Detection of fiber-digesting bacteria in the forestomach contents of llamas (Lama glama) by PCR
Detección de bacterias que digieren fibra en el contenido preestomacal de llamas (Lama glama) por PCR
María E. Cerón Cucchia,
, Gisela Marcoppidoa, Marcos D. Trangonib, Silvio L. Craverob
Corresponding author
a Instituto de Patobiología, Centro de Investigación en Ciencias Veterinarias y Agronómicas, Instituto Nacional de Tecnología Agropecuaria, Hurlingham, Argentina
b Instituto de Biotecnología, Centro de Investigación en Ciencias Veterinarias y Agronómicas, Instituto Nacional de Tecnología Agropecuaria, Hurlingham, Argentina
Read
1991
Timeswas read the article
526
Total PDF
1465
Total HTML
Share statistics
array:24 [ "pii" => "S0325754113700154" "issn" => "03257541" "doi" => "10.1016/S0325-7541(13)70015-4" "estado" => "S300" "fechaPublicacion" => "2013-07-01" "aid" => "70015" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2013" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2013;45:147-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 658 "formatos" => array:3 [ "EPUB" => 47 "HTML" => 457 "PDF" => 154 ] ] "itemSiguiente" => array:19 [ "pii" => "S0325754113700166" "issn" => "03257541" "doi" => "10.1016/S0325-7541(13)70016-6" "estado" => "S300" "fechaPublicacion" => "2013-07-01" "aid" => "70016" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2013;45:150-3" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 2719 "formatos" => array:3 [ "EPUB" => 34 "HTML" => 1925 "PDF" => 760 ] ] "es" => array:12 [ "idiomaDefecto" => true "titulo" => "Identificación morfológica y molecular de <span class="elsevierStyleItalic">Cysticercus fasciolaris</span> aislado de un roedor (<span class="elsevierStyleItalic">Rattus norvegicus</span>) de la provincia de Buenos Aires (Argentina)" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "150" "paginaFinal" => "153" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Morphological and molecular identification of <span class="elsevierStyleItalic">Cysticercus fasciolaris</span> isolated from rodent hosts (<span class="elsevierStyleItalic">Rattus norvegicus</span>) in Buenos Aires province (Argentina)" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 468 "Ancho" => 2068 "Tamanyo" => 117096 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Morfología del metacestodo. A. Helminto extendido. B. Escólex del metacestodo con cuatro ventosas laterales prominentes y rostelo armado con doble hilera ganchos (4 X).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Mara L. Martínez, Mariana G. Domínguez, Gabriel E. Morici, Regino Cavia, Daniela P. Montes de Oca, Rosario Lovera, Javier H. Schapiro, Jorge L. Caracostantogolo" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Mara L." "apellidos" => "Martínez" ] 1 => array:2 [ "nombre" => "Mariana G." "apellidos" => "Domínguez" ] 2 => array:2 [ "nombre" => "Gabriel E." "apellidos" => "Morici" ] 3 => array:2 [ "nombre" => "Regino" "apellidos" => "Cavia" ] 4 => array:2 [ "nombre" => "Daniela P." "apellidos" => "Montes de Oca" ] 5 => array:2 [ "nombre" => "Rosario" "apellidos" => "Lovera" ] 6 => array:2 [ "nombre" => "Javier H." "apellidos" => "Schapiro" ] 7 => array:2 [ "nombre" => "Jorge L." "apellidos" => "Caracostantogolo" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754113700166?idApp=UINPBA00004N" "url" => "/03257541/0000004500000003/v1_201310080028/S0325754113700166/v1_201310080028/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754113700142" "issn" => "03257541" "doi" => "10.1016/S0325-7541(13)70014-2" "estado" => "S300" "fechaPublicacion" => "2013-07-01" "aid" => "70014" "copyright" => "Asociación Argentina de Microbiología" "documento" => "simple-article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "edi" "cita" => "Rev Argent Microbiol. 2013;45:145-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 2775 "formatos" => array:3 [ "EPUB" => 27 "HTML" => 2280 "PDF" => 468 ] ] "es" => array:9 [ "idiomaDefecto" => true "titulo" => "El conflicto de interés en la investigación científica" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "145" "paginaFinal" => "146" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Conflict of interest in scientific research" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Mauricio G. Carobene" "autores" => array:1 [ 0 => array:2 [ "nombre" => "Mauricio G." "apellidos" => "Carobene" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754113700142?idApp=UINPBA00004N" "url" => "/03257541/0000004500000003/v1_201310080028/S0325754113700142/v1_201310080028/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "titulo" => "Detection of fiber-digesting bacteria in the forestomach contents of llamas (<span class="elsevierStyleItalic">Lama glama</span>) by PCR" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "147" "paginaFinal" => "149" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "María E. Cerón Cucchi, Gisela Marcoppido, Marcos D. Trangoni, Silvio L. Cravero" "autores" => array:4 [ 0 => array:4 [ "nombre" => "María E." "apellidos" => "Cerón Cucchi" "email" => array:1 [ 0 => "mceron@cnia.inta.gov.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Gisela" "apellidos" => "Marcoppido" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Marcos D." "apellidos" => "Trangoni" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Silvio L." "apellidos" => "Cravero" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Instituto de Patobiología, Centro de Investigación en Ciencias Veterinarias y Agronómicas, Instituto Nacional de Tecnología Agropecuaria, Hurlingham, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Instituto de Biotecnología, Centro de Investigación en Ciencias Veterinarias y Agronómicas, Instituto Nacional de Tecnología Agropecuaria, Hurlingham, Argentina" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "*" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Detección de bacterias que digieren fibra en el contenido preestomacal de llamas (<span class="elsevierStyleItalic">Lama glama</span>) por PCR" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1109 "Ancho" => 930 "Tamanyo" => 60557 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">PCR detection of fibrolytic bacteria from the forestomach contents of llamas using species-specific primers for 1: <span class="elsevierStyleItalic">Ruminococcus albus</span>; 2: <span class="elsevierStyleItalic">Ruminococcus flavefaciens</span>; 3: <span class="elsevierStyleItalic">Fibrobacter succinogenes</span>. MWM: 100 bp ladder molecular weight marker.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">The llama (<span class="elsevierStyleItalic">Lama glama</span>) is one of the two domestic species of South American Camelids (SACs) together with the alpaca (<span class="elsevierStyleItalic">Lama pacos</span>), while the guanaco (<span class="elsevierStyleItalic">Lama guanicoe</span>) and the vicuña (<span class="elsevierStyleItalic">Vicugna vicugna</span>) are wild species. Similarly to Old World Camels (<span class="elsevierStyleItalic">Camelus dromedarius</span> and <span class="elsevierStyleItalic">Camelus bactrianus</span>), SACs have a complex three-compartment stomach (C-1, C-2 and C-3), which comprises 83, 11 and 6% of the total volume of the stomach respectively; they are classified as pseudoruminants or false ruminants<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a>. Camelids regurgitate and rechew ingested forage as true ruminants. However, camelids are more efficient in extracting protein and energy from poor-quality forages<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a>. In addition, the presence of glandular sacs in the stomach allows an efficient mashing, mixing and absorption of digesta. Like in ruminants, the forestomach of SACs have a highly complex microbial community, which comprises an undetermined number of species of protozoa, fungi, archaea and bacteria that combines to breakdown plant material. This community changes according to the health, age, the season of the year, the use of therapeutic and promoting antibiotics and, most importantly, to the diet of the host animal. Great efforts toward the isolation of rumen anaerobic bacteria were made and molecular techniques have allowed recognizing a predominance of uncultured bacteria in the rumen. The forestomach contents of SAC in general and of llama in particular are poorly described. Few reports have been published on the detection or bacterial isolation of the digestive tract of llama<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>. Previous studies have determined the distribution of the rumen bacterial population based on 16S rRNA clone libraries from different ruminants, 55–71% belong to Firmicutes, 25–42% to Bacteroidetes and 0–10% to other phyla<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a>. The majority (77%) of fiber-associated community members are uncultured bacteria, while 17% of cloned bacterial 16S rRNA gene sequences were classified as known fibrolytic species such as <span class="elsevierStyleItalic">Fibrobacter succinogenes</span> and <span class="elsevierStyleItalic">Butyrivibrio fibrisolvens</span><a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a>. Our current research focuses on three species of bacteria, which are considered to be principal fibrolytic bacteria in the rumen of ruminants: <span class="elsevierStyleItalic">Ruminococcus albus, Ruminococcus flavefaciens</span> and <span class="elsevierStyleItalic">Fibrobacter succinogenes</span><a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a>. Because of the complexity involved in the isolation of fiber-digesting bacteria, we used a molecular approach based on PCR to study fibrolytic microorganisms.</p><p id="par0010" class="elsevierStylePara elsevierViewall">The llamas were sampled by trained personnel and specialized veterinarians following INTA's Animal welfare protocols and international guidelines on the care and use of farm animals in research, teaching and testing<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a>.</p><p id="par0015" class="elsevierStylePara elsevierViewall">In this study, the forestomach contents (compartment C-1) were obtained from three adult male llamas slaughtered (estimated body weight, ~ 120<span class="elsevierStyleHsp" style=""></span>kg) during an annual sanitary program in the community of Cieneguillas, Jujuy, 22°08′15″S, 65°08′12″W (3800 m altitude) in the Altiplano in northern Argentina. In addition, the forestomach contents from five adult male llamas (estimated body weight, ~ 100<span class="elsevierStyleHsp" style=""></span>kg) were collected by esophageal tube in Buenos Aires, 34°36′12″S, 58°40′32″W (43<span class="elsevierStyleHsp" style=""></span>m altitude). Llamas from Jujuy fed on native plants based mainly in <span class="elsevierStyleItalic">Festuca argentiniensis ad libitum</span> whereas llamas from Buenos Aires fed on alfalfa hay (2% body weight). The forestomach content sample (40<span class="elsevierStyleHsp" style=""></span>ml) was filtered through a double layer of gauze to remove particulate matter, was immediately frozen using dry ice and then kept at −80<span class="elsevierStyleHsp" style=""></span>°C until processing. Total DNA extraction was performed with the QIAamp DNA Stool Kit (Qiagen, Germany). Speciesspecific primer sets that amplify 16S rRNA of <span class="elsevierStyleItalic">Ruminococcus albus, Ruminococcus flavefaciens</span> and <span class="elsevierStyleItalic">Fibrobacter succinogenes</span> are available to detect these species in gut microbial ecosystems<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>. The PCR mixture was performed using 1X PCR buffer (60<span class="elsevierStyleHsp" style=""></span>mM Tris-SO4 pH 8.9, 18<span class="elsevierStyleHsp" style=""></span>mM ammonium sulphate), 0.25<span class="elsevierStyleHsp" style=""></span>mM each dNTPs, 2<span class="elsevierStyleHsp" style=""></span>mM MgSO4, 0.2<span class="elsevierStyleHsp" style=""></span>mM each primer, 1U of Platinum Taq High Fidelity (Invitrogen, USA), 20<span class="elsevierStyleHsp" style=""></span>ng of genomic DNA and DNA/RNA free water adjusted to a total volume of 50<span class="elsevierStyleHsp" style=""></span>μl. The PCR condition was 95<span class="elsevierStyleHsp" style=""></span>°C 5<span class="elsevierStyleHsp" style=""></span>min followed by 30 cycles of 94<span class="elsevierStyleHsp" style=""></span>°C 30 sec for denaturing, annealing at different temperatures (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) for 30 sec and finally 68<span class="elsevierStyleHsp" style=""></span>°C 45 sec for elongation, using a PxE 0.2 thermal cycler (Thermo electron corporation, USA). The PCR products were separated by 2% agarose gel electrophoresis using the molecular weight marker 100 bp Ladder (Promega USA), stained with SYBR Safe (Invitrogen, USA) and the image was captured with a gel image analyzer (Uvitec, Cambridge, UK).</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0020" class="elsevierStylePara elsevierViewall">The DNA fragments of the expected size (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) were amplified from all the samples tested, irrespective of the diet and the geographical location. A representative image of the amplification after gel electrophoresis is shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0025" class="elsevierStylePara elsevierViewall">To confirm the specificity of the amplification, the PCR products were purified and three clone libraries were constructed in <span class="elsevierStyleItalic">Escherichia coli</span> using the vector TOPO TA cloning Kit (Invitrogen, USA). Plasmid DNA from several clones of each library was purified, sequenced and analyzed using BLAST (<a href="http://blast.ncbi.nlm.nih.gov/">http://blast.ncbi.nlm.nih.gov</a>). As expected,<a name="p149"></a> BLAST hits confirmed the specifity of the amplification (data not shown).</p><p id="par0030" class="elsevierStylePara elsevierViewall">In previous studies, fibrolytic bacteria have been isolated or detected from the gastrointestinal tract or feces of ruminants, horses, pigs, rats, rabbits, gorillas and ostriches<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a>. The present study extends the host range of the habitat of these bacteria showing that <span class="elsevierStyleItalic">Fibrobacter</span> sp. and <span class="elsevierStyleItalic">Ruminococcus</span> sp. are common constituents in the anaerobic environments of the forestomach contents of llamas herein mentioned.</p><p id="par0035" class="elsevierStylePara elsevierViewall">Like rumen, the forestomach houses a complex ecosystem that includes a high genetic microbial diversity with a vast array of metabolic functions. Fiber-digesting bacteria such as those described in this study are rich in enzymes capable of degrading complex polysaccharides present in the diet as cellulose, hemicellulose and pectin. The characterization of cellulolytic microorganisms for advanced ethanol production from lignocellulosic materials has the potential to provide a sustainable alternative to the global energy crisis. Thus, these bacteria could be a source of new hydrolytic enzymes for the biofuel industry. We conclude that the three major fiber-digesting anaerobic bacterial species are present in the forestomach contents of llamas. To the best of our knowledge, this is the first report on the presence of <span class="elsevierStyleItalic">Fibrobacter</span> sp. and <span class="elsevierStyleItalic">Ruminococcus</span> sp. in the forestomach contents of SACs.</p><p id="par0040" class="elsevierStylePara elsevierViewall">This initial characterization provides evidence that the isolation of these bacteria from the contents of C-1 compartment of llamas is feasible, which will allow a phenotypic and genetic characterization.</p><p id="par0045" class="elsevierStylePara elsevierViewall">Currently, we are analyzing the diversity of the amplified DNA through cloning and sequencing in order to define the presence of new phylotypes of these fibrolytic bacteria detected in llamas. Attempts to obtain the isolates are also under way.</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conflicts of interest</span><p id="par0050" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:7 [ 0 => array:2 [ "identificador" => "xres278942" "titulo" => "Abstract" ] 1 => array:2 [ "identificador" => "xpalclavsec260764" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres278941" "titulo" => "Resumen" ] 3 => array:2 [ "identificador" => "xpalclavsec260765" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Conflicts of interest" ] 5 => array:2 [ "identificador" => "xack64332" "titulo" => "Acknowledgments" ] 6 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2013-02-07" "fechaAceptado" => "2013-07-16" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec260764" "palabras" => array:4 [ 0 => "Llama" 1 => "<span class="elsevierStyleItalic">Lama glama</span>" 2 => "Fibrolytic bacteria" 3 => "PCR" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec260765" "palabras" => array:4 [ 0 => "Llama" 1 => "<span class="elsevierStyleItalic">Lama glama</span>" 2 => "Bacterias fibrolíticas" 3 => "PCR" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">The high fibrolytic activity and large biomass of strictly-anaerobic bacteria that inhabit the rumen makes them primarily responsible for the degradation of the forage consumed by ruminants. Llamas feed mainly on low quality fibrous roughages that are digested by an active and diverse microflora. The products of this fermentation are volatile fatty acids and microbial biomass, which will be used by the animals. The aim of this study was to detect the three major fiber-digesting anaerobic bacteria in the forestomach contents of llamas by PCR. In this study, we detected <span class="elsevierStyleItalic">Ruminococcus albus, Ruminococcus flavefaciens</span> and <span class="elsevierStyleItalic">Fibrobacter succinogenes</span> in the forestomach contents of eight native llamas from Argentina.</p>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">La alta actividad fibrolítica y la gran biomasa de las bacterias anaerobias estrictas que habitan el rumen las hacen las principales responsables de la degradación del forraje consumido por los rumiantes. Las llamas se alimentan sobre todo de forrajes fibrosos de baja calidad, que son digeridos por una activa y diversa microflora. Los productos de esta fermentación son ácidos grasos volátiles y biomasa bacteriana, los cuales serán utilizados por el animal. El objetivo de este estudio fue detectar las tres principales bacterias anaerobias que digieren fibra en el contenido del preestómago de llamas por PCR. En este estudio, detectamos <span class="elsevierStyleItalic">Ruminococcus albus, Ruminococcus flavefaciens</span> y <span class="elsevierStyleItalic">Fibrobacter succinogenes</span> en el contenido del preestómago de ocho llamas nativas de Argentina.<a name="p148"></a></p>" ] ] "multimedia" => array:2 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1109 "Ancho" => 930 "Tamanyo" => 60557 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">PCR detection of fibrolytic bacteria from the forestomach contents of llamas using species-specific primers for 1: <span class="elsevierStyleItalic">Ruminococcus albus</span>; 2: <span class="elsevierStyleItalic">Ruminococcus flavefaciens</span>; 3: <span class="elsevierStyleItalic">Fibrobacter succinogenes</span>. MWM: 100 bp ladder molecular weight marker.</p>" ] ] 1 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Bacterium \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Primer name \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Sequence (5′-3′) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Annealing temp. (°C) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Product size (bp) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Ref. \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Ruminococcus albus</span></td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ra1281 f \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCCTAAAAGCAGTCTTAGTTCG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">175 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ra1439 r \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCTCCTTGCGGTTAGAACA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Ruminococcus flavefaciens</span></td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Rf154 f \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCTGGAAACGGATGGTA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">295 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Rf425 r \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCTTTAAGACAGGAGTTTACAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Fibrobacter succinogenes</span></td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fs219 f \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGTATGGGATGAGCTTGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">445 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fs654 r \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCCTGCCCCTGAACTATC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab402537.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Species-specific primers sequences for 16S RNA genes used in this study</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:11 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1." "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Canadian Council on Animal Care. Guidelines on: the care and use of farm animals in research, teaching and testing, 2009; ISBN: 978-0-919087-50-7. Ottawa, ON, Canada." ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2." "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Cerón Cucchi ME, Rojas D, Marcoppido G, Trangoni MD, Cravero SLP. Isolation, characterization and phylogenetic analysis of two butyrate-producing anaerobic bacteria from the forestomach content of llama (<span class="elsevierStyleItalic">Lama Glama</span>). 26° Congresso Brasileiro de Microbiologia, Abstract 199B. Microbiol in foco. 2011;16Suppl:128." ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "16S rDNA library-based analysis of ruminal bacterial diversity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.E. Edwards" 1 => "N.R. McEwan" 2 => "A.J. Travis" 3 => "R.J. Wallace" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1023/B:ANTO.0000047942.69033.24" "Revista" => array:6 [ "tituloSerie" => "Antonie Van Leeuwenhoek" "fecha" => "2004" "volumen" => "86" "paginaInicial" => "263" "paginaFinal" => "281" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15539930" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Camelids are not ruminants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Fowler" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:5 [ "titulo" => "Zoo and Wild Animal Medicine" "paginaInicial" => "375" "paginaFinal" => "385" "edicion" => "6th" "serieFecha" => "2008" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Update on llama nutrition" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "L.W. Johnson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Vet Clin North Am: Food Anim Pract" "fecha" => "1994" "volumen" => "10" "paginaInicial" => "187" "paginaFinal" => "201" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development and use of competitive PCR assays for the ruminal cellulolytic bacteria: <span class="elsevierStyleItalic">Fibrobacter succinogenes</span>, <span class="elsevierStyleItalic">Ruminococcus albus</span> and <span class="elsevierStyleItalic">Ruminococcus flavefaciens</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S. Koike" 1 => "Y. Kobayashi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "FEMS Microbiol Letter" "fecha" => "2001" "volumen" => "204" "paginaInicial" => "361" "paginaFinal" => "366" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Kinetics of in sacco fiberattachment of representative ruminal cellulolytic bacteria monitored by competitive PCR" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S. Koike" 1 => "J. Pan" 2 => "Y. Kobayashi" 3 => "K. Tanaka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3168/jds.S0022-0302(03)73726-6" "Revista" => array:6 [ "tituloSerie" => "J Dairy Sci" "fecha" => "2003" "volumen" => "86" "paginaInicial" => "1429" "paginaFinal" => "1435" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12741567" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of fiber-digesting bacteria in the ceca of ostrich using specific primer sets" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Matsui" 1 => "T. Ban-Tokuda" 2 => "M. Wakita" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00284-009-9513-9" "Revista" => array:6 [ "tituloSerie" => "Curr Microbiol" "fecha" => "2010" "volumen" => "60" "paginaInicial" => "112" "paginaFinal" => "116" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19787401" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cellulolytic bacteria in the foregut of the dromedary camel (<span class="elsevierStyleItalic">Camelus dromedarius</span>)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A.A. Samsudin" 1 => "A.D.G. Wright" 2 => "R. Al Jassim" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AEM.02420-12" "Revista" => array:6 [ "tituloSerie" => "Appl Environ Microbiol" "fecha" => "2012" "volumen" => "78" "paginaInicial" => "8836" "paginaFinal" => "8839" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23042173" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diet-dependent shifts in the bacterial population of the rumen revealed with realtime PCR" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "K. Tajima" 1 => "R.I. Aminov" 2 => "T. Nagamine" 3 => "H. Matsui" 4 => "M. Nakamura" 5 => "Y. Benno" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AEM.67.6.2766-2774.2001" "Revista" => array:6 [ "tituloSerie" => "Appl Environ Microbiol" "fecha" => "2001" "volumen" => "67" "paginaInicial" => "2766" "paginaFinal" => "2774" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11375193" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phylogenetic analyses of rumen bacteria by comparative sequence analysis of cloned 16S rRNA genes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.F. Whitford" 1 => "R.J. Foster" 2 => "C.E. Beard" 3 => "J.H. Gong" 4 => "R.M. Theater" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1006/anae.1998.0155" "Revista" => array:6 [ "tituloSerie" => "Anaerobe" "fecha" => "1998" "volumen" => "4" "paginaInicial" => "153" "paginaFinal" => "163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16887636" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack64332" "titulo" => "Acknowledgments" "texto" => "<p id="par0055" class="elsevierStylePara elsevierViewall">We thank INTA for the financial support of this research through PNEG 1413. We gratefully acknowledge the generous assistance of Dora Rojas in the laboratory, Diego Franco on helping to take the samples and Dr. Andrea Gioffre for revising the manuscript.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000004500000003/v1_201310080028/S0325754113700154/v1_201310080028/en/main.assets" "Apartado" => array:4 [ "identificador" => "18251" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Informe breve" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004500000003/v1_201310080028/S0325754113700154/v1_201310080028/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754113700154?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 October | 5 | 1 | 6 |
| 2024 September | 24 | 3 | 27 |
| 2024 August | 9 | 1 | 10 |
| 2024 July | 17 | 3 | 20 |
| 2024 June | 12 | 5 | 17 |
| 2024 May | 14 | 7 | 21 |
| 2024 April | 14 | 3 | 17 |
| 2024 March | 25 | 2 | 27 |
| 2024 February | 15 | 1 | 16 |
| 2024 January | 10 | 4 | 14 |
| 2023 December | 6 | 5 | 11 |
| 2023 November | 9 | 7 | 16 |
| 2023 October | 13 | 5 | 18 |
| 2023 September | 8 | 5 | 13 |
| 2023 August | 9 | 8 | 17 |
| 2023 July | 10 | 7 | 17 |
| 2023 June | 22 | 2 | 24 |
| 2023 May | 42 | 3 | 45 |
| 2023 April | 37 | 8 | 45 |
| 2023 March | 33 | 3 | 36 |
| 2023 February | 13 | 2 | 15 |
| 2023 January | 15 | 1 | 16 |
| 2022 December | 35 | 8 | 43 |
| 2022 November | 19 | 5 | 24 |
| 2022 October | 14 | 4 | 18 |
| 2022 September | 16 | 15 | 31 |
| 2022 August | 23 | 8 | 31 |
| 2022 July | 11 | 7 | 18 |
| 2022 June | 14 | 5 | 19 |
| 2022 May | 32 | 7 | 39 |
| 2022 April | 19 | 14 | 33 |
| 2022 March | 16 | 10 | 26 |
| 2022 February | 24 | 4 | 28 |
| 2022 January | 41 | 4 | 45 |
| 2021 December | 39 | 5 | 44 |
| 2021 November | 44 | 8 | 52 |
| 2021 October | 16 | 8 | 24 |
| 2021 September | 8 | 9 | 17 |
| 2021 August | 34 | 11 | 45 |
| 2021 July | 11 | 5 | 16 |
| 2021 June | 14 | 12 | 26 |
| 2021 May | 13 | 8 | 21 |
| 2021 April | 25 | 8 | 33 |
| 2021 March | 18 | 11 | 29 |
| 2021 February | 9 | 6 | 15 |
| 2021 January | 8 | 16 | 24 |
| 2020 December | 16 | 7 | 23 |
| 2020 November | 14 | 9 | 23 |
| 2020 October | 14 | 3 | 17 |
| 2020 September | 11 | 14 | 25 |
| 2020 August | 11 | 5 | 16 |
| 2020 July | 8 | 4 | 12 |
| 2020 June | 6 | 11 | 17 |
| 2020 May | 27 | 21 | 48 |
| 2020 April | 12 | 11 | 23 |
| 2020 March | 15 | 1 | 16 |
| 2020 February | 18 | 8 | 26 |
| 2020 January | 10 | 3 | 13 |
| 2019 December | 22 | 10 | 32 |
| 2019 November | 2 | 2 | 4 |
| 2019 October | 21 | 4 | 25 |
| 2019 September | 8 | 3 | 11 |
| 2019 August | 3 | 1 | 4 |
| 2019 July | 6 | 9 | 15 |
| 2019 June | 20 | 20 | 40 |
| 2019 May | 49 | 24 | 73 |
| 2019 April | 20 | 14 | 34 |
| 2019 March | 3 | 5 | 8 |
| 2019 February | 3 | 6 | 9 |
| 2019 January | 1 | 1 | 2 |
| 2018 December | 6 | 1 | 7 |
| 2018 November | 5 | 0 | 5 |
| 2018 October | 5 | 8 | 13 |
| 2018 September | 5 | 0 | 5 |
| 2018 August | 4 | 0 | 4 |
| 2018 July | 1 | 5 | 6 |
| 2018 June | 7 | 0 | 7 |
| 2018 May | 0 | 1 | 1 |
| 2018 April | 5 | 0 | 5 |
| 2018 March | 10 | 0 | 10 |
| 2018 February | 4 | 1 | 5 |
| 2018 January | 8 | 1 | 9 |
| 2017 December | 1 | 2 | 3 |
| 2017 November | 10 | 0 | 10 |
| 2017 October | 3 | 3 | 6 |
| 2017 September | 6 | 0 | 6 |
| 2017 August | 8 | 2 | 10 |
| 2017 July | 8 | 4 | 12 |
| 2017 June | 14 | 1 | 15 |
| 2017 May | 17 | 1 | 18 |
| 2017 April | 6 | 0 | 6 |
| 2017 March | 11 | 1 | 12 |
| 2017 February | 12 | 0 | 12 |
| 2017 January | 16 | 1 | 17 |
| 2016 December | 21 | 2 | 23 |
| 2016 November | 24 | 4 | 28 |
| 2016 October | 21 | 3 | 24 |
| 2016 September | 21 | 2 | 23 |
| 2016 August | 12 | 1 | 13 |
| 2016 July | 9 | 2 | 11 |
Show all
