06&#8211;23&#46;38&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;99 &#40;2&#46;35&#8211;6&#46;78&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;77 &#40;2&#46;24&#8211;6&#46;33&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80 &#40;66&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">52 &#40;35&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;75 &#40;2&#46;25&#8211;6&#46;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;04 &#40;2&#46;37&#8211;6&#46;88&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;0&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;0&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;44 &#40;0&#46;15&#8211;39&#46;93&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;30 &#40;0&#46;10&#8211;50&#46;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">158 &#40;65&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">242 &#40;81&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">82 &#40;34&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54 &#40;18&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;32 &#40;1&#46;56&#8211;3&#46;46&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;43 &#40;1&#46;61&#8211;3&#46;66&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>AIC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">342&#46;4<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">370&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">342&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">343&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="15" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs5070</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;29&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">34 &#40;23&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;64 &#40;0&#46;36&#8211;1&#46;14&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;62 &#40;0&#46;34&#8211;1&#46;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;00 &#40;0&#46;60&#8211;1&#46;65&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;70 &#40;0&#46;49&#8211;1&#46;01&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">63 &#40;52&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">74 &#40;50&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;83 &#40;0&#46;46&#8211;1&#46;48&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;72 &#40;0&#46;39&#8211;1&#46;32&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&#47;T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22 &#40;18&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;27&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;53 &#40;0&#46;26&#8211;1&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;50 &#40;0&#46;24&#8211;1&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">133 &#40;55&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">142 &#40;48&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>T&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">107 &#40;44&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">154 &#40;52&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74 &#40;0&#46;52&#8211;1&#46;04&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68 &#40;0&#46;48&#8211;0&#46;97&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>AIC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">368&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">368&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">370&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">367&#46;1<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3448822.png"
              ]
            ]
          ]
          "notaPie" => array:3 [
            0 => array:3 [
              "identificador" => "tblfn0020"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Best fit inheritance model&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0025"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0025">OR crude&#46;</p>"
            ]
            2 => array:3 [
              "identificador" => "tblfn0030"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0030">OR adjusted for sex&#44; age&#44; and BMI&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Genotypic association of rs662799 and rs5070 polymorphisms with AD as a function of inheritance model&#46;</p>"
        ]
      ]
      7 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc1.doc"
          "ficheroTamanyo" => 20333
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:45 [
            0 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dislipidemias en ni&#241;os y adolescentes&#58; diagn&#243;stico y prevenci&#243;n"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "S&#46; Heller-Rouassant"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Bol M&#233;d Hosp Infant M&#233;x"
                        "fecha" => "2006"
                        "volumen" => "63"
                        "paginaInicial" => "158"
                        "paginaFinal" => "161"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum lipid levels and dyslipidaemia prevalence among 2&#8211;10 year-old northern mexican children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;D&#46;M&#46; Bibiloni"
                            1 => "R&#46; Salas"
                            2 => "H&#46;I&#46; Novelo"
                            3 => "J&#46;Z&#46; Villarreal"
                            4 => "A&#46; Sureda"
                            5 => "J&#46;A&#46; Tur"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2015"
                        "volumen" => "10"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "APOA5 variants predispose hyperlipidemic patients to atherogenic dyslipidemia and subclinical atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Guardiola"
                            1 => "M&#46; Cof&#225;n"
                            2 => "I&#46; de Castro-Oros"
                            3 => "A&#46; Cenarro"
                            4 => "N&#46; Plana"
                            5 => "P&#46;J&#46; Talmud"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.atherosclerosis.2015.03.008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Atherosclerosis"
                        "fecha" => "2015"
                        "volumen" => "240"
                        "paginaInicial" => "98"
                        "paginaFinal" => "104"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25770687"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of inherited atherogenic dyslipidemias in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "O&#46; Guardamagna"
                            1 => "P&#46; Cagliero"
                            2 => "F&#46; Abello"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1744-9987.2012.01146.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ther Apher Dial"
                        "fecha" => "2013"
                        "volumen" => "17"
                        "paginaInicial" => "150"
                        "paginaFinal" => "161"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23551671"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "APOA5 and APOA1 polymorphisms are associated with triglyceride levels in Mexican children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Su&#225;rez-S&#225;nchez"
                            1 => "M&#46; Klunder-Klunder"
                            2 => "A&#46; Valladares-Salgado"
                            3 => "J&#46; G&#243;mez-Zamudio"
                            4 => "J&#46; Peralta-Romero"
                            5 => "D&#46; Meyre"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ijpo.12147"
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Obes"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "330"
                        "paginaFinal" => "336"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27171122"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dislipidemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "N&#46; Pappan"
                            1 => "A&#46; Rehman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:3 [
                        "fecha" => "2021"
                        "editorial" => "StatPearls Publishing"
                        "editorialLocalizacion" => "Treasure Island &#40;FL&#41;"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dietary carbohydrates and insulin resistance in adolescents from marginalized areas of chiapas&#44; M&#233;xico"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Castro-Quezada"
                            1 => "E&#46; Flores-Guill&#233;n"
                            2 => "P&#46;E&#46; N&#250;&#241;ez-Ortega"
                            3 => "C&#46;A&#46; Irecta-N&#225;jera"
                            4 => "X&#46;M&#46; S&#225;nchez-Chino"
                            5 => "O&#46;G&#46; Mendez-Flores"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/nu11123066"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nutrients"
                        "fecha" => "2019"
                        "volumen" => "11"
                        "paginaInicial" => "3066"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31888175"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sociodemographic inequalities in cardiovascular risk factors among adolescents from indigenous areas of Chiapas&#44; M&#233;xico"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Flores-Guill&#233;n"
                            1 => "I&#46; Castro-Quezada"
                            2 => "C&#46;A&#46; Irecta-N&#225;jera"
                            3 => "P&#46;E&#46; N&#250;&#241;ez-Ortega"
                            4 => "M&#46; Cruz"
                            5 => "R&#46; Sol&#237;s-Hern&#225;ndez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "Eur PMC"
                        "fecha" => "2020"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The association of pediatric LDL-cholesterol and HDL-cholesterol dyslipidemia classifications and change in dyslipidemia status with carotid intima-media thickness in adulthood&#58; evidence from the cardiovascular risk in Young Finns Study&#44; the Bogalusa Hear"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Magnussen"
                            1 => "A&#46; Venn"
                            2 => "R&#46; Thomson"
                            3 => "M&#46; Juonala"
                            4 => "S&#46;R&#46; Srinivasan"
                            5 => "J&#46;S&#46; Viikari"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jacc.2008.09.061"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Am Coll Cardiol"
                        "fecha" => "2009"
                        "volumen" => "53"
                        "paginaInicial" => "860"
                        "paginaFinal" => "869"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19264243"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetics of dyslipidemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Garc&#237;a-Giustiniani"
                            1 => "R&#46; Stein"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5935/abc.20160074"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arq Bras Cardiol"
                        "fecha" => "2016"
                        "volumen" => "106"
                        "paginaInicial" => "434"
                        "paginaFinal" => "438"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27305287"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;A&#46; Pennacchio"
                            1 => "M&#46; Olivier"
                            2 => "J&#46;A&#46; Hubacek"
                            3 => "J&#46;C&#46; Cohen"
                            4 => "D&#46;R&#46; Cox"
                            5 => "J&#46;C&#46; Fruchart"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.1064852"
                      "Revista" => array:6 [
                        "tituloSerie" => "Science"
                        "fecha" => "2001"
                        "volumen" => "294"
                        "paginaInicial" => "169"
                        "paginaFinal" => "173"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11588264"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A5&#58; extracellular and intracellular roles in trigliceride metabolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T&#46;M&#46; Forte"
                            1 => "R&#46;O&#46; Ryan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2174/1389450116666150531161138"
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Drug Targets"
                        "fecha" => "2015"
                        "volumen" => "16"
                        "paginaInicial" => "1274"
                        "paginaFinal" => "1280"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26028042"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A-I&#58; structure&#8211;function relationships"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "P&#46;G&#46; Frank"
                            1 => "Y&#46;L&#46; Marcel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Lipid Res"
                        "fecha" => "2000"
                        "volumen" => "41"
                        "paginaInicial" => "853"
                        "paginaFinal" => "872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10828078"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lipoprote&#237;nas de alta densidad &#40;HDL&#41;&#46; Un objetivo terap&#233;utico en la prevenci&#243;n de la aterosclerosis&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "&#211;&#46; P&#233;rez-M&#233;ndez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Cardiol M&#233;x"
                        "fecha" => "2004"
                        "volumen" => "74"
                        "paginaInicial" => "53"
                        "paginaFinal" => "67"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15125268"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of APOA5-1131T&#62;C &#40;rs662799&#41; on fasting plasma lipids and risk of metabolic syndrome&#58; evidence from a case&#8211;control study in china and a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Xu"
                            1 => "R&#46; Bai"
                            2 => "D&#46; Zhang"
                            3 => "Z&#46; Li"
                            4 => "H&#46; Zhu"
                            5 => "M&#46; Lai"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2013"
                        "volumen" => "8"
                        "paginaInicial" => "56216"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between MspI polymorphisms of the apolipoprotein A-I gene and hyperlipidemia in an Iranian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46; Pakdel"
                            1 => "M&#46;R&#46; Akbari Eidgahi"
                            2 => "A&#46;R&#46; Bandegi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Middle East J Rehabil Heal Stud"
                        "fecha" => "2018"
                        "volumen" => "5"
                        "paginaInicial" => "26"
                        "paginaFinal" => "29"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of genetic polymorphisms of apolipoprotein A1 on serum HDL cholesterol level in postmenopausal Korean women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46;-Y&#46; Eom"
                            1 => "Y&#46;-D&#46; Kim"
                            2 => "H&#46; Kim"
                            3 => "J&#46;-S&#46; Hong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biomed Res"
                        "fecha" => "2013"
                        "volumen" => "14"
                        "paginaInicial" => "105"
                        "paginaFinal" => "110"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A1 gene polymorphisms as risk factors for hypertension and obesity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;S&#46; Chen"
                            1 => "D&#46;R&#46; Mazzotti"
                            2 => "T&#46;K&#46; Furuya"
                            3 => "M&#46;S&#46; Cendoroglo"
                            4 => "L&#46;R&#46; Ramos"
                            5 => "L&#46;Q&#46; Araujo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10238-009-0051-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Med"
                        "fecha" => "2009"
                        "volumen" => "9"
                        "paginaInicial" => "319"
                        "paginaFinal" => "325"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19408098"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Triglyceride-raising APOA5 genetic variants are associated with obesity and non-HDL-C in Chinese children and adolescents"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46;F&#46; Zhu"
                            1 => "C&#46;L&#46; Wang"
                            2 => "L&#46; Liang"
                            3 => "Z&#46; Shen"
                            4 => "J&#46;F&#46; Fu"
                            5 => "P&#46;N&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Lipids Heal Dis"
                        "fecha" => "2014"
                        "volumen" => "13"
                        "paginaInicial" => "93"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A5 and triglyceridemia&#46; Focus on the effects of the common variants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46;A&#46; Hubacek"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1515/CCLM.2005.153"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chem Lab Med"
                        "fecha" => "2005"
                        "volumen" => "43"
                        "paginaInicial" => "897"
                        "paginaFinal" => "902"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16176166"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "NCBI&#46; Reference SNP &#40;rs&#41; Report rs662799&#59; 2021&#46; Available from&#58; <a target="_blank" href="https://www.ncbi.nlm.nih.gov/snp/rs662799?vertical_tab=true">https&#58;&#47;&#47;www&#46;ncbi&#46;nlm&#46;nih&#46;gov&#47;snp&#47;rs662799&#63;vertical&#95;tab&#61;true&#35;frequency&#95;tab</a> &#91;cited 2021 June 12&#93;&#46;"
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "NCBI&#46; Reference SNP &#40;rs&#41; Report rs5070&#59; 2021&#46; Available from&#58; <a target="_blank" href="https://www.ncbi.nlm.nih.gov/snp/rs5070?vertical_tab=true">https&#58;&#47;&#47;www&#46;ncbi&#46;nlm&#46;nih&#46;gov&#47;snp&#47;rs5070&#63;vertical&#95;tab&#61;true&#35;frequency&#95;tab</a> &#91;cited 2021 June 12&#93;&#46;"
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Percentiles de presi&#243;n arterial para chicos &#40;2&#8211;17 a&#241;os&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46;S&#46;D&#46; Manual"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:1 [
                        "fecha" => "1899"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of dyslipidemia in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Kalra"
                            1 => "A&#46; Gandhi"
                            2 => "B&#46; Kalra"
                            3 => "N&#46; Agrawal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Diabetol Metab Syndr"
                        "fecha" => "2009"
                        "volumen" => "1"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Method for estimating high sdLDL-C by measuring triglyceride and apolipoprotein B levels"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; Hayashi"
                            1 => "S&#46; Koba"
                            2 => "Y&#46; Ito"
                            3 => "T&#46; Hirano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12944-016-0392-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lipids Health Dis"
                        "fecha" => "2017"
                        "volumen" => "16"
                        "paginaInicial" => "1"
                        "paginaFinal" => "10"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28056980"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Expert Panel on Integrated Guidelines for Cardiovascular Health and Risk Reduction in Children and Adolescents&#46; Expert Panel on integrated guidelines for cardiovascular health and risk reduction in children and adolescents&#46; Pediatrics&#59; 2011&#59; 128&#44; Suppl&#58; 94&#8211;133&#46; Available from&#58; <a target="_blank" href="https://www.nhlbi.nih.gov/files/docs/guidelines/peds_guidelines_full.pdf">https&#58;&#47;&#47;www&#46;nhlbi&#46;nih&#46;gov&#47;files&#47;docs&#47;guidelines&#47;peds&#95;guidelines&#95;full&#46;pdf</a> &#91;cited 2020 September 10&#93;&#46;"
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Atherogenic lipoprotein phenotype&#46; A proposed genetic marker for coronary heart disease risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46;A&#46; Austin"
                            1 => "M&#46;C&#46; King"
                            2 => "K&#46;M&#46; Vranizan"
                            3 => "R&#46;M&#46; Krauss"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/01.cir.82.2.495"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "1990"
                        "volumen" => "82"
                        "paginaInicial" => "495"
                        "paginaFinal" => "506"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2372896"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "La hipertrigliceridemia familiar no se asocia a mayor prevalencia de complicaciones macrovasculares en la diabetes mellitus tipo 2"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;A&#46; Aguilar-Salinas"
                            1 => "E&#46; Ram&#237;rez-Moguel"
                            2 => "J&#46; Gallegos-Mart&#237;nez"
                            3 => "O&#46; Leyva"
                            4 => "J&#46; Oseguera"
                            5 => "H&#46; Lozano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Gac Med Mex"
                        "fecha" => "2005"
                        "volumen" => "141"
                        "paginaInicial" => "201"
                        "paginaFinal" => "205"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16025985"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hyperlipidemia in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "B&#46;W&#46; McCrindle"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin invertir"
                        "fecha" => "2006"
                        "volumen" => "118"
                        "paginaInicial" => "49"
                        "paginaFinal" => "58"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between serum lipid levels in greek children with dyslipidemia and mediterranean diet socioeconomic factors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Lampropoulou"
                            1 => "M&#46; Chaini"
                            2 => "N&#46; Rigopoulos"
                            3 => "A&#46; Evangeliou"
                            4 => "K&#46; Papadopoulou-Legbelou"
                            5 => "A&#46;E&#46; Koutelidakis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/nu12061600"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nutrients"
                        "fecha" => "2020"
                        "volumen" => "12"
                        "paginaInicial" => "1600"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32485939"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The APOA5 rs662799 polymorphism is associated with dyslipidemia and the severity of coronary heart disease in Chinese women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Wang"
                            1 => "Z&#46; Lu"
                            2 => "J&#46; Zhang"
                            3 => "Y&#46; Yang"
                            4 => "J&#46; Shen"
                            5 => "X&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Lipids Heal Dis"
                        "fecha" => "2016"
                        "volumen" => "15"
                        "paginaInicial" => "170"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The apolipoprotein A5 &#40;APOA5&#41; gene predisposes Caucasian children to elevated triglycerides and vitamin E &#40;Four Provinces Study&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Guardiola"
                            1 => "J&#46; Ribalta"
                            2 => "D&#46; G&#243;mez-Coronado"
                            3 => "M&#46;A&#46; Lasunci&#243;n"
                            4 => "M&#46; de Oya"
                            5 => "C&#46; Garc&#233;s"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.atherosclerosis.2010.07.004"
                      "Revista" => array:6 [
                        "tituloSerie" => "Atherosclerosis"
                        "fecha" => "2010"
                        "volumen" => "212"
                        "paginaInicial" => "543"
                        "paginaFinal" => "547"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20688329"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The paradox of ApoA5 modulation of triglycerides&#58; evidences from clinical and basic research"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Garelnabi"
                            1 => "K&#46; Lor"
                            2 => "J&#46; Jin"
                            3 => "F&#46; Chai"
                            4 => "N&#46; Santanam"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.clinbiochem.2012.09.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Biochem"
                        "fecha" => "2013"
                        "volumen" => "46"
                        "paginaInicial" => "12"
                        "paginaFinal" => "19"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23000317"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "APOA-5 genetic variant rs662799&#58; role in lipid changes and insulin resistance after a Mediterranean diet in Caucasian obese subjects"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46; De Luis"
                            1 => "O&#46; Izaola"
                            2 => "D&#46; Primo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2021/1257145"
                      "Revista" => array:5 [
                        "tituloSerie" => "Dis Markers"
                        "fecha" => "2021"
                        "volumen" => "2021"
                        "paginaInicial" => "1257145"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34422134"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ApoAV reduces plasma triglycerides by inhibiting very low density lipoprotein-triglycerides &#40;VLDL-TG&#41; production and stimulating lipoprotein lipase-mediated VLDL-TG hydrolysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46;G&#46; Schaap"
                            1 => "P&#46;C&#46;N&#46; Rensen"
                            2 => "P&#46;J&#46; Voshol"
                            3 => "C&#46; Vrins"
                            4 => "H&#46;N&#46; Van Der Vliet"
                            5 => "R&#46;A&#46;F&#46;M&#46; Chamuleau"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M403240200"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2004"
                        "volumen" => "279"
                        "paginaInicial" => "27941"
                        "paginaFinal" => "27947"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15090553"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0405"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Give me A5 for lipoprotein hydrolysis&#33;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Merkel"
                            1 => "J&#46; Heeren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI26712"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Invest"
                        "fecha" => "2005"
                        "volumen" => "115"
                        "paginaInicial" => "2694"
                        "paginaFinal" => "2696"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16200205"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0410"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Determination of the functionality of common APOA5 polymorphisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P&#46;J&#46; Talmud"
                            1 => "J&#46; Palmen"
                            2 => "W&#46; Putt"
                            3 => "L&#46; Lins"
                            4 => "S&#46;E&#46; Humphries"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M502144200"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2005"
                        "volumen" => "280"
                        "paginaInicial" => "28215"
                        "paginaFinal" => "28220"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15941721"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0415"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased risk of obesity related to total energy intake with the APOA5-1131T&#62;C polymorphism in Korean premenopausal women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46;H&#46; Lim"
                            1 => "M&#46; Choi"
                            2 => "J&#46;Y&#46; Kim"
                            3 => "J&#46;H&#46; Lee"
                            4 => "O&#46;Y&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.nutres.2014.08.018"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nutr Res"
                        "fecha" => "2014"
                        "volumen" => "34"
                        "paginaInicial" => "827"
                        "paginaFinal" => "836"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25263629"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0420"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of the APOA1 rs964184 SNP and serum lipid traits in the Chinese Maonan and Han populations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46; Qiu"
                            1 => "R&#46;X&#46; Yin"
                            2 => "E&#46; Khounphinith"
                            3 => "F&#46;H&#46; Zhang"
                            4 => "D&#46;Z&#46; Yang"
                            5 => "S&#46;L&#46; Pan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Lipids Heal Dis"
                        "fecha" => "2018"
                        "volumen" => "17"
                        "paginaInicial" => "105"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0425"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New insights into the regulation of HDL metabolism and reverse cholesterol transport"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46;F&#46; Lewis"
                            1 => "D&#46;J&#46; Rader"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/01.RES.0000170946.56981.5c"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circ Res"
                        "fecha" => "2005"
                        "volumen" => "96"
                        "paginaInicial" => "1221"
                        "paginaFinal" => "1232"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15976321"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0430"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lipoprotein structure and composition"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "H&#46;N&#46; Ginsberg"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0889-8529(05)70023-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocrinol Metab Clin North Am"
                        "fecha" => "1998"
                        "volumen" => "27"
                        "paginaInicial" => "503"
                        "paginaFinal" => "519"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9785050"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0435"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic association and interaction analysis of USF1 and APOA5 on lipid levels and atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;P&#46; Laurila"
                            1 => "J&#46; Naukkarinen"
                            2 => "K&#46; Kristiansson"
                            3 => "S&#46; Ripatti"
                            4 => "T&#46; Kauttu"
                            5 => "K&#46; Silander"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/ATVBAHA.109.188912"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arterioscler Thromb Vasc Biol"
                        "fecha" => "2010"
                        "volumen" => "30"
                        "paginaInicial" => "346"
                        "paginaFinal" => "352"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19910639"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0440"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Update on APOA5 genetics&#58; toward a better understanding of its physiological impact"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Guardiola"
                            1 => "J&#46; Ribalta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Curr Atheroscler Rep"
                        "fecha" => "2017"
                        "volumen" => "19"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0445"
              "etiqueta" => "44"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gender-specific associations of the APOA1-75G&#62;A polymorphism with several metabolic syndrome components in Turkish adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Coban"
                            1 => "A&#46; Onat"
                            2 => "F&#46; Guclu-Geyik"
                            3 => "E&#46; Komurcu-Bayrak"
                            4 => "G&#46; Can"
                            5 => "N&#46; Erginel-Unaltuna"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cca.2014.01.017"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta"
                        "fecha" => "2014"
                        "volumen" => "431"
                        "paginaInicial" => "244"
                        "paginaFinal" => "249"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24508624"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            44 => array:3 [
              "identificador" => "bib0450"
              "etiqueta" => "45"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Polimorfismos de los genes APOA1 y APOB y concentraciones de sus apolipoprote&#237;nas como biomarcadores de riesgo en el s&#237;ndrome coronario agudo&#58; relaci&#243;n con la efectividad del tratamiento hipolipemiante"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Casillas-Mu&#241;oz"
                            1 => "Y&#46; Valle"
                            2 => "J&#46;F&#46; Mu&#241;oz-Valle"
                            3 => "D&#46;E&#46; Mart&#237;nez-Fern&#225;ndez"
                            4 => "G&#46;L&#46; Reynoso-Villalpando"
                            5 => "H&#46;E&#46; Flores-Salinas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Med Clin"
                        "fecha" => "2017"
                        "volumen" => "151"
                        "paginaInicial" => "1"
                        "paginaFinal" => "7"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack725509"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0175" class="elsevierStylePara elsevierViewall">We thank the professionals of the medical unit of the ISSSTE Comit&#225;n de Dom&#237;nguez&#44; Chiapas&#44; and Villahermosa&#44; Tabasco&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/25299123/0000003500000002/v5_202401310708/S2529912323000189/v5_202401310708/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "94034"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Iberoamerican"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/25299123/0000003500000002/v5_202401310708/S2529912323000189/v5_202401310708/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529912323000189?idApp=UINPBA00004N"
]
Article information
ISSN: 25299123
Original language: English
The statistics are updated each day
Year/Month Html Pdf Total
2024 November 2 0 2
2024 October 22 8 30
2024 September 25 7 32
2024 August 23 11 34
2024 July 22 9 31
2024 June 11 5 16
2024 May 16 4 20
2024 April 17 8 25
2024 March 6 10 16

Follow this link to access the full text of the article

es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos