Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients | Endocrinología, Diabetes y Nutrición (English ed.)

array:24 ["pii" => "S2530018021001608" "issn" => "25300180" "doi" => "10.1016/j.endien.2021.12.001" "estado" => "S300" "fechaPublicacion" => "2021-12-01" "aid" => "1174" "copyright" => "SEEN and SED" "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2021;68:680-8" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S2530016421001427" "issn" => "25300164" "doi" => "10.1016/j.endinu.2021.02.008" "estado" => "S300" "fechaPublicacion" => "2021-12-01" "aid" => "1174" "copyright" => "SEEN y SED" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2021;68:680-8" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Evaluación de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con cáncer diferenciado de tiroides" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "680" "paginaFinal" => "688" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1633 "Ancho" => 2091 "Tamanyo" => 121029 ] ] "descripcion" => array:1 [ "es" => "Niveles de ARNm Tg en pacientes con respuesta excelente y respuesta estructural incompleta. Datos de pacientes que recibieron ablación con I131." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "María Fabiana Russo-Picasso, María Pía Serra, María Lorena Viale, María Celeste Puga, Sergio Terrasa, Andrea Elina Kozak, Inés Califano, Luis Alejandro Boccalatte, Analía Stigliano, Patricia Fainstein-Day" "autores" => array:10 [ 0 => array:2 [ "nombre" => "María Fabiana" "apellidos" => "Russo-Picasso" ] 1 => array:2 [ "nombre" => "María Pía" "apellidos" => "Serra" ] 2 => array:2 [ "nombre" => "María Lorena" "apellidos" => "Viale" ] 3 => array:2 [ "nombre" => "María Celeste" "apellidos" => "Puga" ] 4 => array:2 [ "nombre" => "Sergio" "apellidos" => "Terrasa" ] 5 => array:2 [ "nombre" => "Andrea Elina" "apellidos" => "Kozak" ] 6 => array:2 [ "nombre" => "Inés" "apellidos" => "Califano" ] 7 => array:2 [ "nombre" => "Luis Alejandro" "apellidos" => "Boccalatte" ] 8 => array:2 [ "nombre" => "Analía" "apellidos" => "Stigliano" ] 9 => array:2 [ "nombre" => "Patricia" "apellidos" => "Fainstein-Day" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2530018021001608" "doi" => "10.1016/j.endien.2021.12.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001608?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421001427?idApp=UINPBA00004N" "url" => "/25300164/0000006800000010/v1_202111180536/S2530016421001427/v1_202111180536/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S2530018021001591" "issn" => "25300180" "doi" => "10.1016/j.endien.2021.11.033" "estado" => "S300" "fechaPublicacion" => "2021-12-01" "aid" => "1161" "copyright" => "SEEN and SED" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2021;68:689-98" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Equations predicting maturity status: Validation in a cross-sectional sample to assess physical growth and body adiposity in Chilean children and adolescents" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "689" "paginaFinal" => "698" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Ecuaciones que predicen el estado de madurez: Validación en una muestra transversal para evaluar el crecimiento físico y adiposidad corporal en niños y adolescentes chilenos" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 4175 "Ancho" => 2256 "Tamanyo" => 617193 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0015" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Relationship between chronological age and maturity stage categories (early, average and late) for both equations (Mirwald and Moore) in females." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Marco Cossio-Bolaños, Ruben Vidal-Espinoza, Luis Felipe Castelli Correia de Campos, Jose Sulla-Torres, Wilbert Cossio-Bolaños, Camilo Urra Albornoz, Rossana Gómez-Campos" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Marco" "apellidos" => "Cossio-Bolaños" ] 1 => array:2 [ "nombre" => "Ruben" "apellidos" => "Vidal-Espinoza" ] 2 => array:2 [ "nombre" => "Luis Felipe" "apellidos" => "Castelli Correia de Campos" ] 3 => array:2 [ "nombre" => "Jose" "apellidos" => "Sulla-Torres" ] 4 => array:2 [ "nombre" => "Wilbert" "apellidos" => "Cossio-Bolaños" ] 5 => array:2 [ "nombre" => "Camilo" "apellidos" => "Urra Albornoz" ] 6 => array:2 [ "nombre" => "Rossana" "apellidos" => "Gómez-Campos" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S2530016421001142" "doi" => "10.1016/j.endinu.2020.12.009" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421001142?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001591?idApp=UINPBA00004N" "url" => "/25300180/0000006800000010/v1_202112171003/S2530018021001591/v1_202112171003/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S253001802100161X" "issn" => "25300180" "doi" => "10.1016/j.endien.2021.10.010" "estado" => "S300" "fechaPublicacion" => "2021-12-01" "aid" => "1231" "copyright" => "SEEN and SED" "documento" => "article" "crossmark" => 1 "subdocumento" => "sco" "cita" => "Endocrinol Diabetes Nutr. 2021;68:677-9" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:10 [ "idiomaDefecto" => true "cabecera" => "Editorial" "titulo" => "Endocrinología, Diabetes y Nutrición: Year in Review 2021" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "677" "paginaFinal" => "679" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Endocrinología, Diabetes y Nutrición: repaso del año 2021" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Carles Zafon, Assumpta Caixàs, María Ballesteros, Edelmiro Menéndez, José Antonio Gimeno, Carmen Fajardo, Ana M. Wägner" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Carles" "apellidos" => "Zafon" ] 1 => array:2 [ "nombre" => "Assumpta" "apellidos" => "Caixàs" ] 2 => array:2 [ "nombre" => "María" "apellidos" => "Ballesteros" ] 3 => array:2 [ "nombre" => "Edelmiro" "apellidos" => "Menéndez" ] 4 => array:2 [ "nombre" => "José Antonio" "apellidos" => "Gimeno" ] 5 => array:2 [ "nombre" => "Carmen" "apellidos" => "Fajardo" ] 6 => array:2 [ "nombre" => "Ana M." "apellidos" => "Wägner" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S2530016421002469" "doi" => "10.1016/j.endinu.2021.10.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421002469?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S253001802100161X?idApp=UINPBA00004N" "url" => "/25300180/0000006800000010/v1_202112171003/S253001802100161X/v1_202112171003/en/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "680" "paginaFinal" => "688" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "María Fabiana Russo-Picasso, María Pía Serra, María Lorena Viale, María Celeste Puga, Sergio Terrasa, Andrea Elina Kozak, Inés Califano, Luis Alejandro Boccalatte, Analía Stigliano, Patricia Fainstein-Day" "autores" => array:10 [ 0 => array:4 [ "nombre" => "María Fabiana" "apellidos" => "Russo-Picasso" "email" => array:1 [ 0 => "maria.russopicasso@hospitalitaliano.org.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "María Pía" "apellidos" => "Serra" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "María Lorena" "apellidos" => "Viale" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "María Celeste" "apellidos" => "Puga" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "Sergio" "apellidos" => "Terrasa" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 5 => array:3 [ "nombre" => "Andrea Elina" "apellidos" => "Kozak" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 6 => array:3 [ "nombre" => "Inés" "apellidos" => "Califano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 7 => array:3 [ "nombre" => "Luis Alejandro" "apellidos" => "Boccalatte" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "f" "identificador" => "aff0030" ] ] ] 8 => array:3 [ "nombre" => "Analía" "apellidos" => "Stigliano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 9 => array:3 [ "nombre" => "Patricia" "apellidos" => "Fainstein-Day" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] ] "afiliaciones" => array:6 [ 0 => array:3 [ "entidad" => "Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Laboratorio de Biología Molecular, Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Sección Investigación no esponsoreada, Departamento de Investigación, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Laboratorio Hormonal, Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Servicio de Endocrinología, Instituto de Oncología Ángel H. Roffo, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Sección de Cabeza y Cuello, Servicio de Cirugía General, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "f" "identificador" => "aff0030" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Evaluación de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con cáncer diferenciado de tiroides" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1409 "Ancho" => 2091 "Tamanyo" => 146558 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "ROC curve of Tg mRNA levels. Area under the curve 0.6320 (0.48–0.78)." ] ] ] "textoCompleto" => "IntroductionThyroid cancer has shown a marked increase in global incidence over the past 20 years.<a class="elsevierStyleCrossRef" href="#bib0005">1</a> According to data from the United States National Institutes of Health (NIH), it is the cancer with the fifth highest incidence in females, with an incidence of 23.1 per 100,000 population per year,<a class="elsevierStyleCrossRef" href="#bib0010">2</a> representing a significant public health problem. This increase in incidence is tied to differentiated thyroid cancer, since the incidences of the other types of thyroid cancer, such as medullary thyroid cancer and anaplastic thyroid cancer, have remained stable. The Argentinian population has also seen this increased incidence of thyroid cancer.<a class="elsevierStyleCrossRefs" href="#bib0015">3,4</a>Follow-up of thyroid cancer, once initial treatment with surgery and radioiodine ablation in selected cases is completed, is based on neck ultrasound and measurement of serum thyroglobulin (Tg) levels. At present, under the follow-up paradigm suggested by the latest national and international recommendations, follow-up conforms to categories of risk of recurrence, which in turn determine subsequent monitoring and treatment behaviours. Determinations of Tg, with or without thyroid stimulating hormone (TSH), are an essential piece of this diagnostic/therapeutic algorithm.<a class="elsevierStyleCrossRefs" href="#bib0025">5,6</a>Tg is a 660-kDa glycoprotein synthesised by the rough endoplasmic reticulum of thyroid cells and its functions are iodine storage and thyroid hormone production.<a class="elsevierStyleCrossRef" href="#bib0035">7</a> Part of the Tg stored in the colloid is internalised and follows an alternative pathway to lysosomal proteolysis that releases thyroid hormones from Tg for secretion. Through binding to megalin, this alternative pathway transports Tg to the basolateral membrane of thyroid cells; from there, it enters the general circulation.<a class="elsevierStyleCrossRef" href="#bib0040">8</a> In patients who have undergone thyroidectomy for thyroid cancer, Tg measurement is used as a tumour marker, since its levels in that context are correlated to the mass of functioning pathological tissue.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> However, its excellent prognostic value is compromised in 20%–30% of patients with thyroglobulin antibodies (Tg Ab), as in, for example, patients with concomitant Hashimoto's thyroiditis. The presence of Tg Ab interferes with the measurement of Tg by immunometric methods such as immunoradiometric assay (IRMA), yielding falsely low or undetectable Tg levels.<a class="elsevierStyleCrossRef" href="#bib0050">10</a> Therefore, the use of Tg levels measured by immunometric methods presents this limitation in the follow-up of a significant number of patients with thyroid cancer.Our objective was to evaluate the detection and prognostic value of measuring Tg messenger ribonucleic acid (Tg mRNA) levels as an alternative to measuring Tg levels by immunometric methods in the follow-up of patients having undergone surgery for thyroid cancer.Specific objectivesTo evaluate the clinical sensitivity and specificity of Tg mRNA levels measured by quantitative real-time polymerase chain reaction (qRT-PCR) testing in peripheral blood from patients in follow-up for differentiated thyroid cancer having undergone radioiodine ablation. An exploratory descriptive study of Tg mRNA levels in patients not having undergone radioiodine ablation with no structural disease on imaging or nuclear medicine studies.MethodsLaboratory techniquesDetermination of Tg mRNABlood extraction: Blood extraction was performed by venipuncture. A total of 12 mL of blood were extracted in tubes with ethylenediaminetetraacetic acid (EDTA). Mononuclear cells were separated by gradient centrifugation with Ficoll-Paque Plus (GE Healthcare) according to the manufacturer's recommendations. The blood was diluted with an equal volume of normal saline, placed over 15 mL of Ficoll and centrifuged at 400G for 40 min; next, the layer corresponding to the mononuclear cells was separated. These cells were washed with normal saline and sedimented by centrifugation for RNA extraction.mRNA extraction: mRNA extraction was performed using the RiboPure-Blood Kit (Invitrogen) according to the manufacturer's recommendations. Briefly, the cells obtained in the previous step were lysed by adding 800 μl of lysis solution and 50 μl of sodium acetate solution to the pellet and mixing with a vortex mixer to complete the lysis. For extraction, 500 μl of acid-phenol:chloroform were added and the mixture was incubated for 5 min at room temperature, then centrifuged; after that, the aqueous phase was recovered and 600 μl of 100% ethanol were added to it. Purification was done by passing the sample through the kit's purification columns, centrifuging for 10 s and washing the column with 700 μl of wash solutions.Elution of the RNA from the column: The RNA was eluted with 50 μl of the elution solution, preheated to 75 °C.Processing with DNase: 2.5 μl of 20X DNase buffer + 0.5 μl DNase I were added to the RNA and incubated for 30 min at 37 °C. Finally, 10 μl of DNase Inactivation Reagent were added and the mixture was mixed with a vortex mixer, incubated for 2 min at room temperature and centrifuged for 1 min at maximum speed; then, the supernatant was transferred into a new tube.Reverse transcription: Reverse transcription was performed with the ImProm-II Reverse Transcription System reagent (Promega) using 1 μg of total RNA according to the manufacturer's recommendations.Real-time PCR reaction: Absolute quantification was performed using a calibration curve prepared by amplification of Tg mRNA based on total RNA from thyroid tissue obtained from a surgical procedure. The PCR product was purified, quantified and analysed by sequencing. Each RT-PCR reaction was performed in duplicate, from 5 μl of complementary DNA (cDNA) using Mezcla Real (Biodynamics) with SYBR Green according to the manufacturer's recommendations. The LightCycler 96 real-time PCR system (Roche) was used. The following primers were used for Tg: Tg forward 1F: CTATCGACGGCTCCTTCTTG and Tg antisense 1R:nCCAGTTGCCACTCACCTCTC. These primers generate a fragment of 116 base pairs that comprise exons 40 and 41 of Tg cDNA.<a class="elsevierStyleCrossRef" href="#bib0055">11</a> The results were analysed using the Unity Real Time software programme and expressed in fg/μg of RNA. RNA samples were processed without reverse transcription in the RT reaction to be used as controls for detecting contamination with DNA. No contamination was found.Hormone measurementsTSH and Tg Ab were determined in plasma and Tg was determined in serum, without suspending treatment with thyroid hormone (unstimulated TSH). The samples were centrifuged and processed in automated equipment. Hormone levels were measured by chemiluminescence: TSH (ABBOTT Architect, reference range [RR] 0.35–4.94 µIU/mL), functional sensitivity (FS) 0.01 IU/mL, coefficient of variation (%CV): less than 10%; Tg Ab (ABBOTT Architect, RR 0.2–4.1 IU/mL), FS 0.31 IU/mL, %CV: less than 10%. Tg levels were measured with an Immulite 2000 system (Siemens). The RR for this Tg assay is: up to 2.0 ng/mL (athyreotic with elevated TSH) or 0.7–84.0 ng/mL (non-athyreotic). The FS of the assay is 0.5 ng/mL and the %CV is 10%.Tg levels were classified for analysis into three categories: 1) levels less than or equal to 0.5 ng/mL; 2) levels greater than 0.5 and less than 1 ng/mL, and 3) levels greater than or equal to 1 ng/mL. Given that the sensitivity of our method for measuring Tg levels was lower than that used in the American Thyroid Association (ATA) classification, we did a second evaluation of laboratory results and imaging studies prospectively in 31 patients having undergone ablation in order to determine whether they were possible allocation errors, in particular possible cases incorrectly included in the group having undergone ablation with an excellent response. Antibodies were considered positive when their levels exceeded 4.1 IU/mL.PatientsA search for patients of both sexes over 18 years of age with thyroid cancer was conducted in pathology registries, and physicians from the Endocrinology Department of the Hospital Italiano de Buenos Aires and the Instituto de Oncología Ángel H. Roffo with patients in follow-up for thyroid cancer were asked to invite their patients to participate. The inclusion criteria were: having undergone total thyroidectomy at least six months earlier, having had at least one full evaluation of their disease stage after surgery and having complete follow-up data so that they could be appropriately categorised. Levels of risk of postoperative recurrence were determined according to a modified version of the risks of recurrence proposed in the latest ATA guidelines<a class="elsevierStyleCrossRef" href="#bib0030">6</a> (Appendix <a class="elsevierStyleCrossRef" href="#sec0080">B</a>, Supplementary data).To establish the groups to be compared, patients were classified by treatment response accorded to modified ATA criteria.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> 1) Excellent response: Tg less than or equal to 0.5 ng/mL and negative imaging studies. This group also included patients with no evidence of structural disease with positive Tg Ab who had been in follow-up long enough to rule out persistent disease. 2) Structural incomplete response: disease detected on imaging studies and confirmed by pathology where applicable, regardless of Tg levels. 3) Biochemical incomplete response: patients with Tg levels greater than or equal to 1 ng/mL or with Tg Ab levels on an upward curve, but without structural disease on imaging studies. 4) Indeterminate response: patients with Tg levels greater than 0.5 ng/mL but less than 1 ng/mL or nonspecific findings on imaging studies.The analysis included only patients who had received an ablative or therapeutic dose with radioiodine in the postoperative period, and at the time of recruitment had an excellent response or structural incomplete response, such that the predictive accuracy of Tg mRNA levels could be compared using reliable true positives (patients with structural incomplete response) and true negatives (patients with an excellent response). Data from patients with biochemical incomplete response or indeterminate response are presented in Appendix <a class="elsevierStyleCrossRef" href="#sec0080">B</a> (Supplementary data).Those who met the inclusion criteria were later contacted by telephone by the principal investigator to arrange an appointment to explain the protocol to them and obtain their written informed consent. The sample was collected in that same appointment or a later one, depending on which was more convenient for the patient.All patients recruited for evaluation of Tg mRNA levels as a parameter for diagnosis and follow-up had undergone radioiodine ablation (primary endpoint). In addition, a patient group with an excellent response not having undergone radioiodine ablation (secondary endpoint) was evaluated separately.The protocol was approved by the Hospital Italiano de Buenos Aires Independent Ethics Committee for Research Protocols (number 2828).The procedures were performed in patients after they had granted their written informed consent.Statistical analysisThis was a cross-sectional observational study. Continuous variables were expressed in terms of median and interquartile range (IQR) or range, depending on their distribution, while categorical variables were reported in terms of absolute number and percentage of total cases. To compare the characteristics of the different groups, the chi-squared and analysis of variance (ANOVA) statistical tests were used. Comparisons between medians for the groups having undergone ablation with an excellent response or structural incomplete response were made using the Mann–Whitney U test where applicable. A P value <.05 was considered statistically significant.A receiver operating characteristic (ROC) curve was built, considering patients who had received radioiodine and were free from structural disease to be true negatives and considering patients who had received radioiodine and had confirmed structural disease to be true positives.Statistical calculations were performed with the Stata software programme, version 13.0.ResultsWe recruited 120 patients: 97 women and 23 men, with a mean age of 54.8 (43.3–66.6) years. All had undergone total thyroidectomy, and 92 had received radioiodine ablation. The predominant histological type was papillary thyroid cancer (n = 111, 92%), 50 (45%) of them with the classic variant, and 99 (82%) were in stage I according to the eighth edition of the American Joint Committee on Cancer (AJCC) cancer staging manual.<a class="elsevierStyleCrossRef" href="#bib0060">12</a> Half of the patients (60; 50%) belonged to a group with a low risk of recurrence, and most showed an excellent response to treatment (97; 75.8%) according to ATA criteria (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). Within the group that had received radioiodine ablation, 69 showed an excellent response to treatment. This group included four patients who had Tg levels of 0.5 ng/mL, as this value was at the limit of quantitation of the method, and showed no evidence of structural disease in follow-up (30, 45, 82 and 109 months of follow-up). These patients were included in the group of 31 patients who underwent another extraction with a median of 8.46 (7.53–11.06) months after the first evaluation and were found to have undetectable Tg levels in the second extraction. None of the patients who underwent additional evaluation of treatment response had to change groups due to results inconsistent with their allocation in the study. Twenty-three patients had structural incomplete response; 16 of them had distant metastases. Cumulative radioiodine activity was significantly higher in the group with structural incomplete response (P < .001). Four of the patients with distant metastatic disease were receiving treatment with tyrosine kinase inhibitors (one with sorafenib and three with lenvatinib) at the time of the extraction. The group with an excellent response not having undergone ablation included 28 patients.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Clinical chemistry characteristics are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. TSH levels in the group not having undergone ablation were significantly higher than in the groups having undergone ablation (P < .002). The proportion of patients with Tg levels less than or equal to 0.5 ng/mL was significantly higher in the disease-free group having undergone ablation (P < .001). Two patients within the group not having undergone ablation had Tg levels greater than 1 ng/mL but less than 2 ng/mL. Tg mRNA levels did not significantly differ between the group with no evidence of disease and the group with persistent structural disease (P < .06). The group that had not received radioiodine ablation showed similar levels to the groups that had (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).<elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia>ROC curveThe ROC curve for Tg mRNA levels yielded an area under the curve of 0.6320 (0.48−0.78). The analysis demonstrated that Tg mRNA levels greater than 0.116 fg/μg Tg mRNA were associated with a higher risk of persistent structural disease (OR 3.35; 95% CI 1.22–9.19), with a sensitivity of 69.6% and a specificity of 59.4%. In a population with a prevalence of cases with persistent structural disease of 25%, positive predictive value was 36.4% and negative predictive value was 85.4% (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>).<elsevierMultimedia ident="fig0010"></elsevierMultimedia>DiscussionOur study evaluated the sensitivity, specificity and predictive values of Tg mRNA levels measured by qRT-PCR for the first time in a local population of patients with differentiated thyroid cancer. Our experience showed that this technique would be of limited use in the follow-up of patients with differentiated thyroid cancer, since Tg mRNA levels were similar in patients with an excellent response to treatment and in patients with confirmed structural incomplete response, with low sensitivity and specificity for detecting persistent structural disease. However, its high negative predictive value of 85% suggests that it could be a useful rule-out test in selected cases.Routine follow-up of patients with thyroid carcinoma involves measurement of blood Tg levels by immunometric methods and neck ultrasound,<a class="elsevierStyleCrossRef" href="#bib0030">6</a> less commonly, a whole-body radioiodine scan is also included. A disadvantage of this strategy is that Tg measurement has methodological interferences, including Tg Ab.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> The most commonly used immunometric methods yield values that are too low for disease staging in the presence of Tg Ab.<a class="elsevierStyleCrossRef" href="#bib0050">10</a> For this reason, antibodies at stable or decreasing levels place a patient in an indeterminate stage of their disease. This happens in around 8%–29% of patients, and 15%–20% of these patients develop structural disease in the course of their follow-up.<a class="elsevierStyleCrossRef" href="#bib0065">13</a> Other methods for measuring Tg without interference due to antibodies, such as mass spectrometry, have been tested, but have not demonstrated advantages in this context.<a class="elsevierStyleCrossRefs" href="#bib0070">14,15</a>The hypothesis of the usefulness of Tg mRNA levels in the follow-up of patients with thyroid cancer is based on detection of circulating thyroid cells in patients without thyroid disease, patients with benign disease and patients with thyroid cancer.<a class="elsevierStyleCrossRef" href="#bib0080">16</a> The first assays, using qualitative RT-PCR, showed suitable sensitivity but unfortunately low specificity.<a class="elsevierStyleCrossRef" href="#bib0085">17</a> Quantitative measurement techniques were then developed, but yielded disparate results. Ringel et al. reported a sensitivity of 84% and a specificity of 62% when they amplified a fragment of 87 base pairs between base pairs 262 and 348 of Tg cDNA.<a class="elsevierStyleCrossRef" href="#bib0090">18</a> A subsequent publication from the same group reported better accuracy (a higher proportion of patients correctly identified as disease free-or having persistent disease) compared to Tg levels measured by immunoassay (84% versus 75%, respectively).<a class="elsevierStyleCrossRef" href="#bib0095">19</a> These results could not be replicated by other authors. Takano et al. found similar Tg mRNA levels in patients with thyroid cancer without metastases and with confirmed metastases; in their experience, serum Tg levels measured by immunometric methods were a better disease marker than Tg mRNA levels.<a class="elsevierStyleCrossRef" href="#bib0100">20</a> Span et al., using the same primers as Ringel et al., also found no differences in Tg mRNA levels between patients with and without metastatic thyroid carcinoma, whether they were stratified by radioiodine uptake on scintigraphy or by serum Tg levels measured by immunoradiometric methods.<a class="elsevierStyleCrossRef" href="#bib0105">21</a> All these studies used radioiodine uptake on scintigraphy or serum Tg levels measured with assays that are now considered not to be very sensitive (FS > 1 ng/mL) as a gold standard for identifying persistent disease. Tg Ab were also evaluated with methods that were not very sensitive (haemagglutination), casting doubt on the capacity to identify Tg levels that were too low due to interference on the part of antibodies in the group of patients considered “disease-free”. Elisei et al., by contrast, used serum Tg levels measured by ultrasensitive methods (corresponding FSs 0.9 ng/mL and 0.03 ng/mL to confirm the absence of disease) and radioiodine uptake on scintigraphy to stratify patients. With this methodology, sensitivity was 82.3%, specificity 24.2%, positive predictive value was 65.6% and negative predictive value was 47.3%.<a class="elsevierStyleCrossRef" href="#bib0110">22</a> In 2010, Boldarine et al., using a novel strategy, generated and validated a pair of primers that did not include alternative splicing sites. In their study, they achieved a Tg mRNA cut-off point that distinguished between the disease-free population and the population with persistent structural disease with a sensitivity of 94.7% and a specificity of 95.8%.<a class="elsevierStyleCrossRef" href="#bib0090">18</a> However, in our experience, the same pair of primers did not achieve a cut-off point exceeding 90% sensitivity and/or specificity. Many authors have agreed that differences between the different assays can be explained by technical differences.<a class="elsevierStyleCrossRefs" href="#bib0085">17,18</a> One of the most significant differences between our experience and that of Boldarine et al. was the comparatively lower mass of Tg mRNA in our assay. This could be attributed to a lower rate of recovery of circulating tumour cells. Hypothetically, uneven loss across groups could contribute to decreases in sensitivity and specificity.Our study had a population of patients with thyroid cancer who were well identified and staged according to current disease-staging concepts.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> Almost all previously published studies based patient stratification on Tg levels with lower sensitivities than currently recommended (radioimmunoassays [RIAs] or immunoradiometric assays with sensitivities of 1 ng/mL), and many used a whole-body scan with 2−5 mCi of radioiodine as a gold standard for determining the presence of distant metastases.<a class="elsevierStyleCrossRefs" href="#bib0090">18–22</a>Thus, patients considered disease-free might actually have low-volume persistent structural disease that can only be detected by higher-sensitivity methods such as neck ultrasound, which is the method of choice at present.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> Detection of Tg mRNA in patients considered disease-free (38%–75.8%)<a class="elsevierStyleCrossRefs" href="#bib0090">18,22</a> appears to support this hypothesis, with the resulting loss of specificity. Our patients were categorised according to the results of their neck ultrasound performed by expert operators, other diagnostic methods when indicated and Tg levels with an FS of 0.5 ng/mL, yielding a more suitably identified disease-free population. Despite this, 40% of our disease-free patients in the group having undergone ablation had circulating Tg mRNA levels above the cut-off point. It is possible that the lower FS of our Tg assay resulted in the inclusion of patients who would have been considered to have indeterminate response with a more sensitive method due to having Tg levels greater than 0.2 ng/mL, 15%–20% of whom progress to structural incomplete response. Low-volume structural persistence that could not be detected by imaging methods in the excellent response group might have contributed to the relatively high Tg mRNA levels in this group. However, when we performed repeat determinations of Tg levels and imaging studies in a group of patients, including patients with detectable Tg levels in the excellent response group, the results were consistent and there was no need to change the allocation groups. Alternative hypotheses include illegitimate transcription in non-thyroid cells in the blood, interfering with detection of Tg mRNA originating in circulating thyroid cells.<a class="elsevierStyleCrossRef" href="#bib0110">22</a>To date, no method for clinical use enables evaluation of Tg levels in the presence of Tg Ab. Measurement of alternative parameters such as TSH receptor mRNA<a class="elsevierStyleCrossRef" href="#bib0115">23</a> and BRAF V600E has been tested,<a class="elsevierStyleCrossRef" href="#bib0120">24</a> and more recently a great deal of interest in measuring microRNA has arisen.<a class="elsevierStyleCrossRefs" href="#bib0125">25,26</a> As yet, none of these methods has proven to be a good replacement for Tg levels measured by immunoradiometric methods. Could measurement of Tg mRNA play a role in the follow-up of patients with Tg Ab? Under these circumstances, Tg mRNA levels could be useful as a rule-out test, considering their high negative predictive value and the fact that the prevalence of recurrences in the population with indeterminate response is around 20%, which is very close to the 25% found in our study. Nevertheless, this hypothesis should be confirmed in a prospective study of patients with indeterminate response since our study was not designed for this purpose.ConclusionsMeasurement of Tg mRNA levels by qRT-PCR lacks sufficient sensitivity and specificity to be used routinely as a replacement for Tg levels measured by immunoradiometric methods. However, it could have a place as a rule-out test in the follow-up of specific patients, such as those with positive Tg Ab. This hypothesis should be confirmed in a prospective study.FundingThis study was funded by the Fondo para la Investigación Científica y Tecnológica [Fund for Research in Science and Technology] (FONCYT) of the Agencia Nacional de Promoción Científica y Tecnológica [Argentinian National Agency for the Promotion of Science and Technology]. Ministry of Science, Technology and Productive Innovation of the Republic of Argentina.Proyectos de Investigación Científica y Tecnológica Orientados [Science- and Technology-Oriented Research Projects] (2016) grant ID number: 011. (ID: PICTO 2016-011).The agency was involved in the initial evaluation and follow-up of the project only.Conflicts of interestNone of the authors has any conflicts of interest in relation to this research study." "textoCompletoSecciones" => array:1 [ "secciones" => array:13 [ 0 => array:3 [ "identificador" => "xres1631327" "titulo" => "Abstract" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Objectives" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Methods" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Results" ] 4 => array:2 [ "identificador" => "abst0025" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1455564" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1631328" "titulo" => "Resumen" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0030" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0035" "titulo" => "Objetivos" ] 2 => array:2 [ "identificador" => "abst0040" "titulo" => "Métodos" ] 3 => array:2 [ "identificador" => "abst0045" "titulo" => "Resultados" ] 4 => array:2 [ "identificador" => "abst0050" "titulo" => "Conclusiones" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1455563" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:2 [ "identificador" => "sec0010" "titulo" => "Specific objectives" ] 6 => array:3 [ "identificador" => "sec0015" "titulo" => "Methods" "secciones" => array:2 [ 0 => array:3 [ "identificador" => "sec0020" "titulo" => "Laboratory techniques" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0025" "titulo" => "Determination of Tg mRNA" ] 1 => array:2 [ "identificador" => "sec0030" "titulo" => "Hormone measurements" ] 2 => array:2 [ "identificador" => "sec0035" "titulo" => "Patients" ] ] ] 1 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical analysis" ] ] ] 7 => array:3 [ "identificador" => "sec0045" "titulo" => "Results" "secciones" => array:1 [ 0 => array:2 [ "identificador" => "sec0050" "titulo" => "ROC curve" ] ] ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "Discussion" ] 9 => array:2 [ "identificador" => "sec0060" "titulo" => "Conclusions" ] 10 => array:2 [ "identificador" => "sec0065" "titulo" => "Funding" ] 11 => array:2 [ "identificador" => "sec0070" "titulo" => "Conflicts of interest" ] 12 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-07-29" "fechaAceptado" => "2021-02-21" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1455564" "palabras" => array:6 [ 0 => "Differentiated thyroid cancer" 1 => "Thyroid cancer" 2 => "Thyroglobulin" 3 => "Thyroglobulin messenger RNA" 4 => "Cancer follow-up" 5 => "RT-PCR" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1455563" "palabras" => array:6 [ 0 => "Cáncer diferenciado de tiroides" 1 => "Cáncer de tiroides" 2 => "Tiroglobulina" 3 => "ARN mensajero de tiroglobulina" 4 => "Seguimiento cáncer" 5 => "RT-PCR" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "IntroductionThe determination of thyroglobulin levels by immunoassay and imaging studies is subject to interference by antithyroglobulin antibodies in up to 30% of cases, suggesting a need to find alternative methods for the follow-up of a significant number of thyroid cancer patients. ObjectivesAssess the sensitivity, specificity, and predictive values of thyroglobulin messenger RNA levels measured by quantitative Real Time-PCR (qRT-PCR) in the blood of patients followed for differentiated thyroid cancer. MethodsThis is a prospective study of Tg-mRNA levels measured with qRT-PCR. A peripheral blood sample was taken in patients with excellent response (69) and with structural incomplete response to treatment (23). Results were analysed using the Unity Real-Time program and expressed as fg/μg RNA. A Receiver Operating Characteristic curve was constructed to assess Tg-mRNA cut-off values. ResultsTg-mRNA levels were not significantly different between the group with excellent response [0.10 fg/μg RNA (0.08−0.17)] and the group with incomplete structural response [0.133 fg/μg RNA (0.07−0.33)] (P < .06). Test sensitivity was 69.6%, specificity was 59.4%, negative predictive value was 85.4% and positive predictive value 36.4% ConclusionsOur experience shows that this technique could be useful as a rule-out test in selected cases, but its low sensitivity and specificity preclude its usefulness as a first-line test." "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Objectives" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Methods" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Results" ] 4 => array:2 [ "identificador" => "abst0025" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "IntroducciónLa determinación de tiroglobulina por métodos inmuno radiométricos presenta interferencia por anticuerpos antitiroglobulina hasta en el 30% de los casos, sugiriendo la necesidad de encontrar métodos alternativos para el seguimiento de un número significativo de pacientes con cáncer de tiroides. ObjetivosEvaluar la sensibilidad, especificidad y valores predictivos de los niveles de ARN mensajero de la tiroglobulina medidos con la técnica de PCR cuantitativa en tiempo real (qRT-PCR) en sangre periférica de pacientes en seguimiento por cáncer diferenciado de tiroides. MétodosEstudio prospectivo de los niveles de ARNm de Tg (ARNm Tg) determinados por qRT-PCR cuantitativa. Se extrajo una muestra de sangre periférica en pacientes con respuesta excelente (69), y con respuesta estructural incompleta al tratamiento(23). Los resultados fueron analizados por el programa Unity Real-Time y expresados en fg/μg ARN. Se realizó una curva ROC para evaluar el punto de corte de niveles de ARNm Tg. ResultadosLos niveles de ARNm Tg no fueron significativamente diferentes entre el grupo con respuesta excelente [0,10 fg/μg ARN (0,08–0,17)] y el grupo respuesta estructural incompleta [0,133 fg/μg ARN (0,07–0,33)] (P < .06). La sensibilidad fue 69.6%, la especificidad 59.4%, el valor predictivo negativo 85.4% y el valor predictivo positivo 36.4%. ConclusionesNuestra experiencia muestra que esta técnica tendría utilidad como prueba de exclusión en casos seleccionados, pero sus características no permiten su utilización como una prueba de primera línea." "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0030" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0035" "titulo" => "Objetivos" ] 2 => array:2 [ "identificador" => "abst0040" "titulo" => "Métodos" ] 3 => array:2 [ "identificador" => "abst0045" "titulo" => "Resultados" ] 4 => array:2 [ "identificador" => "abst0050" "titulo" => "Conclusiones" ] ] ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "Please cite this article as: Russo-Picasso MF, Serra MP, Viale ML, Puga MC, Terrasa S, Kozak AE, et al. Evaluación de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con cáncer diferenciado de tiroides. Endocrinol Diabetes Nutr. 2021;68:680–688." ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following are Supplementary data to this article:<elsevierMultimedia ident="upi0005"></elsevierMultimedia><elsevierMultimedia ident="upi0010"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0080" ] ] ] ] "multimedia" => array:6 [ 0 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1633 "Ancho" => 2091 "Tamanyo" => 126998 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Tg mRNA levels in patients with an excellent response and structural incomplete response. Data from patients who underwent ablation with I131." ] ] 1 => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1409 "Ancho" => 2091 "Tamanyo" => 146558 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "ROC curve of Tg mRNA levels. Area under the curve 0.6320 (0.48–0.78)." ] ] 2 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0015" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation excellent response (n = 69) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation structural incomplete response (n = 23) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No ablation excellent response (n = 28) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age (years), med. (IQR) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57.3 (42.8−67.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">63 (53−74.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">52.2 (39.4−60.5) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Female sex, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62 (90) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 (56) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 (78) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Papillary cancer, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64 (93) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 (83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (100) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Follicular cancer, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (13) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Oncocytic cell cancer, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">[0,1–4]TNM stage (eighth edition of AJCC), n (%)</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">I \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 (94) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (100) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">II \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (39) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">III \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IVa \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IVb \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (17) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NE \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (13) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">[0,1–4] \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">[0,1–4]Risk of postoperative recurrence according to ATA,<a class="elsevierStyleCrossRef" href="#bib0030">6</a>n (%)</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low risk \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 (45) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (100) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Intermediate risk \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 (45) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">High risk \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 (65) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Not evaluable \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cumulative radioiodine activity, mCi, med. (range) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100 (30−250) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">250 (100−500) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">N/A \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Time since onset, years, med. (IQR) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.0 (2.54−6.78) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.77 (1.91−7.73) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.72 (2.55−4.74) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2779654.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Characteristics of patients by disease stage." ] ] 3 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0020" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Parameter \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation excellent response (n = 69) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation structural incomplete response (n = 23) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No ablation excellent response (n = 28) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TSH (μIU/mL), med. (IQR) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.72 (0.23−2.33) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.4 (0.06−1.24) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.03 (1.0−5.5) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tg ≤ 0.5 ng/mL, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">69 (100) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 (68) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tg > 0.5 and <1 ng/mL, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (25) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tg ≥ 1 ng/mL, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 (74) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (7) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive Tg Ab, n (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (10) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (22) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (21) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tg mRNA (fg/μg RNA), med. (IQR) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.105 (0.079−0.175) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.133 (0.071−0.331) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.116 (0.049−0.271) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2779655.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Clinical chemistry characteristics of patients by disease stage." ] ] 4 => array:5 [ "identificador" => "upi0005" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc1.docx" "ficheroTamanyo" => 16879 ] ] 5 => array:5 [ "identificador" => "upi0010" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc2.docx" "ficheroTamanyo" => 17424 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:26 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Worldwide thyroid-cancer epidemic? The increasing impact of overdiagnosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Vaccarella" 1 => "S. Franceschi" 2 => "F. Bray" 3 => "C.P. Wild" 4 => "M. Plummer" 5 => "L. Dal Maso" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMp1604412" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med." "fecha" => "2016" "volumen" => "375" "paginaInicial" => "614" "paginaFinal" => "617" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27532827" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Programa de vigilancia, epidemiología y resultados (SEER) del Instituto Nacional de Salud (NIH) [Accessed 27 July 2020 por la autora MFRP]. Available from: <a target="_blank" href="https://seer.cancer.gov/csr/1975_2017/browse_csr.php?sectionSEL=1&pageSEL=sect_01_table.25">https://seer.cancer.gov/csr/1975_2017/browse_csr.php?sectionSEL=1&pageSEL=sect_01_table.25</a>." ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Estimación de la incidencia de cáncer de tiroides en capital Federal y Gran Buenos Aires (período 2003-2011)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "E.N. Faure" 1 => "M.J. Soutelo" 2 => "G. Faraj" 3 => "R. Lutfi" 4 => "J. Juvenal Guillermo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Argent Endocrinol Metab." "fecha" => "2012" "volumen" => "49" "paginaInicial" => "20" "paginaFinal" => "24" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Incidencia de cáncer de tiroides en la provincia de Neuquén, período 2001-2012" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Cohen-Sabban" 1 => "C. Palmero" 2 => "B. Bertrand" 3 => "A. Aiello" 4 => "Ghiglioni" 5 => "M.C. MacDonell" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.endonu.2014.04.005" "Revista" => array:6 [ "tituloSerie" => "Endocrinol Nutr." "fecha" => "2014" "volumen" => "61" "paginaInicial" => "455" "paginaFinal" => "459" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25043100" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Consenso intersocietario sobre tratamiento y seguimiento de pacientes con cáncer diferenciado de tiroides" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Pitoia" 1 => "I. Califano" 2 => "A. Vázquez" 3 => "E. Faure" 4 => "A. Gauna" 5 => "A. Orlandi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Argent Endocrinol Metab." "fecha" => "2014" "volumen" => "51" "paginaInicial" => "85" "paginaFinal" => "118" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer. The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B.R. Haugen" 1 => "E.K. Alexander" 2 => "K.C. Bible" 3 => "G.M. Doherty" 4 => "S.J. Mandel" 5 => "Y.E. Nikiforov" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/thy.2016.0628" "Revista" => array:6 [ "tituloSerie" => "Thyroid." "fecha" => "2017" "volumen" => "27" "paginaInicial" => "481" "paginaFinal" => "483" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28114862" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyroglobulin from molecular and cellular biology to clinical endocrinology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Di Geso" 1 => "P. Arvan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/er.2015-1090" "Revista" => array:6 [ "tituloSerie" => "Endocr Rev." "fecha" => "2016" "volumen" => "37" "paginaInicial" => "2" "paginaFinal" => "36" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26595189" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Megalin in thyroid physiology and pathology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Marino" 1 => "A. Pinchera" 2 => "R.T. McCluskey" 3 => "L. Chiovato" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/10507250150500667" "Revista" => array:6 [ "tituloSerie" => "Thyroid." "fecha" => "2001" "volumen" => "11" "paginaInicial" => "47" "paginaFinal" => "56" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11272097" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyroglobulin measurement. Techniques, clinical benefits, and pitfalls" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "C.A. Spencer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0889-8529(18)30023-9" "Revista" => array:5 [ "tituloSerie" => "Lab Clin North Am." "fecha" => "1995" "volumen" => "24" "paginaInicial" => "841" "paginaFinal" => "863" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Implications of thyroglobulin antibody positivity in patients with differentiated thyroid cancer: a clinical position statement" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Verburg" 1 => "M. Luster" 2 => "C. Cupini" 3 => "L. Chiovato" 4 => "L. Dunas" 5 => "R. Elisei" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/thy.2012.0606" "Revista" => array:6 [ "tituloSerie" => "Thyroid." "fecha" => "2013" "volumen" => "23" "paginaInicial" => "1211" "paginaFinal" => "1225" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23692026" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development of a sensitive and specific quantitative reverse transcription-polymerase chain reaction assay for blood thyroglobulin messenger ribonucleic acid in the follow-up of patients with differentiated thyroid carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "V.T. Boldarine" 1 => "R.M. Maciel" 2 => "G.S. Guimarães" 3 => "C.C. Nakabashi" 4 => "C.P. Camacho" 5 => "D.M. Andreoni" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2009-1354" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab." "fecha" => "2010" "volumen" => "95" "paginaInicial" => "1726" "paginaFinal" => "1733" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20173019" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyroid differentiated and anaplastic carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.M. Tuttle" 1 => "L.F. Morris" 2 => "B.R. Haugen" 3 => "J.P. Shah" 4 => "J.A. Sosa" 5 => "E. Rohren" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:6 [ "edicion" => "8th ed." "titulo" => "AJCC Cancer Staging Manual" "fecha" => "2017" "paginaInicial" => "873" "paginaFinal" => "890" "editorial" => "Springer" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dynamic risk assessment in patients with differentiated thyroid cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F. Pitoia" 1 => "F. Jerkovich" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1530/ERC-19-0213" "Revista" => array:6 [ "tituloSerie" => "Endocr Relat Cancer." "fecha" => "2019" "volumen" => "26" "paginaInicial" => "R553" "paginaFinal" => "R566" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31394499" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyroglobulin (Tg) testing revisited: Tg assays, TgAb assays, and correlation of results with clinical outcomes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B.C. Netzel" 1 => "S.K.G. Grebe" 2 => "B.C. Carranza Leon" 3 => "M.R. Castro" 4 => "P.N. Clark" 5 => "A.N. Hoofnagle" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2015-1967" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab." "fecha" => "2015" "volumen" => "100" "paginaInicial" => "E1074" "paginaFinal" => "E1083" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26079778" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyroglobulin liquid chromatography–tandem mass spectrometry has a low sensitivity for detecting structural disease in patients with antithyroglobulin antibodies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "U. Azmat" 1 => "K. Porter" 2 => "L. Senter" 3 => "M.D. Ringel" 4 => "F. Nabhan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/thy.2016.0210" "Revista" => array:6 [ "tituloSerie" => "Thyroid." "fecha" => "2017" "volumen" => "27" "paginaInicial" => "74" "paginaFinal" => "80" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27736322" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular diagnosis of residual and recurrent thyroid cancer by amplification of thyroglobulin messenger ribonucleic acid in peripheral blood" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.D. RingeL" 1 => "P.W. LadensoN" 2 => "M.A. Levine" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jcem.83.12.5346" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab." "fecha" => "1998" "volumen" => "83" "paginaInicial" => "4435" "paginaFinal" => "4442" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9851791" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of circulating Tg-mRNA in the follow-up of papillary and follicular thyroid cancer: how useful is it?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "F.A. Verburg" 1 => "C.J.M. Lips" 2 => "E.G.W.M. Lentjes" 3 => "J.M.H. de Klerk" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjc.6601991" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer." "fecha" => "2004" "volumen" => "91" "paginaInicial" => "200" "paginaFinal" => "204" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15213710" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantitative reverse transcription-polymerase chain reaction of circulating thyroglobulin messenger ribonucleic acid for monitoring patients with thyroid carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.D. Ringel" 1 => "P.L. Balducci-Silano" 2 => "J.S. Anderson" 3 => "C.A. Spencer" 4 => "J. Silverman" 5 => "Y.H. Sparling" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jcem.84.11.6164" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab." "fecha" => "1999" "volumen" => "84" "paginaInicial" => "4037" "paginaFinal" => "4042" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10566646" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Measurement of thyroglobulin mRNA in peripheral blood as an adjunctive test for monitoring thyroid cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Grammatopoulos" 1 => "Y. Elliott" 2 => "S.C. Smith" 3 => "I. Brown" 4 => "R.J. Grieve" 5 => "E.W. Hillhouse" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/mp.56.3.162" "Revista" => array:5 [ "tituloSerie" => "J Clin Mol Pathol." "fecha" => "2003" "volumen" => "56" "paginaInicial" => "162" "paginaFinal" => "166" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantitative measurement of thyroglobulin mRNA in peripheral blood of patients after total thyroidectomy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "T. Takano" 1 => "A. Miyauchi" 2 => "H. Yoshida" 3 => "Y. Hasegawa" 4 => "K. Kuma" 5 => "N. Amino" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1054/bjoc.2001.1904" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer." "fecha" => "2001" "volumen" => "85" "paginaInicial" => "102" "paginaFinal" => "106" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11437410" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantitative detection of peripheral thyroglobulin mRNA has limited clinical value in the follow-up of thyroid cancer patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.N. Span" 1 => "M.J.M. Sluggers" 2 => "Van den Broek" 3 => "H.A. Ross" 4 => "W.-A. Nieuwlaat" 5 => "A.R.M.M. Hermus" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1258/000456303321016231" "Revista" => array:6 [ "tituloSerie" => "Ann Clin Biochem." "fecha" => "2003" "volumen" => "40" "paginaInicial" => "94" "paginaFinal" => "99" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12542917" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Low specificity of blood Thyroglobulin Messenger Ribonucleic Acid assay prevents its use in the follow-up of differentiated thyroid cancer patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Elisei" 1 => "A. Vivaldi" 2 => "L. Agate" 3 => "E. Molinaro" 4 => "C. Nencetti" 5 => "L. Grasso" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2003-031341" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab." "fecha" => "2004" "volumen" => "89" "paginaInicial" => "33" "paginaFinal" => "39" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14715824" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effectiveness of peripheral thyrotropin receptor mRNA n follow-up of differentiated thyroid cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Milas" 1 => "G.F. Barbosa" 2 => "J. Mitchell" 3 => "E. Berber" 4 => "A. Siperstein" 5 => "M. Gupta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1245/s10434-008-0211-9" "Revista" => array:6 [ "tituloSerie" => "Ann Surg Oncol." "fecha" => "2009" "volumen" => "16" "paginaInicial" => "473" "paginaFinal" => "480" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19015922" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of circulating BRAFV600E in patients with papillary thyroid carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.C. Lubitz" 1 => "S. Parangi" 2 => "T.M. Holm" 3 => "M.J. Bernasconi" 4 => "A.P. Schalck" 5 => "H. Suh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jmoldx.2015.08.003" "Revista" => array:5 [ "tituloSerie" => "J Moll Diag." "fecha" => "2016" "volumen" => "18" "paginaInicial" => "100" "paginaFinal" => "108" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of thyroid-associated serum microRNA profiles and their potential use in thyroid cancer follow-up" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Rosignolo" 1 => "M. Sponziello" 2 => "L. Giacomelli" 3 => "D. Russo" 4 => "V. Pecce" 5 => "M. Biffoni" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/js.2016-1032" "Revista" => array:6 [ "tituloSerie" => "J Endocr Soc." "fecha" => "2017" "volumen" => "1" "paginaInicial" => "3" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29264441" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New molecular biomarkers in differentiated thyroid carcinoma: impact of miR-146, miR-221 and miR-222 levels in the evolution of the disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.M. Gómez-Pérez" 1 => "I.M. Cornejo Pareja" 2 => "J. García Alemán" 3 => "L. Coín Aragüez" 4 => "A. Sebastián Ochoa" 5 => "J. Alcaide Torres" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/cen.13972" "Revista" => array:6 [ "tituloSerie" => "Clin Endocrinol (Oxf)." "fecha" => "2019" "volumen" => "91" "paginaInicial" => "187" "paginaFinal" => "194" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30887564" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/25300180/0000006800000010/v1_202112171003/S2530018021001608/v1_202112171003/en/main.assets" "Apartado" => array:4 [ "identificador" => "64496" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/25300180/0000006800000010/v1_202112171003/S2530018021001608/v1_202112171003/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001608?idApp=UINPBA00004N"]

Statistics

Original article

Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients

Evaluación de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con cáncer diferenciado de tiroides

María Fabiana Russo-Picassoa,

Corresponding author

maria.russopicasso@hospitalitaliano.org.ar

Corresponding author.

, María Pía Serrab, María Lorena Vialeb, María Celeste Pugac, Sergio Terrasac, Andrea Elina Kozakd, Inés Califanoe, Luis Alejandro Boccalattef, Analía Stiglianob, Patricia Fainstein-Daya

a Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina

b Laboratorio de Biología Molecular, Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina

c Sección Investigación no esponsoreada, Departamento de Investigación, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina

d Laboratorio Hormonal, Servicio de Endocrinología, Metabolismo y Medicina Nuclear, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina

e Servicio de Endocrinología, Instituto de Oncología Ángel H. Roffo, Ciudad Autónoma de Buenos Aires, Argentina

f Sección de Cabeza y Cuello, Servicio de Cirugía General, Hospital Italiano de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina

Read

975

Times
was read the article

216

Total PDF

759

Total HTML

Share statistics

 array:24 [
  "pii" => "S2530018021001608"
  "issn" => "25300180"
  "doi" => "10.1016/j.endien.2021.12.001"
  "estado" => "S300"
  "fechaPublicacion" => "2021-12-01"
  "aid" => "1174"
  "copyright" => "SEEN and SED"
  "copyrightAnyo" => "2021"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Endocrinol Diabetes Nutr. 2021;68:680-8"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "es" => array:19 [
      "pii" => "S2530016421001427"
      "issn" => "25300164"
      "doi" => "10.1016/j.endinu.2021.02.008"
      "estado" => "S300"
      "fechaPublicacion" => "2021-12-01"
      "aid" => "1174"
      "copyright" => "SEEN y SED"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Endocrinol Diabetes Nutr. 2021;68:680-8"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "es" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
        "titulo" => "Evaluaci&#243;n de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con c&#225;ncer diferenciado de tiroides"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "tieneResumen" => array:2 [
          0 => "es"
          1 => "en"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "680"
            "paginaFinal" => "688"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients"
          ]
        ]
        "contieneResumen" => array:2 [
          "es" => true
          "en" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Figura 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 1633
                "Ancho" => 2091
                "Tamanyo" => 121029
              ]
            ]
            "descripcion" => array:1 [
              "es" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Niveles de ARNm Tg en pacientes con respuesta excelente y respuesta estructural incompleta&#46; Datos de pacientes que recibieron ablaci&#243;n con I<span class="elsevierStyleSup">131</span>&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Mar&#237;a Fabiana Russo-Picasso, Mar&#237;a P&#237;a Serra, Mar&#237;a Lorena Viale, Mar&#237;a Celeste Puga, Sergio Terrasa, Andrea Elina Kozak, In&#233;s Califano, Luis Alejandro Boccalatte, Anal&#237;a Stigliano, Patricia Fainstein-Day"
            "autores" => array:10 [
              0 => array:2 [
                "nombre" => "Mar&#237;a Fabiana"
                "apellidos" => "Russo-Picasso"
              ]
              1 => array:2 [
                "nombre" => "Mar&#237;a P&#237;a"
                "apellidos" => "Serra"
              ]
              2 => array:2 [
                "nombre" => "Mar&#237;a Lorena"
                "apellidos" => "Viale"
              ]
              3 => array:2 [
                "nombre" => "Mar&#237;a Celeste"
                "apellidos" => "Puga"
              ]
              4 => array:2 [
                "nombre" => "Sergio"
                "apellidos" => "Terrasa"
              ]
              5 => array:2 [
                "nombre" => "Andrea Elina"
                "apellidos" => "Kozak"
              ]
              6 => array:2 [
                "nombre" => "In&#233;s"
                "apellidos" => "Califano"
              ]
              7 => array:2 [
                "nombre" => "Luis Alejandro"
                "apellidos" => "Boccalatte"
              ]
              8 => array:2 [
                "nombre" => "Anal&#237;a"
                "apellidos" => "Stigliano"
              ]
              9 => array:2 [
                "nombre" => "Patricia"
                "apellidos" => "Fainstein-Day"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S2530018021001608"
          "doi" => "10.1016/j.endien.2021.12.001"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001608?idApp=UINPBA00004N"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421001427?idApp=UINPBA00004N"
      "url" => "/25300164/0000006800000010/v1_202111180536/S2530016421001427/v1_202111180536/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S2530018021001591"
    "issn" => "25300180"
    "doi" => "10.1016/j.endien.2021.11.033"
    "estado" => "S300"
    "fechaPublicacion" => "2021-12-01"
    "aid" => "1161"
    "copyright" => "SEEN and SED"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Endocrinol Diabetes Nutr. 2021;68:689-98"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Equations predicting maturity status&#58; Validation in a cross-sectional sample to assess physical growth and body adiposity in Chilean children and adolescents"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "689"
          "paginaFinal" => "698"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Ecuaciones que predicen el estado de madurez&#58; Validaci&#243;n en una muestra transversal para evaluar el crecimiento f&#237;sico y adiposidad corporal en ni&#241;os y adolescentes chilenos"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 4175
              "Ancho" => 2256
              "Tamanyo" => 617193
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0015"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Relationship between chronological age and maturity stage categories &#40;early&#44; average and late&#41; for both equations &#40;Mirwald and Moore&#41; in females&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Marco Cossio-Bola&#241;os, Ruben Vidal-Espinoza, Luis Felipe Castelli Correia de Campos, Jose Sulla-Torres, Wilbert Cossio-Bola&#241;os, Camilo Urra Albornoz, Rossana G&#243;mez-Campos"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Marco"
              "apellidos" => "Cossio-Bola&#241;os"
            ]
            1 => array:2 [
              "nombre" => "Ruben"
              "apellidos" => "Vidal-Espinoza"
            ]
            2 => array:2 [
              "nombre" => "Luis Felipe"
              "apellidos" => "Castelli Correia de Campos"
            ]
            3 => array:2 [
              "nombre" => "Jose"
              "apellidos" => "Sulla-Torres"
            ]
            4 => array:2 [
              "nombre" => "Wilbert"
              "apellidos" => "Cossio-Bola&#241;os"
            ]
            5 => array:2 [
              "nombre" => "Camilo"
              "apellidos" => "Urra Albornoz"
            ]
            6 => array:2 [
              "nombre" => "Rossana"
              "apellidos" => "G&#243;mez-Campos"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S2530016421001142"
        "doi" => "10.1016/j.endinu.2020.12.009"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421001142?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001591?idApp=UINPBA00004N"
    "url" => "/25300180/0000006800000010/v1_202112171003/S2530018021001591/v1_202112171003/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S253001802100161X"
    "issn" => "25300180"
    "doi" => "10.1016/j.endien.2021.10.010"
    "estado" => "S300"
    "fechaPublicacion" => "2021-12-01"
    "aid" => "1231"
    "copyright" => "SEEN and SED"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "sco"
    "cita" => "Endocrinol Diabetes Nutr. 2021;68:677-9"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:10 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Editorial</span>"
      "titulo" => "Endocrinolog&#237;a&#44; Diabetes y Nutrici&#243;n&#58; Year in Review 2021"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "677"
          "paginaFinal" => "679"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Endocrinolog&#237;a&#44; Diabetes y Nutrici&#243;n&#58; repaso del a&#241;o 2021"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Carles Zafon, Assumpta Caix&#224;s, Mar&#237;a Ballesteros, Edelmiro Men&#233;ndez, Jos&#233; Antonio Gimeno, Carmen Fajardo, Ana M&#46; W&#228;gner"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Carles"
              "apellidos" => "Zafon"
            ]
            1 => array:2 [
              "nombre" => "Assumpta"
              "apellidos" => "Caix&#224;s"
            ]
            2 => array:2 [
              "nombre" => "Mar&#237;a"
              "apellidos" => "Ballesteros"
            ]
            3 => array:2 [
              "nombre" => "Edelmiro"
              "apellidos" => "Men&#233;ndez"
            ]
            4 => array:2 [
              "nombre" => "Jos&#233; Antonio"
              "apellidos" => "Gimeno"
            ]
            5 => array:2 [
              "nombre" => "Carmen"
              "apellidos" => "Fajardo"
            ]
            6 => array:2 [
              "nombre" => "Ana M&#46;"
              "apellidos" => "W&#228;gner"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S2530016421002469"
        "doi" => "10.1016/j.endinu.2021.10.001"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016421002469?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S253001802100161X?idApp=UINPBA00004N"
    "url" => "/25300180/0000006800000010/v1_202112171003/S253001802100161X/v1_202112171003/en/main.assets"
  ]
  "en" => array:21 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Assessment of the utility of measuring Thyroglobulin mRNA levels by Quantitative Real-Time PCR in the follow-up of differentiated thyroid cancer patients"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "680"
        "paginaFinal" => "688"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Mar&#237;a Fabiana Russo-Picasso, Mar&#237;a P&#237;a Serra, Mar&#237;a Lorena Viale, Mar&#237;a Celeste Puga, Sergio Terrasa, Andrea Elina Kozak, In&#233;s Califano, Luis Alejandro Boccalatte, Anal&#237;a Stigliano, Patricia Fainstein-Day"
        "autores" => array:10 [
          0 => array:4 [
            "nombre" => "Mar&#237;a Fabiana"
            "apellidos" => "Russo-Picasso"
            "email" => array:1 [
              0 => "maria.russopicasso@hospitalitaliano.org.ar"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Mar&#237;a P&#237;a"
            "apellidos" => "Serra"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Mar&#237;a Lorena"
            "apellidos" => "Viale"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Mar&#237;a Celeste"
            "apellidos" => "Puga"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Sergio"
            "apellidos" => "Terrasa"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Andrea Elina"
            "apellidos" => "Kozak"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "In&#233;s"
            "apellidos" => "Califano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Luis Alejandro"
            "apellidos" => "Boccalatte"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Anal&#237;a"
            "apellidos" => "Stigliano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Patricia"
            "apellidos" => "Fainstein-Day"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:6 [
          0 => array:3 [
            "entidad" => "Servicio de Endocrinolog&#237;a&#44; Metabolismo y Medicina Nuclear&#44; Hospital Italiano de Buenos Aires&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Laboratorio de Biolog&#237;a Molecular&#44; Servicio de Endocrinolog&#237;a&#44; Metabolismo y Medicina Nuclear&#44; Hospital Italiano de Buenos Aires&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Secci&#243;n Investigaci&#243;n no esponsoreada&#44; Departamento de Investigaci&#243;n&#44; Hospital Italiano de Buenos Aires&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Laboratorio Hormonal&#44; Servicio de Endocrinolog&#237;a&#44; Metabolismo y Medicina Nuclear&#44; Hospital Italiano de Buenos Aires&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Servicio de Endocrinolog&#237;a&#44; Instituto de Oncolog&#237;a &#193;ngel H&#46; Roffo&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Secci&#243;n de Cabeza y Cuello&#44; Servicio de Cirug&#237;a General&#44; Hospital Italiano de Buenos Aires&#44; Ciudad Aut&#243;noma de Buenos Aires&#44; Argentina"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Evaluaci&#243;n de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con c&#225;ncer diferenciado de tiroides"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1409
            "Ancho" => 2091
            "Tamanyo" => 146558
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">ROC curve of Tg mRNA levels&#46; Area under the curve 0&#46;6320 &#40;0&#46;48&#8211;0&#46;78&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Thyroid cancer has shown a marked increase in global incidence over the past 20 years&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> According to data from the United States National Institutes of Health &#40;NIH&#41;&#44; it is the cancer with the fifth highest incidence in females&#44; with an incidence of 23&#46;1 per 100&#44;000 population per year&#44;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> representing a significant public health problem&#46; This increase in incidence is tied to differentiated thyroid cancer&#44; since the incidences of the other types of thyroid cancer&#44; such as medullary thyroid cancer and anaplastic thyroid cancer&#44; have remained stable&#46; The Argentinian population has also seen this increased incidence of thyroid cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3&#44;4</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Follow-up of thyroid cancer&#44; once initial treatment with surgery and radioiodine ablation in selected cases is completed&#44; is based on neck ultrasound and measurement of serum thyroglobulin &#40;Tg&#41; levels&#46; At present&#44; under the follow-up paradigm suggested by the latest national and international recommendations&#44; follow-up conforms to categories of risk of recurrence&#44; which in turn determine subsequent monitoring and treatment behaviours&#46; Determinations of Tg&#44; with or without thyroid stimulating hormone &#40;TSH&#41;&#44; are an essential piece of this diagnostic&#47;therapeutic algorithm&#46;<a class="elsevierStyleCrossRefs" href="#bib0025"><span class="elsevierStyleSup">5&#44;6</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Tg is a 660-kDa glycoprotein synthesised by the rough endoplasmic reticulum of thyroid cells and its functions are iodine storage and thyroid hormone production&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> Part of the Tg stored in the colloid is internalised and follows an alternative pathway to lysosomal proteolysis that releases thyroid hormones from Tg for secretion&#46; Through binding to megalin&#44; this alternative pathway transports Tg to the basolateral membrane of thyroid cells&#59; from there&#44; it enters the general circulation&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> In patients who have undergone thyroidectomy for thyroid cancer&#44; Tg measurement is used as a tumour marker&#44; since its levels in that context are correlated to the mass of functioning pathological tissue&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> However&#44; its excellent prognostic value is compromised in 20&#37;&#8211;30&#37; of patients with thyroglobulin antibodies &#40;Tg Ab&#41;&#44; as in&#44; for example&#44; patients with concomitant Hashimoto&#39;s thyroiditis&#46; The presence of Tg Ab interferes with the measurement of Tg by immunometric methods such as immunoradiometric assay &#40;IRMA&#41;&#44; yielding falsely low or undetectable Tg levels&#46;<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> Therefore&#44; the use of Tg levels measured by immunometric methods presents this limitation in the follow-up of a significant number of patients with thyroid cancer&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Our objective was to evaluate the detection and prognostic value of measuring Tg messenger ribonucleic acid &#40;Tg mRNA&#41; levels as an alternative to measuring Tg levels by immunometric methods in the follow-up of patients having undergone surgery for thyroid cancer&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Specific objectives</span><p id="par0025" class="elsevierStylePara elsevierViewall">To evaluate the clinical sensitivity and specificity of Tg mRNA levels measured by quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41; testing in peripheral blood from patients in follow-up for differentiated thyroid cancer having undergone radioiodine ablation&#46; An exploratory descriptive study of Tg mRNA levels in patients not having undergone radioiodine ablation with no structural disease on imaging or nuclear medicine studies&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Methods</span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Laboratory techniques</span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Determination of Tg mRNA</span><p id="par0030" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Blood extraction&#58;</span> Blood extraction was performed by venipuncture&#46; A total of 12&#8239;mL of blood were extracted in tubes with ethylenediaminetetraacetic acid &#40;EDTA&#41;&#46; Mononuclear cells were separated by gradient centrifugation with Ficoll-Paque Plus &#40;GE Healthcare&#41; according to the manufacturer&#39;s recommendations&#46; The blood was diluted with an equal volume of normal saline&#44; placed over 15&#8239;mL of Ficoll and centrifuged at 400G for 40&#8239;min&#59; next&#44; the layer corresponding to the mononuclear cells was separated&#46; These cells were washed with normal saline and sedimented by centrifugation for RNA extraction&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">mRNA extraction&#58;</span> mRNA extraction was performed using the RiboPure-Blood Kit &#40;Invitrogen&#41; according to the manufacturer&#39;s recommendations&#46; Briefly&#44; the cells obtained in the previous step were lysed by adding 800&#8239;&#956;l of lysis solution and 50&#8239;&#956;l of sodium acetate solution to the pellet and mixing with a vortex mixer to complete the lysis&#46; For extraction&#44; 500&#8239;&#956;l of acid-phenol&#58;chloroform were added and the mixture was incubated for 5&#8239;min at room temperature&#44; then centrifuged&#59; after that&#44; the aqueous phase was recovered and 600&#8239;&#956;l of 100&#37; ethanol were added to it&#46; Purification was done by passing the sample through the kit&#39;s purification columns&#44; centrifuging for 10&#8239;s and washing the column with 700&#8239;&#956;l of wash solutions&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Elution of the RNA from the column&#58;</span> The RNA was eluted with 50&#8239;&#956;l of the elution solution&#44; preheated to 75&#8239;&#176;C&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Processing with DNase&#58;</span> 2&#46;5&#8239;&#956;l of 20X DNase buffer&#8239;&#43;&#8239;0&#46;5&#8239;&#956;l DNase I were added to the RNA and incubated for 30&#8239;min at 37&#8239;&#176;C&#46; Finally&#44; 10&#8239;&#956;l of DNase Inactivation Reagent were added and the mixture was mixed with a vortex mixer&#44; incubated for 2&#8239;min at room temperature and centrifuged for 1&#8239;min at maximum speed&#59; then&#44; the supernatant was transferred into a new tube&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Reverse transcription&#58;</span> Reverse transcription was performed with the ImProm-II Reverse Transcription System reagent &#40;Promega&#41; using 1&#8239;&#956;g of total RNA according to the manufacturer&#39;s recommendations&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Real-time PCR reaction</span>&#58; Absolute quantification was performed using a calibration curve prepared by amplification of Tg mRNA based on total RNA from thyroid tissue obtained from a surgical procedure&#46; The PCR product was purified&#44; quantified and analysed by sequencing&#46; Each RT-PCR reaction was performed in duplicate&#44; from 5&#8239;&#956;l of complementary DNA &#40;cDNA&#41; using Mezcla Real &#40;Biodynamics&#41; with SYBR Green according to the manufacturer&#39;s recommendations&#46; The LightCycler 96 real-time PCR system &#40;Roche&#41; was used&#46; The following primers were used for Tg&#58; Tg forward 1F&#58; CTATCGACGGCTCCTTCTTG and Tg antisense 1R&#58;nCCAGTTGCCACTCACCTCTC&#46; These primers generate a fragment of 116 base pairs that comprise exons 40 and 41 of Tg cDNA&#46;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a> The results were analysed using the Unity Real Time software programme and expressed in fg&#47;&#956;g of RNA&#46; RNA samples were processed without reverse transcription in the RT reaction to be used as controls for detecting contamination with DNA&#46; No contamination was found&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Hormone measurements</span><p id="par0060" class="elsevierStylePara elsevierViewall">TSH and Tg Ab were determined in plasma and Tg was determined in serum&#44; without suspending treatment with thyroid hormone &#40;unstimulated TSH&#41;&#46; The samples were centrifuged and processed in automated equipment&#46; Hormone levels were measured by chemiluminescence&#58; TSH &#40;ABBOTT Architect&#44; reference range &#91;RR&#93; 0&#46;35&#8211;4&#46;94&#8239;&#181;IU&#47;mL&#41;&#44; functional sensitivity &#40;FS&#41; 0&#46;01&#8239;IU&#47;mL&#44; coefficient of variation &#40;&#37;CV&#41;&#58; less than 10&#37;&#59; Tg Ab &#40;ABBOTT Architect&#44; RR 0&#46;2&#8211;4&#46;1&#8239;IU&#47;mL&#41;&#44; FS 0&#46;31 IU&#47;mL&#44; &#37;CV&#58; less than 10&#37;&#46; Tg levels were measured with an Immulite 2000 system &#40;Siemens&#41;&#46; The RR for this Tg assay is&#58; up to 2&#46;0&#8239;ng&#47;mL &#40;athyreotic with elevated TSH&#41; or 0&#46;7&#8211;84&#46;0&#8239;ng&#47;mL &#40;non-athyreotic&#41;&#46; The FS of the assay is 0&#46;5&#8239;ng&#47;mL and the &#37;CV is 10&#37;&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">Tg levels were classified for analysis into three categories&#58; 1&#41; levels less than or equal to 0&#46;5&#8239;ng&#47;mL&#59; 2&#41; levels greater than 0&#46;5 and less than 1&#8239;ng&#47;mL&#44; and 3&#41; levels greater than or equal to 1&#8239;ng&#47;mL&#46; Given that the sensitivity of our method for measuring Tg levels was lower than that used in the American Thyroid Association &#40;ATA&#41; classification&#44; we did a second evaluation of laboratory results and imaging studies prospectively in 31 patients having undergone ablation in order to determine whether they were possible allocation errors&#44; in particular possible cases incorrectly included in the group having undergone ablation with an excellent response&#46; Antibodies were considered positive when their levels exceeded 4&#46;1&#8239;IU&#47;mL&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Patients</span><p id="par0070" class="elsevierStylePara elsevierViewall">A search for patients of both sexes over 18 years of age with thyroid cancer was conducted in pathology registries&#44; and physicians from the Endocrinology Department of the Hospital Italiano de Buenos Aires and the Instituto de Oncolog&#237;a &#193;ngel H&#46; Roffo with patients in follow-up for thyroid cancer were asked to invite their patients to participate&#46; The inclusion criteria were&#58; having undergone total thyroidectomy at least six months earlier&#44; having had at least one full evaluation of their disease stage after surgery and having complete follow-up data so that they could be appropriately categorised&#46; Levels of risk of postoperative recurrence were determined according to a modified version of the risks of recurrence proposed in the latest ATA guidelines<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> &#40;Appendix <a class="elsevierStyleCrossRef" href="#sec0080">B</a>&#44; Supplementary data&#41;&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">To establish the groups to be compared&#44; patients were classified by treatment response accorded to modified ATA criteria&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> 1&#41; Excellent response&#58; Tg less than or equal to 0&#46;5&#8239;ng&#47;mL and negative imaging studies&#46; This group also included patients with no evidence of structural disease with positive Tg Ab who had been in follow-up long enough to rule out persistent disease&#46; 2&#41; Structural incomplete response&#58; disease detected on imaging studies and confirmed by pathology where applicable&#44; regardless of Tg levels&#46; 3&#41; Biochemical incomplete response&#58; patients with Tg levels greater than or equal to 1&#8239;ng&#47;mL or with Tg Ab levels on an upward curve&#44; but without structural disease on imaging studies&#46; 4&#41; Indeterminate response&#58; patients with Tg levels greater than 0&#46;5&#8239;ng&#47;mL but less than 1&#8239;ng&#47;mL or nonspecific findings on imaging studies&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">The analysis included only patients who had received an ablative or therapeutic dose with radioiodine in the postoperative period&#44; and at the time of recruitment had an excellent response or structural incomplete response&#44; such that the predictive accuracy of Tg mRNA levels could be compared using reliable true positives &#40;patients with structural incomplete response&#41; and true negatives &#40;patients with an excellent response&#41;&#46; Data from patients with biochemical incomplete response or indeterminate response are presented in Appendix <a class="elsevierStyleCrossRef" href="#sec0080">B</a> &#40;Supplementary data&#41;&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">Those who met the inclusion criteria were later contacted by telephone by the principal investigator to arrange an appointment to explain the protocol to them and obtain their written informed consent&#46; The sample was collected in that same appointment or a later one&#44; depending on which was more convenient for the patient&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">All patients recruited for evaluation of Tg mRNA levels as a parameter for diagnosis and follow-up had undergone radioiodine ablation &#40;primary endpoint&#41;&#46; In addition&#44; a patient group with an excellent response not having undergone radioiodine ablation &#40;secondary endpoint&#41; was evaluated separately&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">The protocol was approved by the Hospital Italiano de Buenos Aires Independent Ethics Committee for Research Protocols &#40;number 2828&#41;&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">The procedures were performed in patients after they had granted their written informed consent&#46;</p></span></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Statistical analysis</span><p id="par0105" class="elsevierStylePara elsevierViewall">This was a cross-sectional observational study&#46; Continuous variables were expressed in terms of median and interquartile range &#40;IQR&#41; or range&#44; depending on their distribution&#44; while categorical variables were reported in terms of absolute number and percentage of total cases&#46; To compare the characteristics of the different groups&#44; the chi-squared and analysis of variance &#40;ANOVA&#41; statistical tests were used&#46; Comparisons between medians for the groups having undergone ablation with an excellent response or structural incomplete response were made using the Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test where applicable&#46; A <span class="elsevierStyleItalic">P</span> value &#60;&#46;05 was considered statistically significant&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">A receiver operating characteristic &#40;ROC&#41; curve was built&#44; considering patients who had received radioiodine and were free from structural disease to be true negatives and considering patients who had received radioiodine and had confirmed structural disease to be true positives&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">Statistical calculations were performed with the Stata software programme&#44; version 13&#46;0&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Results</span><p id="par0120" class="elsevierStylePara elsevierViewall">We recruited 120 patients&#58; 97 women and 23 men&#44; with a mean age of 54&#46;8 &#40;43&#46;3&#8211;66&#46;6&#41; years&#46; All had undergone total thyroidectomy&#44; and 92 had received radioiodine ablation&#46; The predominant histological type was papillary thyroid cancer &#40;n&#8239;&#61;&#8239;111&#44; 92&#37;&#41;&#44; 50 &#40;45&#37;&#41; of them with the classic variant&#44; and 99 &#40;82&#37;&#41; were in stage I according to the eighth edition of the American Joint Committee on Cancer &#40;AJCC&#41; cancer staging manual&#46;<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">12</span></a> Half of the patients &#40;60&#59; 50&#37;&#41; belonged to a group with a low risk of recurrence&#44; and most showed an excellent response to treatment &#40;97&#59; 75&#46;8&#37;&#41; according to ATA criteria &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; Within the group that had received radioiodine ablation&#44; 69 showed an excellent response to treatment&#46; This group included four patients who had Tg levels of 0&#46;5&#8239;ng&#47;mL&#44; as this value was at the limit of quantitation of the method&#44; and showed no evidence of structural disease in follow-up &#40;30&#44; 45&#44; 82 and 109 months of follow-up&#41;&#46; These patients were included in the group of 31 patients who underwent another extraction with a median of 8&#46;46 &#40;7&#46;53&#8211;11&#46;06&#41; months after the first evaluation and were found to have undetectable Tg levels in the second extraction&#46; None of the patients who underwent additional evaluation of treatment response had to change groups due to results inconsistent with their allocation in the study&#46; Twenty-three patients had structural incomplete response&#59; 16 of them had distant metastases&#46; Cumulative radioiodine activity was significantly higher in the group with structural incomplete response &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;001&#41;&#46; Four of the patients with distant metastatic disease were receiving treatment with tyrosine kinase inhibitors &#40;one with sorafenib and three with lenvatinib&#41; at the time of the extraction&#46; The group with an excellent response not having undergone ablation included 28 patients&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0125" class="elsevierStylePara elsevierViewall">Clinical chemistry characteristics are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; TSH levels in the group not having undergone ablation were significantly higher than in the groups having undergone ablation &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;002&#41;&#46; The proportion of patients with Tg levels less than or equal to 0&#46;5&#8239;ng&#47;mL was significantly higher in the disease-free group having undergone ablation &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;001&#41;&#46; Two patients within the group not having undergone ablation had Tg levels greater than 1&#8239;ng&#47;mL but less than 2&#8239;ng&#47;mL&#46; Tg mRNA levels did not significantly differ between the group with no evidence of disease and the group with persistent structural disease &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;06&#41;&#46; The group that had not received radioiodine ablation showed similar levels to the groups that had &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">ROC curve</span><p id="par0130" class="elsevierStylePara elsevierViewall">The ROC curve for Tg mRNA levels yielded an area under the curve of 0&#46;6320 &#40;0&#46;48&#8722;0&#46;78&#41;&#46; The analysis demonstrated that Tg mRNA levels greater than 0&#46;116&#8239;fg&#47;&#956;g Tg mRNA were associated with a higher risk of persistent structural disease &#40;OR 3&#46;35&#59; 95&#37; CI 1&#46;22&#8211;9&#46;19&#41;&#44; with a sensitivity of 69&#46;6&#37; and a specificity of 59&#46;4&#37;&#46; In a population with a prevalence of cases with persistent structural disease of 25&#37;&#44; positive predictive value was 36&#46;4&#37; and negative predictive value was 85&#46;4&#37; &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Discussion</span><p id="par0135" class="elsevierStylePara elsevierViewall">Our study evaluated the sensitivity&#44; specificity and predictive values of Tg mRNA levels measured by qRT-PCR for the first time in a local population of patients with differentiated thyroid cancer&#46; Our experience showed that this technique would be of limited use in the follow-up of patients with differentiated thyroid cancer&#44; since Tg mRNA levels were similar in patients with an excellent response to treatment and in patients with confirmed structural incomplete response&#44; with low sensitivity and specificity for detecting persistent structural disease&#46; However&#44; its high negative predictive value of 85&#37; suggests that it could be a useful rule-out test in selected cases&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Routine follow-up of patients with thyroid carcinoma involves measurement of blood Tg levels by immunometric methods and neck ultrasound&#44;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> less commonly&#44; a whole-body radioiodine scan is also included&#46; A disadvantage of this strategy is that Tg measurement has methodological interferences&#44; including Tg Ab&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> The most commonly used immunometric methods yield values that are too low for disease staging in the presence of Tg Ab&#46;<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> For this reason&#44; antibodies at stable or decreasing levels place a patient in an indeterminate stage of their disease&#46; This happens in around 8&#37;&#8211;29&#37; of patients&#44; and 15&#37;&#8211;20&#37; of these patients develop structural disease in the course of their follow-up&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> Other methods for measuring Tg without interference due to antibodies&#44; such as mass spectrometry&#44; have been tested&#44; but have not demonstrated advantages in this context&#46;<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;15</span></a></p><p id="par0145" class="elsevierStylePara elsevierViewall">The hypothesis of the usefulness of Tg mRNA levels in the follow-up of patients with thyroid cancer is based on detection of circulating thyroid cells in patients without thyroid disease&#44; patients with benign disease and patients with thyroid cancer&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> The first assays&#44; using qualitative RT-PCR&#44; showed suitable sensitivity but unfortunately low specificity&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Quantitative measurement techniques were then developed&#44; but yielded disparate results&#46; Ringel et al&#46; reported a sensitivity of 84&#37; and a specificity of 62&#37; when they amplified a fragment of 87 base pairs between base pairs 262 and 348 of Tg cDNA&#46;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> A subsequent publication from the same group reported better accuracy &#40;a higher proportion of patients correctly identified as disease free-or having persistent disease&#41; compared to Tg levels measured by immunoassay &#40;84&#37; versus 75&#37;&#44; respectively&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> These results could not be replicated by other authors&#46; Takano et al&#46; found similar Tg mRNA levels in patients with thyroid cancer without metastases and with confirmed metastases&#59; in their experience&#44; serum Tg levels measured by immunometric methods were a better disease marker than Tg mRNA levels&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> Span et al&#46;&#44; using the same primers as Ringel et al&#46;&#44; also found no differences in Tg mRNA levels between patients with and without metastatic thyroid carcinoma&#44; whether they were stratified by radioiodine uptake on scintigraphy or by serum Tg levels measured by immunoradiometric methods&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> All these studies used radioiodine uptake on scintigraphy or serum Tg levels measured with assays that are now considered not to be very sensitive &#40;FS&#8239;&#62;&#8239;1&#8239;ng&#47;mL&#41; as a gold standard for identifying persistent disease&#46; Tg Ab were also evaluated with methods that were not very sensitive &#40;haemagglutination&#41;&#44; casting doubt on the capacity to identify Tg levels that were too low due to interference on the part of antibodies in the group of patients considered &#8220;disease-free&#8221;&#46; Elisei et al&#46;&#44; by contrast&#44; used serum Tg levels measured by ultrasensitive methods &#40;corresponding FSs 0&#46;9&#8239;ng&#47;mL and 0&#46;03&#8239;ng&#47;mL to confirm the absence of disease&#41; and radioiodine uptake on scintigraphy to stratify patients&#46; With this methodology&#44; sensitivity was 82&#46;3&#37;&#44; specificity 24&#46;2&#37;&#44; positive predictive value was 65&#46;6&#37; and negative predictive value was 47&#46;3&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> In 2010&#44; Boldarine et al&#46;&#44; using a novel strategy&#44; generated and validated a pair of primers that did not include alternative splicing sites&#46; In their study&#44; they achieved a Tg mRNA cut-off point that distinguished between the disease-free population and the population with persistent structural disease with a sensitivity of 94&#46;7&#37; and a specificity of 95&#46;8&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> However&#44; in our experience&#44; the same pair of primers did not achieve a cut-off point exceeding 90&#37; sensitivity and&#47;or specificity&#46; Many authors have agreed that differences between the different assays can be explained by technical differences&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;18</span></a> One of the most significant differences between our experience and that of Boldarine et al&#46; was the comparatively lower mass of Tg mRNA in our assay&#46; This could be attributed to a lower rate of recovery of circulating tumour cells&#46; Hypothetically&#44; uneven loss across groups could contribute to decreases in sensitivity and specificity&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">Our study had a population of patients with thyroid cancer who were well identified and staged according to current disease-staging concepts&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Almost all previously published studies based patient stratification on Tg levels with lower sensitivities than currently recommended &#40;radioimmunoassays &#91;RIAs&#93; or immunoradiometric assays with sensitivities of 1&#8239;ng&#47;mL&#41;&#44; and many used a whole-body scan with 2&#8722;5&#8239;mCi of radioiodine as a gold standard for determining the presence of distant metastases&#46;<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#8211;22</span></a></p><p id="par0155" class="elsevierStylePara elsevierViewall">Thus&#44; patients considered disease-free might actually have low-volume persistent structural disease that can only be detected by higher-sensitivity methods such as neck ultrasound&#44; which is the method of choice at present&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Detection of Tg mRNA in patients considered disease-free &#40;38&#37;&#8211;75&#46;8&#37;&#41;<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;22</span></a> appears to support this hypothesis&#44; with the resulting loss of specificity&#46; Our patients were categorised according to the results of their neck ultrasound performed by expert operators&#44; other diagnostic methods when indicated and Tg levels with an FS of 0&#46;5&#8239;ng&#47;mL&#44; yielding a more suitably identified disease-free population&#46; Despite this&#44; 40&#37; of our disease-free patients in the group having undergone ablation had circulating Tg mRNA levels above the cut-off point&#46; It is possible that the lower FS of our Tg assay resulted in the inclusion of patients who would have been considered to have indeterminate response with a more sensitive method due to having Tg levels greater than 0&#46;2&#8239;ng&#47;mL&#44; 15&#37;&#8211;20&#37; of whom progress to structural incomplete response&#46; Low-volume structural persistence that could not be detected by imaging methods in the excellent response group might have contributed to the relatively high Tg mRNA levels in this group&#46; However&#44; when we performed repeat determinations of Tg levels and imaging studies in a group of patients&#44; including patients with detectable Tg levels in the excellent response group&#44; the results were consistent and there was no need to change the allocation groups&#46; Alternative hypotheses include illegitimate transcription in non-thyroid cells in the blood&#44; interfering with detection of Tg mRNA originating in circulating thyroid cells&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a></p><p id="par0160" class="elsevierStylePara elsevierViewall">To date&#44; no method for clinical use enables evaluation of Tg levels in the presence of Tg Ab&#46; Measurement of alternative parameters such as TSH receptor mRNA<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> and BRAF V600E has been tested&#44;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> and more recently a great deal of interest in measuring microRNA has arisen&#46;<a class="elsevierStyleCrossRefs" href="#bib0125"><span class="elsevierStyleSup">25&#44;26</span></a> As yet&#44; none of these methods has proven to be a good replacement for Tg levels measured by immunoradiometric methods&#46; Could measurement of Tg mRNA play a role in the follow-up of patients with Tg Ab&#63; Under these circumstances&#44; Tg mRNA levels could be useful as a rule-out test&#44; considering their high negative predictive value and the fact that the prevalence of recurrences in the population with indeterminate response is around 20&#37;&#44; which is very close to the 25&#37; found in our study&#46; Nevertheless&#44; this hypothesis should be confirmed in a prospective study of patients with indeterminate response since our study was not designed for this purpose&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Conclusions</span><p id="par0165" class="elsevierStylePara elsevierViewall">Measurement of Tg mRNA levels by qRT-PCR lacks sufficient sensitivity and specificity to be used routinely as a replacement for Tg levels measured by immunoradiometric methods&#46; However&#44; it could have a place as a rule-out test in the follow-up of specific patients&#44; such as those with positive Tg Ab&#46; This hypothesis should be confirmed in a prospective study&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Funding</span><p id="par0170" class="elsevierStylePara elsevierViewall">This study was funded by the Fondo para la Investigaci&#243;n Cient&#237;fica y Tecnol&#243;gica &#91;Fund for Research in Science and Technology&#93; &#40;<span class="elsevierStyleGrantSponsor" id="gs0005">FONCYT</span>&#41; of the Agencia Nacional de Promoci&#243;n Cient&#237;fica y Tecnol&#243;gica &#91;Argentinian National Agency for the Promotion of Science and Technology&#93;&#46; Ministry of Science&#44; Technology and Productive Innovation of the Republic of Argentina&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">Proyectos de Investigaci&#243;n Cient&#237;fica y Tecnol&#243;gica Orientados &#91;<span class="elsevierStyleGrantSponsor" id="gs0010">Science- and Technology-Oriented Research Projects</span>&#93; &#40;2016&#41; grant ID number&#58; <span class="elsevierStyleGrantNumber" refid="gs0010">011&#46; &#40;ID&#58; PICTO 2016-011&#41;</span>&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">The agency was involved in the initial evaluation and follow-up of the project only&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conflicts of interest</span><p id="par0185" class="elsevierStylePara elsevierViewall">None of the authors has any conflicts of interest in relation to this research study&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres1631327"
          "titulo" => "Abstract"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objectives"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1455564"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1631328"
          "titulo" => "Resumen"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Objetivos"
            ]
            2 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "M&#233;todos"
            ]
            3 => array:2 [
              "identificador" => "abst0045"
              "titulo" => "Resultados"
            ]
            4 => array:2 [
              "identificador" => "abst0050"
              "titulo" => "Conclusiones"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1455563"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Specific objectives"
        ]
        6 => array:3 [
          "identificador" => "sec0015"
          "titulo" => "Methods"
          "secciones" => array:2 [
            0 => array:3 [
              "identificador" => "sec0020"
              "titulo" => "Laboratory techniques"
              "secciones" => array:3 [
                0 => array:2 [
                  "identificador" => "sec0025"
                  "titulo" => "Determination of Tg mRNA"
                ]
                1 => array:2 [
                  "identificador" => "sec0030"
                  "titulo" => "Hormone measurements"
                ]
                2 => array:2 [
                  "identificador" => "sec0035"
                  "titulo" => "Patients"
                ]
              ]
            ]
            1 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0045"
          "titulo" => "Results"
          "secciones" => array:1 [
            0 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "ROC curve"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Conclusions"
        ]
        10 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Funding"
        ]
        11 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Conflicts of interest"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-07-29"
    "fechaAceptado" => "2021-02-21"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1455564"
          "palabras" => array:6 [
            0 => "Differentiated thyroid cancer"
            1 => "Thyroid cancer"
            2 => "Thyroglobulin"
            3 => "Thyroglobulin messenger RNA"
            4 => "Cancer follow-up"
            5 => "RT-PCR"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1455563"
          "palabras" => array:6 [
            0 => "C&#225;ncer diferenciado de tiroides"
            1 => "C&#225;ncer de tiroides"
            2 => "Tiroglobulina"
            3 => "ARN mensajero de tiroglobulina"
            4 => "Seguimiento c&#225;ncer"
            5 => "RT-PCR"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">The determination of thyroglobulin levels by immunoassay and imaging studies is subject to interference by antithyroglobulin antibodies in up to 30&#37; of cases&#44; suggesting a need to find alternative methods for the follow-up of a significant number of thyroid cancer patients&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objectives</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Assess the sensitivity&#44; specificity&#44; and predictive values of thyroglobulin messenger RNA levels measured by quantitative Real Time-PCR &#40;qRT-PCR&#41; in the blood of patients followed for differentiated thyroid cancer&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">This is a prospective study of Tg-mRNA levels measured with qRT-PCR&#46; A peripheral blood sample was taken in patients with excellent response &#40;69&#41; and with structural incomplete response to treatment &#40;23&#41;&#46; Results were analysed using the Unity Real-Time program and expressed as fg&#47;&#956;g RNA&#46; A Receiver Operating Characteristic curve was constructed to assess Tg-mRNA cut-off values&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Tg-mRNA levels were not significantly different between the group with excellent response &#91;0&#46;10&#8239;fg&#47;&#956;g RNA &#40;0&#46;08&#8722;0&#46;17&#41;&#93; and the group with incomplete structural response &#91;0&#46;133&#8239;fg&#47;&#956;g RNA &#40;0&#46;07&#8722;0&#46;33&#41;&#93; &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;06&#41;&#46; Test sensitivity was 69&#46;6&#37;&#44; specificity was 59&#46;4&#37;&#44; negative predictive value was 85&#46;4&#37; and positive predictive value 36&#46;4&#37;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Conclusions</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Our experience shows that this technique could be useful as a rule-out test in selected cases&#44; but its low sensitivity and specificity preclude its usefulness as a first-line test&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objectives"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Conclusions"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Introducci&#243;n</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">La determinaci&#243;n de tiroglobulina por m&#233;todos inmuno radiom&#233;tricos presenta interferencia por anticuerpos antitiroglobulina hasta en el 30&#37; de los casos&#44; sugiriendo la necesidad de encontrar m&#233;todos alternativos para el seguimiento de un n&#250;mero significativo de pacientes con c&#225;ncer de tiroides&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Objetivos</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Evaluar la sensibilidad&#44; especificidad y valores predictivos de los niveles de ARN mensajero de la tiroglobulina medidos con la t&#233;cnica de PCR cuantitativa en tiempo real &#40;qRT-PCR&#41; en sangre perif&#233;rica de pacientes en seguimiento por c&#225;ncer diferenciado de tiroides&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">M&#233;todos</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Estudio prospectivo de los niveles de ARNm de Tg &#40;ARNm Tg&#41; determinados por qRT-PCR cuantitativa&#46; Se extrajo una muestra de sangre perif&#233;rica en pacientes con respuesta excelente &#40;69&#41;&#44; y con respuesta estructural incompleta al tratamiento&#40;23&#41;&#46; Los resultados fueron analizados por el programa Unity Real-Time y expresados en fg&#47;&#956;g ARN&#46; Se realiz&#243; una curva ROC para evaluar el punto de corte de niveles de ARNm Tg&#46;</p></span> <span id="abst0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Resultados</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Los niveles de ARNm Tg no fueron significativamente diferentes entre el grupo con respuesta excelente &#91;0&#44;10&#8239;fg&#47;&#956;g ARN &#40;0&#44;08&#8211;0&#44;17&#41;&#93; y el grupo respuesta estructural incompleta &#91;0&#44;133&#8239;fg&#47;&#956;g ARN &#40;0&#44;07&#8211;0&#44;33&#41;&#93; &#40;<span class="elsevierStyleItalic">P</span>&#8239;&#60;&#8239;&#46;06&#41;&#46; La sensibilidad fue 69&#46;6&#37;&#44; la especificidad 59&#46;4&#37;&#44; el valor predictivo negativo 85&#46;4&#37; y el valor predictivo positivo 36&#46;4&#37;&#46;</p></span> <span id="abst0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Conclusiones</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Nuestra experiencia muestra que esta t&#233;cnica tendr&#237;a utilidad como prueba de exclusi&#243;n en casos seleccionados&#44; pero sus caracter&#237;sticas no permiten su utilizaci&#243;n como una prueba de primera l&#237;nea&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Objetivos"
          ]
          2 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "M&#233;todos"
          ]
          3 => array:2 [
            "identificador" => "abst0045"
            "titulo" => "Resultados"
          ]
          4 => array:2 [
            "identificador" => "abst0050"
            "titulo" => "Conclusiones"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as&#58; Russo-Picasso MF&#44; Serra MP&#44; Viale ML&#44; Puga MC&#44; Terrasa S&#44; Kozak AE&#44; et al&#46; Evaluaci&#243;n de la utilidad de medir los niveles de ARN mensajero de tiroglobulina por PCR cuantitativa en tiempo real para el seguimiento de pacientes con c&#225;ncer diferenciado de tiroides&#46; Endocrinol Diabetes Nutr&#46; 2021&#59;68&#58;680&#8211;688&#46;</p>"
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0195" class="elsevierStylePara elsevierViewall">The following are Supplementary data to this article&#58;<elsevierMultimedia ident="upi0005"></elsevierMultimedia><elsevierMultimedia ident="upi0010"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0080"
          ]
        ]
      ]
    ]
    "multimedia" => array:6 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1633
            "Ancho" => 2091
            "Tamanyo" => 126998
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Tg mRNA levels in patients with an excellent response and structural incomplete response&#46; Data from patients who underwent ablation with I<span class="elsevierStyleSup">131</span>&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1409
            "Ancho" => 2091
            "Tamanyo" => 146558
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">ROC curve of Tg mRNA levels&#46; Area under the curve 0&#46;6320 &#40;0&#46;48&#8211;0&#46;78&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation excellent response &#40;n&#8239;&#61;&#8239;69&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation structural incomplete response &#40;n&#8239;&#61;&#8239;23&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No ablation excellent response &#40;n&#8239;&#61;&#8239;28&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Age &#40;years&#41;&#44; med&#46; &#40;IQR&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">57&#46;3 &#40;42&#46;8&#8722;67&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">63 &#40;53&#8722;74&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">52&#46;2 &#40;39&#46;4&#8722;60&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Female sex&#44; n &#40;&#37;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">62 &#40;90&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;56&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22 &#40;78&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Papillary cancer&#44; n &#40;&#37;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64 &#40;93&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;83&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Follicular cancer&#44; n &#40;&#37;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Oncocytic cell cancer&#44; n &#40;&#37;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#91;0&#44;1&#8211;4&#93;<span class="elsevierStyleItalic">TNM stage &#40;eighth edition of AJCC&#41;&#44; n &#40;&#37;&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>I&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65 &#40;94&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>II&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;39&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>III&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>IVa&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>IVb&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;17&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>NE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#91;0&#44;1&#8211;4&#93;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#91;0&#44;1&#8211;4&#93;<span class="elsevierStyleItalic">Risk of postoperative recurrence according to ATA</span>&#44;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a><span class="elsevierStyleItalic">n &#40;&#37;&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Low risk&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;45&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Intermediate risk&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;45&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>High risk&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;65&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Not evaluable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Cumulative radioiodine activity&#44; mCi&#44; med&#46; &#40;range&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;30&#8722;250&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">250 &#40;100&#8722;500&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">N&#47;A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Time since onset&#44; years&#44; med&#46; &#40;IQR&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;0 &#40;2&#46;54&#8722;6&#46;78&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;77 &#40;1&#46;91&#8722;7&#46;73&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;72 &#40;2&#46;55&#8722;4&#46;74&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2779654.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Characteristics of patients by disease stage&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Parameter&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation excellent response &#40;n&#8239;&#61;&#8239;69&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Ablation structural incomplete response &#40;n&#8239;&#61;&#8239;23&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No ablation excellent response &#40;n&#8239;&#61;&#8239;28&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TSH &#40;&#956;IU&#47;mL&#41;&#44; med&#46; &#40;IQR&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;72 &#40;0&#46;23&#8722;2&#46;33&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;4 &#40;0&#46;06&#8722;1&#46;24&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;03 &#40;1&#46;0&#8722;5&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tg&#8239;&#8804;&#8239;0&#46;5&#8239;ng&#47;mL&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">69 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;68&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tg&#8239;&#62;&#8239;0&#46;5 and &#60;1&#8239;ng&#47;mL&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tg&#8239;&#8805;&#8239;1&#8239;ng&#47;mL&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;74&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Positive Tg Ab&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;10&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;22&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;21&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tg mRNA &#40;fg&#47;&#956;g RNA&#41;&#44; med&#46; &#40;IQR&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;105 &#40;0&#46;079&#8722;0&#46;175&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;133 &#40;0&#46;071&#8722;0&#46;331&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;116 &#40;0&#46;049&#8722;0&#46;271&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2779655.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Clinical chemistry characteristics of patients by disease stage&#46;</p>"
        ]
      ]
      4 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc1.docx"
          "ficheroTamanyo" => 16879
        ]
      ]
      5 => array:5 [
        "identificador" => "upi0010"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc2.docx"
          "ficheroTamanyo" => 17424
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:26 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Worldwide thyroid-cancer epidemic&#63; The increasing impact of overdiagnosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46; Vaccarella"
                            1 => "S&#46; Franceschi"
                            2 => "F&#46; Bray"
                            3 => "C&#46;P&#46; Wild"
                            4 => "M&#46; Plummer"
                            5 => "L&#46; Dal Maso"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMp1604412"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med&#46;"
                        "fecha" => "2016"
                        "volumen" => "375"
                        "paginaInicial" => "614"
                        "paginaFinal" => "617"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27532827"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Programa de vigilancia&#44; epidemiolog&#237;a y resultados &#40;SEER&#41; del Instituto Nacional de Salud &#40;NIH&#41; &#91;Accessed 27 July 2020 por la autora MFRP&#93;&#46; Available from&#58; <a target="_blank" href="https://seer.cancer.gov/csr/1975_2017/browse_csr.php?sectionSEL=1&amp;pageSEL=sect_01_table.25">https&#58;&#47;&#47;seer&#46;cancer&#46;gov&#47;csr&#47;1975&#95;2017&#47;browse&#95;csr&#46;php&#63;sectionSEL&#61;1&#38;pageSEL&#61;sect&#95;01&#95;table&#46;25</a>&#46;"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Estimaci&#243;n de la incidencia de c&#225;ncer de tiroides en capital Federal y Gran Buenos Aires &#40;per&#237;odo 2003-2011&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "E&#46;N&#46; Faure"
                            1 => "M&#46;J&#46; Soutelo"
                            2 => "G&#46; Faraj"
                            3 => "R&#46; Lutfi"
                            4 => "J&#46; Juvenal Guillermo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Argent Endocrinol Metab&#46;"
                        "fecha" => "2012"
                        "volumen" => "49"
                        "paginaInicial" => "20"
                        "paginaFinal" => "24"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Incidencia de c&#225;ncer de tiroides en la provincia de Neuqu&#233;n&#44; per&#237;odo 2001-2012"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Cohen-Sabban"
                            1 => "C&#46; Palmero"
                            2 => "B&#46; Bertrand"
                            3 => "A&#46; Aiello"
                            4 => "Ghiglioni"
                            5 => "M&#46;C&#46; MacDonell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.endonu.2014.04.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocrinol Nutr&#46;"
                        "fecha" => "2014"
                        "volumen" => "61"
                        "paginaInicial" => "455"
                        "paginaFinal" => "459"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25043100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Consenso intersocietario sobre tratamiento y seguimiento de pacientes con c&#225;ncer diferenciado de tiroides"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Pitoia"
                            1 => "I&#46; Califano"
                            2 => "A&#46; V&#225;zquez"
                            3 => "E&#46; Faure"
                            4 => "A&#46; Gauna"
                            5 => "A&#46; Orlandi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Argent Endocrinol Metab&#46;"
                        "fecha" => "2014"
                        "volumen" => "51"
                        "paginaInicial" => "85"
                        "paginaFinal" => "118"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer&#46; The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46;R&#46; Haugen"
                            1 => "E&#46;K&#46; Alexander"
                            2 => "K&#46;C&#46; Bible"
                            3 => "G&#46;M&#46; Doherty"
                            4 => "S&#46;J&#46; Mandel"
                            5 => "Y&#46;E&#46; Nikiforov"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/thy.2016.0628"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thyroid&#46;"
                        "fecha" => "2017"
                        "volumen" => "27"
                        "paginaInicial" => "481"
                        "paginaFinal" => "483"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28114862"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyroglobulin from molecular and cellular biology to clinical endocrinology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "B&#46; Di Geso"
                            1 => "P&#46; Arvan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/er.2015-1090"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocr Rev&#46;"
                        "fecha" => "2016"
                        "volumen" => "37"
                        "paginaInicial" => "2"
                        "paginaFinal" => "36"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26595189"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Megalin in thyroid physiology and pathology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Marino"
                            1 => "A&#46; Pinchera"
                            2 => "R&#46;T&#46; McCluskey"
                            3 => "L&#46; Chiovato"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/10507250150500667"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thyroid&#46;"
                        "fecha" => "2001"
                        "volumen" => "11"
                        "paginaInicial" => "47"
                        "paginaFinal" => "56"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11272097"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyroglobulin measurement&#46; Techniques&#44; clinical benefits&#44; and pitfalls"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "C&#46;A&#46; Spencer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0889-8529(18)30023-9"
                      "Revista" => array:5 [
                        "tituloSerie" => "Lab Clin North Am&#46;"
                        "fecha" => "1995"
                        "volumen" => "24"
                        "paginaInicial" => "841"
                        "paginaFinal" => "863"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Implications of thyroglobulin antibody positivity in patients with differentiated thyroid cancer&#58; a clinical position statement"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Verburg"
                            1 => "M&#46; Luster"
                            2 => "C&#46; Cupini"
                            3 => "L&#46; Chiovato"
                            4 => "L&#46; Dunas"
                            5 => "R&#46; Elisei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/thy.2012.0606"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thyroid&#46;"
                        "fecha" => "2013"
                        "volumen" => "23"
                        "paginaInicial" => "1211"
                        "paginaFinal" => "1225"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23692026"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Development of a sensitive and specific quantitative reverse transcription-polymerase chain reaction assay for blood thyroglobulin messenger ribonucleic acid in the follow-up of patients with differentiated thyroid carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "V&#46;T&#46; Boldarine"
                            1 => "R&#46;M&#46; Maciel"
                            2 => "G&#46;S&#46; Guimar&#227;es"
                            3 => "C&#46;C&#46; Nakabashi"
                            4 => "C&#46;P&#46; Camacho"
                            5 => "D&#46;M&#46; Andreoni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/jc.2009-1354"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Endocrinol Metab&#46;"
                        "fecha" => "2010"
                        "volumen" => "95"
                        "paginaInicial" => "1726"
                        "paginaFinal" => "1733"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20173019"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyroid differentiated and anaplastic carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;M&#46; Tuttle"
                            1 => "L&#46;F&#46; Morris"
                            2 => "B&#46;R&#46; Haugen"
                            3 => "J&#46;P&#46; Shah"
                            4 => "J&#46;A&#46; Sosa"
                            5 => "E&#46; Rohren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:6 [
                        "edicion" => "8th ed&#46;"
                        "titulo" => "AJCC Cancer Staging Manual"
                        "fecha" => "2017"
                        "paginaInicial" => "873"
                        "paginaFinal" => "890"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dynamic risk assessment in patients with differentiated thyroid cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "F&#46; Pitoia"
                            1 => "F&#46; Jerkovich"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1530/ERC-19-0213"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocr Relat Cancer&#46;"
                        "fecha" => "2019"
                        "volumen" => "26"
                        "paginaInicial" => "R553"
                        "paginaFinal" => "R566"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31394499"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyroglobulin &#40;Tg&#41; testing revisited&#58; Tg assays&#44; TgAb assays&#44; and correlation of results with clinical outcomes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46;C&#46; Netzel"
                            1 => "S&#46;K&#46;G&#46; Grebe"
                            2 => "B&#46;C&#46; Carranza Leon"
                            3 => "M&#46;R&#46; Castro"
                            4 => "P&#46;N&#46; Clark"
                            5 => "A&#46;N&#46; Hoofnagle"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/jc.2015-1967"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Endocrinol Metab&#46;"
                        "fecha" => "2015"
                        "volumen" => "100"
                        "paginaInicial" => "E1074"
                        "paginaFinal" => "E1083"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26079778"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyroglobulin liquid chromatography&#8211;tandem mass spectrometry has a low sensitivity for detecting structural disease in patients with antithyroglobulin antibodies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "U&#46; Azmat"
                            1 => "K&#46; Porter"
                            2 => "L&#46; Senter"
                            3 => "M&#46;D&#46; Ringel"
                            4 => "F&#46; Nabhan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/thy.2016.0210"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thyroid&#46;"
                        "fecha" => "2017"
                        "volumen" => "27"
                        "paginaInicial" => "74"
                        "paginaFinal" => "80"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27736322"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular diagnosis of residual and recurrent thyroid cancer by amplification of thyroglobulin messenger ribonucleic acid in peripheral blood"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;D&#46; RingeL"
                            1 => "P&#46;W&#46; LadensoN"
                            2 => "M&#46;A&#46; Levine"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/jcem.83.12.5346"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Endocrinol Metab&#46;"
                        "fecha" => "1998"
                        "volumen" => "83"
                        "paginaInicial" => "4435"
                        "paginaFinal" => "4442"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9851791"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of circulating Tg-mRNA in the follow-up of papillary and follicular thyroid cancer&#58; how useful is it&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "F&#46;A&#46; Verburg"
                            1 => "C&#46;J&#46;M&#46; Lips"
                            2 => "E&#46;G&#46;W&#46;M&#46; Lentjes"
                            3 => "J&#46;M&#46;H&#46; de Klerk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bjc.6601991"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Cancer&#46;"
                        "fecha" => "2004"
                        "volumen" => "91"
                        "paginaInicial" => "200"
                        "paginaFinal" => "204"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15213710"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantitative reverse transcription-polymerase chain reaction of circulating thyroglobulin messenger ribonucleic acid for monitoring patients with thyroid carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;D&#46; Ringel"
                            1 => "P&#46;L&#46; Balducci-Silano"
                            2 => "J&#46;S&#46; Anderson"
                            3 => "C&#46;A&#46; Spencer"
                            4 => "J&#46; Silverman"
                            5 => "Y&#46;H&#46; Sparling"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/jcem.84.11.6164"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Endocrinol Metab&#46;"
                        "fecha" => "1999"
                        "volumen" => "84"
                        "paginaInicial" => "4037"
                        "paginaFinal" => "4042"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10566646"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Measurement of thyroglobulin mRNA in peripheral blood as an adjunctive test for monitoring thyroid cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Grammatopoulos"
                            1 => "Y&#46; Elliott"
                            2 => "S&#46;C&#46; Smith"
                            3 => "I&#46; Brown"
                            4 => "R&#46;J&#46; Grieve"
                            5 => "E&#46;W&#46; Hillhouse"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/mp.56.3.162"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Mol Pathol&#46;"
                        "fecha" => "2003"
                        "volumen" => "56"
                        "paginaInicial" => "162"
                        "paginaFinal" => "166"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantitative measurement of thyroglobulin mRNA in peripheral blood of patients after total thyroidectomy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "T&#46; Takano"
                            1 => "A&#46; Miyauchi"
                            2 => "H&#46; Yoshida"
                            3 => "Y&#46; Hasegawa"
                            4 => "K&#46; Kuma"
                            5 => "N&#46; Amino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1054/bjoc.2001.1904"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Cancer&#46;"
                        "fecha" => "2001"
                        "volumen" => "85"
                        "paginaInicial" => "102"
                        "paginaFinal" => "106"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11437410"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantitative detection of peripheral thyroglobulin mRNA has limited clinical value in the follow-up of thyroid cancer patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;N&#46; Span"
                            1 => "M&#46;J&#46;M&#46; Sluggers"
                            2 => "Van den Broek"
                            3 => "H&#46;A&#46; Ross"
                            4 => "W&#46;-A&#46; Nieuwlaat"
                            5 => "A&#46;R&#46;M&#46;M&#46; Hermus"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1258/000456303321016231"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Clin Biochem&#46;"
                        "fecha" => "2003"
                        "volumen" => "40"
                        "paginaInicial" => "94"
                        "paginaFinal" => "99"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12542917"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Low specificity of blood Thyroglobulin Messenger Ribonucleic Acid assay prevents its use in the follow-up of differentiated thyroid cancer patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46; Elisei"
                            1 => "A&#46; Vivaldi"
                            2 => "L&#46; Agate"
                            3 => "E&#46; Molinaro"
                            4 => "C&#46; Nencetti"
                            5 => "L&#46; Grasso"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/jc.2003-031341"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Endocrinol Metab&#46;"
                        "fecha" => "2004"
                        "volumen" => "89"
                        "paginaInicial" => "33"
                        "paginaFinal" => "39"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14715824"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effectiveness of peripheral thyrotropin receptor mRNA n follow-up of differentiated thyroid cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Milas"
                            1 => "G&#46;F&#46; Barbosa"
                            2 => "J&#46; Mitchell"
                            3 => "E&#46; Berber"
                            4 => "A&#46; Siperstein"
                            5 => "M&#46; Gupta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1245/s10434-008-0211-9"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Surg Oncol&#46;"
                        "fecha" => "2009"
                        "volumen" => "16"
                        "paginaInicial" => "473"
                        "paginaFinal" => "480"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19015922"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of circulating BRAFV600E in patients with papillary thyroid carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;C&#46; Lubitz"
                            1 => "S&#46; Parangi"
                            2 => "T&#46;M&#46; Holm"
                            3 => "M&#46;J&#46; Bernasconi"
                            4 => "A&#46;P&#46; Schalck"
                            5 => "H&#46; Suh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jmoldx.2015.08.003"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Moll Diag&#46;"
                        "fecha" => "2016"
                        "volumen" => "18"
                        "paginaInicial" => "100"
                        "paginaFinal" => "108"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of thyroid-associated serum microRNA profiles and their potential use in thyroid cancer follow-up"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Rosignolo"
                            1 => "M&#46; Sponziello"
                            2 => "L&#46; Giacomelli"
                            3 => "D&#46; Russo"
                            4 => "V&#46; Pecce"
                            5 => "M&#46; Biffoni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/js.2016-1032"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Endocr Soc&#46;"
                        "fecha" => "2017"
                        "volumen" => "1"
                        "paginaInicial" => "3"
                        "paginaFinal" => "13"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29264441"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New molecular biomarkers in differentiated thyroid carcinoma&#58; impact of miR-146&#44; miR-221 and miR-222 levels in the evolution of the disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;M&#46; G&#243;mez-P&#233;rez"
                            1 => "I&#46;M&#46; Cornejo Pareja"
                            2 => "J&#46; Garc&#237;a Alem&#225;n"
                            3 => "L&#46; Co&#237;n Arag&#252;ez"
                            4 => "A&#46; Sebasti&#225;n Ochoa"
                            5 => "J&#46; Alcaide Torres"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/cen.13972"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Endocrinol &#40;Oxf&#41;&#46;"
                        "fecha" => "2019"
                        "volumen" => "91"
                        "paginaInicial" => "187"
                        "paginaFinal" => "194"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30887564"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/25300180/0000006800000010/v1_202112171003/S2530018021001608/v1_202112171003/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "64496"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/25300180/0000006800000010/v1_202112171003/S2530018021001608/v1_202112171003/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018021001608?idApp=UINPBA00004N"
]

Article information

ISSN: 25300180
Original language: English

DOI:10.1016/j.endien.2021.12.001

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	8	0	8
2024 October	21	16	37
2024 September	34	16	50
2024 August	31	13	44
2024 July	17	9	26
2024 June	23	9	32
2024 May	20	1	21
2024 April	39	21	60
2024 March	28	10	38
2024 February	66	3	69
2024 January	34	3	37
2023 December	20	3	23
2023 November	13	3	16
2023 October	36	7	43
2023 September	34	1	35
2023 August	23	5	28
2023 July	6	1	7
2023 June	20	5	25
2023 May	39	4	43
2023 April	35	2	37
2023 March	26	4	30
2023 February	21	4	25
2023 January	30	8	38
2022 December	24	7	31
2022 November	26	4	30
2022 October	48	7	55
2022 September	10	33	43
2022 August	7	3	10
2022 July	12	10	22
2022 June	8	4	12

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter