Brief report
First detection of CMY-2 plasmid mediated β-lactamase in Salmonella Heidelberg in South America
Primera detección de CMY-2 en Salmonella Heidelberg en Sudamérica
Daniela Cejasa, Rafael Vignolib, Mirta Quinterosc, Ricardo Marinoc, Raquel Callejoc, Laura Betancorb, Gabriel O. Gutkinda, Marcela A. Radicea,
Corresponding author
a Cátedra de Microbiología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina
b Departamento de Bacteriología y Virología, Instituto de Higiene, Facultad de Medicina, Universidad de la República, Montevideo, Uruguay
c Hospital de Infecciosas “F. Muñiz”, Ciudad Autónoma de Buenos Aires, Argentina
Read
2835
Timeswas read the article
955
Total PDF
1880
Total HTML
Share statistics
array:24 [ "pii" => "S0325754114700446" "issn" => "03257541" "doi" => "10.1016/S0325-7541(14)70044-6" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "70044" "copyright" => "Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L." "copyrightAnyo" => "2013" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2014;46:30-3" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1118 "formatos" => array:3 [ "EPUB" => 59 "HTML" => 644 "PDF" => 415 ] ] "itemSiguiente" => array:19 [ "pii" => "S0325754114700458" "issn" => "03257541" "doi" => "10.1016/S0325-7541(14)70045-8" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "70045" "copyright" => "Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2014;46:34-40" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 760 "formatos" => array:3 [ "EPUB" => 40 "HTML" => 415 "PDF" => 305 ] ] "en" => array:11 [ "idiomaDefecto" => true "titulo" => "Wild-type minimal inhibitory concentration distributions in bacteria of animal origin in Argentina" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "34" "paginaFinal" => "40" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Distribución de la concentración inhibitoria mínima y puntos de corte “<span class="elsevierStyleItalic">wild-type</span>” en bacterias de origen animal en Argentina" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Florencia L. Pantozzi, Mariela P. Ibar, Victorio F. Nievas, Germán B. Vigo, Fabiana A. Moredo, Gabriela I. Giacoboni" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Florencia L." "apellidos" => "Pantozzi" ] 1 => array:2 [ "nombre" => "Mariela P." "apellidos" => "Ibar" ] 2 => array:2 [ "nombre" => "Victorio F." "apellidos" => "Nievas" ] 3 => array:2 [ "nombre" => "Germán B." "apellidos" => "Vigo" ] 4 => array:2 [ "nombre" => "Fabiana A." "apellidos" => "Moredo" ] 5 => array:2 [ "nombre" => "Gabriela I." "apellidos" => "Giacoboni" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754114700458?idApp=UINPBA00004N" "url" => "/03257541/0000004600000001/v2_201605140103/S0325754114700458/v2_201605140103/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754114700434" "issn" => "03257541" "doi" => "10.1016/S0325-7541(14)70043-4" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "70043" "copyright" => "Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/3.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2014;46:24-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1014 "formatos" => array:3 [ "EPUB" => 31 "HTML" => 512 "PDF" => 471 ] ] "es" => array:11 [ "idiomaDefecto" => true "titulo" => "Estudio retrospectivo de la aplicación de la amplificación génica cualitativa en muestras biológicas para el seguimiento de la toxoplasmosis en pacientes pediátricos receptores de trasplante de células progenitoras hematopoyéticas" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "24" "paginaFinal" => "29" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Retrospective study of the implementation of the qualitative PCR technique in biological samples for monitoring toxoplasmosis in pediatric patients receiving hematopoietic stem cell transplantion" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Mónica G. Nigro, Carlos Figueroa, Bibiana A. Ledesma" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Mónica G." "apellidos" => "Nigro" ] 1 => array:2 [ "nombre" => "Carlos" "apellidos" => "Figueroa" ] 2 => array:2 [ "nombre" => "Bibiana A." "apellidos" => "Ledesma" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754114700434?idApp=UINPBA00004N" "url" => "/03257541/0000004600000001/v2_201605140103/S0325754114700434/v2_201605140103/es/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Brief report</span>" "titulo" => "First detection of CMY-2 plasmid mediated β-lactamase in <span class="elsevierStyleItalic">Salmonella</span> Heidelberg in South America" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "30" "paginaFinal" => "33" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Daniela Cejas, Rafael Vignoli, Mirta Quinteros, Ricardo Marino, Raquel Callejo, Laura Betancor, Gabriel O. Gutkind, Marcela A. Radice" "autores" => array:8 [ 0 => array:3 [ "nombre" => "Daniela" "apellidos" => "Cejas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Rafael" "apellidos" => "Vignoli" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Mirta" "apellidos" => "Quinteros" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Ricardo" "apellidos" => "Marino" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "Raquel" "apellidos" => "Callejo" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 5 => array:3 [ "nombre" => "Laura" "apellidos" => "Betancor" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 6 => array:3 [ "nombre" => "Gabriel O." "apellidos" => "Gutkind" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 7 => array:4 [ "nombre" => "Marcela A." "apellidos" => "Radice" "email" => array:1 [ 0 => "mradice@ffyb.uba.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Cátedra de Microbiología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Departamento de Bacteriología y Virología, Instituto de Higiene, Facultad de Medicina, Universidad de la República, Montevideo, Uruguay" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Hospital de Infecciosas “F. Muñiz”, Ciudad Autónoma de Buenos Aires, Argentina" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "*" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Primera detección de CMY-2 en <span class="elsevierStyleItalic">Salmonella</span> Heidelberg en Sudamérica" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 515 "Ancho" => 1886 "Tamanyo" => 64045 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Genetic context of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>. ISE<span class="elsevierStyleItalic">cp1</span>: Insertion sequence <span class="elsevierStyleItalic">Ecp1, blc</span>: gene encoding for outer membrane lipoprotein,(lipocalin); <span class="elsevierStyleItalic">sugE</span>: gene encoding for small multidrug resistance protein; <span class="elsevierStyleItalic">ecnR</span>: coding gene for a transcriptional regulatory protein, entericidinR.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Salmonella enterica</span> serovar Heidelberg is the causative agent of salmonellosis, a self-limiting gastroenteritis that does not usually require antibiotic therapy. However, severe infections may occur, particularly in children and immunocompromised hosts, leading to invasive diseases that require antimicrobial treatment. Fluoroquinolones and extended-spectrum cephalosporins are frequently used in severe <span class="elsevierStyleItalic">Salmonella</span> infections<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>.</p><p id="par0010" class="elsevierStylePara elsevierViewall">Since the late ‘80s <span class="elsevierStyleItalic">Salmonella</span> isolates displaying resistance to extended spectrum cephalosporins have emerged worldwide. Coding genes for TEM-, SHV-, PSE-, OXA-, PER-, CTX-M-, CMY-, ACC-, DHA- extended spectrum β-lactamases (ESBL) and also KPC carbapenemases have been reported in <span class="elsevierStyleItalic">S. enterica</span> isolates<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a>.</p><p id="par0015" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">S. enterica</span> serovar Heidelberg ranks among the most prevalent causes of human salmonellosis in the United States and Canada, although it is infrequently reported in South American and European countries<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a>. During the last decade, extended-spectrum cephalosporin resistance has increased among human and agri-food isolates of this serotype in North American countries. This resistance profile is mainly associated with the spread of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> plasmid encoded AmpC β-lactamase<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>. <span class="elsevierStyleItalic">S</span>. Heidelberg is also one of the most common <span class="elsevierStyleItalic">Salmonella</span> serovars isolated from poultry and eggs, whose consumption has led to many foodborne infection outbreaks. Infections caused by personto- person transmission or direct contact with infected animals have been rarely reported<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a>.</p><p id="par0020" class="elsevierStylePara elsevierViewall">In Argentina, <span class="elsevierStyleItalic">S.</span> Heidelber g isolates are very infrequent among those submitted to the Centro Nacional de Referencia (Mariana Pichel-Instituto Nacional de Enfermedades Infecciosas-ANLIS “Carlos G. Malbrán”-personal communication).</p><p id="par0025" class="elsevierStylePara elsevierViewall">In this study, we characterized oxyimino-cephalosporin resistance in an <span class="elsevierStyleItalic">S.</span> Heidelberg isolate recovered from a diarrheal stool sample of an HIV adult inpatient, in February 2012, in Buenos Aires. Identification was carried out using conventional culture methods. Serotyping was conducted at the Centro Nacional de Salmonella (CNS) in Montevideo, Uruguay. The CNS, housed in the Departamento de Bacteriología y Virología, Instituto de Higiene, Universidad de la República, has characterized <span class="elsevierStyleItalic">Salmonella</span> isolates of human, animal, food, feed and environmental origin, voluntarily submitted by several private and public laboratories for the last 60 years in Uruguay.</p><p id="par0030" class="elsevierStylePara elsevierViewall">Minimal Inhibitory Concentrations (MICs) of different antimicrobial agents were determined using broth microdilution testing and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a>. <span class="elsevierStyleItalic">S.</span> Heidelberg was resistant to ampicillin, cephalothin, cefoxitin, ceftriaxone, ceftazidime, intermediate to tetracycline and susceptible to cefepime, imipenem, aztreonam, kanamycin, gentamicin, ciprofloxacin, levofloxacin and cloramphenicol. Phenotypic screening for β-lactamases was performed by synergy tests using amoxicillin/clavulanic acid (10<span class="elsevierStyleHsp" style=""></span>μg/10<span class="elsevierStyleHsp" style=""></span>μg) and phenyl-boronic acid (300<span class="elsevierStyleHsp" style=""></span>μg)-containing disks. Synergy was observed between phenyl-boronic acid and both ceftazidime and cefotaxime disks, suggesting the presence of an AmpC type β-lactamase. Plasmid DNA was purified according to the <span class="elsevierStyleItalic">Kado</span> and <span class="elsevierStyleItalic">Liu</span> method. A multiplex-PCR assay was conducted to reveal the presence of plasmidencoded <span class="elsevierStyleItalic">ampC</span> alleles<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a>, rendering a 462 bp amplicon, which suggested the presence of a coding gene for a CIT cluster β-lactamase. The following specific primers (5′-3′) were used to achieve the complete <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY</span> gene: CMY-F: ATGATGAAAAAATCGTTATGCT and CMY-R: TTATTGCAGCTTTTCAAGAATGCG. The nucleotide sequence of the 1140 bp amplicon obtained corresponded to <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>. The genetic context of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> was determined by PCR mapping and sequencing, as shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>, using the following primers (5′-3′): TNF: ACCTAGATTCTACGTCAGTACT, AmpC-R: CCCTGGTAGATAACGGCA, Blc-F: CATTCCTGGTTGTCGCGTGT, SugE-F: AGCATGGCGATACTGACGAT, SugE-R: GCCTGATATGTCCTGGATCGT, EcnR-R: GGATTGAGAGGGCACGAT. IS<span class="elsevierStyleItalic">Ecp1</span> was located upstream <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>, and <span class="elsevierStyleItalic">blc, sugE</span> and <span class="elsevierStyleItalic">ecnR</span> were identified downstream (Accession number HG931731). The analyzed <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> context agrees completely with the conserved regions reported for Type I, II and III environments described in <span class="elsevierStyleItalic">S. enterica</span>, in which <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> gene is associated with the insertion sequence IS<span class="elsevierStyleItalic">Ecp1</span>, which could enhance <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> expression and mobilization<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a>.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">Replicon type of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> harboring plasmid was determined according to Carattoli et al.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>, corresponding to the IncN group. Plasmid size was estimated in 97 kb by PFGE analysis of S1 nuclease digested DNA<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a>. Conjugation assays were carried out using <span class="elsevierStyleItalic">E. coli</span> J53 (sodic azid resistant) as recipient strain and Luria Bertani agar plates supplemented with sodium azide (150<span class="elsevierStyleHsp" style=""></span>μg/ml) and ceftadizime (10<span class="elsevierStyleHsp" style=""></span>μg/ml) as selection system. <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> plasmid could not be transferred by conjugation in the assayed conditions.</p><p id="par0040" class="elsevierStylePara elsevierViewall">Multilocus sequence typing (MLST) with seven housekeeping genes (<span class="elsevierStyleItalic">aro</span>C, <span class="elsevierStyleItalic">dna</span>N, <span class="elsevierStyleItalic">hem</span>D, <span class="elsevierStyleItalic">his</span>D, <span class="elsevierStyleItalic">pur</span>E, <span class="elsevierStyleItalic">suc</span>A, <span class="elsevierStyleItalic">thr</span>A) was conducted according to <a id="intr0005" class="elsevierStyleInterRef" href="http://mlst.ucc.ie/mlst/dbs/Senterica">http://mlst.ucc.ie/mlst/dbs/Senterica</a>. The isolate displayed the following allelic profile: 2, 7, 9, 9, 5, 9, 12, which corresponds to ST 15, as well as the majority of the <span class="elsevierStyleItalic">S.</span> Heidelberg isolates deposited in the MLST database. According to the <span class="elsevierStyleItalic">S. enterica</span> MLST database, ST 15 was more often reported in Europe, North America and Asia, however there is only one description in Africa and two in South America <a id="intr0010" class="elsevierStyleInterRef" href="http://mlst.ucc.ie/mlst/mlst/dbs/Senterica/">http://mlst.ucc.ie/mlst/mlst/dbs/Senterica/</a>.<a name="p32"></a></p><p id="par0045" class="elsevierStylePara elsevierViewall">Based on the ST analysis, in 2012, <span class="elsevierStyleItalic">S. enterica</span> isolates were grouped together in 138 discrete genetically related clusters called eBurstGroups (eBGs). Some eBGs exhibit a unique oneto-one relationship with serovars such as eBG26 and <span class="elsevierStyleItalic">S.</span> Heidelberg (<a id="intr0015" class="elsevierStyleInterRef" href="http://mlst.ucc.ie/mlst/mlst/dbs/Senterica/">http://mlst.ucc.ie/mlst/mlst/dbs/Senterica/</a>).</p><p id="par0050" class="elsevierStylePara elsevierViewall">Virotyping was performed by PCR amplification of coding genes for proteins secreted by type III secretion systems (<span class="elsevierStyleItalic">avr</span>A, <span class="elsevierStyleItalic">sop</span>E), <span class="elsevierStyleItalic">Salmonella</span> Typhimurium genomic island CS54 (<span class="elsevierStyleItalic">shd</span>A) and phage encoded genes (<span class="elsevierStyleItalic">gog</span>B and <span class="elsevierStyleItalic">sb</span>41); specific primers for <span class="elsevierStyleItalic">inv</span>A were included as an internal control<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a>. Among the virulence-related genes investigated by PCR amplification, only <span class="elsevierStyleItalic">sop</span>E was detected. The <span class="elsevierStyleItalic">sopE</span> gene encodes for a Rho- GTPase that induces membrane ruffling and elicits a proinfl ammatory response in epithelial cells. The cytosolic localization of SopE in the absence of other bacterial molecules is sufficient for inducing NF-κB activation<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a>.</p><p id="par0055" class="elsevierStylePara elsevierViewall">Although there is a national network of laboratories that conducts an exhaustive surveillance of diarrheal episodes, reports of <span class="elsevierStyleItalic">Salmonella</span> spp. infections are not mandatory, except for <span class="elsevierStyleItalic">S</span>. Typhi. It is estimated that only 5% of salmonellosis infections are registered. According to national reports <span class="elsevierStyleItalic">S</span>. Typhimurium and <span class="elsevierStyleItalic">S</span>. Enteriditis constitute the most prevalent serotypes, being <span class="elsevierStyleItalic">S</span>. Heiderberg only sporadically reported. There are no reported data about extended-spectrum cephalosporin resistance among human <span class="elsevierStyleItalic">S</span>. Heidelberg isolates in Argentina. Here we report the first CMY-2-producing <span class="elsevierStyleItalic">S</span>. Heiderberg human isolate in our country, an even in South America.</p><p id="par0060" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> gene, constitutes the most common marker among extended-spectrum cephalosporin-resistant <span class="elsevierStyleItalic">Salmonella</span> in the United States, mainly mediated by the spread of IncI1 <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> plasmid<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a>. This replicon type plasmid has also been described in <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> producing <span class="elsevierStyleItalic">S</span>. Typhimurium isolated from children with diarrhea in Uruguay<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a>. More recently IncA/C plasmids have been associated with <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> bovine isolates of <span class="elsevierStyleItalic">S</span>. Heidelberg<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>. However, in the studied isolate <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> was located in an IncN plasmid, this replicon type has not been previously associated to <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> in <span class="elsevierStyleItalic">Salmonella</span> spp. Even in previous studies performed in <span class="elsevierStyleItalic">E. coli</span> in Argentina, where we reported the association of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> with IncA/C, IncI1, IncFIA/FI, IncK, IncF, IncY and IncBO plasmids, the IncN group was not detected<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a>.</p><p id="par0065" class="elsevierStylePara elsevierViewall">Considering the wide diversity of Inc/<span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> associations, the spread of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> may be related to the presence of a transposable element responsible for its mobilization. Additionally, the co-mobilization of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> and <span class="elsevierStyleItalic">sugE</span> increases the possibility of co-selection processes. SugE is a member of the small multidrug resistance (SMR) transporter family, responsible for conferring resistance to antiseptics such as quaternary ammonium compounds and SDS<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">12</span></a>.</p><p id="par0070" class="elsevierStylePara elsevierViewall">The spread of resistance markers among <span class="elsevierStyleItalic">S.</span> Heidelberg isolates constitutes a risk for the management of severe salmonellosis in clinical practice. Therefore, a better understanding of the pathogen distribution and its antimicrobial resistance is important for the development of strategies to limit salmonellosis due to multidrugresistant strains.</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Ethical responsibilities</span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Protection of human and animal subjects</span><p id="par0075" class="elsevierStylePara elsevierViewall">The authors declare that no experiments were performed on humans or animals for this investigation.</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Confidentiality of data</span><p id="par0080" class="elsevierStylePara elsevierViewall">The authors declare that no patient data appears in this article.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Right to privacy and informed consent</span><p id="par0085" class="elsevierStylePara elsevierViewall">The authors declare that no patient data appears in this article.</p></span></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:7 [ 0 => array:3 [ "identificador" => "xres635796" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec648282" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres635795" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec648281" "titulo" => "Palabras clave" ] 4 => array:3 [ "identificador" => "sec0005" "titulo" => "Ethical responsibilities" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0010" "titulo" => "Protection of human and animal subjects" ] 1 => array:2 [ "identificador" => "sec0015" "titulo" => "Confidentiality of data" ] 2 => array:2 [ "identificador" => "sec0020" "titulo" => "Right to privacy and informed consent" ] ] ] 5 => array:2 [ "identificador" => "xack214231" "titulo" => "Acknowledgements" ] 6 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2013-12-04" "fechaAceptado" => "2014-02-11" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec648282" "palabras" => array:3 [ 0 => "<span class="elsevierStyleItalic">Salmonella</span> Heidelberg" 1 => "CMY-2 β-lactamase" 2 => "ST15" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec648281" "palabras" => array:3 [ 0 => "<span class="elsevierStyleItalic">Salmonella</span> Heidelberg" 1 => "CMY-2 β-lactamasa" 2 => "ST15" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Salmonella enterica</span> serovar Heidelberg ranks among the most prevalent causes of human salmonellosis in the United States and Canada, although it has been infrequently reported in South American and European countries. Most <span class="elsevierStyleItalic">Salmonella</span> infections are self-limiting; however, some invasive infections require antimicrobial therapy. In this work we characterized an oxyimino-cephalosporin resistant <span class="elsevierStyleItalic">S.</span> Heidelberg isolate recovered from an inpatient in a Buenos Aires hospital. CMY-2 was responsible for the β-lactam resistance profile. <span class="elsevierStyleItalic">S.</span> Heidelberg contained a 97<span class="elsevierStyleHsp" style=""></span>kb plasmid belonging to the Inc N group harboring <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>. IS<span class="elsevierStyleItalic">Ecp1</span> was located upstream <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> driving its expression and mobilization. The isolate belonged to sequence type 15 and virotyping revealed the presence of <span class="elsevierStyleItalic">sopE</span> gene. In this study we identified the first CMY-2 producing isolate of <span class="elsevierStyleItalic">S.</span> Heidelberg in Argentina and even in South America.</p></span>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Salmonella enterica</span> serovar Heidelberg es uno de los principales agentes causantes de salmonelosis en humanos en Estados Unidos y Canadá, sin embargo, resulta infrecuente en los países de Sudamérica y Europa. En este trabajo se caracterizó un aislamiento de <span class="elsevierStyleItalic">S.</span> Heidelberg resistente a oximino-cefalosporinas recuperado de un paciente internado<a name="p31"></a> en un hospital de la Ciudad de Buenos Aires. Se evidenció la presencia de un plásmido de 97<span class="elsevierStyleHsp" style=""></span>kb perteneciente al grupo de incompatibilidad IncN, portador del gen <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>. IS<span class="elsevierStyleItalic">Ecp1</span> fue localizado corriente arriba de <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>, promoviendo su expresión y movilización. El aislamiento de <span class="elsevierStyleItalic">S.</span> Heidelberg correspondió al secuenciotipo 15 y en la virotipificación se detectó el gen <span class="elsevierStyleItalic">sopE</span>. En este trabajo describimos por primera vez la producción de CMY-2 en una cepa de <span class="elsevierStyleItalic">S.</span> Heidelberg en nuestro país y América Latina.</p></span>" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 515 "Ancho" => 1886 "Tamanyo" => 64045 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Genetic context of <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span>. ISE<span class="elsevierStyleItalic">cp1</span>: Insertion sequence <span class="elsevierStyleItalic">Ecp1, blc</span>: gene encoding for outer membrane lipoprotein,(lipocalin); <span class="elsevierStyleItalic">sugE</span>: gene encoding for small multidrug resistance protein; <span class="elsevierStyleItalic">ecnR</span>: coding gene for a transcriptional regulatory protein, entericidinR.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:15 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic characterization of clinical and agri-food isolates of multi drug resistant <span class="elsevierStyleItalic">Salmonella enterica</span> serovar Heidelberg from Canada" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "A.K. Andrysiak" 1 => "A.B. Olson" 2 => "D.M. Tracz" 3 => "K. Dore" 4 => "R. Irwin" 5 => "L.K. Ng" 6 => "M.W. Gilmour" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1471-2180-8-89" "Revista" => array:5 [ "tituloSerie" => "BMC Microbiol" "fecha" => "2008" "volumen" => "8" "paginaInicial" => "89" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18538029" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of plasmids by PCR-based replicon typing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Carattoli" 1 => "A. Bertini" 2 => "L. Villa" 3 => "V. Fal bo" 4 => "K.L. Hopkins" 5 => "E.J. Threlfall" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.mimet.2005.03.018" "Revista" => array:6 [ "tituloSerie" => "J Microbiol Methods" "fecha" => "2005" "volumen" => "63" "paginaInicial" => "219" "paginaFinal" => "228" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15935499" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Resistance plasmid fami lies in <span class="elsevierStyleItalic">Enterobacteriaceae</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. Carattoli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AAC.01707-08" "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2009" "volumen" => "53" "paginaInicial" => "2227" "paginaFinal" => "2238" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19307361" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Plasmid-encoded AmpC (pAmpC) in <span class="elsevierStyleItalic">Enterobacteriaceae</span>: epidemiology of microorganisms and resistance markers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:11 [ 0 => "D. Cejas" 1 => "L. Fernández Canigia" 2 => "M. Quinte ros" 3 => "M. Giovanakis" 4 => "C. Vay" 5 => "S. Lascialandare" 6 => "D. Mutti" 7 => "G. Pagniez" 8 => "M. Almuzara" 9 => "G. Gutkind" 10 => "M. Radice" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Argent Microbiol" "fecha" => "2012" "volumen" => "44" "paginaInicial" => "182" "paginaFinal" => "186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23102467" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5." "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Clinical and Laboratory Standards In stitute: Performance standards for antimicrobial susceptibility testing; 22nd informational supplement, 2012; M100-S22. Wayne, PA, USA." ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of the first <span class="elsevierStyleItalic">bla</span><span class="elsevierStyleInf">CMY-2</span> gene in <span class="elsevierStyleItalic">Salmonella enterica</span> serovar Typhimurium isolates obtained from cases of paediatric diarrhoea illness detected in South America" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:12 [ 0 => "Y.L. Cordeiro Nicolás" 1 => "L. Betancor" 2 => "D. Cej as" 3 => "V. García-Fulgueiras" 4 => "M. Mota" 5 => "G. Varela" 6 => "L. Anzalone" 7 => "G. Algorta" 8 => "G. Gutkind" 9 => "J. Ayala" 10 => "J. Chabalgoity" 11 => "R. Vignoli" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Global Antimicrob Resist" "fecha" => "2013" "volumen" => "1" "paginaInicial" => "143" "paginaFinal" => "148" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Frozen chicken nuggets and strips and eggs are leading risk factors for <span class="elsevierStyleItalic">Salmonella</span> Heidelberg infections in Canada" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Currie" 1 => "L. MacDougall" 2 => "J. Aramini" 3 => "C. Gau lin" 4 => "R. Ahmed" 5 => "S. Isaacs" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1017/S0950268805004383" "Revista" => array:6 [ "tituloSerie" => "Epidemiol Infect" "fecha" => "2005" "volumen" => "133" "paginaInicial" => "809" "paginaFinal" => "816" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16181499" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of extended-spectrum cephalosporin-resistant <span class="elsevierStyleItalic">Salmonella enterica</span> serovar Heidelberg isolated from humans in the United States" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "J.P. Folster" 1 => "G. Pecic" 2 => "S. Bolcen" 3 => "L. Theobal d" 4 => "K. Hise" 5 => "A. Carattoli" 6 => "S. Zhao" 7 => "P.F. McDermott" 8 => "J.M. Whichard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/fpd.2009.0376" "Revista" => array:6 [ "tituloSerie" => "Foodborne Pathog Dis" "fecha" => "2010" "volumen" => "7" "paginaInicial" => "181" "paginaFinal" => "187" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19785533" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emergence of extended-spectrum β-lactamases and AmpC-type β-lactamases in human <span class="elsevierStyleItalic">Salmonella</span> isolated in Spain from 2001 to 2005" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R. Gonzalez-Sanz" 1 => "S. Herrera-Leon" 2 => "M. de la Fuente" 3 => "M. Arroyo" 4 => "M.A. Echeita" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkp361" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2009" "volumen" => "64" "paginaInicial" => "1181" "paginaFinal" => "1186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19815633" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA sequence analysis of plasmids from multidrug resistant <span class="elsevierStyleItalic">Salmonella enterica</span> serotype Heidelberg isolates" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "J. Han" 1 => "A.M. Lynne" 2 => "D.E. David" 3 => "H. Tang" 4 => "J. Xu" 5 => "R. Nayak" 6 => "P. Kaldhone" 7 => "C.M. Logue" 8 => "S.L. Foley" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0051160" "Revista" => array:5 [ "tituloSerie" => "PloS one." "fecha" => "2012" "volumen" => "7" "paginaInicial" => "e51160" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23251446" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">S</span>. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "W.D. Hardt" 1 => "L.M. Chen" 2 => "K.E. Schuebel" 3 => "X.R. Buste lo" 4 => "J.E. Galan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cell" "fecha" => "1998" "volumen" => "93" "paginaInicial" => "815" "paginaFinal" => "826" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9630225" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "SugE, a new member of the SMR family of transporters, contributes to antimicrobial resistance in <span class="elsevierStyleItalic">Enterobacter cloacae</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "G.X. He" 1 => "C. Zhang" 2 => "R.R. Crow" 3 => "C. Thorpe" 4 => "H. Ch en" 5 => "S. Kumar" 6 => "T. Tsuchiya" 7 => "M.F. Varela" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AAC.00094-11" "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2011" "volumen" => "55" "paginaInicial" => "3954" "paginaFinal" => "3957" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21576447" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Variabil ity in the region downstream of the <span class="elsevierStyleItalic">bla</span>CMY-2 β-lactamase gene in <span class="elsevierStyleItalic">Escherichia coli</span> and <span class="elsevierStyleItalic">Salmonella enterica</span> plasmids" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.S. Kang" 1 => "T.E. Besser" 2 => "D.R. Call" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AAC.50.4.1590-1593.2006" "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2006" "volumen" => "50" "paginaInicial" => "1590" "paginaFinal" => "1593" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16569893" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Imipenem resistance in a <span class="elsevierStyleItalic">Salmonella</span> clinical strain due to plasmid-mediated class A carbapenemase KPC-2" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "V. Miriagou" 1 => "L.S. Tzouvelekis" 2 => "S. Rossiter" 3 => "E. Tzelepi" 4 => "F.J. Angulo" 5 => "J.M. Whichard" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2003" "volumen" => "47" "paginaInicial" => "1297" "paginaFinal" => "1300" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12654661" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F.J. Pérez-Pérez" 1 => "N.D. Hanson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2002" "volumen" => "40" "paginaInicial" => "2153" "paginaFinal" => "2162" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12037080" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack214231" "titulo" => "Acknowledgements" "texto" => "<p id="par0095" class="elsevierStylePara elsevierViewall">This work was partially supported by Grants from UBACyT and ANPCyT to M. Radice and G. Gutkind. G. Gutkind and M. Radice are members of Carrera del Investigador Científico (CONICET). D. Cejas was recipient of a doctoral fellowship from CONICET and is now recipient of a postdoctoral fellowship from Fundación Bunge y Born.</p> <p id="par0100" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">Conflicts of interest</span></p> <p id="par0090" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000004600000001/v2_201605140103/S0325754114700446/v2_201605140103/en/main.assets" "Apartado" => array:4 [ "identificador" => "17603" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Agentes antimicrobianos" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004600000001/v2_201605140103/S0325754114700446/v2_201605140103/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754114700446?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 3 | 0 | 3 |
| 2024 October | 26 | 5 | 31 |
| 2024 September | 30 | 5 | 35 |
| 2024 August | 28 | 3 | 31 |
| 2024 July | 31 | 6 | 37 |
| 2024 June | 16 | 1 | 17 |
| 2024 May | 32 | 6 | 38 |
| 2024 April | 23 | 3 | 26 |
| 2024 March | 34 | 6 | 40 |
| 2024 February | 16 | 4 | 20 |
| 2024 January | 22 | 14 | 36 |
| 2023 December | 20 | 6 | 26 |
| 2023 November | 27 | 10 | 37 |
| 2023 October | 24 | 10 | 34 |
| 2023 September | 23 | 5 | 28 |
| 2023 August | 25 | 12 | 37 |
| 2023 July | 19 | 11 | 30 |
| 2023 June | 25 | 6 | 31 |
| 2023 May | 49 | 13 | 62 |
| 2023 April | 69 | 5 | 74 |
| 2023 March | 37 | 4 | 41 |
| 2023 February | 21 | 7 | 28 |
| 2023 January | 9 | 2 | 11 |
| 2022 December | 22 | 14 | 36 |
| 2022 November | 19 | 8 | 27 |
| 2022 October | 28 | 17 | 45 |
| 2022 September | 23 | 10 | 33 |
| 2022 August | 24 | 12 | 36 |
| 2022 July | 32 | 7 | 39 |
| 2022 June | 21 | 6 | 27 |
| 2022 May | 27 | 13 | 40 |
| 2022 April | 27 | 7 | 34 |
| 2022 March | 43 | 13 | 56 |
| 2022 February | 21 | 10 | 31 |
| 2022 January | 16 | 8 | 24 |
| 2021 December | 17 | 16 | 33 |
| 2021 November | 11 | 10 | 21 |
| 2021 October | 17 | 14 | 31 |
| 2021 September | 11 | 12 | 23 |
| 2021 August | 16 | 13 | 29 |
| 2021 July | 8 | 9 | 17 |
| 2021 June | 10 | 12 | 22 |
| 2021 May | 16 | 10 | 26 |
| 2021 April | 48 | 37 | 85 |
| 2021 March | 17 | 11 | 28 |
| 2021 February | 11 | 12 | 23 |
| 2021 January | 10 | 12 | 22 |
| 2020 December | 13 | 12 | 25 |
| 2020 November | 11 | 10 | 21 |
| 2020 October | 7 | 5 | 12 |
| 2020 September | 13 | 11 | 24 |
| 2020 August | 13 | 9 | 22 |
| 2020 July | 11 | 6 | 17 |
| 2020 June | 13 | 15 | 28 |
| 2020 May | 17 | 7 | 24 |
| 2020 April | 11 | 9 | 20 |
| 2020 March | 14 | 9 | 23 |
| 2020 February | 14 | 10 | 24 |
| 2020 January | 15 | 12 | 27 |
| 2019 December | 13 | 10 | 23 |
| 2019 November | 14 | 6 | 20 |
| 2019 October | 7 | 5 | 12 |
| 2019 September | 12 | 13 | 25 |
| 2019 August | 9 | 3 | 12 |
| 2019 July | 15 | 6 | 21 |
| 2019 June | 41 | 18 | 59 |
| 2019 May | 102 | 37 | 139 |
| 2019 April | 55 | 7 | 62 |
| 2019 March | 3 | 0 | 3 |
| 2019 February | 6 | 2 | 8 |
| 2019 January | 7 | 0 | 7 |
| 2018 December | 1 | 3 | 4 |
| 2018 November | 9 | 7 | 16 |
| 2018 October | 7 | 21 | 28 |
| 2018 September | 19 | 5 | 24 |
| 2018 August | 3 | 12 | 15 |
| 2018 July | 3 | 14 | 17 |
| 2018 June | 6 | 8 | 14 |
| 2018 May | 10 | 14 | 24 |
| 2018 April | 11 | 2 | 13 |
| 2018 March | 9 | 3 | 12 |
| 2018 February | 3 | 4 | 7 |
| 2018 January | 6 | 1 | 7 |
| 2017 December | 6 | 2 | 8 |
| 2017 November | 10 | 0 | 10 |
| 2017 October | 10 | 9 | 19 |
| 2017 September | 6 | 2 | 8 |
| 2017 August | 5 | 5 | 10 |
| 2017 July | 8 | 2 | 10 |
| 2017 June | 8 | 8 | 16 |
| 2017 May | 20 | 9 | 29 |
| 2017 April | 9 | 1 | 10 |
| 2017 March | 12 | 118 | 130 |
| 2017 February | 15 | 10 | 25 |
| 2017 January | 10 | 5 | 15 |
| 2016 December | 13 | 1 | 14 |
| 2016 November | 18 | 2 | 20 |
| 2016 October | 22 | 3 | 25 |
| 2016 September | 15 | 6 | 21 |
| 2016 August | 15 | 7 | 22 |
| 2016 July | 22 | 1 | 23 |
| 2016 June | 20 | 8 | 28 |
| 2016 May | 9 | 3 | 12 |
Show all
