was read the article
array:24 [ "pii" => "S1575092216300249" "issn" => "15750922" "doi" => "10.1016/j.endonu.2016.03.005" "estado" => "S300" "fechaPublicacion" => "2016-08-01" "aid" => "785" "copyright" => "SEEN" "copyrightAnyo" => "2016" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "crp" "cita" => "Endocrinol Nutr. 2016;63:371-3" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 989 "formatos" => array:2 [ "HTML" => 755 "PDF" => 234 ] ] "Traduccion" => array:1 [ "en" => array:19 [ "pii" => "S2173509316300708" "issn" => "21735093" "doi" => "10.1016/j.endoen.2016.08.010" "estado" => "S300" "fechaPublicacion" => "2016-08-01" "aid" => "785" "copyright" => "SEEN" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "crp" "cita" => "Endocrinol Nutr. 2016;63:371-3" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 945 "formatos" => array:2 [ "HTML" => 724 "PDF" => 221 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Scientific Letter</span>" "titulo" => "Medullary thyroid carcinoma as manifestation of the loss of heterozygosity in a patient with MEN1" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "371" "paginaFinal" => "373" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Carcinoma medular de tiroides como manifestación de la pérdida de heterozigosidad en un paciente con MEN1" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2047 "Ancho" => 1657 "Tamanyo" => 347314 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Genetic analysis of the tumor specimen with loss of heterozygosity and mutation was found in hemizygosis.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Gloria Beatriz Aranda Velazquez, Mireia Mora Porta, Daniel Martínez, Josep Oriola, Irene Halperin Rabinovich" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Gloria Beatriz" "apellidos" => "Aranda Velazquez" ] 1 => array:2 [ "nombre" => "Mireia Mora" "apellidos" => "Porta" ] 2 => array:2 [ "nombre" => "Daniel" "apellidos" => "Martínez" ] 3 => array:2 [ "nombre" => "Josep" "apellidos" => "Oriola" ] 4 => array:2 [ "nombre" => "Irene" "apellidos" => "Halperin Rabinovich" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1575092216300249" "doi" => "10.1016/j.endonu.2016.03.005" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1575092216300249?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173509316300708?idApp=UINPBA00004N" "url" => "/21735093/0000006300000007/v2_201609300106/S2173509316300708/v2_201609300106/en/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1575092216300754" "issn" => "15750922" "doi" => "10.1016/j.endonu.2016.05.007" "estado" => "S300" "fechaPublicacion" => "2016-08-01" "aid" => "808" "copyright" => "SEEN" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "cor" "cita" => "Endocrinol Nutr. 2016;63:374-5" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 1917 "formatos" => array:2 [ "HTML" => 1287 "PDF" => 630 ] ] "es" => array:10 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Carta al Editor</span>" "titulo" => "Comentarios sobre «Hipercarotinemia tras cirugía bariátrica»" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "374" "paginaFinal" => "375" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Comments on «Hipercarotinemia after bariatric surgery»" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Patricia Soblechero Martin, Fernando Granado Lorencio, Encarnación Donoso Navarro, M. Ramona de los Ángeles Silvestre Mardomingo" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Patricia" "apellidos" => "Soblechero Martin" ] 1 => array:2 [ "nombre" => "Fernando" "apellidos" => "Granado Lorencio" ] 2 => array:2 [ "nombre" => "Encarnación" "apellidos" => "Donoso Navarro" ] 3 => array:2 [ "nombre" => "M. Ramona de los Ángeles" "apellidos" => "Silvestre Mardomingo" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2173509316300691" "doi" => "10.1016/j.endoen.2016.08.009" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173509316300691?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1575092216300754?idApp=UINPBA00004N" "url" => "/15750922/0000006300000007/v1_201607200626/S1575092216300754/v1_201607200626/es/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S1575092216300419" "issn" => "15750922" "doi" => "10.1016/j.endonu.2016.03.010" "estado" => "S300" "fechaPublicacion" => "2016-08-01" "aid" => "790" "copyright" => "SEEN" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "crp" "cita" => "Endocrinol Nutr. 2016;63:369-71" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 1056 "formatos" => array:2 [ "HTML" => 800 "PDF" => 256 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Scientific letter</span>" "titulo" => "Glucocorticoid resistance syndrome caused by two novel mutations in the <span class="elsevierStyleItalic">NR3C1</span> gene" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "369" "paginaFinal" => "371" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Síndrome de resistencia a los glucocorticoides causado por dos nuevas mutaciones en el gen NR3C1" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1821 "Ancho" => 2221 "Tamanyo" => 149892 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">(A) Schematic representation of the structure and functions of the human glucocorticoid receptor (GR). Exon 1 is not translated. AF-1, activation function-1 domain; DBD, DNA-binding domain; LBD, ligand-binding domain. (B) Schematic diagram of the zinc finger structure of the DBD of the human GR. Several residues at these zinc fingers are required for dimerization (aminoacids 458–462; highlighted in bold), transactivation (aminoacids 469, 470, 472; boxed) or to repress other transcription factors, such as AP-1 (aminoacids 425, 436, 478; circled). Aminoacid 477, affected in Case 1, is represented double-underlined.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Teresa Velayos, Gema Grau, Itxaso Rica, Gustavo Pérez-Nanclares, Sonia Gaztambide" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Teresa" "apellidos" => "Velayos" ] 1 => array:2 [ "nombre" => "Gema" "apellidos" => "Grau" ] 2 => array:2 [ "nombre" => "Itxaso" "apellidos" => "Rica" ] 3 => array:2 [ "nombre" => "Gustavo" "apellidos" => "Pérez-Nanclares" ] 4 => array:2 [ "nombre" => "Sonia" "apellidos" => "Gaztambide" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1575092216300419?idApp=UINPBA00004N" "url" => "/15750922/0000006300000007/v1_201607200626/S1575092216300419/v1_201607200626/en/main.assets" ] "en" => array:14 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Scientific Letter</span>" "titulo" => "Medullary thyroid carcinoma as manifestation of the loss of heterozygosity in a patient with MEN1" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "371" "paginaFinal" => "373" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Gloria Beatriz Aranda Velazquez, Mireia Mora Porta, Daniel Martínez, Josep Oriola, Irene Halperin Rabinovich" "autores" => array:5 [ 0 => array:3 [ "nombre" => "Gloria Beatriz" "apellidos" => "Aranda Velazquez" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "Mireia Mora" "apellidos" => "Porta" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Daniel" "apellidos" => "Martínez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Josep" "apellidos" => "Oriola" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 4 => array:4 [ "nombre" => "Irene" "apellidos" => "Halperin Rabinovich" "email" => array:1 [ 0 => "halperin@clinic.ub.es" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0025" ] 3 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Department of Endocrinology and Nutrition, Hospital Clinic, Barcelona, Spain" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Laboratory of Endocrine Disorders, IDIBAPS, Barcelona, Spain" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Department of Pathology, Hospital Clinic, Barcelona, Spain" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Department of Biochemistry and Molecular Genetics, CDB, Hospital Clínic, Barcelona, Spain" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Faculty of Medicine, University of Barcelona, Spain" "etiqueta" => "e" "identificador" => "aff0025" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Carcinoma medular de tiroides como manifestación de la pérdida de heterozigosidad en un paciente con MEN1" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2047 "Ancho" => 1657 "Tamanyo" => 304488 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Genetic analysis of the tumor specimen with loss of heterozygosity and mutation was found in hemizygosis.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">Multiple endocrine neoplasia type 1 (MEN1) is a rare inherited disease characterized by hyperplastic and neoplastic disorders mainly affecting parathyroids, anterior pituitary and gastroenteropancreatic endocrine tissues.<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">1</span></a> In most subjects with MEN1 phenotype a heterozygous germline mutation in the <span class="elsevierStyleItalic">MEN1</span> gene is identified. In addition, somatic mutations and large deletions of the <span class="elsevierStyleItalic">MEN1</span> locus and its surrounding regions in chromosome 11, known as loss of heterozygosity (LOH), are found in MEN1 associated tumors.<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">2</span></a> We hereby present a MEN1 patient who developed a thyroid neuroendocrine carcinoma, and analyze the potential involvement of <span class="elsevierStyleItalic">MEN1</span> gene in the development of this tumor.</p><p id="par0010" class="elsevierStylePara elsevierViewall">A 44 year-old Caucasian woman with MEN1 familial background was identified as a carrier of the mutation c.549G>A (p.Trp183*) in exon 3 of <span class="elsevierStyleItalic">MEN1</span> gene in 2008. Previously, two MEN1 related disorders had been identified: a prolactin secreting pituitary microadenoma responsive to cabergoline had been diagnosed in 1996, and primary hyperparathyroidism in 2002, with resection of a right lower parathyroid adenoma. Hyperparathyroidism recurred in 2008. After the molecular diagnosis of MEN1 was established, abdominal computed tomography and magnetic nuclear resonance imaging detected 2 small, 1<span class="elsevierStyleHsp" style=""></span>cm-diameter pancreatic lesions located in body and tail regions of the gland; a cytologic specimen obtained by echoendoscopy confirmed a low grade neuroendocrine neoplasia. There was no evidence of liver metastases.</p><p id="par0015" class="elsevierStylePara elsevierViewall">Neck ultrasound performed prior to surgery for hyperparathyroidism recurrence identified multiple nodules in the left thyroid lobe. Fine needle aspiration biopsy of a 20<span class="elsevierStyleHsp" style=""></span>mm poorly delimited hypoechoic nodule and of a 16<span class="elsevierStyleHsp" style=""></span>mm left cervical lymph node led to a cytologic diagnosis of a neuroendocrine carcinoma, with positive chromogranin staining. Both lesions had increased octreoscan uptake. Blood calcitonin was normal, while progastrin-releasing peptide was elevated. The patient underwent total thyroidectomy, subtotal parathyroidectomy and left lateral neck node dissection. She signed informed consent for genetic analysis.</p><p id="par0020" class="elsevierStylePara elsevierViewall">The histological study of the left thyroid lobe showed a tumor composed of sheets, nests and trabecula of polygonal cells, separated by thin fibrovascular stroma, with moderate cytoplasm and clear large nuclei with prominent nucleoli. Immunohistochemical staining of tumor cells was positive for chromogranin A, synaptophysin and CD56, confirming its neuroendocrine origin; it was also focally positive for calcitonin. TTF1 and thyroglobulin were negative. Ki67 was 15%. Staining for Congo red did not identify stromal deposits of amyloid. On the right thyroid lobe, two microscopic papillary thyroid carcinoma foci were identified. Metastatic neuroendocrine carcinoma was identified in one out of seven lymph nodes. The parathyroidectomy specimen was consistent with an adenoma.</p><p id="par0025" class="elsevierStylePara elsevierViewall">MEN1 gene mutation had been previously identified as described, and MEN2 gene was now investigated. Genomic DNA was extracted from peripheral leukocytes by standard procedures QIAmp DNA. Protooncogen RET was studied by standardized PCR protocol in which coding regions of exons 8, 10, 11, 13, 14, 15 and 16 were amplified. PCR products were sequenced by BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and purification with Millipore system (96 well plates Multiscreen PCRu96 & Montage seq96), followed by analysis with ABI Prism Genetic Analyzer 3130.xl (Applied Biosystems). No germline mutations were identified.</p><p id="par0030" class="elsevierStylePara elsevierViewall">To detect LOH for MEN1 gene we amplified exon 3, where the patient's mutation was located, from tumor DNA isolated from paraffin-embedded thyroid-tumor tissue. A couple of exon 3 internal primers 5′GTGTGGCCTTTGCTGTGGTTG3′ and 5′ACTGTCTGGCCCCTGCGGTCC3′ were used in order to improve the efficiency of the PCR (short amplification). LOH involving chromosome 11q13 was demonstrated (mutation was found in hemizygosis) (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). Exons 10, 11 and 16 of RET gene were also studied on DNA from tumor tissue, with no evidence of somatic RET mutations.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">We report the concurrence of a MEN1 syndrome and a neuroendocrine thyroid neoplasm compatible with medullary thyroid carcinoma (MTC); to our knowledge, this association has been previously described just once.<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">3</span></a></p><p id="par0040" class="elsevierStylePara elsevierViewall">This association poses various possible explanations: the thyroid tumor could be a metastasis of her neuroendocrine pancreatic tumor, a MTC of either sporadic nature or due to an inherited RET gene mutation, or finally a thyroid neoplasia related with her MEN1 mutation. The first option is unlikely, as she presented neither local growth nor liver metastasis, as is expected in the progression of pancreatic neuroendocrine tumors. Although MEN1 and MEN2 coexistence is highly improbable, we excluded MEN2, as in any young patient with MTC. Sporadic MTC cannot be ruled out, though it presented atypical characteristics such as normal serum calcitonin and scarce calcitonin tumor staining. The last option, an atypical medullary/neuroendocrine carcinoma of the thyroid as a manifestation of her MEN1 status, seems the most feasible in view of the genetic findings, shared by all the neoplasia developed in the MEN1 context. More than 90% of tumors from MEN1 patients exhibit LOH on 11q13, an evidence of MEN1 gene activity as a tumor-suppressor gene, consistent with Knudson's two-hit hypothesis. This second hit may occur by LOH or other mechanisms including intragenic deletions and point mutations. On the other hand, LOH in the MEN1 locus has also been observed in 5–50% of sporadic endocrine tumors.<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">4</span></a></p><p id="par0045" class="elsevierStylePara elsevierViewall">In conclusion, we have identified a rare association of MEN1 and MTC, with LOH in the thyroid tumor involving chromosome 11q13 that had not been reported previously. As the complete inactivation of the MEN1 gene and subsequent absence of normal menin expression characterize MEN1 associated tumors, this finding relates her thyroid neoplasia to the MEN1 scope.</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0005">Conflict of interest</span><p id="par0050" class="elsevierStylePara elsevierViewall">The authors have nothing to disclose.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0005" "titulo" => "Conflict of interest" ] 1 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2047 "Ancho" => 1657 "Tamanyo" => 304488 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Genetic analysis of the tumor specimen with loss of heterozygosity and mutation was found in hemizygosis.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:4 [ 0 => array:3 [ "identificador" => "bib0025" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiple endocrine neoplasia – introduction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.J. Marx" 1 => "C.A. Stratakis" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2796.2004.01419.x" "Revista" => array:6 [ "tituloSerie" => "J Intern Med" "fecha" => "2005" "volumen" => "257" "paginaInicial" => "2" "paginaFinal" => "5" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15606371" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0030" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiple allelic deletions and intratumoral genetic heterogeneity in MEN1 pancreatic tumors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "O. Hessman" 1 => "B. Skogseid" 2 => "G. Westin" 3 => "G. Akerstrom" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jcem.86.3.7332" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab" "fecha" => "2001" "volumen" => "86" "paginaInicial" => "1355" "paginaFinal" => "1361" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11238532" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0035" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Medullary thyroid carcinoma in a patient with MEN1" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "L. Bohacek" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jso.23719" "Revista" => array:6 [ "tituloSerie" => "J Surg Oncol" "fecha" => "2014" "volumen" => "110" "paginaInicial" => "899" "paginaFinal" => "900" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25043548" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0040" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical practice guidelines for multiple endocrine neoplasia type 1 (MEN1)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Thakker" 1 => "P. Newey" 2 => "G. Walls" 3 => "J. Bilezikian" 4 => "H. Dralle" 5 => "P.R. Ebeling" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2012-1230" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab" "fecha" => "2012" "volumen" => "97" "paginaInicial" => "2990" "paginaFinal" => "3011" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22723327" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15750922/0000006300000007/v1_201607200626/S1575092216300249/v1_201607200626/en/main.assets" "Apartado" => array:4 [ "identificador" => "8574" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Cartas científicas" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/15750922/0000006300000007/v1_201607200626/S1575092216300249/v1_201607200626/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1575092216300249?idApp=UINPBA00004N" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 October | 27 | 0 | 27 |
2024 September | 27 | 4 | 31 |
2024 August | 20 | 2 | 22 |
2024 July | 26 | 1 | 27 |
2024 June | 26 | 5 | 31 |
2024 May | 32 | 5 | 37 |
2024 April | 25 | 19 | 44 |
2024 March | 52 | 4 | 56 |
2024 February | 48 | 1 | 49 |
2024 January | 55 | 4 | 59 |
2023 December | 39 | 7 | 46 |
2023 November | 60 | 18 | 78 |
2023 October | 73 | 11 | 84 |
2023 September | 36 | 3 | 39 |
2023 August | 26 | 6 | 32 |
2023 July | 39 | 5 | 44 |
2023 June | 60 | 0 | 60 |
2023 May | 57 | 7 | 64 |
2023 April | 71 | 1 | 72 |
2023 March | 63 | 1 | 64 |
2023 February | 51 | 6 | 57 |
2023 January | 28 | 5 | 33 |
2022 December | 55 | 7 | 62 |
2022 November | 48 | 10 | 58 |
2022 October | 40 | 14 | 54 |
2022 September | 53 | 7 | 60 |
2022 August | 21 | 14 | 35 |
2022 July | 28 | 7 | 35 |
2022 June | 25 | 10 | 35 |
2022 May | 19 | 7 | 26 |
2022 April | 36 | 7 | 43 |
2022 March | 28 | 17 | 45 |
2022 February | 47 | 4 | 51 |
2022 January | 24 | 10 | 34 |
2021 December | 21 | 14 | 35 |
2021 November | 38 | 10 | 48 |
2021 October | 35 | 11 | 46 |
2021 September | 12 | 13 | 25 |
2021 August | 34 | 6 | 40 |
2021 July | 18 | 10 | 28 |
2021 June | 36 | 11 | 47 |
2021 May | 37 | 8 | 45 |
2021 April | 64 | 29 | 93 |
2021 March | 45 | 13 | 58 |
2021 February | 34 | 9 | 43 |
2021 January | 49 | 12 | 61 |
2020 December | 44 | 12 | 56 |
2020 November | 49 | 17 | 66 |
2020 October | 33 | 12 | 45 |
2020 September | 32 | 16 | 48 |
2020 August | 34 | 10 | 44 |
2020 July | 33 | 14 | 47 |
2020 June | 19 | 12 | 31 |
2020 May | 40 | 10 | 50 |
2020 April | 37 | 7 | 44 |
2020 March | 28 | 7 | 35 |
2020 February | 25 | 6 | 31 |
2020 January | 32 | 8 | 40 |
2019 December | 54 | 16 | 70 |
2019 November | 31 | 8 | 39 |
2019 October | 28 | 7 | 35 |
2019 September | 30 | 6 | 36 |
2019 August | 32 | 16 | 48 |
2019 July | 21 | 11 | 32 |
2019 June | 43 | 14 | 57 |
2019 May | 94 | 22 | 116 |
2019 April | 26 | 13 | 39 |
2019 March | 16 | 7 | 23 |
2019 February | 28 | 8 | 36 |
2019 January | 16 | 4 | 20 |
2018 December | 11 | 6 | 17 |
2018 November | 20 | 4 | 24 |
2018 October | 16 | 4 | 20 |
2018 September | 11 | 1 | 12 |
2018 August | 18 | 0 | 18 |
2018 July | 9 | 0 | 9 |
2018 June | 13 | 0 | 13 |
2018 May | 8 | 1 | 9 |
2018 April | 8 | 0 | 8 |
2018 March | 2 | 0 | 2 |
2018 February | 5 | 0 | 5 |
2018 January | 10 | 2 | 12 |
2017 December | 9 | 4 | 13 |
2017 November | 12 | 4 | 16 |
2017 October | 12 | 3 | 15 |
2017 September | 11 | 4 | 15 |
2017 August | 11 | 2 | 13 |
2017 July | 13 | 3 | 16 |
2017 June | 15 | 7 | 22 |
2017 May | 13 | 4 | 17 |
2017 April | 15 | 20 | 35 |
2017 March | 18 | 13 | 31 |
2017 February | 14 | 4 | 18 |
2017 January | 4 | 0 | 4 |
2016 September | 1 | 1 | 2 |
2016 August | 5 | 1 | 6 |
2016 July | 2 | 0 | 2 |