GATA3 promotes the autophagy and activation of hepatic stellate cell in hepatic fibrosis via regulating miR-370/HMGB1 pathway

array:22 ["pii" => "S0210570523003369" "issn" => "02105705" "doi" => "10.1016/j.gastrohep.2023.05.005" "estado" => "S300" "fechaPublicacion" => "2024-03-01" "aid" => "2080" "copyright" => "Elsevier España, S.L.U.. All rights reserved" "copyrightAnyo" => "2023" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Gastroenterol Hepatol. 2024;47:219-29" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S0210570523003370" "issn" => "02105705" "doi" => "10.1016/j.gastrohep.2023.05.006" "estado" => "S300" "fechaPublicacion" => "2024-03-01" "aid" => "2081" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Gastroenterol Hepatol. 2024;47:230-5" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Manejo de la analgesia en la pancreatitis aguda. Resultados de una encuesta nacional" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "230" "paginaFinal" => "235" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Management of analgesia in acute pancreatitis: Results of a national survey" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1691 "Ancho" => 2508 "Tamanyo" => 144788 ] ] "descripcion" => array:1 [ "es" => "Mapa con el número de respuestas a la encuesta por comunidad autónoma." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ana Campillo Arregui, Federico Bolado Concejo, Helena León Brito, Diego Martínez-Acítores de la Mata, Verónica Ubieto Capela, Alba Cebrián García, Marcos Kutz Leoz, Matilde Laiglesia Izquierdo" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Ana" "apellidos" => "Campillo Arregui" ] 1 => array:2 [ "nombre" => "Federico" "apellidos" => "Bolado Concejo" ] 2 => array:2 [ "nombre" => "Helena" "apellidos" => "León Brito" ] 3 => array:2 [ "nombre" => "Diego" "apellidos" => "Martínez-Acítores de la Mata" ] 4 => array:2 [ "nombre" => "Verónica" "apellidos" => "Ubieto Capela" ] 5 => array:2 [ "nombre" => "Alba" "apellidos" => "Cebrián García" ] 6 => array:2 [ "nombre" => "Marcos" "apellidos" => "Kutz Leoz" ] 7 => array:2 [ "nombre" => "Matilde" "apellidos" => "Laiglesia Izquierdo" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2444382424000592" "doi" => "10.1016/j.gastre.2023.05.010" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382424000592?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570523003370?idApp=UINPBA00004N" "url" => "/02105705/0000004700000003/v4_202404281047/S0210570523003370/v4_202404281047/es/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "GATA3 promotes the autophagy and activation of hepatic stellate cell in hepatic fibrosis via regulating miR-370/HMGB1 pathway" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "219" "paginaFinal" => "229" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Zhengyuan Xie, Yangyang Li, Peiguang Xiao, Shanmiao Ke" "autores" => array:4 [ 0 => array:4 [ "nombre" => "Zhengyuan" "apellidos" => "Xie" "email" => array:1 [ 0 => "xzytg2021@163.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Yangyang" "apellidos" => "Li" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Peiguang" "apellidos" => "Xiao" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Shanmiao" "apellidos" => "Ke" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Department of Gastroenterology, The Second Affiliated Hospital of Nanchang University, Nanchang 330006, China" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Medical College of Nanchang University, Nanchang 330006, China" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "GATA3 promueve la autofagia y la activación de la célula estrellada hepática en la fibrosis hepática a través de la regulación de la vía miR-370/HMGB1" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 3021 "Ancho" => 2925 "Tamanyo" => 1080664 ] ] "descripcion" => array:1 [ "en" => "GATA3 aggravated fibrogenesis through activating autophagy in HF model mice. HF model mice were administrated with the GATA3 overexpression lentivirus through tail vein and autophagy inhibitor 3-MA through intraperitoneal injection. (A and B) Expression of LC3II/I and Beclin 1 was measured by western blotting. (C and D) Pathological changes in liver tissues was measured by H&E staining. (E and F) Liver fibrosis was measured by Masson staining. (G and H) Collagen deposition in liver tissues was measured by Sirius Red staining. n=6, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] ] "textoCompleto" => "IntroductionHepatic fibrosis (HF) is a repair response of the organism to chronic damage caused by various factors. Abnormal extracellular matrix (ECM) deposition can lead to the damages in structure and function of liver tissues.<a class="elsevierStyleCrossRef" href="#bib0220">1</a> HF is a necessary pathological stage for various chronic liver diseases to develop into liver cirrhosis. If the damaging factors cannot be removed for a long time, HF will develop into liver cirrhosis and finally liver cancer.<a class="elsevierStyleCrossRef" href="#bib0225">2</a> Liver cirrhosis causes 1.2 million deaths worldwide each year, ranking as the 10th leading cause of death among the most developed countries.<a class="elsevierStyleCrossRef" href="#bib0230">3</a> Therefore, exploring the pathogenesis and therapeutic targets of HF is still an important issue to be solved urgently.HF is characterized by the activation of hepatic stellate cells (HSCs) and the deposition of ECM. The activation of HSCs is the central link in the occurrence of HF.<a class="elsevierStyleCrossRef" href="#bib0235">4</a> In normal liver tissues, HSCs are in a non-proliferative resting state. During the process of liver injury, HSCs are activated and transformed into myofibroblasts, which in turn participate in HF formation.<a class="elsevierStyleCrossRef" href="#bib0240">5</a> In addition, for activated HSCs, the content of lipid droplets is reduced, but the proliferation capacity of it is enhanced. Activated HSCs also secrete pro-inflammatory and fibrotic factors, and specifically express α-SMA and collagen I.<a class="elsevierStyleCrossRefs" href="#bib0245">6,7</a> Thus, continuous activation of HSCs eventually leads to the progression of HF and finally liver cirrhosis. Furthermore, the expression of LC3, an autophagy-related gene, in liver tissues of the CCl4-induced HF mouse model is significantly increased, indicating that autophagy is activated in HF.<a class="elsevierStyleCrossRef" href="#bib0255">8</a> It was reported that autophagic activity is significantly enhanced in the HSCs isolated from fibrotic liver tissues of hepatitis B patients.<a class="elsevierStyleCrossRef" href="#bib0260">9</a> HSCs activation is dependent on autophagy, autophagy-mediated lipid degradation could provide energy for HSCs activation.<a class="elsevierStyleCrossRef" href="#bib0265">10</a> The treatment of autophagy inhibitor such as 3-methyladenine (3-MA) could lead to a significant down-regulating in α-SMA and Collagen I expression and induce cell cycle arrest in G2 phase, thereby inhibiting the proliferation and activation of HSCs.<a class="elsevierStyleCrossRef" href="#bib0270">11</a> Both autophagy inhibitor papulomycin and suppression of ATG7 inhibit accumulation of the collagen I in HSCs.<a class="elsevierStyleCrossRef" href="#bib0275">12</a> Therefore, blocking autophagy and HSCs activation may be a therapeutic strategy to control or prevent the progression of HF.GATA-binding protein 3 (GATA3) belongs to the GATA family, regulates target molecules through the combination of zinc finger structure and consensus sequence [T/A(GATA)A/G].<a class="elsevierStyleCrossRef" href="#bib0280">13</a> Previous studies have confirmed that GATA3 expression can be inhibited by some microRNAs (miRNAs). Conversely, GATA3 has been proved to also regulate expression of multiple miRNAs through acting as transcription factor, such as miR-29b and miR-155.<a class="elsevierStyleCrossRefs" href="#bib0285">14–16</a> In addition, it has been reported that GATA3 overexpression aggravates pulmonary fibrogenesis.<a class="elsevierStyleCrossRef" href="#bib0300">17</a> GATA3 is also expressed in the activated HSCs and contributes to HF by down-regulating PPARγ.<a class="elsevierStyleCrossRef" href="#bib0305">18</a> Moreover, high mobility group box 1 protein (HMGB1) is a nonhistone nuclear protein that regulates chromatin structure remodeling.<a class="elsevierStyleCrossRef" href="#bib0310">19</a> Accumulating studies have indicated that HMGB1 promotes autophagy and participates in fibrogenesis.<a class="elsevierStyleCrossRef" href="#bib0315">20</a> In the current study, we found some miRNAs that maybe regulate HMGB1 expression by using some known websites like TargetScan Human and miRDB.<a class="elsevierStyleCrossRefs" href="#bib0320">21–23</a> Among these miRNAs, miR-370 was proved to be an anti-fibrosis molecule, and HMGB1 is a really target of miR-370.<a class="elsevierStyleCrossRefs" href="#bib0335">24,25</a> Meantime, we found GATA3 has binding sites in the sequence of the miR-370 using JASPAR website (<a href="https://jaspar.genereg.net/">https://jaspar.genereg.net/</a>).Hence, we wondered to known whether GATA3 regulate the miR-370/HMGB1 signaling pathway to promote the autophagy and activation of HSCs. Here, we investigated the mechanism of action of GATA3 in HF through in vivo and in vitro assays.Materials and methodsAnimalsMale C57BL/6 mice (6 weeks old, 20–22g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). All mice were raised in a controlled humidity (20–22°C) and temperature (40–60%), and a 12h light/dark cycle. All animal protocols were approved by the Animal Care and Use Committee of Nanchang University (No. NCUSYDWFL-2020-149).Mouse model of HFHF mouse model was induced by CCl4 administration as previous described with minor modification.<a class="elsevierStyleCrossRef" href="#bib0345">26</a> Mice were randomly divided into 2 or 3 groups (n=6). CCl4 group: mice were intraperitoneally injected with 10μL/g CCl4 (20% in olive oil) twice a week for 4 weeks. Control group: mice were intraperitoneally injected with the same dosage of olive oil at the same time intervals. pcDNA-GATA3 group: mice were received with the GATA3 overexpression lentivirus (1×1010PFU/ml; GenePharma, Shanghai, China) through tail vein at 72h before CCl4 administration. Vector group: mice were injected with the control lentivirus (empty viral vector). pcDNA-GATA3+3-MA group: mice were administrated with the GATA3 overexpression lentivirus through tail vein at 72h before CCl4 administration and autophagy inhibitor (3-MA, 20mg/kg) at 2h before CCl4 administration through intraperitoneal injection.Mice were intraperitoneally injected with 4% pentobarbital sodium (400mg/kg), then blood samples were collected from orbital sinus of mice following removal of eyeball. Next, mice were euthanized by cervical dislocation. Liver tissues were separated and fixed with 4% paraformaldehyde for histological analysis, or were snap-frozen with liquid nitrogen and stored at −80°C for quantitative real-time PCR (qRT-PCR) and western blotting.Cell culturePrimary mouse hepatic stellate cells (HSCs) were isolated from liver tissues of 8 C57BL/6 mice following previously described.<a class="elsevierStyleCrossRef" href="#bib0350">27</a> Following perfusion in situ, the liver tissues were separated from mice, and sliced into small pieces and digested with Life Technologies Liver Digestion Media (Invitrogen, Carlsbad, CA, USA). The liver digests were filtered through a cell strainer, and washed with Gey's balanced salt solution (GBSS; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 2mg/mL DNase I (Beyotime, Shanghai, China). The homogenate was centrifuged at 2000×g for 5min to remove the hepatocytes. The cell pellet was resuspended in 15% OptiPrep (Sigma-Aldrich) and subjected to density gradient centrifugation. The final cell pellet was resuspended in Dulbecco's modified eagle medium (DMEM; Gibco, Grand Island, NY, USA) containing 1% penicillin/streptomycin, and 10% fetal bovine serum (FBS, Gibco), and incubated on uncoated plastic at 37°C and 5% CO2 for 24h. After that, the adherent cells were collected by centrifugation. Cell viability was assessed by trypan blue, and cell viability greater than 90% can be used for subsequent experiments. HSCs were treated with 10ng/mL TGF-β1 for 48h as HF cell model.<a class="elsevierStyleCrossRef" href="#bib0355">28</a> HSCs were treated with 10mM 3-MA (autophagy inhibitor; Sigma–Aldrich) for 24h.Cell transfectionThe overexpression vectors pcDNA3.1 carrying GATA3 (pcDNA-GATA3), empty pcDNA3.1 (vector), miR-370 mimic and mimic NC were obtained from GeneChem (Shanghai, China). The gene knockdown vectors small interference RNA (siRNA) specifically targeting GATA3 (si-GATA3) or HMGB1 (si-HMGB1), si-NC, miR-370 inhibitor and inhibitor NC were bought from GeneChem. HSCs were transfected with vectors utilizing Lipofectamine 2000 Transfection Reagent (Invitrogen) at room temperature for 20min.Histological analysisLiver tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The paraffin sections were dewaxed with xylene and hydrated with concentration gradient of ethanol. The sections were stained with Hematoxylin and Eosin (H&E) Staining Kit (Beyotime) to examine the histopathologic changes of liver tissues. Szapiel scoring system was used to evaluate the degree of inflammatory response.<a class="elsevierStyleCrossRef" href="#bib0360">29</a> The sections were stained with Masson Trichrome Stain Kit (Solarbio, Beijing, China) to assess hepatic fibrosis. Ashcroft scoring system was utilized to assess the degree of hepatic fibrosis.<a class="elsevierStyleCrossRef" href="#bib0365">30</a> Sections were stained with Sirius Red Stain Kit (Solarbio) to assess collagen deposition in hepatic tissues.Enzyme-linked immunosorbent assay (ELISA)After standing for 1–2h, the blood samples were centrifuged at 3000rpm for 15min, and the serum was collected. The serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in mice were detected using Mouse ALT ELISA Kit and Mouse AST ELISA Kit. The absorbance of samples was detected on a Multiskan FC Automatic microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). A series of concentration gradient standards were used to draw a standard curve. The absorbance value of the sample was plugged into formula of the corresponding standard curve to calculate the concentration of samples.Quantitative real-time PCR (qRT-PCR)The qRT-PCR was utilized to measure the gene expression in liver tissues and HSCs. Total RNA was extracted from cells or tissues using Total RNA Extraction Kit (Solarbio), followed by examination of RNA integrity on 1.5% agarose gel electrophoresis. The cDNA was generated using PrimeScript™ RT reagent Kit (Takara, Tokyo, Japan). PCR reactions were performed applying TB Green® Premix Ex Taq™ II (Takara). The amplification protocol was shown as follow: preheating at 94°C for 5min, 35 cycles of denaturation at 94°C for 30s, annealing for 30s and extension at 72°C for 30s. GAPDH served as a loading control for GATA3 and HMGB1. U6 served as a loading control for miR-370. The primers used in qRT-PCR are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. The data were analyzed using 2−ΔΔCT method for quantification.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Western blottingTotal protein was extracted from liver tissues and HSCs utilizing Total Protein Extraction Kit (Solarbio). Protein concentration was detected using BCA Protein Assay Kit (Solarbio). Then, 20μg equal quality samples for each group was separated on 10% or 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were incubated with the primary antibodies, GATA3 (#ab199428, 1:1000), HMGB1 (#ab18256; 1:1000), LC3 (#ab192890; 1:2000), Beclin 1 (#ab210498; 1:1000), α-SMA (#ab5694; 1:1000), collagen I (#ab270993; 1:1000) or GAPDH (#ab9485; 1:2500) at 4°C overnight, and then incubated with goat anti-rabbit horseradish peroxidase-IgG (#ab6721; 1:2000) at room temperature for 1h. All antibodies were obtained from Abcam (Cambridge, MA, USA). GAPDH served as internal reference. The gray levels of bands were analyzed by Image J software, and the relative expression levels of proteins in “Control or vector group” were normalized to 1.Autophagy analysisAutophagy was examined by quantification of fluorescent autophagosomes in HSCs following transfection of GFP-LC3 according to the previous described.<a class="elsevierStyleCrossRef" href="#bib0370">31</a> HSCs were cultured in DMEM at 37°C for 24h. HSCs were transfected with lentiviral-mediated GFP-LC3 plasmids utilizing 5mg/mL Polybrene for 6h. The GFP fluorescent puncta was observed under fluorescence microscopy. Five visual fields were randomly selected, ten cells were selected in each field, and the number of GFP fluorescent puncta in each cell.Luciferase reporter assayThe wild-type (WT)/mutant type (Mut) of pGL3 vector carrying 3′ untranslated regions (UTR) of HMGB1 containing the predicted miR-370 binding sites (pGL3-HMGB1) were synthesized by GeneChem. 293T cells were transfected with the WT/Mut pGL3-HMGB1 and miR-370 mimic or mimic NC. The luciferase activity of the cells was detected using the luciferase assay system (Ambion, Austin, TX, USA).Statistical analysisEach assay was carried out for 3 times. All data reported as mean±standard deviation. GraphPad Software (San Diego, CA, USA) was used for statistical analysis. Two-tailed Student's t test and one-way ANOVA were used to analyze the statistical difference. P<0.05 was considered as a significant difference.ResultsGATA3 and HMGB1 were up-regulated but miR-370 was down-regulated in CCl4-induced HF miceIn order to investigate the functional role of GATA3 in HF, we constructed HF mouse model by administration of CCl4. Serum levels of the ALT and AST in CCl4-induced HF mice were examined by ELISA. ALT and AST are biochemical markers of liver damage.<a class="elsevierStyleCrossRef" href="#bib0375">32</a> Serum levels of above markers were increased in CCl4-induced HF mice with respect to normal mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A and B). Then, H&E, Masson and Sirius Red staining were carried out to examine the histopathologic changes of liver tissues. Normal mice exhibited a normal structure of liver tissues, while severe inflammatory cell infiltration and hepatocyte necrosis occurred in liver tissues of the CCl4-induced HF mice which have a higher Szapiel score than normal mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>C and D). Levels of collagenous fiber in the CCl4-induced HF mice were more serious than the normal mice, and Ashcroft score of CCl4-induced HF mice also higher than that in normal mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>E and F). Meantime, Sirius Red staining showed serious collagen deposition in liver tissues of the CCl4-induced HF mice when contrast to the normal mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>G and H). Importantly, results of qRT-PCR showed that miR-370 expression was decreased in the CCl4-induced HF mice when contrast to normal mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>I). Western blotting revealed that GATA3 and HMGB1 protein expression were up-regulated in the CCl4-induced HF mice (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>J–L). Thus, miR-370, GATA3 and HMGB may be associated with the development of HF.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Autophagy and activation of TGF-β1-treated HSCs is positively regulated by GATA3It was reported that TGF-β1 can be utilized to induce HSCs activation and autophagy.<a class="elsevierStyleCrossRefs" href="#bib0355">28,33,34</a> Here, our results showed that GATA3 expression was significantly elevated in the TGF-β1-treated HSCs (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A and B). GATA3 has the same tendency of TGF-β1 in facilitating α-SMA and collagen I in HSCs, indicating that GATA3 has the same tendency of TGF-β1 in activating HSC (<a class="elsevierStyleCrossRef" href="#sec0130">Supplementary Fig. 1A and B</a>). Then, to explore the regulation of GATA3 to TGF-β1-induced HSCs autophagy, GATA3 was overexpressed or knocked down in TGF-β1-treated HSCs. mRNA and protein expression of GATA3 was enhanced in TGF-β1-stimulated HSCs by GATA3 overexpression vector transfection, or was silenced by si-GATA3 transfection (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>C–E). Moreover, we examined the impacts of GATA3 on HSCs autophagy and activation by western blotting. Expression of autophagy markers like LC3-II/LC3-I and Beclin 1 was boosted by GATA3 overexpression and was declined by GATA3 silencing in the TGF-β1-induced HSCs (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>F and G). Consistently, expression of HSCs activation markers like α-SMA and collagen I was also obviously increased by GATA3 overexpression and was inhibited by GATA3 deficiency in the TGF-β1-induced HSCs (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>H and I). Overall, TGF-β1-induced autophagy and activation in HSCs was positively regulated by GATA3. Based on the above results, we thought that whether GATA3 regulates the activation of HSCs through affecting autophagy.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>GATA3 regulated TGF-β1-induced HSCs activation via activating autophagyTo verify the hypothesis, we used 10μM of 3-MA, an inhibitor of autophagy, to treat the activated HSCs. As shown in <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A and B, GATA3 overexpression elevated number of punctate GFP-LC3 in the TGF-β1-treated HSCs, which was partly rescued by 3-MA treatment. The promotion of GATA3 to α-SMA and collagen I expression in the TGF-β1-induced HSCs also was partly rescued by 3-MA treatment (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C and D). Thus, these findings indicated that GATA3 overexpression activated HSCs by promoting autophagy.<elsevierMultimedia ident="fig0015"></elsevierMultimedia>GATA3 aggravated hepatic injury through activating autophagyFinally, we verified the functions and action mechanism of GATA3 in hepatic fibrosis of HF model mouse, GATA3-overexpressed lentivirus and/or 3-MA were used to administrate the mouse. Our data demonstrated that GATA3 promoted LC3II/I and Beclin 1 expression in liver tissues of the HF mouse model, which was partly rescued by autophagy inhibition (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A and B). Importantly, GATA3-induced liver injury and inflammatory cells infiltration was attenuated with the administration of autophagy inhibitor 3-MA (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>C and D). GATA3-resulted hepatic fibrosis (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>E and F) and collagen deposition (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>G and H) were also attenuated by autophagy inhibition. Overall, GATA3 could aggravated hepatic fibrosis through activating autophagy.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>GATA3 facilitated HMGB1 expression through limiting miR-370 transcription in the TGF-β1-induced HSCsTo verify whether GATA3 regulates TGF-β1-induced HSCs activation by targeting miR-370 and HMGB1, we firstly determined expression of miR-370 and HMGB1 in the cells. Our data indicated that miR-370 expression was decreased but HMGB1 was increased in TGF-β1-stimulated HSCs (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A–C). Subsequently, we estimated the regulation of GATA3 on miR-370 and HMGB1 expression in the TGF-β1-induced HSCs. Results uncovered that GATA3 overexpression suppressed miR-370 expression, but enhanced HMGB1 mRNA and protein expression in the TGF-β1-induced HSCs. GATA3 deficiency led to an opposite result (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>D–G).<elsevierMultimedia ident="fig0025"></elsevierMultimedia>As a transcription factor, GATA3 could affect the expression of its target genes through binding to promotor region. Here, the binding sites between GATA3 and promotor of miR-370 was predicted using JAPSAR database (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>H). The results of ChIP and luciferase reporter assay revealed that GATA3 bound with miR-370 gene promoter, thus to impede miR-370 expression (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>I and J). In addition, luciferase reporter assay demonstrated that luciferase activity was severely decreased in 293T cells in the presence of miR-370 mimic and WT pGL3-HMGB1, indicating that miR-370 interacted with HMGB1 3′-UTR (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>N and O). Subsequently, our data confirmed that overexpression of miR-370 suppressed the expression of HMGB1 mRNA and protein, and that silencing of miR-370 facilitated HMGB1 mRNA and protein expression in the TGF-β1-induced HSCs (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>K and M). In addition, GATA3 overexpression-induced up-regulation of HMGB1 was partly abolished by transfection of miR-370 mimic in the TGF-β1-induced HSCs (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>P–R). In short, these results revealed that GATA3 suppressed miR-370 expression and thus to elevate HMGB1 expression in the TGF-β1-induced HSCs.GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370/HMGB1 axisSubsequently, we explored the regulatory mechanism of GATA3 on TGF-β1-induced HSCs autophagy and activation. Number of punctate GFP-LC3 in TGF-β1-induced HSCs was increased by GATA3 overexpression. However, the promotion of GATA3 to HSCs autophagy was reversed by miR-370 overexpression or HMGB1 knockdown (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A and B). The promotion of GATA3 to LC3-II/LC3-I and Beclin 1 expression also was rescued by miR-370 overexpression or HMGB1 silencing (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>C and D). Consistently, α-SMA and collagen I expression was up-regulated in TGF-β1-induced HSCs following GATA3 increasing, but miR-370 overexpression or HMGB1 deficiency reversed the up-regulation of them in the cells (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>E and F). To sum up, GATA3 overexpression promoted TGF-β1-induced HSCs autophagy and activation by regulating miR-370/HMGB1 axis.<elsevierMultimedia ident="fig0030"></elsevierMultimedia>DiscussionGATA3 could promote proliferation and differentiation of various tissues and cells, such as lymphocytes, thymocytes, sympathetic nervous system and hair follicles.<a class="elsevierStyleCrossRef" href="#bib0390">35</a> GATA3 also participates in the progression of various diseases. For instance, GATA3 deficiency activates epithelial-mesenchymal transition to induce poorly-differentiated mammary tumors in mice, thus promotes the initiating and metastatic potential of human breast cancer.<a class="elsevierStyleCrossRef" href="#bib0395">36</a> PM2.5 exposure upsets the balance between Th1 and Th2 by promoting GATA3 expression and inhibiting Runx3 expression, thereby evoking the allergic airway inflammation response in the asthmatic mice.<a class="elsevierStyleCrossRef" href="#bib0400">37</a> GATA3 expression is decreased in hepatocellular carcinoma, and closely associated with the tumor size, tumor node metastasis stage and lymph node metastasis, it represses the malignant phenotypes of hepatocellular carcinoma by regulating slug expression.<a class="elsevierStyleCrossRef" href="#bib0405">38</a> In the current study, we constructed HF mouse model by administration of CCl4, and determined the functional role of GATA3 in HF. CCl4-induced HF mice displayed an increase in serum ALT and AST levels, severe damage in liver tissues and hepatic fibrosis. GATA3 was highly expressed in liver tissues of the CCl4-induced HF mice and in the TGF-β1-treated HSCs. These data suggested that GATA3 may take part in HF development. Previous study has confirmed that adipocyte-derived hormone leptin enhances GATA3 expression to play a unique role in accelerating liver fibrosis,<a class="elsevierStyleCrossRef" href="#bib0305">18</a> which is consistent with our results. Moreover, our data demonstrated that GATA3 activated autophagy in TGF-β1-induced HSCs by elevating LC3-II/LC3-I ratio and Beclin 1 expression. The expression of α-SMA and collagen I in TGF-β1-induced HSCs were also enhanced following GATA3 up-regulation. α-SMA and collagen I are biomarkers for the activated HSCs.<a class="elsevierStyleCrossRef" href="#bib0245">6</a> In activated HSCs, GATA3 positively regulated cell autophagy and activation. In addition, 3-MA, an inhibitor of autophagy, treatment could reverse GATA3-mediated activation of HSCs by inhibiting autophagy. In vivo experiments, GATA3 significantly aggravated liver damage and fibrogenesis, which was partly rescued by autophagy inhibitor administration. All results indicated that GATA3 overexpression activated HSCs by accelerating autophagy.HMGB1 takes part in the development of various liver diseases. HMGB1 has an irreplaceable role in ductular reaction, and it promotes tumor progression in autophagy-deficient livers.<a class="elsevierStyleCrossRef" href="#bib0410">39</a> HMGB1 is highly expressed in the liver tissues of non-alcoholic fatty liver disease mouse model and patient and is associated with the disease-related hepatic fibrogenesis.<a class="elsevierStyleCrossRef" href="#bib0415">40</a> Li et al. have confirmed that HMGB1 induces autophagy and activation of HSCs through regulating ERK/JNK/MAPK and mTOR/STAT3 signaling pathways.<a class="elsevierStyleCrossRef" href="#bib0420">41</a> The present study showed that HMGB1 was highly expressed in liver tissues of the HF model moues and the TGF-β1-treated primary HSCs. GATA3 increased HMGB1 expression in the activated HSCs. Moreover, miR-370 inhibited HMGB1 expression in activated HSCs by interacting with its mRNA 3′-UTR. GATA3 overexpression-induced autophagy and activation of HSCs was abrogated by HMGB1 knockdown.The miR-370 has been reported to exert an anti-fibrotic effect by maintaining the quiescent phenotype of normal HSCs, inhibiting proliferation and activation of HSCs.<a class="elsevierStyleCrossRef" href="#bib0425">42</a> Previous study has confirmed that miR-370 expression is decreased in fibrotic liver tissues of rats and TGF-β1-treated HSCs, and miR-370 up-regulation inhibits activation of HSCs and attenuates liver fibrosis in rats by inhibiting SMO expression.<a class="elsevierStyleCrossRef" href="#bib0430">43</a> Our data also found that miR-370 was down-regulated in liver tissues of the CCl4-induced HF mice and the TGF-β1-treated primary HSCs. miR-370 expression was suppressed by GATA3 in the activated HSCs. Importantly, GATA3 bound with the gene promoter of miR-370, thus to inhibit miR-370 expression. Overexpression of miR-370 also could reverse GATA3 overexpression-induced autophagy and activation of TGF-β1-induced HSCs.In conclusion, this work demonstrates that GATA3 regulates miR-370/HMGB1 signaling pathway to promote autophagy and activation of HSCs, which contributes to accelerate HF. Thus, this work suggests that GATA3 may be a potential target for prevention and treatment of HF.Authors’ contributionsZ.X. conceived and designed research; Y.L., P.X. and S.K. performed experiments; Y.L. analyzed data; P.X. interpreted results of experiments; S.K. prepared figures; Z.X. drafted manuscript; Z.X. edited and revised manuscript; all authors approved final version of manuscript.Ethical considerationsThe work described has been carried out in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki). This research was approved by the Animal Care and Use Committee of Nanchang University (No. NCUSYDWFL-2020-149).FundingThis study was supported by the National Natural Science Foundation of China [Grant No. 81860119; 82260131]; Key Research and Development Program of Jiangxi Provincial Department of Science and Technology [Grant No. 20203BBG73044]; Natural Science Foundation of Jiangxi Province of China [Grant No. 20212ACB206017]; Science and Technology Project Foundation of Education Department of Jiangxi Province, China [Grant No. GJJ200193].Conflict of interestNone." "textoCompletoSecciones" => array:1 [ "secciones" => array:13 [ 0 => array:3 [ "identificador" => "xres2136078" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1813941" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres2136077" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst1025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst1030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst1035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst1040" "titulo" => "Conclusiones" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1813942" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:11 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Animals" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Mouse model of HF" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Cell culture" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Cell transfection" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Histological analysis" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Enzyme-linked immunosorbent assay (ELISA)" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Quantitative real-time PCR (qRT-PCR)" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "Western blotting" ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "Autophagy analysis" ] 9 => array:2 [ "identificador" => "sec0060" "titulo" => "Luciferase reporter assay" ] 10 => array:2 [ "identificador" => "sec0065" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0070" "titulo" => "Results" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0075" "titulo" => "GATA3 and HMGB1 were up-regulated but miR-370 was down-regulated in CCl-induced HF mice" ] 1 => array:2 [ "identificador" => "sec0080" "titulo" => "Autophagy and activation of TGF-β1-treated HSCs is positively regulated by GATA3" ] 2 => array:2 [ "identificador" => "sec0085" "titulo" => "GATA3 regulated TGF-β1-induced HSCs activation via activating autophagy" ] 3 => array:2 [ "identificador" => "sec0090" "titulo" => "GATA3 aggravated hepatic injury through activating autophagy" ] 4 => array:2 [ "identificador" => "sec0095" "titulo" => "GATA3 facilitated HMGB1 expression through limiting miR-370 transcription in the TGF-β1-induced HSCs" ] 5 => array:2 [ "identificador" => "sec0100" "titulo" => "GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370/HMGB1 axis" ] ] ] 7 => array:2 [ "identificador" => "sec0105" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0110" "titulo" => "Authors’ contributions" ] 9 => array:2 [ "identificador" => "sec0115" "titulo" => "Ethical considerations" ] 10 => array:2 [ "identificador" => "sec0120" "titulo" => "Funding" ] 11 => array:2 [ "identificador" => "sec0125" "titulo" => "Conflict of interest" ] 12 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2022-12-07" "fechaAceptado" => "2023-05-10" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1813941" "palabras" => array:5 [ 0 => "Hepatic fibrosis" 1 => "GATA3" 2 => "HMGB1" 3 => "Hepatic stellate cell" 4 => "Autophagy" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1813942" "palabras" => array:5 [ 0 => "Fibrosis hepática" 1 => "GATA3" 2 => "HMGB1" 3 => "Células hepáticas estrelladas" 4 => "Autofagia" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundHepatic fibrosis (HF) is a common result of the repair process of various chronic liver diseases. Hepatic stellate cells (HSCs) activation is the central link in the occurrence of HF. MethodsELISA and histological analysis were performed to detect the pathological changes of liver tissues. In vitro, HSCs were treated with TGF-β1 as HF cell model. Combination of GATA-binding protein 3 (GATA3) and miR-370 gene promoter was ensured by ChIP and luciferase reporter assay. Autophagy was monitored by observing the GFP-LC3 puncta formation. The interaction between miR-370 and high mobility group box 1 protein (HMGB1) was verified by luciferase reporter assay. ResultsCCl4-induced HF mice exhibited an increase of ALT and AST, and severe damage and fibrosis of liver tissues. GATA3 and HMGB1 were up-regulated, and miR-370 was down-regulated in CCl4-induced HF mice and activated HSCs. GATA3 enhanced expression of the autophagy-related proteins and activation markers in the activated HSCs. Inhibition of autophagy partly reversed GATA3-induced activation of HSCs and the promotion of GATA3 to hepatic fibrosis. Moreover, GATA3 suppressed miR-370 expression via binding with its promotor, and enhanced HMGB1 expression in HSCs. Increasing of miR-370 inhibited HMGB1 expression by directly targeting its mRNA 3′-UTR. The promotion of GATA3 to TGF-β1-induced HSCs autophagy and activation was abrogated by miR-370 up-regulation or HMGB1 knockdown. ConclusionsThis work demonstrates that GATA3 promotes autophagy and activation of HSCs by regulating miR-370/HMGB1 signaling pathway, which contributes to accelerate HF. Thus, this work suggests that GATA3 may be a potential target for prevention and treatment of HF." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "IntroducciónLa fibrosis hepática (IC) es un resultado común del proceso de reparación de diversas enfermedades hepáticas crónicas. La activación de las células estrelladas hepáticas (HSC) es el vínculo central en la aparición de insuficiencia cardíaca. MétodosSe realizaron ELISA y análisis histológicos para detectar los cambios patológicos de los tejidos hepáticos. In vitro, las HSC se trataron con TGF-1 como modelo de células HF. La combinación de la proteína 3 de unión a GATA (GATA3) y el promotor del gen miR-370 se aseguró mediante el ensayo ChIP y el indicador de luciferasa. La autofagia se controló observando la formación de puntos GFP-LC3. La interacción entre miR-370 y la proteína de la caja 1 del grupo de alta movilidad (HMGB1) se verificó mediante el ensayo indicador de luciferasa. ResultadosLos ratones con HF inducida por CCl4 exhibieron un aumento de ALT y AST, y daño severo y fibrosis de los tejidos hepáticos. GATA3 y HMGB1 estaban regulados positivamente, y miR-370 estaba regulado negativamente en ratones HF inducidos por CCl4 y HSC activadas. GATA3 mejoró la expresión de las proteínas relacionadas con la autofagia y los marcadores de activación en las HSC activadas. La inhibición de la autofagia revirtió parcialmente la activación de HSC inducida por GATA3 y la promoción de GATA3 a la fibrosis hepática. Además, GATA3 suprimió la expresión de miR-370 mediante la unión con su promotor y mejoró la expresión de HMGB1 en HSC. El aumento de miR-370 inhibió la expresión de HMGB1 al apuntar directamente a su ARNm 3 -UTR. La promoción de GATA3 a la autofagia y activación de las HSC inducidas por TGF-1 fue anulada por la regulación positiva de miR-370 o la eliminación de HMGB1. ConclusionesEste trabajo demuestra que GATA3 promueve la autofagia y la activación de las HSC mediante la regulación de la vía de señalización de miR-370/HMGB1, lo que contribuye para acelerar la HF. Por lo tanto, este trabajo sugiere que GATA3 puede ser un objetivo potencial para la prevención y el tratamiento de la insuficiencia cardíaca." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst1025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst1030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst1035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst1040" "titulo" => "Conclusiones" ] ] ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following are the supplementary data to this article:<elsevierMultimedia ident="fig0035"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0135" ] ] ] ] "multimedia" => array:8 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2627 "Ancho" => 3008 "Tamanyo" => 874443 ] ] "descripcion" => array:1 [ "en" => "Expression of miR-370, GATA3 and HMGB1 in the CCl4-induced HF mice. Serum levels of ALT (A) and AST (B) of the CCl4-induced HF mice and normal mice were detected by ELISA. (C, D) Histopathologic changes in liver tissues of the CCl4-induced HF mice and normal mice were assessed by H&E staining. (E, F) Hepatic fibrosis were examined by Masson staining. (G, H) Collagen deposition in liver tissues were examined by using Sirius Red staining. (I) miR-370 expression in liver tissues of the CCl4-induced HF mice and normal mice was assessed by qRT-PCR. (J–L) Protein expression of GATA3 and HMGB1 in liver tissues of the CCl4-induced HF mice and normal mice was assessed by western blotting analysis. n=6, all experiments were repeated for three time at least. *P<0.05, **P<0.01, and ***P<0.001." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3315 "Ancho" => 2925 "Tamanyo" => 542088 ] ] "descripcion" => array:1 [ "en" => "Regulation of GATA3 on autophagy and activation in the TGF-β1-treated primary HSCs. (A and B) Western blotting was used to assess protein expression of GATA3 in TGF-β1-treated HSCs. Next, HSCs were transfected with pcDNA-GATA3, vector, si-GATA3 or si-NC, followed by TGF-β1 treatment. qRT-PCR (C) and western blotting (D and E) were performed to detect mRNA and protein expression of GATA3 in the HSCs. (F and G) Protein expression of LC3-II/LC3-I and Beclin 1 in the HSCs was examined by western blotting. (H and I) Protein expression of α-SMA and collagen I in the HSCs was examined by western blotting. n=3, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2031 "Ancho" => 2508 "Tamanyo" => 273405 ] ] "descripcion" => array:1 [ "en" => "Autophagy silencing inhibited TGF-β1-induced HSCs activation. HSCs were transfected with pcDNA-GATA3 or vector, followed by TGF-β1 alone or in combination with 10μM of 3-MA treatment. (A and B) Autophagosome (GFP-LC3 punctate) number in the HSCs was examined under fluorescence microscopy. (C and D) Protein expression of α-SMA and collagen I in the HSCs was examined by western blotting. n=3, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 3021 "Ancho" => 2925 "Tamanyo" => 1080664 ] ] "descripcion" => array:1 [ "en" => "GATA3 aggravated fibrogenesis through activating autophagy in HF model mice. HF model mice were administrated with the GATA3 overexpression lentivirus through tail vein and autophagy inhibitor 3-MA through intraperitoneal injection. (A and B) Expression of LC3II/I and Beclin 1 was measured by western blotting. (C and D) Pathological changes in liver tissues was measured by H&E staining. (E and F) Liver fibrosis was measured by Masson staining. (G and H) Collagen deposition in liver tissues was measured by Sirius Red staining. n=6, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2548 "Ancho" => 3341 "Tamanyo" => 644220 ] ] "descripcion" => array:1 [ "en" => "GATA3 enhanced HMGB1 expression by targeting miR-370 in the TGF-β1-induced HSCs. (A) qRT-PCR was performed to detect miR-370 expression in the TGF-β1-treated and –untreated HSCs. (B and C) Western blotting was carried out to measure expression of HMGB1 in the TGF-β1-treated and -untreated HSCs. After that, HSCs were transfected with pcDNA-GATA3, vector, si-GATA3 or si-NC, followed by TGF-β1 treatment. (D) qRT-PCR was used to assess the expression of miR-370 in HSCs. qRT-PCR (E) and western blotting (F and G) were performed to detect the mRNA and protein expression of HMGB1 in the HSCs. (H) The binding sites between GATA3 and miR-370 was analyzed utilizing JAPSAR database. (I and J) Combination of GATA3 and miR-370 gene promoter was determined utilizing ChIP assay and luciferase reporter assay. HSCs were transfected with miR-370 mimic, mimic NC, miR-370 inhibitor or inhibitor NC, followed by TGF-β1 treatment. qRT-PCR (K) and western blotting (L and M) were performed to detect the mRNA and protein expression of HMGB1 in the HSCs. (N and O) The interaction between miR-370 and HMGB1 mRNA 3′-UTR was verified by Luciferase reporter assay. HSCs were co-transfected pcDNA-GATA3 or vector with miR-370 mimic or mimic NC, followed by TGF-β1 treatment. qRT-PCR (P) and western blotting analysis (Q and R) were performed to detect the mRNA and protein expression of HMGB1 in the HSCs. n=3, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] 5 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1509 "Ancho" => 2508 "Tamanyo" => 320646 ] ] "descripcion" => array:1 [ "en" => "GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370/HMGB1. HSCs were co-transfected pcDNA-GATA3 or vector with miR-370 mimic or si-HMGB1, followed by TGF-β1 treatment. (A and B) Autophagy in HSCs was examined under fluorescence microscopy. (C–F) Protein expression of LC3-II, LC3-I, Beclin 1, α-SMA and collagen I in the HSCs was examined by western blotting. n=3, all experiments were repeated for three time at least. *P<0.05 and **P<0.01." ] ] 6 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer sequence (5′-3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GATA3-F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGTGGACGTACTTTTTAACATCGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GATA3-R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCTGACGGAGTTTCCGTAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">miR-370-F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGCCTGCTGGGGTGGAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">miR-370-R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTCAACTGGTGTCGTGGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HMGB1-F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGGATCCCAATGCACCCAAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HMGB1-R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CGCAACATCACCAATGGACAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U6-F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTCGCTTCGGCAGCACA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U6-R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AACGCTTCACGAATTTGCGT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH-F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGTTCCTACCCCCAATGTGTCCGTC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH-R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTGGTCCTCAGTGTAGCCCAAGATG \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3521624.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Sequences of primers used in qRT-PCR." ] ] 7 => array:5 [ "identificador" => "fig0035" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => false "mostrarDisplay" => true "figura" => array:1 [ 0 => array:4 [ "imagen" => "mmc1.jpeg" "Alto" => 675 "Ancho" => 2500 "Tamanyo" => 105001 ] ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:43 [ 0 => array:3 [ "identificador" => "bib0220" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatic fibrosis: emerging therapies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "S.L. Friedman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000374098" "Revista" => array:6 [ "tituloSerie" => "Dig Dis" "fecha" => "2015" "volumen" => "33" "paginaInicial" => "504" "paginaFinal" => "507" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26159266" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0225" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Liver fibrosis: pathophysiology, pathogenetic targets and clinical issues" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Parola" 1 => "M. Pinzani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.mam.2018.09.002" "Revista" => array:6 [ "tituloSerie" => "Mol Aspects Med" "fecha" => "2019" "volumen" => "65" "paginaInicial" => "37" "paginaFinal" => "55" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30213667" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0230" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immune dysfunction and albumin-related immunity in liver cirrhosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Wilde" 1 => "A. Katsounas" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Mediat Inflamm" "fecha" => "2019" "volumen" => "2019" "paginaInicial" => "7537649" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0235" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mechanisms of hepatic stellate cell activation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "T. Tsuchida" 1 => "S. Friedman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrgastro.2017.38" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Gastroenterol Hepatol" "fecha" => "2017" "volumen" => "14" "paginaInicial" => "397" "paginaFinal" => "411" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28487545" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0240" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metabolic signature of hepatic fibrosis: from individual pathways to systems biology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Chang" 1 => "S. Yang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/cells8111423" "Revista" => array:5 [ "tituloSerie" => "Cells" "fecha" => "2019" "volumen" => "8" "paginaInicial" => "1423" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31726658" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0245" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR 21 promotes α-SMA and collagen I expression in hepatic stellate cells via the Smad7 signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R. Fu" 1 => "D. Hu" 2 => "Y. Hu" 3 => "L. Hong" 4 => "Q. Sun" 5 => "J. Ding" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mol Med Rep" "fecha" => "2017" "volumen" => "16" "paginaInicial" => "4327" "paginaFinal" => "4333" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0250" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methyl ferulic acid attenuates liver fibrosis and hepatic stellate cell activation through the TGF-β1/Smad and NOX4/ROS pathways" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q. Cheng" 1 => "C. Li" 2 => "C. Yang" 3 => "Y. Zhong" 4 => "D. Wu" 5 => "L. Shi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cbi.2018.12.006" "Revista" => array:6 [ "tituloSerie" => "Chem Biol Interact" "fecha" => "2019" "volumen" => "299" "paginaInicial" => "131" "paginaFinal" => "139" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30543783" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0255" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chloroquine improved carbon tetrachloride-induced liver fibrosis through its inhibition of the activation of hepatic stellate cells: role of autophagy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W. He" 1 => "B. Wang" 2 => "J. Yang" 3 => "Y. Zhuang" 4 => "L. Wang" 5 => "X. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1248/bpb.b14-00297" "Revista" => array:6 [ "tituloSerie" => "Biol Pharm Bull" "fecha" => "2014" "volumen" => "37" "paginaInicial" => "1505" "paginaFinal" => "1509" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25177034" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0260" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "V. Hernández-Gea" 1 => "Z. Ghiassi-Nejad" 2 => "R. Rozenfeld" 3 => "R. Gordon" 4 => "M. Fiel" 5 => "Z. Yue" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2011.12.044" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2012" "volumen" => "142" "paginaInicial" => "938" "paginaFinal" => "946" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22240484" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0265" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A role for autophagy during hepatic stellate cell activation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Thoen" 1 => "E. Guimarães" 2 => "L. Dollé" 3 => "I. Mannaerts" 4 => "M. Najimi" 5 => "E. Sokal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2011.07.010" "Revista" => array:7 [ "tituloSerie" => "J Hepatol" "fecha" => "2011" "volumen" => "55" "paginaInicial" => "1353" "paginaFinal" => "1360" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21803012" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0090429521011997" "estado" => "S300" "issn" => "00904295" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0270" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of autophagy inhibitor 3-methyladenine on proliferation and activation of hepatic stellate cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Liu" 1 => "Y. He" 2 => "J. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Chin J Cell Mol Immunol" "fecha" => "2013" "volumen" => "29" "paginaInicial" => "809" "paginaFinal" => "812" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0275" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phospholipase D1 decreases type I collagen levels in hepatic stellate cells via induction of autophagy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Seo" 1 => "B. Jang" 2 => "Y. Jung" 3 => "E. Lee" 4 => "H. Kim" 5 => "J. Jeon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2014.04.149" "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2014" "volumen" => "449" "paginaInicial" => "38" "paginaFinal" => "43" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24802400" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0280" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The multi-faceted role of Gata3 in developmental haematopoiesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "N. Zaidan" 1 => "K. Ottersbach" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1098/rsob.180152" "Revista" => array:5 [ "tituloSerie" => "Open Biol" "fecha" => "2018" "volumen" => "8" "paginaInicial" => "180152" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30463912" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0285" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "GATA3 inhibits viral infection by promoting microRNA-155 expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Li" 1 => "A. Haiyilati" 2 => "L. Zhou" 3 => "J. Chen" 4 => "Y. Wang" 5 => "L. Gao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/jvi.01888-21" "Revista" => array:6 [ "tituloSerie" => "J Virol" "fecha" => "2022" "volumen" => "96" "paginaInicial" => "e0188821" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35319228" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S147020452300061X" "estado" => "S300" "issn" => "14702045" ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0290" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-374b targets GATA3 to promote progression and development of glioblastoma via regulating SEMA3B" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. Gao" 1 => "S. Bai" 2 => "Y. Wang" 3 => "S. Zhao" 4 => "Z. He" 5 => "R. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4149/neo_2018_180830N659" "Revista" => array:6 [ "tituloSerie" => "Neoplasma" "fecha" => "2019" "volumen" => "66" "paginaInicial" => "543" "paginaFinal" => "554" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30868892" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0295" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "GATA3 suppresses metastasis and modulates the tumour microenvironment by regulating microRNA-29b expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. Chou" 1 => "J.H. Lin" 2 => "A. Brenot" 3 => "J.W. Kim" 4 => "S. Provot" 5 => "Z. Werb" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ncb2672" "Revista" => array:6 [ "tituloSerie" => "Nat Cell Biol" "fecha" => "2013" "volumen" => "15" "paginaInicial" => "201" "paginaFinal" => "213" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23354167" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0300" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Overexpression of the transcription factor GATA-3 enhances the development of pulmonary fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Kimura" 1 => "Y. Ishii" 2 => "K. Yoh" 3 => "Y. Morishima" 4 => "T. Iizuka" 5 => "T. Kiwamoto" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Am J Pathol" "fecha" => "2006" "volumen" => "169" "paginaInicial" => "96" "paginaFinal" => "104" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0305" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "GATA binding protein 3 is correlated with leptin regulation of PPARγ1 in hepatic stellate cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W. Guan" 1 => "F. Cheng" 2 => "H. Wu" 3 => "Q. Cao" 4 => "X. Zhu" 5 => "Y. Fan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/jcmm.13002" "Revista" => array:6 [ "tituloSerie" => "J Cell Mol Med" "fecha" => "2017" "volumen" => "21" "paginaInicial" => "568" "paginaFinal" => "578" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27709831" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0310" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Synthesized HMGB1 peptide attenuates liver inflammation and suppresses fibrosis in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Nojiri" 1 => "A. Tsuchiya" 2 => "K. Natsui" 3 => "S. Takeuchi" 4 => "T. Watanabe" 5 => "Y. Kojima" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s41232-021-00177-4" "Revista" => array:5 [ "tituloSerie" => "Inflamm Regen" "fecha" => "2021" "volumen" => "41" "paginaInicial" => "28" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34565478" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0315" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Synthesized HMGB1 peptide prevents the progression of inflammation, steatosis, fibrosis, and tumor occurrence in a non-alcoholic steatohepatitis mouse model" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Ishii" 1 => "A. Tsuchiya" 2 => "K. Natsui" 3 => "Y. Koseki" 4 => "N. Takeda" 5 => "K. Tomiyoshi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/hepr.13825" "Revista" => array:7 [ "tituloSerie" => "Hepatol Res" "fecha" => "2022" "volumen" => "52" "paginaInicial" => "985" "paginaFinal" => "997" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35932481" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283810010833" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0320" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Most mammalian mRNAs are conserved targets of microRNAs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R.C. Friedman" 1 => "K.K. Farh" 2 => "C.B. Burge" 3 => "D.P. Bartel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1101/gr.082701.108" "Revista" => array:6 [ "tituloSerie" => "Genome Res" "fecha" => "2009" "volumen" => "19" "paginaInicial" => "92" "paginaFinal" => "105" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18955434" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0325" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pan-cancer analysis shows that ALKBH5 is a potential prognostic and immunotherapeutic biomarker for multiple cancer types including gliomas" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Wei" 1 => "B. Wang" 2 => "D. Peng" 3 => "X. Zhang" 4 => "Z. Li" 5 => "L. Luo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fimmu.2022.849592" "Revista" => array:6 [ "tituloSerie" => "Front Immunol" "fecha" => "2022" "volumen" => "13" "paginaInicial" => "849592" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35444654" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S002604951730015X" "estado" => "S300" "issn" => "00260495" ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0330" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mex3a promotes oncogenesis through the RAP1/MAPK signaling pathway in colorectal cancer and is inhibited by hsa-miR-6887-3p" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Li" 1 => "J. Liang" 2 => "J. Wang" 3 => "J. Han" 4 => "S. Li" 5 => "K. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/cac2.12149" "Revista" => array:6 [ "tituloSerie" => "Cancer Commun (Lond)" "fecha" => "2021" "volumen" => "41" "paginaInicial" => "472" "paginaFinal" => "491" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33638620" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0335" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-370 attenuates hepatic fibrogenesis by targeting smoothened" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.H. Lu" 1 => "Q.R. Hou" 2 => "L.F. Deng" 3 => "C. Fei" 4 => "W.P. Xu" 5 => "Q. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10620-015-3585-0" "Revista" => array:7 [ "tituloSerie" => "Dig Dis Sci" "fecha" => "2015" "volumen" => "60" "paginaInicial" => "2038" "paginaFinal" => "2048" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25686745" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0090429511004134" "estado" => "S300" "issn" => "00904295" ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0340" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Paclitaxel alleviates the sepsis-induced acute kidney injury via lnc-MALAT1/miR-370-3p/HMGB1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "L. Xu" 1 => "G. Hu" 2 => "P. Xing" 3 => "M. Zhou" 4 => "D. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.lfs.2020.118505" "Revista" => array:5 [ "tituloSerie" => "Life Sci" "fecha" => "2020" "volumen" => "262" "paginaInicial" => "118505" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32998017" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0345" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Margatoxin mitigates CCl4induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B.M. Wu" 1 => "J.D. Liu" 2 => "Y.H. Li" 3 => "J. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/ijmm.2019.4395" "Revista" => array:6 [ "tituloSerie" => "Int J Mol Med" "fecha" => "2019" "volumen" => "45" "paginaInicial" => "103" "paginaFinal" => "114" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31746414" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0350" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-17A plays a critical role in the pathogenesis of liver fibrosis through hepatic stellate cell activation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Z. Tan" 1 => "X. Qian" 2 => "R. Jiang" 3 => "Q. Liu" 4 => "Y. Wang" 5 => "C. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Immunol (Baltimore, Md: 1950)" "fecha" => "2013" "volumen" => "191" "paginaInicial" => "1835" "paginaFinal" => "1844" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0355" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Limonin relieves TGF-β-induced hepatocyte EMT and hepatic stellate cell activation in vitro and CCl(4)-induced liver fibrosis in mice via upregulating Smad7 and subsequent suppression of TGF-β/Smad cascade" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G. Shu" 1 => "C. Dai" 2 => "A. Yusuf" 3 => "H. Sun" 4 => "X. Deng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jnutbio.2022.109039" "Revista" => array:5 [ "tituloSerie" => "J Nutr Biochem" "fecha" => "2022" "volumen" => "107" "paginaInicial" => "109039" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35533902" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0360" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bleomycin-induced interstitial pulmonary disease in the nude, athymic mouse" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Szapiel" 1 => "N. Elson" 2 => "J. Fulmer" 3 => "G. Hunninghake" 4 => "R. Crystal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/arrd.1979.120.4.893" "Revista" => array:6 [ "tituloSerie" => "Am Rev Respir Dis" "fecha" => "1979" "volumen" => "120" "paginaInicial" => "893" "paginaFinal" => "899" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/92208" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0365" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Simple method of estimating severity of pulmonary fibrosis on a numerical scale" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Ashcroft" 1 => "J. Simpson" 2 => "V. Timbrell" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/jcp.41.4.467" "Revista" => array:7 [ "tituloSerie" => "J Clin Pathol" "fecha" => "1988" "volumen" => "41" "paginaInicial" => "467" "paginaFinal" => "470" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3366935" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0002937822000680" "estado" => "S300" "issn" => "00029378" ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0370" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-137 inhibits autophagy and chemosensitizes pancreatic cancer cells by targeting ATG5" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Z. Wang" 1 => "F. Huang" 2 => "H. Xu" 3 => "J. Sun" 4 => "C. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.biocel.2019.01.020" "Revista" => array:6 [ "tituloSerie" => "Int J Biochem Cell Biol" "fecha" => "2019" "volumen" => "111" "paginaInicial" => "63" "paginaFinal" => "71" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30710750" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0375" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sestrin 2 attenuates rat hepatic stellate cell (HSC) activation and liver fibrosis via an mTOR/AMPK-dependent mechanism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Hu" 1 => "X. Ye" 2 => "Q. Zhou" 3 => "R. Fu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000495829" "Revista" => array:6 [ "tituloSerie" => "Cell Physiol Biochem" "fecha" => "2018" "volumen" => "51" "paginaInicial" => "2111" "paginaFinal" => "2122" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30522100" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0380" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TGF-β1-induced autophagy activates hepatic stellate cells via the ERK and JNK signaling pathways" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Zhang" 1 => "N. Jiang" 2 => "J. Ping" 3 => "L. Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/ijmm.2020.4778" "Revista" => array:6 [ "tituloSerie" => "Int J Mol Med" "fecha" => "2021" "volumen" => "47" "paginaInicial" => "256" "paginaFinal" => "266" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33236148" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0385" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-654-5p contributes to the activation and proliferation of hepatic stellate cells by targeting RXRα" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Ma" 1 => "X. Wang" 2 => "X. Liu" 3 => "C. Wang" 4 => "X. Gao" 5 => "J. Niu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fcell.2022.841248" "Revista" => array:5 [ "tituloSerie" => "Front Cell Dev Biol" "fecha" => "2022" "volumen" => "10" "paginaInicial" => "841248" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35465330" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0390" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Value of GATA3 immunostaining in tumor diagnosis: a review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "N. Ordóñez" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/PAP.0b013e3182a28a68" "Revista" => array:6 [ "tituloSerie" => "Adv Anat Pathol" "fecha" => "2013" "volumen" => "20" "paginaInicial" => "352" "paginaFinal" => "360" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23939152" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0395" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "GATA3 functions downstream of BRCA1 to suppress EMT in breast cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Bai" 1 => "L. Zhang" 2 => "X. Liu" 3 => "C. Wang" 4 => "C. Zheng" 5 => "J. Sun" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7150/thno.59280" "Revista" => array:7 [ "tituloSerie" => "Theranostics" "fecha" => "2021" "volumen" => "11" "paginaInicial" => "8218" "paginaFinal" => "8233" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34373738" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0090429507024223" "estado" => "S300" "issn" => "00904295" ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0400" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Fine particulate matter induces airway inflammation by disturbing the balance between Th1/Th2 and regulation of GATA3 and Runx3 expression in BALB/c mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L. Pang" 1 => "P. Yu" 2 => "X. Liu" 3 => "Y. Fan" 4 => "Y. Shi" 5 => "S. Zou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/mmr.2021.12017" "Revista" => array:5 [ "tituloSerie" => "Mol Med Rep" "fecha" => "2021" "volumen" => "23" "paginaInicial" => "378" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33760131" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0405" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "GATA3 is downregulated in HCC and accelerates HCC aggressiveness by transcriptionally inhibiting slug expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Z. Zhang" 1 => "X. Fang" 2 => "G. Xie" 3 => "J. Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/ol.2021.12492" "Revista" => array:5 [ "tituloSerie" => "Oncol Lett" "fecha" => "2021" "volumen" => "21" "paginaInicial" => "231" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33613720" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0410" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HMGB1 promotes ductular reaction and tumorigenesis in autophagy-deficient livers" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Khambu" 1 => "N. Huda" 2 => "X. Chen" 3 => "D. Antoine" 4 => "Y. Li" 5 => "G. Dai" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI91814" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "2018" "volumen" => "128" "paginaInicial" => "2419" "paginaFinal" => "2435" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29558368" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0415" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Significance of MR/OPN/HMGB1 axis in NAFLD-associated hepatic fibrogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Tang" 1 => "H. Jia" 2 => "S. Chen" 3 => "B. Yang" 4 => "B. Patpur" 5 => "W. Song" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.lfs.2020.118619" "Revista" => array:5 [ "tituloSerie" => "Life Sci" "fecha" => "2021" "volumen" => "264" "paginaInicial" => "118619" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33091447" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0420" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HMGB1-induced autophagy facilitates hepatic stellate cells activation: a new pathway in liver fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Li" 1 => "C. Zeng" 2 => "B. Zheng" 3 => "C. Liu" 4 => "M. Tang" 5 => "Y. Jiang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Sci (Lond, Engl: 1979)" "fecha" => "2018" "volumen" => "132" "paginaInicial" => "1645" "paginaFinal" => "1667" ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0425" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA interplay between hepatic stellate cell quiescence and activation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D. Ezhilarasan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejphar.2020.173507" "Revista" => array:6 [ "tituloSerie" => "Eur J Pharmacol" "fecha" => "2020" "volumen" => "885" "paginaInicial" => "173507" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32858048" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0090429520307172" "estado" => "S300" "issn" => "00904295" ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0430" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-370 attenuates hepatic fibrogenesis by targeting smoothened" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Lu" 1 => "Q. Hou" 2 => "L. Deng" 3 => "C. Fei" 4 => "W. Xu" 5 => "Q. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10620-015-3585-0" "Revista" => array:7 [ "tituloSerie" => "Dig Dis Sci" "fecha" => "2015" "volumen" => "60" "paginaInicial" => "2038" "paginaFinal" => "2048" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25686745" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022534711049743" "estado" => "S300" "issn" => "00225347" ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/02105705/0000004700000003/v4_202404281047/S0210570523003369/v4_202404281047/en/main.assets" "Apartado" => array:4 [ "identificador" => "9009" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/02105705/0000004700000003/v4_202404281047/S0210570523003369/v4_202404281047/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570523003369?idApp=UINPBA00004N"]

Statistics

Original Article

GATA3 promotes the autophagy and activation of hepatic stellate cell in hepatic fibrosis via regulating miR-370/HMGB1 pathway

GATA3 promueve la autofagia y la activación de la célula estrellada hepática en la fibrosis hepática a través de la regulación de la vía miR-370/HMGB1

Zhengyuan Xiea,

Corresponding author

xzytg2021@163.com

Corresponding author.

, Yangyang Lib, Peiguang Xiaob, Shanmiao Keb

a Department of Gastroenterology, The Second Affiliated Hospital of Nanchang University, Nanchang 330006, China

b Medical College of Nanchang University, Nanchang 330006, China

Read

583

Times
was read the article

129

Total PDF

454

Total HTML

Share statistics

 array:22 [
  "pii" => "S0210570523003369"
  "issn" => "02105705"
  "doi" => "10.1016/j.gastrohep.2023.05.005"
  "estado" => "S300"
  "fechaPublicacion" => "2024-03-01"
  "aid" => "2080"
  "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;. All rights reserved"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Gastroenterol Hepatol. 2024;47:219-29"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0210570523003370"
    "issn" => "02105705"
    "doi" => "10.1016/j.gastrohep.2023.05.006"
    "estado" => "S300"
    "fechaPublicacion" => "2024-03-01"
    "aid" => "2081"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Gastroenterol Hepatol. 2024;47:230-5"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Manejo de la analgesia en la pancreatitis aguda&#46; Resultados de una encuesta nacional"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "230"
          "paginaFinal" => "235"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Management of analgesia in acute pancreatitis&#58; Results of a national survey"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1691
              "Ancho" => 2508
              "Tamanyo" => 144788
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Mapa con el n&#250;mero de respuestas a la encuesta por comunidad aut&#243;noma&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ana Campillo Arregui, Federico Bolado Concejo, Helena Le&#243;n Brito, Diego Mart&#237;nez-Ac&#237;tores de la Mata, Ver&#243;nica Ubieto Capela, Alba Cebri&#225;n Garc&#237;a, Marcos Kutz Leoz, Matilde Laiglesia Izquierdo"
          "autores" => array:8 [
            0 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Campillo Arregui"
            ]
            1 => array:2 [
              "nombre" => "Federico"
              "apellidos" => "Bolado Concejo"
            ]
            2 => array:2 [
              "nombre" => "Helena"
              "apellidos" => "Le&#243;n Brito"
            ]
            3 => array:2 [
              "nombre" => "Diego"
              "apellidos" => "Mart&#237;nez-Ac&#237;tores de la Mata"
            ]
            4 => array:2 [
              "nombre" => "Ver&#243;nica"
              "apellidos" => "Ubieto Capela"
            ]
            5 => array:2 [
              "nombre" => "Alba"
              "apellidos" => "Cebri&#225;n Garc&#237;a"
            ]
            6 => array:2 [
              "nombre" => "Marcos"
              "apellidos" => "Kutz Leoz"
            ]
            7 => array:2 [
              "nombre" => "Matilde"
              "apellidos" => "Laiglesia Izquierdo"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2444382424000592"
        "doi" => "10.1016/j.gastre.2023.05.010"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382424000592?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570523003370?idApp=UINPBA00004N"
    "url" => "/02105705/0000004700000003/v4_202404281047/S0210570523003370/v4_202404281047/es/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "GATA3 promotes the autophagy and activation of hepatic stellate cell in hepatic fibrosis via regulating miR-370&#47;HMGB1 pathway"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "219"
        "paginaFinal" => "229"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Zhengyuan Xie, Yangyang Li, Peiguang Xiao, Shanmiao Ke"
        "autores" => array:4 [
          0 => array:4 [
            "nombre" => "Zhengyuan"
            "apellidos" => "Xie"
            "email" => array:1 [
              0 => "xzytg2021@163.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Yangyang"
            "apellidos" => "Li"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Peiguang"
            "apellidos" => "Xiao"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Shanmiao"
            "apellidos" => "Ke"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Department of Gastroenterology&#44; The Second Affiliated Hospital of Nanchang University&#44; Nanchang 330006&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Medical College of Nanchang University&#44; Nanchang 330006&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "GATA3 promueve la autofagia y la activaci&#243;n de la c&#233;lula estrellada hep&#225;tica en la fibrosis hep&#225;tica a trav&#233;s de la regulaci&#243;n de la v&#237;a miR-370&#47;HMGB1"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 3021
            "Ancho" => 2925
            "Tamanyo" => 1080664
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">GATA3 aggravated fibrogenesis through activating autophagy in HF model mice&#46; HF model mice were administrated with the GATA3 overexpression lentivirus through tail vein and autophagy inhibitor 3-MA through intraperitoneal injection&#46; &#40;A and B&#41; Expression of LC3II&#47;I and Beclin 1 was measured by western blotting&#46; &#40;C and D&#41; Pathological changes in liver tissues was measured by H&#38;E staining&#46; &#40;E and F&#41; Liver fibrosis was measured by Masson staining&#46; &#40;G and H&#41; Collagen deposition in liver tissues was measured by Sirius Red staining&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Hepatic fibrosis &#40;HF&#41; is a repair response of the organism to chronic damage caused by various factors&#46; Abnormal extracellular matrix &#40;ECM&#41; deposition can lead to the damages in structure and function of liver tissues&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">1</span></a> HF is a necessary pathological stage for various chronic liver diseases to develop into liver cirrhosis&#46; If the damaging factors cannot be removed for a long time&#44; HF will develop into liver cirrhosis and finally liver cancer&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">2</span></a> Liver cirrhosis causes 1&#46;2 million deaths worldwide each year&#44; ranking as the 10th leading cause of death among the most developed countries&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">3</span></a> Therefore&#44; exploring the pathogenesis and therapeutic targets of HF is still an important issue to be solved urgently&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">HF is characterized by the activation of hepatic stellate cells &#40;HSCs&#41; and the deposition of ECM&#46; The activation of HSCs is the central link in the occurrence of HF&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">4</span></a> In normal liver tissues&#44; HSCs are in a non-proliferative resting state&#46; During the process of liver injury&#44; HSCs are activated and transformed into myofibroblasts&#44; which in turn participate in HF formation&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">5</span></a> In addition&#44; for activated HSCs&#44; the content of lipid droplets is reduced&#44; but the proliferation capacity of it is enhanced&#46; Activated HSCs also secrete pro-inflammatory and fibrotic factors&#44; and specifically express &#945;-SMA and collagen I&#46;<a class="elsevierStyleCrossRefs" href="#bib0245"><span class="elsevierStyleSup">6&#44;7</span></a> Thus&#44; continuous activation of HSCs eventually leads to the progression of HF and finally liver cirrhosis&#46; Furthermore&#44; the expression of LC3&#44; an autophagy-related gene&#44; in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mouse model is significantly increased&#44; indicating that autophagy is activated in HF&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">8</span></a> It was reported that autophagic activity is significantly enhanced in the HSCs isolated from fibrotic liver tissues of hepatitis B patients&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">9</span></a> HSCs activation is dependent on autophagy&#44; autophagy-mediated lipid degradation could provide energy for HSCs activation&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">10</span></a> The treatment of autophagy inhibitor such as 3-methyladenine &#40;3-MA&#41; could lead to a significant down-regulating in &#945;-SMA and Collagen I expression and induce cell cycle arrest in G2 phase&#44; thereby inhibiting the proliferation and activation of HSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">11</span></a> Both autophagy inhibitor papulomycin and suppression of ATG7 inhibit accumulation of the collagen I in HSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">12</span></a> Therefore&#44; blocking autophagy and HSCs activation may be a therapeutic strategy to control or prevent the progression of HF&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">GATA-binding protein 3 &#40;GATA3&#41; belongs to the GATA family&#44; regulates target molecules through the combination of zinc finger structure and consensus sequence &#91;T&#47;A&#40;GATA&#41;A&#47;G&#93;&#46;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">13</span></a> Previous studies have confirmed that GATA3 expression can be inhibited by some microRNAs &#40;miRNAs&#41;&#46; Conversely&#44; GATA3 has been proved to also regulate expression of multiple miRNAs through acting as transcription factor&#44; such as miR-29b and miR-155&#46;<a class="elsevierStyleCrossRefs" href="#bib0285"><span class="elsevierStyleSup">14&#8211;16</span></a> In addition&#44; it has been reported that GATA3 overexpression aggravates pulmonary fibrogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">17</span></a> GATA3 is also expressed in the activated HSCs and contributes to HF by down-regulating PPAR&#947;&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">18</span></a> Moreover&#44; high mobility group box 1 protein &#40;HMGB1&#41; is a nonhistone nuclear protein that regulates chromatin structure remodeling&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">19</span></a> Accumulating studies have indicated that HMGB1 promotes autophagy and participates in fibrogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">20</span></a> In the current study&#44; we found some miRNAs that maybe regulate HMGB1 expression by using some known websites like TargetScan Human and miRDB&#46;<a class="elsevierStyleCrossRefs" href="#bib0320"><span class="elsevierStyleSup">21&#8211;23</span></a> Among these miRNAs&#44; miR-370 was proved to be an anti-fibrosis molecule&#44; and HMGB1 is a really target of miR-370&#46;<a class="elsevierStyleCrossRefs" href="#bib0335"><span class="elsevierStyleSup">24&#44;25</span></a> Meantime&#44; we found GATA3 has binding sites in the sequence of the miR-370 using JASPAR website &#40;<a href="https://jaspar.genereg.net/">https&#58;&#47;&#47;jaspar&#46;genereg&#46;net&#47;</a>&#41;&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Hence&#44; we wondered to known whether GATA3 regulate the miR-370&#47;HMGB1 signaling pathway to promote the autophagy and activation of HSCs&#46; Here&#44; we investigated the mechanism of action of GATA3 in HF through in vivo and in vitro assays&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Animals</span><p id="par0025" class="elsevierStylePara elsevierViewall">Male C57BL&#47;6 mice &#40;6 weeks old&#44; 20&#8211;22<span class="elsevierStyleHsp" style=""></span>g&#41; were obtained from Shanghai SLAC Laboratory Animal Co&#46;&#44; Ltd &#40;Shanghai&#44; China&#41;&#46; All mice were raised in a controlled humidity &#40;20&#8211;22<span class="elsevierStyleHsp" style=""></span>&#176;C&#41; and temperature &#40;40&#8211;60&#37;&#41;&#44; and a 12<span class="elsevierStyleHsp" style=""></span>h light&#47;dark cycle&#46; All animal protocols were approved by the Animal Care and Use Committee of Nanchang University &#40;No&#46; NCUSYDWFL-2020-149&#41;&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Mouse model of HF</span><p id="par0030" class="elsevierStylePara elsevierViewall">HF mouse model was induced by CCl<span class="elsevierStyleInf">4</span> administration as previous described with minor modification&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">26</span></a> Mice were randomly divided into 2 or 3 groups &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#41;&#46; CCl<span class="elsevierStyleInf">4</span> group&#58; mice were intraperitoneally injected with 10<span class="elsevierStyleHsp" style=""></span>&#956;L&#47;g CCl<span class="elsevierStyleInf">4</span> &#40;20&#37; in olive oil&#41; twice a week for 4 weeks&#46; Control group&#58; mice were intraperitoneally injected with the same dosage of olive oil at the same time intervals&#46; pcDNA-GATA3 group&#58; mice were received with the GATA3 overexpression lentivirus &#40;1<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">10</span><span class="elsevierStyleHsp" style=""></span>PFU&#47;ml&#59; GenePharma&#44; Shanghai&#44; China&#41; through tail vein at 72<span class="elsevierStyleHsp" style=""></span>h before CCl<span class="elsevierStyleInf">4</span> administration&#46; Vector group&#58; mice were injected with the control lentivirus &#40;empty viral vector&#41;&#46; pcDNA-GATA3<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>3-MA group&#58; mice were administrated with the GATA3 overexpression lentivirus through tail vein at 72<span class="elsevierStyleHsp" style=""></span>h before CCl<span class="elsevierStyleInf">4</span> administration and autophagy inhibitor &#40;3-MA&#44; 20<span class="elsevierStyleHsp" style=""></span>mg&#47;kg&#41; at 2<span class="elsevierStyleHsp" style=""></span>h before CCl4 administration through intraperitoneal injection&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall">Mice were intraperitoneally injected with 4&#37; pentobarbital sodium &#40;400<span class="elsevierStyleHsp" style=""></span>mg&#47;kg&#41;&#44; then blood samples were collected from orbital sinus of mice following removal of eyeball&#46; Next&#44; mice were euthanized by cervical dislocation&#46; Liver tissues were separated and fixed with 4&#37; paraformaldehyde for histological analysis&#44; or were snap-frozen with liquid nitrogen and stored at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C for quantitative real-time PCR &#40;qRT-PCR&#41; and western blotting&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Cell culture</span><p id="par0040" class="elsevierStylePara elsevierViewall">Primary mouse hepatic stellate cells &#40;HSCs&#41; were isolated from liver tissues of 8 C57BL&#47;6 mice following previously described&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">27</span></a> Following perfusion in situ&#44; the liver tissues were separated from mice&#44; and sliced into small pieces and digested with Life Technologies Liver Digestion Media &#40;Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41;&#46; The liver digests were filtered through a cell strainer&#44; and washed with Gey&#39;s balanced salt solution &#40;GBSS&#59; Sigma-Aldrich&#44; St&#46; Louis&#44; MO&#44; USA&#41; supplemented with 2<span class="elsevierStyleHsp" style=""></span>mg&#47;mL DNase I &#40;Beyotime&#44; Shanghai&#44; China&#41;&#46; The homogenate was centrifuged at 2000<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span> for 5<span class="elsevierStyleHsp" style=""></span>min to remove the hepatocytes&#46; The cell pellet was resuspended in 15&#37; OptiPrep &#40;Sigma-Aldrich&#41; and subjected to density gradient centrifugation&#46; The final cell pellet was resuspended in Dulbecco&#39;s modified eagle medium &#40;DMEM&#59; Gibco&#44; Grand Island&#44; NY&#44; USA&#41; containing 1&#37; penicillin&#47;streptomycin&#44; and 10&#37; fetal bovine serum &#40;FBS&#44; Gibco&#41;&#44; and incubated on uncoated plastic at 37<span class="elsevierStyleHsp" style=""></span>&#176;C and 5&#37; CO<span class="elsevierStyleInf">2</span> for 24<span class="elsevierStyleHsp" style=""></span>h&#46; After that&#44; the adherent cells were collected by centrifugation&#46; Cell viability was assessed by trypan blue&#44; and cell viability greater than 90&#37; can be used for subsequent experiments&#46; HSCs were treated with 10<span class="elsevierStyleHsp" style=""></span>ng&#47;mL TGF-&#946;1 for 48<span class="elsevierStyleHsp" style=""></span>h as HF cell model&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">28</span></a> HSCs were treated with 10<span class="elsevierStyleHsp" style=""></span>mM 3-MA &#40;autophagy inhibitor&#59; Sigma&#8211;Aldrich&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Cell transfection</span><p id="par0045" class="elsevierStylePara elsevierViewall">The overexpression vectors pcDNA3&#46;1 carrying GATA3 &#40;pcDNA-GATA3&#41;&#44; empty pcDNA3&#46;1 &#40;vector&#41;&#44; miR-370 mimic and mimic NC were obtained from GeneChem &#40;Shanghai&#44; China&#41;&#46; The gene knockdown vectors small interference RNA &#40;siRNA&#41; specifically targeting GATA3 &#40;si-GATA3&#41; or HMGB1 &#40;si-HMGB1&#41;&#44; si-NC&#44; miR-370 inhibitor and inhibitor NC were bought from GeneChem&#46; HSCs were transfected with vectors utilizing Lipofectamine 2000 Transfection Reagent &#40;Invitrogen&#41; at room temperature for 20<span class="elsevierStyleHsp" style=""></span>min&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Histological analysis</span><p id="par0050" class="elsevierStylePara elsevierViewall">Liver tissues were fixed in 4&#37; paraformaldehyde and embedded in paraffin&#46; The paraffin sections were dewaxed with xylene and hydrated with concentration gradient of ethanol&#46; The sections were stained with Hematoxylin and Eosin &#40;H&#38;E&#41; Staining Kit &#40;Beyotime&#41; to examine the histopathologic changes of liver tissues&#46; Szapiel scoring system was used to evaluate the degree of inflammatory response&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">29</span></a> The sections were stained with Masson Trichrome Stain Kit &#40;Solarbio&#44; Beijing&#44; China&#41; to assess hepatic fibrosis&#46; Ashcroft scoring system was utilized to assess the degree of hepatic fibrosis&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">30</span></a> Sections were stained with Sirius Red Stain Kit &#40;Solarbio&#41; to assess collagen deposition in hepatic tissues&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Enzyme-linked immunosorbent assay &#40;ELISA&#41;</span><p id="par0055" class="elsevierStylePara elsevierViewall">After standing for 1&#8211;2<span class="elsevierStyleHsp" style=""></span>h&#44; the blood samples were centrifuged at 3000<span class="elsevierStyleHsp" style=""></span>rpm for 15<span class="elsevierStyleHsp" style=""></span>min&#44; and the serum was collected&#46; The serum levels of alanine aminotransferase &#40;ALT&#41; and aspartate aminotransferase &#40;AST&#41; in mice were detected using Mouse ALT ELISA Kit and Mouse AST ELISA Kit&#46; The absorbance of samples was detected on a Multiskan FC Automatic microplate reader &#40;Thermo Fisher Scientific&#44; Waltham&#44; MA&#44; USA&#41;&#46; A series of concentration gradient standards were used to draw a standard curve&#46; The absorbance value of the sample was plugged into formula of the corresponding standard curve to calculate the concentration of samples&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Quantitative real-time PCR &#40;qRT-PCR&#41;</span><p id="par0060" class="elsevierStylePara elsevierViewall">The qRT-PCR was utilized to measure the gene expression in liver tissues and HSCs&#46; Total RNA was extracted from cells or tissues using Total RNA Extraction Kit &#40;Solarbio&#41;&#44; followed by examination of RNA integrity on 1&#46;5&#37; agarose gel electrophoresis&#46; The cDNA was generated using PrimeScript&#8482; RT reagent Kit &#40;Takara&#44; Tokyo&#44; Japan&#41;&#46; PCR reactions were performed applying TB Green&#174; Premix Ex Taq&#8482; II &#40;Takara&#41;&#46; The amplification protocol was shown as follow&#58; preheating at 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#44; 35 cycles of denaturation at 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; annealing for 30<span class="elsevierStyleHsp" style=""></span>s and extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#46; GAPDH served as a loading control for GATA3 and HMGB1&#46; U6 served as a loading control for miR-370&#46; The primers used in qRT-PCR are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; The data were analyzed using 2<span class="elsevierStyleSup">&#8722;&#916;&#916;CT</span> method for quantification&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Western blotting</span><p id="par0065" class="elsevierStylePara elsevierViewall">Total protein was extracted from liver tissues and HSCs utilizing Total Protein Extraction Kit &#40;Solarbio&#41;&#46; Protein concentration was detected using BCA Protein Assay Kit &#40;Solarbio&#41;&#46; Then&#44; 20<span class="elsevierStyleHsp" style=""></span>&#956;g equal quality samples for each group was separated on 10&#37; or 12&#37; sodium dodecyl sulfate polyacrylamide gel electrophoresis &#40;SDS-PAGE&#41;&#46; The separated proteins were then transferred onto polyvinylidene fluoride &#40;PVDF&#41; membranes&#46; The membranes were incubated with the primary antibodies&#44; GATA3 &#40;&#35;ab199428&#44; 1&#58;1000&#41;&#44; HMGB1 &#40;&#35;ab18256&#59; 1&#58;1000&#41;&#44; LC3 &#40;&#35;ab192890&#59; 1&#58;2000&#41;&#44; Beclin 1 &#40;&#35;ab210498&#59; 1&#58;1000&#41;&#44; &#945;-SMA &#40;&#35;ab5694&#59; 1&#58;1000&#41;&#44; collagen I &#40;&#35;ab270993&#59; 1&#58;1000&#41; or GAPDH &#40;&#35;ab9485&#59; 1&#58;2500&#41; at 4<span class="elsevierStyleHsp" style=""></span>&#176;C overnight&#44; and then incubated with goat anti-rabbit horseradish peroxidase-IgG &#40;&#35;ab6721&#59; 1&#58;2000&#41; at room temperature for 1<span class="elsevierStyleHsp" style=""></span>h&#46; All antibodies were obtained from Abcam &#40;Cambridge&#44; MA&#44; USA&#41;&#46; GAPDH served as internal reference&#46; The gray levels of bands were analyzed by Image J software&#44; and the relative expression levels of proteins in &#8220;Control or vector group&#8221; were normalized to 1&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Autophagy analysis</span><p id="par0070" class="elsevierStylePara elsevierViewall">Autophagy was examined by quantification of fluorescent autophagosomes in HSCs following transfection of GFP-LC3 according to the previous described&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">31</span></a> HSCs were cultured in DMEM at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 24<span class="elsevierStyleHsp" style=""></span>h&#46; HSCs were transfected with lentiviral-mediated GFP-LC3 plasmids utilizing 5<span class="elsevierStyleHsp" style=""></span>mg&#47;mL Polybrene for 6<span class="elsevierStyleHsp" style=""></span>h&#46; The GFP fluorescent puncta was observed under fluorescence microscopy&#46; Five visual fields were randomly selected&#44; ten cells were selected in each field&#44; and the number of GFP fluorescent puncta in each cell&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Luciferase reporter assay</span><p id="par0075" class="elsevierStylePara elsevierViewall">The wild-type &#40;WT&#41;&#47;mutant type &#40;Mut&#41; of pGL3 vector carrying 3&#8242; untranslated regions &#40;UTR&#41; of HMGB1 containing the predicted miR-370 binding sites &#40;pGL3-HMGB1&#41; were synthesized by GeneChem&#46; 293T cells were transfected with the WT&#47;Mut pGL3-HMGB1 and miR-370 mimic or mimic NC&#46; The luciferase activity of the cells was detected using the luciferase assay system &#40;Ambion&#44; Austin&#44; TX&#44; USA&#41;&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Statistical analysis</span><p id="par0080" class="elsevierStylePara elsevierViewall">Each assay was carried out for 3 times&#46; All data reported as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>standard deviation&#46; GraphPad Software &#40;San Diego&#44; CA&#44; USA&#41; was used for statistical analysis&#46; Two-tailed Student&#39;s <span class="elsevierStyleItalic">t</span> test and one-way ANOVA were used to analyze the statistical difference&#46; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 was considered as a significant difference&#46;</p></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Results</span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">GATA3 and HMGB1 were up-regulated but miR-370 was down-regulated in CCl<span class="elsevierStyleInf">4</span>-induced HF mice</span><p id="par0085" class="elsevierStylePara elsevierViewall">In order to investigate the functional role of GATA3 in HF&#44; we constructed HF mouse model by administration of CCl<span class="elsevierStyleInf">4</span>&#46; Serum levels of the ALT and AST in CCl<span class="elsevierStyleInf">4</span>-induced HF mice were examined by ELISA&#46; ALT and AST are biochemical markers of liver damage&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">32</span></a> Serum levels of above markers were increased in CCl<span class="elsevierStyleInf">4</span>-induced HF mice with respect to normal mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A and B&#41;&#46; Then&#44; H&#38;E&#44; Masson and Sirius Red staining were carried out to examine the histopathologic changes of liver tissues&#46; Normal mice exhibited a normal structure of liver tissues&#44; while severe inflammatory cell infiltration and hepatocyte necrosis occurred in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice which have a higher Szapiel score than normal mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>C and D&#41;&#46; Levels of collagenous fiber in the CCl<span class="elsevierStyleInf">4</span>-induced HF mice were more serious than the normal mice&#44; and Ashcroft score of CCl<span class="elsevierStyleInf">4</span>-induced HF mice also higher than that in normal mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>E and F&#41;&#46; Meantime&#44; Sirius Red staining showed serious collagen deposition in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice when contrast to the normal mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>G and H&#41;&#46; Importantly&#44; results of qRT-PCR showed that miR-370 expression was decreased in the CCl<span class="elsevierStyleInf">4</span>-induced HF mice when contrast to normal mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>I&#41;&#46; Western blotting revealed that GATA3 and HMGB1 protein expression were up-regulated in the CCl<span class="elsevierStyleInf">4</span>-induced HF mice &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>J&#8211;L&#41;&#46; Thus&#44; miR-370&#44; GATA3 and HMGB may be associated with the development of HF&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Autophagy and activation of TGF-&#946;1-treated HSCs is positively regulated by GATA3</span><p id="par0090" class="elsevierStylePara elsevierViewall">It was reported that TGF-&#946;1 can be utilized to induce HSCs activation and autophagy&#46;<a class="elsevierStyleCrossRefs" href="#bib0355"><span class="elsevierStyleSup">28&#44;33&#44;34</span></a> Here&#44; our results showed that GATA3 expression was significantly elevated in the TGF-&#946;1-treated HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A and B&#41;&#46; GATA3 has the same tendency of TGF-&#946;1 in facilitating &#945;-SMA and collagen I in HSCs&#44; indicating that GATA3 has the same tendency of TGF-&#946;1 in activating HSC &#40;<a class="elsevierStyleCrossRef" href="#sec0130">Supplementary Fig&#46; 1A and B</a>&#41;&#46; Then&#44; to explore the regulation of GATA3 to TGF-&#946;1-induced HSCs autophagy&#44; GATA3 was overexpressed or knocked down in TGF-&#946;1-treated HSCs&#46; mRNA and protein expression of GATA3 was enhanced in TGF-&#946;1-stimulated HSCs by GATA3 overexpression vector transfection&#44; or was silenced by si-GATA3 transfection &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C&#8211;E&#41;&#46; Moreover&#44; we examined the impacts of GATA3 on HSCs autophagy and activation by western blotting&#46; Expression of autophagy markers like LC3-II&#47;LC3-I and Beclin 1 was boosted by GATA3 overexpression and was declined by GATA3 silencing in the TGF-&#946;1-induced HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>F and G&#41;&#46; Consistently&#44; expression of HSCs activation markers like &#945;-SMA and collagen I was also obviously increased by GATA3 overexpression and was inhibited by GATA3 deficiency in the TGF-&#946;1-induced HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>H and I&#41;&#46; Overall&#44; TGF-&#946;1-induced autophagy and activation in HSCs was positively regulated by GATA3&#46; Based on the above results&#44; we thought that whether GATA3 regulates the activation of HSCs through affecting autophagy&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">GATA3 regulated TGF-&#946;1-induced HSCs activation via activating autophagy</span><p id="par0095" class="elsevierStylePara elsevierViewall">To verify the hypothesis&#44; we used 10<span class="elsevierStyleHsp" style=""></span>&#956;M of 3-MA&#44; an inhibitor of autophagy&#44; to treat the activated HSCs&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A and B&#44; GATA3 overexpression elevated number of punctate GFP-LC3 in the TGF-&#946;1-treated HSCs&#44; which was partly rescued by 3-MA treatment&#46; The promotion of GATA3 to &#945;-SMA and collagen I expression in the TGF-&#946;1-induced HSCs also was partly rescued by 3-MA treatment &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>C and D&#41;&#46; Thus&#44; these findings indicated that GATA3 overexpression activated HSCs by promoting autophagy&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">GATA3 aggravated hepatic injury through activating autophagy</span><p id="par0100" class="elsevierStylePara elsevierViewall">Finally&#44; we verified the functions and action mechanism of GATA3 in hepatic fibrosis of HF model mouse&#44; GATA3-overexpressed lentivirus and&#47;or 3-MA were used to administrate the mouse&#46; Our data demonstrated that GATA3 promoted LC3II&#47;I and Beclin 1 expression in liver tissues of the HF mouse model&#44; which was partly rescued by autophagy inhibition &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>A and B&#41;&#46; Importantly&#44; GATA3-induced liver injury and inflammatory cells infiltration was attenuated with the administration of autophagy inhibitor 3-MA &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>C and D&#41;&#46; GATA3-resulted hepatic fibrosis &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>E and F&#41; and collagen deposition &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>G and H&#41; were also attenuated by autophagy inhibition&#46; Overall&#44; GATA3 could aggravated hepatic fibrosis through activating autophagy&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">GATA3 facilitated HMGB1 expression through limiting miR-370 transcription in the TGF-&#946;1-induced HSCs</span><p id="par0105" class="elsevierStylePara elsevierViewall">To verify whether GATA3 regulates TGF-&#946;1-induced HSCs activation by targeting miR-370 and HMGB1&#44; we firstly determined expression of miR-370 and HMGB1 in the cells&#46; Our data indicated that miR-370 expression was decreased but HMGB1 was increased in TGF-&#946;1-stimulated HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A&#8211;C&#41;&#46; Subsequently&#44; we estimated the regulation of GATA3 on miR-370 and HMGB1 expression in the TGF-&#946;1-induced HSCs&#46; Results uncovered that GATA3 overexpression suppressed miR-370 expression&#44; but enhanced HMGB1 mRNA and protein expression in the TGF-&#946;1-induced HSCs&#46; GATA3 deficiency led to an opposite result &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>D&#8211;G&#41;&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia><p id="par0110" class="elsevierStylePara elsevierViewall">As a transcription factor&#44; GATA3 could affect the expression of its target genes through binding to promotor region&#46; Here&#44; the binding sites between GATA3 and promotor of miR-370 was predicted using JAPSAR database &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>H&#41;&#46; The results of ChIP and luciferase reporter assay revealed that GATA3 bound with miR-370 gene promoter&#44; thus to impede miR-370 expression &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>I and J&#41;&#46; In addition&#44; luciferase reporter assay demonstrated that luciferase activity was severely decreased in 293T cells in the presence of miR-370 mimic and WT pGL3-HMGB1&#44; indicating that miR-370 interacted with HMGB1 3&#8242;-UTR &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>N and O&#41;&#46; Subsequently&#44; our data confirmed that overexpression of miR-370 suppressed the expression of HMGB1 mRNA and protein&#44; and that silencing of miR-370 facilitated HMGB1 mRNA and protein expression in the TGF-&#946;1-induced HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>K and M&#41;&#46; In addition&#44; GATA3 overexpression-induced up-regulation of HMGB1 was partly abolished by transfection of miR-370 mimic in the TGF-&#946;1-induced HSCs &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>P&#8211;R&#41;&#46; In short&#44; these results revealed that GATA3 suppressed miR-370 expression and thus to elevate HMGB1 expression in the TGF-&#946;1-induced HSCs&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370&#47;HMGB1 axis</span><p id="par0115" class="elsevierStylePara elsevierViewall">Subsequently&#44; we explored the regulatory mechanism of GATA3 on TGF-&#946;1-induced HSCs autophagy and activation&#46; Number of punctate GFP-LC3 in TGF-&#946;1-induced HSCs was increased by GATA3 overexpression&#46; However&#44; the promotion of GATA3 to HSCs autophagy was reversed by miR-370 overexpression or HMGB1 knockdown &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>A and B&#41;&#46; The promotion of GATA3 to LC3-II&#47;LC3-I and Beclin 1 expression also was rescued by miR-370 overexpression or HMGB1 silencing &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>C and D&#41;&#46; Consistently&#44; &#945;-SMA and collagen I expression was up-regulated in TGF-&#946;1-induced HSCs following GATA3 increasing&#44; but miR-370 overexpression or HMGB1 deficiency reversed the up-regulation of them in the cells &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>E and F&#41;&#46; To sum up&#44; GATA3 overexpression promoted TGF-&#946;1-induced HSCs autophagy and activation by regulating miR-370&#47;HMGB1 axis&#46;</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Discussion</span><p id="par0120" class="elsevierStylePara elsevierViewall">GATA3 could promote proliferation and differentiation of various tissues and cells&#44; such as lymphocytes&#44; thymocytes&#44; sympathetic nervous system and hair follicles&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">35</span></a> GATA3 also participates in the progression of various diseases&#46; For instance&#44; GATA3 deficiency activates epithelial-mesenchymal transition to induce poorly-differentiated mammary tumors in mice&#44; thus promotes the initiating and metastatic potential of human breast cancer&#46;<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">36</span></a> PM2&#46;5 exposure upsets the balance between Th1 and Th2 by promoting GATA3 expression and inhibiting Runx3 expression&#44; thereby evoking the allergic airway inflammation response in the asthmatic mice&#46;<a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">37</span></a> GATA3 expression is decreased in hepatocellular carcinoma&#44; and closely associated with the tumor size&#44; tumor node metastasis stage and lymph node metastasis&#44; it represses the malignant phenotypes of hepatocellular carcinoma by regulating slug expression&#46;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">38</span></a> In the current study&#44; we constructed HF mouse model by administration of CCl<span class="elsevierStyleInf">4</span>&#44; and determined the functional role of GATA3 in HF&#46; CCl<span class="elsevierStyleInf">4</span>-induced HF mice displayed an increase in serum ALT and AST levels&#44; severe damage in liver tissues and hepatic fibrosis&#46; GATA3 was highly expressed in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and in the TGF-&#946;1-treated HSCs&#46; These data suggested that GATA3 may take part in HF development&#46; Previous study has confirmed that adipocyte-derived hormone leptin enhances GATA3 expression to play a unique role in accelerating liver fibrosis&#44;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">18</span></a> which is consistent with our results&#46; Moreover&#44; our data demonstrated that GATA3 activated autophagy in TGF-&#946;1-induced HSCs by elevating LC3-II&#47;LC3-I ratio and Beclin 1 expression&#46; The expression of &#945;-SMA and collagen I in TGF-&#946;1-induced HSCs were also enhanced following GATA3 up-regulation&#46; &#945;-SMA and collagen I are biomarkers for the activated HSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">6</span></a> In activated HSCs&#44; GATA3 positively regulated cell autophagy and activation&#46; In addition&#44; 3-MA&#44; an inhibitor of autophagy&#44; treatment could reverse GATA3-mediated activation of HSCs by inhibiting autophagy&#46; In vivo experiments&#44; GATA3 significantly aggravated liver damage and fibrogenesis&#44; which was partly rescued by autophagy inhibitor administration&#46; All results indicated that GATA3 overexpression activated HSCs by accelerating autophagy&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">HMGB1 takes part in the development of various liver diseases&#46; HMGB1 has an irreplaceable role in ductular reaction&#44; and it promotes tumor progression in autophagy-deficient livers&#46;<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">39</span></a> HMGB1 is highly expressed in the liver tissues of non-alcoholic fatty liver disease mouse model and patient and is associated with the disease-related hepatic fibrogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0415"><span class="elsevierStyleSup">40</span></a> Li et al&#46; have confirmed that HMGB1 induces autophagy and activation of HSCs through regulating ERK&#47;JNK&#47;MAPK and mTOR&#47;STAT3 signaling pathways&#46;<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">41</span></a> The present study showed that HMGB1 was highly expressed in liver tissues of the HF model moues and the TGF-&#946;1-treated primary HSCs&#46; GATA3 increased HMGB1 expression in the activated HSCs&#46; Moreover&#44; miR-370 inhibited HMGB1 expression in activated HSCs by interacting with its mRNA 3&#8242;-UTR&#46; GATA3 overexpression-induced autophagy and activation of HSCs was abrogated by HMGB1 knockdown&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">The miR-370 has been reported to exert an anti-fibrotic effect by maintaining the quiescent phenotype of normal HSCs&#44; inhibiting proliferation and activation of HSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0425"><span class="elsevierStyleSup">42</span></a> Previous study has confirmed that miR-370 expression is decreased in fibrotic liver tissues of rats and TGF-&#946;1-treated HSCs&#44; and miR-370 up-regulation inhibits activation of HSCs and attenuates liver fibrosis in rats by inhibiting SMO expression&#46;<a class="elsevierStyleCrossRef" href="#bib0430"><span class="elsevierStyleSup">43</span></a> Our data also found that miR-370 was down-regulated in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and the TGF-&#946;1-treated primary HSCs&#46; miR-370 expression was suppressed by GATA3 in the activated HSCs&#46; Importantly&#44; GATA3 bound with the gene promoter of miR-370&#44; thus to inhibit miR-370 expression&#46; Overexpression of miR-370 also could reverse GATA3 overexpression-induced autophagy and activation of TGF-&#946;1-induced HSCs&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">In conclusion&#44; this work demonstrates that GATA3 regulates miR-370&#47;HMGB1 signaling pathway to promote autophagy and activation of HSCs&#44; which contributes to accelerate HF&#46; Thus&#44; this work suggests that GATA3 may be a potential target for prevention and treatment of HF&#46;</p></span><span id="sec0110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Authors&#8217; contributions</span><p id="par0140" class="elsevierStylePara elsevierViewall">Z&#46;X&#46; conceived and designed research&#59; Y&#46;L&#46;&#44; P&#46;X&#46; and S&#46;K&#46; performed experiments&#59; Y&#46;L&#46; analyzed data&#59; P&#46;X&#46; interpreted results of experiments&#59; S&#46;K&#46; prepared figures&#59; Z&#46;X&#46; drafted manuscript&#59; Z&#46;X&#46; edited and revised manuscript&#59; all authors approved final version of manuscript&#46;</p></span><span id="sec0115" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Ethical considerations</span><p id="par0145" class="elsevierStylePara elsevierViewall">The work described has been carried out in accordance with The Code of Ethics of the World Medical Association &#40;Declaration of Helsinki&#41;&#46; This research was approved by the Animal Care and Use Committee of Nanchang University &#40;No&#46; NCUSYDWFL-2020-149&#41;&#46;</p></span><span id="sec0120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Funding</span><p id="par0150" class="elsevierStylePara elsevierViewall">This study was supported by the <span class="elsevierStyleGrantSponsor" id="gs1">National Natural Science Foundation of China</span> &#91;Grant No&#46; <span class="elsevierStyleGrantNumber" refid="gs1">81860119&#59; 82260131</span>&#93;&#59; <span class="elsevierStyleGrantSponsor" id="gs2">Key Research and Development Program of Jiangxi Provincial Department of Science and Technology</span> &#91;Grant No&#46; <span class="elsevierStyleGrantNumber" refid="gs2">20203BBG73044</span>&#93;&#59; <span class="elsevierStyleGrantSponsor" id="gs3">Natural Science Foundation of Jiangxi Province of China</span> &#91;Grant No&#46; <span class="elsevierStyleGrantNumber" refid="gs3">20212ACB206017</span>&#93;&#59; <span class="elsevierStyleGrantSponsor" id="gs4">Science and Technology Project Foundation of Education Department of Jiangxi Province&#44; China</span> &#91;Grant No&#46; <span class="elsevierStyleGrantNumber" refid="gs4">GJJ200193</span>&#93;&#46;</p></span><span id="sec0125" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Conflict of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">None&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres2136078"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1813941"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres2136077"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst1025"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst1030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst1035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst1040"
              "titulo" => "Conclusiones"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1813942"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:11 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Animals"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Mouse model of HF"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Cell culture"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Cell transfection"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Histological analysis"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Enzyme-linked immunosorbent assay &#40;ELISA&#41;"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Quantitative real-time PCR &#40;qRT-PCR&#41;"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Western blotting"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Autophagy analysis"
            ]
            9 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Luciferase reporter assay"
            ]
            10 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0070"
          "titulo" => "Results"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "GATA3 and HMGB1 were up-regulated but miR-370 was down-regulated in CCl-induced HF mice"
            ]
            1 => array:2 [
              "identificador" => "sec0080"
              "titulo" => "Autophagy and activation of TGF-&#946;1-treated HSCs is positively regulated by GATA3"
            ]
            2 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "GATA3 regulated TGF-&#946;1-induced HSCs activation via activating autophagy"
            ]
            3 => array:2 [
              "identificador" => "sec0090"
              "titulo" => "GATA3 aggravated hepatic injury through activating autophagy"
            ]
            4 => array:2 [
              "identificador" => "sec0095"
              "titulo" => "GATA3 facilitated HMGB1 expression through limiting miR-370 transcription in the TGF-&#946;1-induced HSCs"
            ]
            5 => array:2 [
              "identificador" => "sec0100"
              "titulo" => "GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370&#47;HMGB1 axis"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0105"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0110"
          "titulo" => "Authors&#8217; contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0115"
          "titulo" => "Ethical considerations"
        ]
        10 => array:2 [
          "identificador" => "sec0120"
          "titulo" => "Funding"
        ]
        11 => array:2 [
          "identificador" => "sec0125"
          "titulo" => "Conflict of interest"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-12-07"
    "fechaAceptado" => "2023-05-10"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1813941"
          "palabras" => array:5 [
            0 => "Hepatic fibrosis"
            1 => "GATA3"
            2 => "HMGB1"
            3 => "Hepatic stellate cell"
            4 => "Autophagy"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1813942"
          "palabras" => array:5 [
            0 => "Fibrosis hep&#225;tica"
            1 => "GATA3"
            2 => "HMGB1"
            3 => "C&#233;lulas hep&#225;ticas estrelladas"
            4 => "Autofagia"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Hepatic fibrosis &#40;HF&#41; is a common result of the repair process of various chronic liver diseases&#46; Hepatic stellate cells &#40;HSCs&#41; activation is the central link in the occurrence of HF&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">ELISA and histological analysis were performed to detect the pathological changes of liver tissues&#46; In vitro&#44; HSCs were treated with TGF-&#946;1 as HF cell model&#46; Combination of GATA-binding protein 3 &#40;GATA3&#41; and miR-370 gene promoter was ensured by ChIP and luciferase reporter assay&#46; Autophagy was monitored by observing the GFP-LC3 puncta formation&#46; The interaction between miR-370 and high mobility group box 1 protein &#40;HMGB1&#41; was verified by luciferase reporter assay&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">CCl<span class="elsevierStyleInf">4</span>-induced HF mice exhibited an increase of ALT and AST&#44; and severe damage and fibrosis of liver tissues&#46; GATA3 and HMGB1 were up-regulated&#44; and miR-370 was down-regulated in CCl<span class="elsevierStyleInf">4</span>-induced HF mice and activated HSCs&#46; GATA3 enhanced expression of the autophagy-related proteins and activation markers in the activated HSCs&#46; Inhibition of autophagy partly reversed GATA3-induced activation of HSCs and the promotion of GATA3 to hepatic fibrosis&#46; Moreover&#44; GATA3 suppressed miR-370 expression via binding with its promotor&#44; and enhanced HMGB1 expression in HSCs&#46; Increasing of miR-370 inhibited HMGB1 expression by directly targeting its mRNA 3&#8242;-UTR&#46; The promotion of GATA3 to TGF-&#946;1-induced HSCs autophagy and activation was abrogated by miR-370 up-regulation or HMGB1 knockdown&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">This work demonstrates that GATA3 promotes autophagy and activation of HSCs by regulating miR-370&#47;HMGB1 signaling pathway&#44; which contributes to accelerate HF&#46; Thus&#44; this work suggests that GATA3 may be a potential target for prevention and treatment of HF&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusions"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst1025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect1035">Introducci&#243;n</span><p id="spar1030" class="elsevierStyleSimplePara elsevierViewall">La fibrosis hep&#225;tica &#40;IC&#41; es un resultado com&#250;n del proceso de reparaci&#243;n de diversas enfermedades hep&#225;ticas cr&#243;nicas&#46; La activaci&#243;n de las c&#233;lulas estrelladas hep&#225;ticas &#40;HSC&#41; es el v&#237;nculo central en la aparici&#243;n de insuficiencia card&#237;aca&#46;</p></span> <span id="abst1030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect1040">M&#233;todos</span><p id="spar1035" class="elsevierStyleSimplePara elsevierViewall">Se realizaron ELISA y an&#225;lisis histol&#243;gicos para detectar los cambios patol&#243;gicos de los tejidos hep&#225;ticos&#46; In vitro&#44; las HSC se trataron con TGF-1 como modelo de c&#233;lulas HF&#46; La combinaci&#243;n de la prote&#237;na 3 de uni&#243;n a GATA &#40;GATA3&#41; y el promotor del gen miR-370 se asegur&#243; mediante el ensayo ChIP y el indicador de luciferasa&#46; La autofagia se control&#243; observando la formaci&#243;n de puntos GFP-LC3&#46; La interacci&#243;n entre miR-370 y la prote&#237;na de la caja 1 del grupo de alta movilidad &#40;HMGB1&#41; se verific&#243; mediante el ensayo indicador de luciferasa&#46;</p></span> <span id="abst1035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect1045">Resultados</span><p id="spar1040" class="elsevierStyleSimplePara elsevierViewall">Los ratones con HF inducida por CCl4 exhibieron un aumento de ALT y AST&#44; y da&#241;o severo y fibrosis de los tejidos hep&#225;ticos&#46; GATA3 y HMGB1 estaban regulados positivamente&#44; y miR-370 estaba regulado negativamente en ratones HF inducidos por CCl4 y HSC activadas&#46; GATA3 mejor&#243; la expresi&#243;n de las prote&#237;nas relacionadas con la autofagia y los marcadores de activaci&#243;n en las HSC activadas&#46; La inhibici&#243;n de la autofagia revirti&#243; parcialmente la activaci&#243;n de HSC inducida por GATA3 y la promoci&#243;n de GATA3 a la fibrosis hep&#225;tica&#46; Adem&#225;s&#44; GATA3 suprimi&#243; la expresi&#243;n de miR-370 mediante la uni&#243;n con su promotor y mejor&#243; la expresi&#243;n de HMGB1 en HSC&#46; El aumento de miR-370 inhibi&#243; la expresi&#243;n de HMGB1 al apuntar directamente a su ARNm 3 -UTR&#46; La promoci&#243;n de GATA3 a la autofagia y activaci&#243;n de las HSC inducidas por TGF-1 fue anulada por la regulaci&#243;n positiva de miR-370 o la eliminaci&#243;n de HMGB1&#46;</p></span> <span id="abst1040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect1050">Conclusiones</span><p id="spar1045" class="elsevierStyleSimplePara elsevierViewall">Este trabajo demuestra que GATA3 promueve la autofagia y la activaci&#243;n de las HSC mediante la regulaci&#243;n de la v&#237;a de se&#241;alizaci&#243;n de miR-370&#47;HMGB1&#44; lo que contribuye para acelerar la HF&#46; Por lo tanto&#44; este trabajo sugiere que GATA3 puede ser un objetivo potencial para la prevenci&#243;n y el tratamiento de la insuficiencia card&#237;aca&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst1025"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst1030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst1035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst1040"
            "titulo" => "Conclusiones"
          ]
        ]
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0165" class="elsevierStylePara elsevierViewall">The following are the supplementary data to this article&#58;<elsevierMultimedia ident="fig0035"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0135"
          ]
        ]
      ]
    ]
    "multimedia" => array:8 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2627
            "Ancho" => 3008
            "Tamanyo" => 874443
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Expression of miR-370&#44; GATA3 and HMGB1 in the CCl<span class="elsevierStyleInf">4</span>-induced HF mice&#46; Serum levels of ALT &#40;A&#41; and AST &#40;B&#41; of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and normal mice were detected by ELISA&#46; &#40;C&#44; D&#41; Histopathologic changes in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and normal mice were assessed by H&#38;E staining&#46; &#40;E&#44; F&#41; Hepatic fibrosis were examined by Masson staining&#46; &#40;G&#44; H&#41; Collagen deposition in liver tissues were examined by using Sirius Red staining&#46; &#40;I&#41; miR-370 expression in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and normal mice was assessed by qRT-PCR&#46; &#40;J&#8211;L&#41; Protein expression of GATA3 and HMGB1 in liver tissues of the CCl<span class="elsevierStyleInf">4</span>-induced HF mice and normal mice was assessed by western blotting analysis&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#44; and &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3315
            "Ancho" => 2925
            "Tamanyo" => 542088
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Regulation of GATA3 on autophagy and activation in the TGF-&#946;1-treated primary HSCs&#46; &#40;A and B&#41; Western blotting was used to assess protein expression of GATA3 in TGF-&#946;1-treated HSCs&#46; Next&#44; HSCs were transfected with pcDNA-GATA3&#44; vector&#44; si-GATA3 or si-NC&#44; followed by TGF-&#946;1 treatment&#46; qRT-PCR &#40;C&#41; and western blotting &#40;D and E&#41; were performed to detect mRNA and protein expression of GATA3 in the HSCs&#46; &#40;F and G&#41; Protein expression of LC3-II&#47;LC3-I and Beclin 1 in the HSCs was examined by western blotting&#46; &#40;H and I&#41; Protein expression of &#945;-SMA and collagen I in the HSCs was examined by western blotting&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2031
            "Ancho" => 2508
            "Tamanyo" => 273405
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Autophagy silencing inhibited TGF-&#946;1-induced HSCs activation&#46; HSCs were transfected with pcDNA-GATA3 or vector&#44; followed by TGF-&#946;1 alone or in combination with 10<span class="elsevierStyleHsp" style=""></span>&#956;M of 3-MA treatment&#46; &#40;A and B&#41; Autophagosome &#40;GFP-LC3 punctate&#41; number in the HSCs was examined under fluorescence microscopy&#46; &#40;C and D&#41; Protein expression of &#945;-SMA and collagen I in the HSCs was examined by western blotting&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 3021
            "Ancho" => 2925
            "Tamanyo" => 1080664
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">GATA3 aggravated fibrogenesis through activating autophagy in HF model mice&#46; HF model mice were administrated with the GATA3 overexpression lentivirus through tail vein and autophagy inhibitor 3-MA through intraperitoneal injection&#46; &#40;A and B&#41; Expression of LC3II&#47;I and Beclin 1 was measured by western blotting&#46; &#40;C and D&#41; Pathological changes in liver tissues was measured by H&#38;E staining&#46; &#40;E and F&#41; Liver fibrosis was measured by Masson staining&#46; &#40;G and H&#41; Collagen deposition in liver tissues was measured by Sirius Red staining&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 2548
            "Ancho" => 3341
            "Tamanyo" => 644220
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">GATA3 enhanced HMGB1 expression by targeting miR-370 in the TGF-&#946;1-induced HSCs&#46; &#40;A&#41; qRT-PCR was performed to detect miR-370 expression in the TGF-&#946;1-treated and &#8211;untreated HSCs&#46; &#40;B and C&#41; Western blotting was carried out to measure expression of HMGB1 in the TGF-&#946;1-treated and -untreated HSCs&#46; After that&#44; HSCs were transfected with pcDNA-GATA3&#44; vector&#44; si-GATA3 or si-NC&#44; followed by TGF-&#946;1 treatment&#46; &#40;D&#41; qRT-PCR was used to assess the expression of miR-370 in HSCs&#46; qRT-PCR &#40;E&#41; and western blotting &#40;F and G&#41; were performed to detect the mRNA and protein expression of HMGB1 in the HSCs&#46; &#40;H&#41; The binding sites between GATA3 and miR-370 was analyzed utilizing JAPSAR database&#46; &#40;I and J&#41; Combination of GATA3 and miR-370 gene promoter was determined utilizing ChIP assay and luciferase reporter assay&#46; HSCs were transfected with miR-370 mimic&#44; mimic NC&#44; miR-370 inhibitor or inhibitor NC&#44; followed by TGF-&#946;1 treatment&#46; qRT-PCR &#40;K&#41; and western blotting &#40;L and M&#41; were performed to detect the mRNA and protein expression of HMGB1 in the HSCs&#46; &#40;N and O&#41; The interaction between miR-370 and HMGB1 mRNA 3&#8242;-UTR was verified by Luciferase reporter assay&#46; HSCs were co-transfected pcDNA-GATA3 or vector with miR-370 mimic or mimic NC&#44; followed by TGF-&#946;1 treatment&#46; qRT-PCR &#40;P&#41; and western blotting analysis &#40;Q and R&#41; were performed to detect the mRNA and protein expression of HMGB1 in the HSCs&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "fig0030"
        "etiqueta" => "Figure 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1509
            "Ancho" => 2508
            "Tamanyo" => 320646
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">GATA3 overexpression promoted HSCs autophagy and activation by regulating miR-370&#47;HMGB1&#46; HSCs were co-transfected pcDNA-GATA3 or vector with miR-370 mimic or si-HMGB1&#44; followed by TGF-&#946;1 treatment&#46; &#40;A and B&#41; Autophagy in HSCs was examined under fluorescence microscopy&#46; &#40;C&#8211;F&#41; Protein expression of LC3-II&#44; LC3-I&#44; Beclin 1&#44; &#945;-SMA and collagen I in the HSCs was examined by western blotting&#46; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#44; all experiments were repeated for three time at least&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer sequence &#40;5&#8242;-3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GATA3-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGTGGACGTACTTTTTAACATCGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GATA3-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCCTGACGGAGTTTCCGTAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">miR-370-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCCTGCTGGGGTGGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">miR-370-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTCAACTGGTGTCGTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB1-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGGATCCCAATGCACCCAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB1-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCAACATCACCAATGGACAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTCGCTTCGGCAGCACA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AACGCTTCACGAATTTGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTTCCTACCCCCAATGTGTCCGTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTGGTCCTCAGTGTAGCCCAAGATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3521624.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Sequences of primers used in qRT-PCR&#46;</p>"
        ]
      ]
      7 => array:5 [
        "identificador" => "fig0035"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "mmc1.jpeg"
            "Alto" => 675
            "Ancho" => 2500
            "Tamanyo" => 105001
          ]
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:43 [
            0 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatic fibrosis&#58; emerging therapies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "S&#46;L&#46; Friedman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1159/000374098"
                      "Revista" => array:6 [
                        "tituloSerie" => "Dig Dis"
                        "fecha" => "2015"
                        "volumen" => "33"
                        "paginaInicial" => "504"
                        "paginaFinal" => "507"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26159266"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Liver fibrosis&#58; pathophysiology&#44; pathogenetic targets and clinical issues"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Parola"
                            1 => "M&#46; Pinzani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.mam.2018.09.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Aspects Med"
                        "fecha" => "2019"
                        "volumen" => "65"
                        "paginaInicial" => "37"
                        "paginaFinal" => "55"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30213667"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immune dysfunction and albumin-related immunity in liver cirrhosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "B&#46; Wilde"
                            1 => "A&#46; Katsounas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Mediat Inflamm"
                        "fecha" => "2019"
                        "volumen" => "2019"
                        "paginaInicial" => "7537649"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mechanisms of hepatic stellate cell activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T&#46; Tsuchida"
                            1 => "S&#46; Friedman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrgastro.2017.38"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Gastroenterol Hepatol"
                        "fecha" => "2017"
                        "volumen" => "14"
                        "paginaInicial" => "397"
                        "paginaFinal" => "411"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28487545"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Metabolic signature of hepatic fibrosis&#58; from individual pathways to systems biology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Chang"
                            1 => "S&#46; Yang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/cells8111423"
                      "Revista" => array:5 [
                        "tituloSerie" => "Cells"
                        "fecha" => "2019"
                        "volumen" => "8"
                        "paginaInicial" => "1423"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31726658"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR 21 promotes &#945;-SMA and collagen I expression in hepatic stellate cells via the Smad7 signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "R&#46; Fu"
                            1 => "D&#46; Hu"
                            2 => "Y&#46; Hu"
                            3 => "L&#46; Hong"
                            4 => "Q&#46; Sun"
                            5 => "J&#46; Ding"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Med Rep"
                        "fecha" => "2017"
                        "volumen" => "16"
                        "paginaInicial" => "4327"
                        "paginaFinal" => "4333"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methyl ferulic acid attenuates liver fibrosis and hepatic stellate cell activation through the TGF-&#946;1&#47;Smad and NOX4&#47;ROS pathways"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q&#46; Cheng"
                            1 => "C&#46; Li"
                            2 => "C&#46; Yang"
                            3 => "Y&#46; Zhong"
                            4 => "D&#46; Wu"
                            5 => "L&#46; Shi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cbi.2018.12.006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chem Biol Interact"
                        "fecha" => "2019"
                        "volumen" => "299"
                        "paginaInicial" => "131"
                        "paginaFinal" => "139"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30543783"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chloroquine improved carbon tetrachloride-induced liver fibrosis through its inhibition of the activation of hepatic stellate cells&#58; role of autophagy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; He"
                            1 => "B&#46; Wang"
                            2 => "J&#46; Yang"
                            3 => "Y&#46; Zhuang"
                            4 => "L&#46; Wang"
                            5 => "X&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1248/bpb.b14-00297"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biol Pharm Bull"
                        "fecha" => "2014"
                        "volumen" => "37"
                        "paginaInicial" => "1505"
                        "paginaFinal" => "1509"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25177034"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "V&#46; Hern&#225;ndez-Gea"
                            1 => "Z&#46; Ghiassi-Nejad"
                            2 => "R&#46; Rozenfeld"
                            3 => "R&#46; Gordon"
                            4 => "M&#46; Fiel"
                            5 => "Z&#46; Yue"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1053/j.gastro.2011.12.044"
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "2012"
                        "volumen" => "142"
                        "paginaInicial" => "938"
                        "paginaFinal" => "946"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22240484"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A role for autophagy during hepatic stellate cell activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Thoen"
                            1 => "E&#46; Guimar&#227;es"
                            2 => "L&#46; Doll&#233;"
                            3 => "I&#46; Mannaerts"
                            4 => "M&#46; Najimi"
                            5 => "E&#46; Sokal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2011.07.010"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2011"
                        "volumen" => "55"
                        "paginaInicial" => "1353"
                        "paginaFinal" => "1360"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21803012"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0090429521011997"
                          "estado" => "S300"
                          "issn" => "00904295"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effect of autophagy inhibitor 3-methyladenine on proliferation and activation of hepatic stellate cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Liu"
                            1 => "Y&#46; He"
                            2 => "J&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Chin J Cell Mol Immunol"
                        "fecha" => "2013"
                        "volumen" => "29"
                        "paginaInicial" => "809"
                        "paginaFinal" => "812"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Phospholipase D1 decreases type I collagen levels in hepatic stellate cells via induction of autophagy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Seo"
                            1 => "B&#46; Jang"
                            2 => "Y&#46; Jung"
                            3 => "E&#46; Lee"
                            4 => "H&#46; Kim"
                            5 => "J&#46; Jeon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2014.04.149"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2014"
                        "volumen" => "449"
                        "paginaInicial" => "38"
                        "paginaFinal" => "43"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24802400"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The multi-faceted role of Gata3 in developmental haematopoiesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "N&#46; Zaidan"
                            1 => "K&#46; Ottersbach"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1098/rsob.180152"
                      "Revista" => array:5 [
                        "tituloSerie" => "Open Biol"
                        "fecha" => "2018"
                        "volumen" => "8"
                        "paginaInicial" => "180152"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30463912"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "GATA3 inhibits viral infection by promoting microRNA-155 expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Li"
                            1 => "A&#46; Haiyilati"
                            2 => "L&#46; Zhou"
                            3 => "J&#46; Chen"
                            4 => "Y&#46; Wang"
                            5 => "L&#46; Gao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/jvi.01888-21"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Virol"
                        "fecha" => "2022"
                        "volumen" => "96"
                        "paginaInicial" => "e0188821"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35319228"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S147020452300061X"
                          "estado" => "S300"
                          "issn" => "14702045"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-374b targets GATA3 to promote progression and development of glioblastoma via regulating SEMA3B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "J&#46; Gao"
                            1 => "S&#46; Bai"
                            2 => "Y&#46; Wang"
                            3 => "S&#46; Zhao"
                            4 => "Z&#46; He"
                            5 => "R&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4149/neo_2018_180830N659"
                      "Revista" => array:6 [
                        "tituloSerie" => "Neoplasma"
                        "fecha" => "2019"
                        "volumen" => "66"
                        "paginaInicial" => "543"
                        "paginaFinal" => "554"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30868892"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "GATA3 suppresses metastasis and modulates the tumour microenvironment by regulating microRNA-29b expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "J&#46; Chou"
                            1 => "J&#46;H&#46; Lin"
                            2 => "A&#46; Brenot"
                            3 => "J&#46;W&#46; Kim"
                            4 => "S&#46; Provot"
                            5 => "Z&#46; Werb"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ncb2672"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Cell Biol"
                        "fecha" => "2013"
                        "volumen" => "15"
                        "paginaInicial" => "201"
                        "paginaFinal" => "213"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23354167"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Overexpression of the transcription factor GATA-3 enhances the development of pulmonary fibrosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Kimura"
                            1 => "Y&#46; Ishii"
                            2 => "K&#46; Yoh"
                            3 => "Y&#46; Morishima"
                            4 => "T&#46; Iizuka"
                            5 => "T&#46; Kiwamoto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Am J Pathol"
                        "fecha" => "2006"
                        "volumen" => "169"
                        "paginaInicial" => "96"
                        "paginaFinal" => "104"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "GATA binding protein 3 is correlated with leptin regulation of PPAR&#947;1 in hepatic stellate cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Guan"
                            1 => "F&#46; Cheng"
                            2 => "H&#46; Wu"
                            3 => "Q&#46; Cao"
                            4 => "X&#46; Zhu"
                            5 => "Y&#46; Fan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jcmm.13002"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Cell Mol Med"
                        "fecha" => "2017"
                        "volumen" => "21"
                        "paginaInicial" => "568"
                        "paginaFinal" => "578"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27709831"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Synthesized HMGB1 peptide attenuates liver inflammation and suppresses fibrosis in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Nojiri"
                            1 => "A&#46; Tsuchiya"
                            2 => "K&#46; Natsui"
                            3 => "S&#46; Takeuchi"
                            4 => "T&#46; Watanabe"
                            5 => "Y&#46; Kojima"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s41232-021-00177-4"
                      "Revista" => array:5 [
                        "tituloSerie" => "Inflamm Regen"
                        "fecha" => "2021"
                        "volumen" => "41"
                        "paginaInicial" => "28"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34565478"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Synthesized HMGB1 peptide prevents the progression of inflammation&#44; steatosis&#44; fibrosis&#44; and tumor occurrence in a non-alcoholic steatohepatitis mouse model"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Ishii"
                            1 => "A&#46; Tsuchiya"
                            2 => "K&#46; Natsui"
                            3 => "Y&#46; Koseki"
                            4 => "N&#46; Takeda"
                            5 => "K&#46; Tomiyoshi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/hepr.13825"
                      "Revista" => array:7 [
                        "tituloSerie" => "Hepatol Res"
                        "fecha" => "2022"
                        "volumen" => "52"
                        "paginaInicial" => "985"
                        "paginaFinal" => "997"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35932481"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0302283810010833"
                          "estado" => "S300"
                          "issn" => "03022838"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Most mammalian mRNAs are conserved targets of microRNAs"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46;C&#46; Friedman"
                            1 => "K&#46;K&#46; Farh"
                            2 => "C&#46;B&#46; Burge"
                            3 => "D&#46;P&#46; Bartel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1101/gr.082701.108"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genome Res"
                        "fecha" => "2009"
                        "volumen" => "19"
                        "paginaInicial" => "92"
                        "paginaFinal" => "105"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18955434"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pan-cancer analysis shows that ALKBH5 is a potential prognostic and immunotherapeutic biomarker for multiple cancer types including gliomas"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Wei"
                            1 => "B&#46; Wang"
                            2 => "D&#46; Peng"
                            3 => "X&#46; Zhang"
                            4 => "Z&#46; Li"
                            5 => "L&#46; Luo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fimmu.2022.849592"
                      "Revista" => array:6 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2022"
                        "volumen" => "13"
                        "paginaInicial" => "849592"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35444654"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S002604951730015X"
                          "estado" => "S300"
                          "issn" => "00260495"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mex3a promotes oncogenesis through the RAP1&#47;MAPK signaling pathway in colorectal cancer and is inhibited by hsa-miR-6887-3p"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Li"
                            1 => "J&#46; Liang"
                            2 => "J&#46; Wang"
                            3 => "J&#46; Han"
                            4 => "S&#46; Li"
                            5 => "K&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/cac2.12149"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Commun &#40;Lond&#41;"
                        "fecha" => "2021"
                        "volumen" => "41"
                        "paginaInicial" => "472"
                        "paginaFinal" => "491"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33638620"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-370 attenuates hepatic fibrogenesis by targeting smoothened"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;H&#46; Lu"
                            1 => "Q&#46;R&#46; Hou"
                            2 => "L&#46;F&#46; Deng"
                            3 => "C&#46; Fei"
                            4 => "W&#46;P&#46; Xu"
                            5 => "Q&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10620-015-3585-0"
                      "Revista" => array:7 [
                        "tituloSerie" => "Dig Dis Sci"
                        "fecha" => "2015"
                        "volumen" => "60"
                        "paginaInicial" => "2038"
                        "paginaFinal" => "2048"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25686745"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0090429511004134"
                          "estado" => "S300"
                          "issn" => "00904295"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Paclitaxel alleviates the sepsis-induced acute kidney injury via lnc-MALAT1&#47;miR-370-3p&#47;HMGB1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Xu"
                            1 => "G&#46; Hu"
                            2 => "P&#46; Xing"
                            3 => "M&#46; Zhou"
                            4 => "D&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.lfs.2020.118505"
                      "Revista" => array:5 [
                        "tituloSerie" => "Life Sci"
                        "fecha" => "2020"
                        "volumen" => "262"
                        "paginaInicial" => "118505"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32998017"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Margatoxin mitigates CCl4induced hepatic fibrosis in mice via macrophage polarization&#44; cytokine secretion and STAT signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46;M&#46; Wu"
                            1 => "J&#46;D&#46; Liu"
                            2 => "Y&#46;H&#46; Li"
                            3 => "J&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ijmm.2019.4395"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Med"
                        "fecha" => "2019"
                        "volumen" => "45"
                        "paginaInicial" => "103"
                        "paginaFinal" => "114"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31746414"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-17A plays a critical role in the pathogenesis of liver fibrosis through hepatic stellate cell activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z&#46; Tan"
                            1 => "X&#46; Qian"
                            2 => "R&#46; Jiang"
                            3 => "Q&#46; Liu"
                            4 => "Y&#46; Wang"
                            5 => "C&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Immunol &#40;Baltimore&#44; Md&#58; 1950&#41;"
                        "fecha" => "2013"
                        "volumen" => "191"
                        "paginaInicial" => "1835"
                        "paginaFinal" => "1844"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Limonin relieves TGF-&#946;-induced hepatocyte EMT and hepatic stellate cell activation in vitro and CCl&#40;4&#41;-induced liver fibrosis in mice via upregulating Smad7 and subsequent suppression of TGF-&#946;&#47;Smad cascade"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Shu"
                            1 => "C&#46; Dai"
                            2 => "A&#46; Yusuf"
                            3 => "H&#46; Sun"
                            4 => "X&#46; Deng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jnutbio.2022.109039"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Nutr Biochem"
                        "fecha" => "2022"
                        "volumen" => "107"
                        "paginaInicial" => "109039"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35533902"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bleomycin-induced interstitial pulmonary disease in the nude&#44; athymic mouse"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Szapiel"
                            1 => "N&#46; Elson"
                            2 => "J&#46; Fulmer"
                            3 => "G&#46; Hunninghake"
                            4 => "R&#46; Crystal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/arrd.1979.120.4.893"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am Rev Respir Dis"
                        "fecha" => "1979"
                        "volumen" => "120"
                        "paginaInicial" => "893"
                        "paginaFinal" => "899"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/92208"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Simple method of estimating severity of pulmonary fibrosis on a numerical scale"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46; Ashcroft"
                            1 => "J&#46; Simpson"
                            2 => "V&#46; Timbrell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/jcp.41.4.467"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Pathol"
                        "fecha" => "1988"
                        "volumen" => "41"
                        "paginaInicial" => "467"
                        "paginaFinal" => "470"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3366935"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0002937822000680"
                          "estado" => "S300"
                          "issn" => "00029378"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-137 inhibits autophagy and chemosensitizes pancreatic cancer cells by targeting ATG5"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Z&#46; Wang"
                            1 => "F&#46; Huang"
                            2 => "H&#46; Xu"
                            3 => "J&#46; Sun"
                            4 => "C&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biocel.2019.01.020"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Biochem Cell Biol"
                        "fecha" => "2019"
                        "volumen" => "111"
                        "paginaInicial" => "63"
                        "paginaFinal" => "71"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30710750"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sestrin 2 attenuates rat hepatic stellate cell &#40;HSC&#41; activation and liver fibrosis via an mTOR&#47;AMPK-dependent mechanism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Hu"
                            1 => "X&#46; Ye"
                            2 => "Q&#46; Zhou"
                            3 => "R&#46; Fu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1159/000495829"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell Physiol Biochem"
                        "fecha" => "2018"
                        "volumen" => "51"
                        "paginaInicial" => "2111"
                        "paginaFinal" => "2122"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30522100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "TGF-&#946;1-induced autophagy activates hepatic stellate cells via the ERK and JNK signaling pathways"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Zhang"
                            1 => "N&#46; Jiang"
                            2 => "J&#46; Ping"
                            3 => "L&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ijmm.2020.4778"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Med"
                        "fecha" => "2021"
                        "volumen" => "47"
                        "paginaInicial" => "256"
                        "paginaFinal" => "266"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33236148"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-654-5p contributes to the activation and proliferation of hepatic stellate cells by targeting RXR&#945;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Ma"
                            1 => "X&#46; Wang"
                            2 => "X&#46; Liu"
                            3 => "C&#46; Wang"
                            4 => "X&#46; Gao"
                            5 => "J&#46; Niu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fcell.2022.841248"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Cell Dev Biol"
                        "fecha" => "2022"
                        "volumen" => "10"
                        "paginaInicial" => "841248"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35465330"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Value of GATA3 immunostaining in tumor diagnosis&#58; a review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "N&#46; Ord&#243;&#241;ez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/PAP.0b013e3182a28a68"
                      "Revista" => array:6 [
                        "tituloSerie" => "Adv Anat Pathol"
                        "fecha" => "2013"
                        "volumen" => "20"
                        "paginaInicial" => "352"
                        "paginaFinal" => "360"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23939152"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "GATA3 functions downstream of BRCA1 to suppress EMT in breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Bai"
                            1 => "L&#46; Zhang"
                            2 => "X&#46; Liu"
                            3 => "C&#46; Wang"
                            4 => "C&#46; Zheng"
                            5 => "J&#46; Sun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7150/thno.59280"
                      "Revista" => array:7 [
                        "tituloSerie" => "Theranostics"
                        "fecha" => "2021"
                        "volumen" => "11"
                        "paginaInicial" => "8218"
                        "paginaFinal" => "8233"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34373738"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0090429507024223"
                          "estado" => "S300"
                          "issn" => "00904295"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fine particulate matter induces airway inflammation by disturbing the balance between Th1&#47;Th2 and regulation of GATA3 and Runx3 expression in BALB&#47;c mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46; Pang"
                            1 => "P&#46; Yu"
                            2 => "X&#46; Liu"
                            3 => "Y&#46; Fan"
                            4 => "Y&#46; Shi"
                            5 => "S&#46; Zou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/mmr.2021.12017"
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Med Rep"
                        "fecha" => "2021"
                        "volumen" => "23"
                        "paginaInicial" => "378"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33760131"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0405"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "GATA3 is downregulated in HCC and accelerates HCC aggressiveness by transcriptionally inhibiting slug expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Z&#46; Zhang"
                            1 => "X&#46; Fang"
                            2 => "G&#46; Xie"
                            3 => "J&#46; Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ol.2021.12492"
                      "Revista" => array:5 [
                        "tituloSerie" => "Oncol Lett"
                        "fecha" => "2021"
                        "volumen" => "21"
                        "paginaInicial" => "231"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33613720"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0410"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HMGB1 promotes ductular reaction and tumorigenesis in autophagy-deficient livers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Khambu"
                            1 => "N&#46; Huda"
                            2 => "X&#46; Chen"
                            3 => "D&#46; Antoine"
                            4 => "Y&#46; Li"
                            5 => "G&#46; Dai"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI91814"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "2018"
                        "volumen" => "128"
                        "paginaInicial" => "2419"
                        "paginaFinal" => "2435"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29558368"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0415"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Significance of MR&#47;OPN&#47;HMGB1 axis in NAFLD-associated hepatic fibrogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Tang"
                            1 => "H&#46; Jia"
                            2 => "S&#46; Chen"
                            3 => "B&#46; Yang"
                            4 => "B&#46; Patpur"
                            5 => "W&#46; Song"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.lfs.2020.118619"
                      "Revista" => array:5 [
                        "tituloSerie" => "Life Sci"
                        "fecha" => "2021"
                        "volumen" => "264"
                        "paginaInicial" => "118619"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33091447"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0420"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HMGB1-induced autophagy facilitates hepatic stellate cells activation&#58; a new pathway in liver fibrosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Li"
                            1 => "C&#46; Zeng"
                            2 => "B&#46; Zheng"
                            3 => "C&#46; Liu"
                            4 => "M&#46; Tang"
                            5 => "Y&#46; Jiang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Sci &#40;Lond&#44; Engl&#58; 1979&#41;"
                        "fecha" => "2018"
                        "volumen" => "132"
                        "paginaInicial" => "1645"
                        "paginaFinal" => "1667"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0425"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA interplay between hepatic stellate cell quiescence and activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "D&#46; Ezhilarasan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejphar.2020.173507"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Pharmacol"
                        "fecha" => "2020"
                        "volumen" => "885"
                        "paginaInicial" => "173507"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32858048"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0090429520307172"
                          "estado" => "S300"
                          "issn" => "00904295"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0430"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-370 attenuates hepatic fibrogenesis by targeting smoothened"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Lu"
                            1 => "Q&#46; Hou"
                            2 => "L&#46; Deng"
                            3 => "C&#46; Fei"
                            4 => "W&#46; Xu"
                            5 => "Q&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10620-015-3585-0"
                      "Revista" => array:7 [
                        "tituloSerie" => "Dig Dis Sci"
                        "fecha" => "2015"
                        "volumen" => "60"
                        "paginaInicial" => "2038"
                        "paginaFinal" => "2048"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25686745"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0022534711049743"
                          "estado" => "S300"
                          "issn" => "00225347"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/02105705/0000004700000003/v4_202404281047/S0210570523003369/v4_202404281047/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "9009"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/02105705/0000004700000003/v4_202404281047/S0210570523003369/v4_202404281047/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570523003369?idApp=UINPBA00004N"
]

Article information

ISSN: 02105705
Original language: English

DOI:10.1016/j.gastrohep.2023.05.005

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	5	1	6
2024 October	23	4	27
2024 September	11	4	15
2024 August	11	0	11
2024 July	23	0	23
2024 June	18	7	25
2024 May	21	7	28
2024 April	24	7	31
2024 March	38	20	58
2024 February	44	7	51
2024 January	30	3	33
2023 December	20	3	23
2023 November	26	2	28
2023 October	45	4	49
2023 September	19	1	20
2023 August	23	0	23
2023 July	38	6	44
2023 June	32	48	80
2023 May	3	5	8

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter