Epstein–Barr virus load in transplant patients: Early detection of post-transplant lymphoproliferative disorders

array:24 ["pii" => "S0325754116000110" "issn" => "03257541" "doi" => "10.1016/j.ram.2016.02.006" "estado" => "S300" "fechaPublicacion" => "2016-04-01" "aid" => "92" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2016" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:110-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1716 "formatos" => array:3 [ "EPUB" => 30 "HTML" => 971 "PDF" => 715 ] ] "itemSiguiente" => array:19 [ "pii" => "S0325754116000109" "issn" => "03257541" "doi" => "10.1016/j.ram.2016.02.005" "estado" => "S300" "fechaPublicacion" => "2016-04-01" "aid" => "91" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:119-21" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1350 "formatos" => array:3 [ "EPUB" => 31 "HTML" => 887 "PDF" => 432 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Informe breve" "titulo" => "Absceso de psoas por Staphylococcus lugdunensis" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "119" "paginaFinal" => "121" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Psoas abscess caused by Staphylococcus lugdunensis" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1275 "Ancho" => 1700 "Tamanyo" => 239135 ] ] "descripcion" => array:1 [ "es" => "A) Artritis infecciosa, dependiendo de la articulación facetaria derecha del nivel L4-L5, con colecciones abscesificadas en el área adyacente al músculo psoas derecho en L4-L5 (flecha), y en el espacio epidural izquierdo en L5-S1, con afectación de partes blandas adyacentes (punta de flecha). B) Desaparición de las colecciones abscesificadas (flecha). Persistencia de alteración de señal de la articulación facetaria L4-L5, y mínimo edema de partes blandas (punta de flecha)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "María Tamargo Delpón, Pablo Demelo-Rodríguez, Juan Carlos Cano Ballesteros, Laura Vela de la Cruz" "autores" => array:4 [ 0 => array:2 [ "nombre" => "María" "apellidos" => "Tamargo Delpón" ] 1 => array:2 [ "nombre" => "Pablo" "apellidos" => "Demelo-Rodríguez" ] 2 => array:2 [ "nombre" => "Juan Carlos" "apellidos" => "Cano Ballesteros" ] 3 => array:2 [ "nombre" => "Laura" "apellidos" => "Vela de la Cruz" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754116000109?idApp=UINPBA00004N" "url" => "/03257541/0000004800000002/v1_201607030039/S0325754116000109/v1_201607030039/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S032575411600002X" "issn" => "03257541" "doi" => "10.1016/j.ram.2015.12.003" "estado" => "S300" "fechaPublicacion" => "2016-04-01" "aid" => "83" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:105-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1430 "formatos" => array:3 [ "EPUB" => 40 "HTML" => 1112 "PDF" => 278 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Brief reports" "titulo" => "Arcobacter butzleri survives within trophozoite of Acanthamoeba castellanii" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "105" "paginaFinal" => "109" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Arcobacter butzleri sobrevive en el interior de trofozoitos de Acanthamoeba castellanii" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1009 "Ancho" => 2040 "Tamanyo" => 261224 ] ] "descripcion" => array:1 [ "en" => "Phase contrast microscopy. (A) Trophozoite of A. castellanii showing A. butzleri seen in close association with A. castellanii gathering at one pole of the amoeba cell known as food-cup (30min of co-incubation). (B) Trophozoite of A. castellanii showing A. butzleri within the amoebic vacuoles (50min of co-incubation)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "María P. Villanueva, Gustavo Medina, Heriberto Fernández" "autores" => array:3 [ 0 => array:2 [ "nombre" => "María P." "apellidos" => "Villanueva" ] 1 => array:2 [ "nombre" => "Gustavo" "apellidos" => "Medina" ] 2 => array:2 [ "nombre" => "Heriberto" "apellidos" => "Fernández" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S032575411600002X?idApp=UINPBA00004N" "url" => "/03257541/0000004800000002/v1_201607030039/S032575411600002X/v1_201607030039/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Epstein–Barr virus load in transplant patients: Early detection of post-transplant lymphoproliferative disorders" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "110" "paginaFinal" => "118" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "María Dolores Fellner, Karina A. Durand, Veronica Solernou, Andrea Bosaleh, Ziomara Balbarrey, María T. García de Dávila, Marcelo Rodríguez, Lucía Irazu, Lidia V. Alonio, María A. Picconi" "autores" => array:10 [ 0 => array:4 [ "nombre" => "María Dolores" "apellidos" => "Fellner" "email" => array:1 [ 0 => "oncovir1@anlis.gov.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Karina A." "apellidos" => "Durand" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Veronica" "apellidos" => "Solernou" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Andrea" "apellidos" => "Bosaleh" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "Ziomara" "apellidos" => "Balbarrey" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 5 => array:3 [ "nombre" => "María T." "apellidos" => "García de Dávila" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 6 => array:3 [ "nombre" => "Marcelo" "apellidos" => "Rodríguez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 7 => array:3 [ "nombre" => "Lucía" "apellidos" => "Irazu" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 8 => array:3 [ "nombre" => "Lidia V." "apellidos" => "Alonio" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 9 => array:3 [ "nombre" => "María A." "apellidos" => "Picconi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Oncogenic Viruses Service, Virology Department, “Carlos G. Malbrán” National Institute of Infectious Diseases, Av. Vélez Sársfield 563, C1282AFF Buenos Aires, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Pathology Service, “Prof. Dr. Juan. P. Garrahan” National Pediatrics Hospital, Pichincha 1890, C1249ABP Buenos Aires, Argentina" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Operational Team Quality Management, Parasitology Department, “Carlos G. Malbrán” National Institute of Infectious Diseases, Av. Vélez Sársfield 563, C1282AFF Buenos Aires, Argentina" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Carga de virus Epstein-Barr en pacientes trasplantados: detección temprana de desórdenes linfoproliferativos postrasplante" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 697 "Ancho" => 2532 "Tamanyo" => 132852 ] ] "descripcion" => array:1 [ "en" => "Analysis of the EBV load from plasma samples. The plasma EBV load showed high specificity to detect all PTLD; while an increasing sensitivity was noted as PTLD stages progressed. Total PTLD: included categories 1–4 (A); advanced PTLD: categories 2–4 (B)." ] ] ] "textoCompleto" => "IntroductionThe Epstein–Barr virus (EBV) infection is associated with the development of post-transplant lymphoproliferative disorders (PTLD) in solid-organ and stem cell transplant recipients<a class="elsevierStyleCrossRef" href="#bib0200">17</a>.PTLD encompass a wide range of disorders including benign to malignant lymphoproliferations<a class="elsevierStyleCrossRef" href="#bib0225">22</a>. Briefly, category 1 includes early benign PTLD; category 2, benign and neoplastic PTLD and categories 3 and 4, neoplastic PTLD. It had been noted that a therapeutic intervention, particularly during the early PTLD phases, could reverse lymphoproliferation and prevent progression to the irreversible lymphoma stage<a class="elsevierStyleCrossRef" href="#bib0130">3</a>.The association of PTLD and elevated levels of circulating EBV were first described in the nineties<a class="elsevierStyleCrossRef" href="#bib0205">18</a>. Since then, different authors showed that PTLD, especially those occurring early after transplantation, are generally associated with an increase in EBV DNA in peripheral blood samples. This has led to using the EBV load as a risk marker for this disease<a class="elsevierStyleCrossRefs" href="#bib0150">7,8,10</a>.Initially, many studies explored the clinical usefulness of these tests in a single sample in the presence of disease<a class="elsevierStyleCrossRefs" href="#bib0210">19,20</a>. Then, the importance of surveillance through frequent repetitive monitoring was brought up<a class="elsevierStyleCrossRef" href="#bib0170">11</a>. At present, a high viral load is used for two purposes: an early diagnosis (indicating when to start the search for disease in a potential site), and as a prevention strategy (indicating when to therapeutically intervene)<a class="elsevierStyleCrossRefs" href="#bib0145">6,10</a>. Furthermore, some authors have proposed to calculate an average load in a set time, rather than use a single cut-off value<a class="elsevierStyleCrossRef" href="#bib0145">6</a>. Thus, a reduction in PTLD morbidity and mortality was reported in centers that had implemented systematic EBV load monitoring, and the viral burden was maintained at levels defined as “low”, by regulating the degree of immunosuppression<a class="elsevierStyleCrossRef" href="#bib0175">12</a>.In the literature, the definition of a threshold indicative of a “high load” is inconsistent because each laboratory has implemented its own cut-off values to distinguish PTLD from baseline levels<a class="elsevierStyleCrossRef" href="#bib0180">13</a>. The broad diversity of methods (type of quantitative PCR, amplified viral fragment), type and quantity of clinical sample analyzed (peripheral blood mononuclear cells, PBMC; whole blood; plasma), controls used to standardize assays, expression of results (number of viral genome equivalents per number of cells, DNA quantity, volume), sampling frequency, among others, have made it difficult to compare published data and extrapolate cut-off values from one laboratory to another. Therefore, the overall sensitivity, specificity, positive and negative predictive values obtained by different authors relied on the population studied (adult vs. pediatric), type of transplanted organ (solid organ vs. stem cells), pre-transplant infection status, among others.An assay to quantify EBV by real-time PCR was developed in our laboratory to monitor transplant patients<a class="elsevierStyleCrossRef" href="#bib0140">5</a>. Thus, considering the lack of consensus on the EBV level that identifies PTLD, the optimal type of clinical sample, and using the logistics implemented to handle transplant patients’ samples in our laboratory (already underway using a semi-quantitative PCR)<a class="elsevierStyleCrossRef" href="#bib0135">4</a>, the EBV load in this report was analyzed in different clinical specimens, which also represent anatomical sites of viral persistence. Therefore, the aim of this study was to clinically validate the developed EBV quantification assay for the early detection of PTLD in transplant patients.Materials and methodsPatients and samplesPediatric recipients of solid organ transplants treated at “Prof. Dr Juan P. Garrahan” Pediatric Hospital, Austral University Hospital, Sor María Ludovica Children's Hospital and Favaloro Foundation between 2001 and 2010 were selected for inclusion in the present study. All patients were found to be infected with EBV, as established by the previous detection of IgG antibodies against viral capsid antigen and/or EBV-DNA in PBMC. Samples were obtained according to the monitoring of transplanted patients or treatment protocol and their selection was based on clinical data (presence or absence of signs and symptoms associated with EBV infection), previous EBV load results acquired by semi-quantitative PCR<a class="elsevierStyleCrossRef" href="#bib0135">4</a> (including varying EBV load levels: low, high and very high) and histopathological examination of biopsy material (PTLD or a different diagnosis based on the corresponding lymphoid tissue).An informed consent was obtained from all patients in accordance with the Helsinki declaration and other national or international regulations. All procedures were approved by the Ethical Research Committee, National Center of Medical Genetics, ANLIS “Dr. Carlos G. Malbrán”.Transversal study designPaired peripheral blood and oropharyngeal lymphoid tissue (OLT) samples from 105 pediatric solid-organ transplant recipients were included. Fifty-eight of them were histologically diagnosed with PTLD, according to the World Health Organization classification: IARC, 2008<a class="elsevierStyleCrossRef" href="#bib0225">22</a> (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>).<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Retrospective follow-up study designSeventy one paired PBMC and plasma samples were included from six organ recipients with a histological diagnosis of PTLD, and six transplant patients with a variety of clinical conditions associated with EBV, but not with PTLD.PBMC and plasma were separated from 2.5 to 5ml of EDTA-anticoagulated whole blood samples by centrifugation on a density gradient (Histopaque-1077, Sigma–Aldrich) as recommended, and then stored at −20°C. The OLT from patients with lymphoid hypertrophy were surgically removed and immediately stored at −80°C.DNA extractionDNA from PBMC and OLT samples was obtained as previously reported<a class="elsevierStyleCrossRef" href="#bib0135">4</a>.Plasma DNA was extracted using the QIAmp DNA mini kit (QIAgen, Hilden, Germany) following manufacturers’ recommendations for free viral DNA extraction.EBV DNA quantificationWe applied a duplex real-time PCR assay that simultaneously amplifies an EBNA-1 coding gene portion and one of the human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) encoding genes; the amplification was performed as previously described<a class="elsevierStyleCrossRef" href="#bib0140">5</a>.The primers/probes were as follows:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">EBV reaction: 5′ CCGCTCCTACCTGCAATATCA 3′ (forward primer) and 5′ GGAAACCAGGGAGGCAAATC 3′ (reverse primer); 5′ VIC-TGCAGCTTTGACGATGG-MGB 3′ (probe). They amplified a 73bp fragment.</li><li class="elsevierStyleListItem" id="lsti0010">GAPDH reaction: 5′ GGTGGTCTCCTCTGACTTCAACA 3′ (forward primer); 5′ GTGGTCGTTGAGGGCAATG 3′ (reverse primer) and 5′ FAM-CCACTCCTCCACCTTTGACGCTGG-3′ TAMRA (probe). They amplified a 79bp fragment.</li></ul>Amplification was performed in a final reaction volume of 25μl, containing 1× TaqMan Universal Master Mix with AmpErase UNG (Applied Biosystems, New Jersey, USA), 0.3μM of EBV-primers, 0.05μM of GAPDH-primers, 0.1μM of EBV-probe and GAPDH-probe (Applied Biosystems, Foster city, USA) and the DNA to be amplified.For each reaction around 366ng of DNA were assayed (corresponding to the amount of DNA of 105 human cells<a class="elsevierStyleCrossRef" href="#bib0135">4</a>) from PBMC or OLT or the extracted DNA from 30μl of plasma. The amplification was performed using a 7500 real-time PCR System (Applied Biosystems) under the following cycle conditions: 50°C 2min; 95°C 10min followed by 45 cycles of 95°C 15s, 60°C 1min.The EBV load measured in PBMC DNA was expressed as the number of EBV genome equivalents (gEq) per 105 PBMC. The normalized EBV load was estimated from the results of the EBNA-1 and GAPDH reactions (EBNA−1 load/GAPDH load×105). The EBV load in plasma was expressed as the number of EBV gEq per ml of plasma by multiplying the EBNA-1 load by a factor of 33.3 and correcting by extraction efficiency.Kinetic variation was defined as a greater than 0.5log unit increase or decrease with respect to the EBV load measured in a previous sample. This implies a load variation greater than the overall precision of the method<a class="elsevierStyleCrossRef" href="#bib0140">5</a> and also relies on the concept that a difference higher than 0.5log units is clinically significant<a class="elsevierStyleCrossRef" href="#bib0160">9</a>.Clinical validationTransversal study: it was done in order to analyze the diagnostic performance of different cut-off values as PTLD indicators. The diagnostic ability of the assay for detecting total PTLD (including categories 1–4), advanced PTLD (categories 2–4), or neoplastic PTLD (categories 3 and 4) cases (positive reference population) was evaluated analyzing the sensitivity and specificity of different EBV load levels. The organ recipients without PTLD were considered the negative reference population. Paired PBMC, plasma and OLT samples were analyzed. The viral load corresponding to the cross-point between sensitivity and specificity was considered the most efficient cut-off value.Retrospective follow-up study: the purpose of the retrospective follow-up study was to analyze the usefulness of the EBV load variation as PTLD indicator. The diagnostic ability of the EBV load kinetic variation for detecting total PTLD was evaluated in samples taken before and at the moment of the diagnosis for PTLD cases, and between successive samples for organ recipients without a PTLD history. The analysis was run on paired PBMC and plasma samples.Statistical analysisSensitivity, specificity, positive and negative predictive values were calculated applying the Describe program, version 2.41, from the software package WinPEPI, version 11.14.ResultsThe EBV load measured in PBMC, plasma and OLT samples from transplant patients with and without PTLD diagnosis is shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>A–C, respectively.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Clinical validationTransversal designPeripheral blood mononuclear cellsThe analysis of the ability of PBMC-measured EBV load to identify PTLD is shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>. The highest diagnostic efficacy for the detection of total PTLD is achieved at a cut-off value of 1.08log gEq per 105 PBMC (A); for advanced PTLD, at a cut-off of 1.60log gEq per 105 PBMC (B), and for neoplastic PTLD, at a cut-off of 2.47log gEq per 105 PBMC (C).<elsevierMultimedia ident="fig0010"></elsevierMultimedia>Plasma<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a> describes the sensitivity and specificity of EBV levels in plasma samples for PTLD diagnosis. The EBV load in plasma samples showed low sensitivity and high specificity to detect total PTLD (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A). While increased sensitivity, maintaining high specificity, was observed for the detection of advanced PTLD (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>B), similar results were obtained when analyzing only neoplastic PTLD (data not shown).<elsevierMultimedia ident="fig0015"></elsevierMultimedia>Lymphoid tissueThe best relations between sensitivity (Se) and specificity (Sp) for the detection of total, advanced or neoplastic PTLD were obtained at cut-off values of 2.30log (Se=57.4% and Sp=55.5%), 2.60log (Se=63.6% and Sp=66.7%) or 4.48log gEq per 105 cells (Se=100% and Sp=100%), respectively (data not shown).Combination of several samplesIn order to improve the diagnostic performance for PTLD detection, the combination of the EBV load measured in different anatomical sites of viral persistence was analyzed (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>). The most effective total PTLD detection was obtained by co-measuring the EBV load in PBMC and plasma. However, the incorporation of the OLT viral load did not improve diagnostic eficcacy.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Retrospective follow-upResults from the retrospective follow-up study are shown in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a> and <a class="elsevierStyleCrossRefs" href="#tbl0015">Tables 3 and 4</a>. The determination of the kinetic load variation increased diagnostic efficacy compared to the use of a single cut-off value (<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>). Moreover, the co-measurement of the kinetic variation in more than one clinical sample improved the diagnostic ability of the assay.<elsevierMultimedia ident="fig0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0025"></elsevierMultimedia>DiscussionMany of the publications in which EBV load was used to identify PTLD were based on patients diagnosed with neoplastic categories<a class="elsevierStyleCrossRefs" href="#bib0185">14,15</a>. This would explain the high threshold levels applied by different laboratories, which could be considered consistent with those proposed in the present study for identifying neoplastic lymphoproliferations (transversal study). Thus, considering the present data, the highest EBV levels would be particularly associated with neoplasia. The definition of high load based on a cut-off value that detects neoplastic cases may not be useful for prevention purposes. In such sense, few reports exist that describe the amount of EBV associated with the different categories of PTLD<a class="elsevierStyleCrossRef" href="#bib0220">21</a>. According to the present results, early PTLD stages tend to show a number of EBV genomes in all anatomical sites of viral persistence, lower than that observed in neoplastic categories (transversal study).Therefore, considering that the aim of the EBV quantification in transplant patients is to detect the onset of lymphoproliferation, we wondered which monitoring strategy would be the best. Thus, a cut-off of 2.48log gEq per 105 PBMC would point to neoplastic PTLD patients, but many cases with less advanced stages would be missed. A cut-off value of 1.08log gEq per 105 PBMC would detect the majority of organ recipients with PTLD, but would also include many without PTLD.It has already been proposed that a high EBV load in plasma is a more specific PTLD marker than its determination in PBMC<a class="elsevierStyleCrossRef" href="#bib0230">23</a>; however, it is also less sensitive<a class="elsevierStyleCrossRef" href="#bib0120">1</a>. According to the present transversal study, the detection of EBV DNA in plasma samples appears to be a sensitive and specific indicator of advanced PTLD, albeit very insensitive to identify early phases. In addition, as noted in the retrospective follow-up (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>), two patients showed undetectable EBV load in plasma at PTLD diagnosis, one in category 1 (case F) and one even in a neoplastic stage (case E).The levels of EBV in lymphoid tissue are not usually analyzed to detect PTLD since peripheral blood samples are less invasive and more easily available. In this respect, the present data showed that a high amount of EBV DNA in lymphoid tissue exhibits the highest ability for neoplastic PTLD detection, but not for less advanced categories.In most reports, the determination of an increased EBV load in a single blood sample type is used for PTLD identification<a class="elsevierStyleCrossRef" href="#bib0120">1</a>; however it has also been suggested that the simultaneous evaluation of whole blood and plasma samples allows for better diagnosis and monitoring, and may be used to rule out their presence<a class="elsevierStyleCrossRef" href="#bib0230">23</a>. Thus, among all the combinations analyzed in the present report, the simultaneous measurement of EBV load in PBMC and plasma resulted in a greater diagnostic efficacy regarding the quantification of a single sample type (transversal study).Moreover, as the retrospective follow-up showed the kinetic variation of the EBV levels measured in PBMC or plasma, it evidenced a better diagnostic ability than the use of a single cut-off value; these results are consistent with already reported data<a class="elsevierStyleCrossRef" href="#bib0145">6</a>. Furthermore, an increased risk of PTLD was demonstrated when detecting viral level variations in patients with persistent high EBV loads<a class="elsevierStyleCrossRef" href="#bib0125">2</a>.Therefore, it has been concluded that the best strategy to monitor transplant patients, regarding the detection of the early stages of PTLD and the risk of progressing to neoplastic categories would include the following algorithm. Initially, it includes the monitoring of the EBV load in PBMC, taking into account that:<ul class="elsevierStyleList" id="lis0010"><li class="elsevierStyleListItem" id="lsti0015">(1)An EBV load below 1.08log gEq per 105 PBMC implies low risk. Thus, the patient's routine monitoring should be continued.</li><li class="elsevierStyleListItem" id="lsti0020">(2)An EBV load between 1.08log and 2.48log gEq per 105 PBMC involves an increased risk. A more frequent monitoring of the EBV load in PBMC is required to detect a kinetic variation, plus the monitoring of viral levels in plasma. The detection of a kinetic variation in PBMC and/or an EBV load in plasma greater than 2log gEq/ml involves high PTLD risk.</li><li class="elsevierStyleListItem" id="lsti0025">(3)An EBV load above 2.48log gEq per 105 PBMC plus the detection of viral levels greater than 2.52log gEq/ml in plasma imply a high risk of neoplastic PTLD. The greater the EBV load and/or the simultaneous detection of a kinetic variation, the greater the risk of neoplastic PTLD stages.</li></ul>It should be borne in mind that the algorithm requires some consideration. Firstly, the overlap in the EBV DNA levels in PBMC among transplant patients with and without PTLD. It should be noted that according to the present results and coinciding with other authors<a class="elsevierStyleCrossRef" href="#bib0185">14</a>, not all EBV loads defined as “high” imply the development of PTLD.Carefully monitoring an organ recipient with a low or moderate EBV load is also suggested, since a small increase in viral levels may be associated with PTLD, as was observed in this study and previously reported ones<a class="elsevierStyleCrossRef" href="#bib0195">16</a>.The suggested algorithm aims to identify PTLD in the most effective way; however there are patients with PTLD that remain undetected and recipients without PTLD who are included as risky. This points to the need for more specific markers that, when combined with the viral load, result in a more accurate selection of cases of incipient PTLD, allowing to reverse lymphoproliferation in its initial stages.It should be mentioned that the study presented some limitations. One of them is the variety of transplanted organs included, as they show different PTLD prevalence. However, as the EBV levels in healthy carriers were known<a class="elsevierStyleCrossRef" href="#bib0140">5</a>, the initial point of rising load (shared by all the transplanted organ groups) could be identified. Furthermore, the number of patients included into each PTLD category was quite different, being the initial stages of PTLD (category 1) the broader. Such category 1 just depicted the beginning of the lymphoproliferation process, which was the aim of the present study; however, all stages of the process were analyzed separately in order to describe the differences among them.Finally, considering that the determination of the EBV load lacks a gold standard strategy worldwide, this paper provides an in-house methodology, which is analytical, clinically validated, less expensive and more accessible than commercial assays. Thus, it may represent an initial, but very helpful step for the monitoring of transplant patients, especially in low resource settings, where commercial kits are not affordable.Ethical disclosuresProtection of human and animal subjectsThe authors declare that the procedures followed were in accordance with the regulations of the responsible Clinical Research Ethics Committee and in accordance with those of the World Medical Association and the Helsinki Declaration.Confidentiality of dataThe authors declare that they have followed the protocols of their work centre on the publication of patient data.Right to privacy and informed consentThe authors must have obtained the informed consent of the patients and/or subjects mentioned in the article. The author for correspondence must be in possession of this document.Conflict of interestThe authors declare that they have no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres680254" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec686106" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres680255" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec686105" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Patients and samples" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Transversal study design" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Retrospective follow-up study design" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "DNA extraction" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "EBV DNA quantification" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Clinical validation" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0050" "titulo" => "Results" "secciones" => array:1 [ 0 => array:3 [ "identificador" => "sec0055" "titulo" => "Clinical validation" "secciones" => array:2 [ 0 => array:3 [ "identificador" => "sec0060" "titulo" => "Transversal design" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0065" "titulo" => "Peripheral blood mononuclear cells" ] 1 => array:2 [ "identificador" => "sec0070" "titulo" => "Plasma" ] 2 => array:2 [ "identificador" => "sec0075" "titulo" => "Lymphoid tissue" ] 3 => array:2 [ "identificador" => "sec0080" "titulo" => "Combination of several samples" ] ] ] 1 => array:2 [ "identificador" => "sec0085" "titulo" => "Retrospective follow-up" ] ] ] ] ] 7 => array:2 [ "identificador" => "sec0090" "titulo" => "Discussion" ] 8 => array:3 [ "identificador" => "sec0095" "titulo" => "Ethical disclosures" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0100" "titulo" => "Protection of human and animal subjects" ] 1 => array:2 [ "identificador" => "sec0105" "titulo" => "Confidentiality of data" ] 2 => array:2 [ "identificador" => "sec0110" "titulo" => "Right to privacy and informed consent" ] ] ] 9 => array:2 [ "identificador" => "sec0115" "titulo" => "Conflict of interest" ] 10 => array:2 [ "identificador" => "xack229395" "titulo" => "Acknowledgements" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2015-08-21" "fechaAceptado" => "2016-02-21" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec686106" "palabras" => array:6 [ 0 => "Epstein–Barr virus" 1 => "Early PTLD detection" 2 => "Lymphoma" 3 => "Real-time PCR" 4 => "Transplant patients" 5 => "Viral load" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec686105" "palabras" => array:6 [ 0 => "Virus Epstein-Barr" 1 => "Detección temprana de PTLD" 2 => "Linfoma" 3 => "PCR en tiempo real" 4 => "Pacientes trasplantados" 5 => "Carga viral" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "High levels of circulating EBV load are used as a marker of post-transplant lymphoproliferative disorders (PTLD). There is no consensus regarding the threshold level indicative of an increase in peripheral EBV DNA. The aim of the study was to clinically validate a developed EBV quantification assay for early PTLD detection.Transversal study: paired peripheral blood mononuclear cells (PBMC), plasma and oropharyngeal lymphoid tissue (OLT) from children undergoing a solid organ transplant with (n=58) and without (n=47) PTLD. Retrospective follow-up: 71 paired PBMC and plasma from recipients with (n=6) and without (n=6) PTLD history. EBV load was determined by real-time PCR. The diagnostic ability to detect all PTLD (categories 1–4), advanced PTLD (categories 2–4) or neoplastic PTLD (categories 3 and 4) was estimated by analyzing the test performance at different cut-off values or with a load variation greater than 0.5log units.The higher diagnostic performance for identifying all, advanced or neoplastic PTLD, was achieved with cut-off values of 1.08; 1.60 and 2.47log EBVgEq/105 PBMC or 2.30; 2.60; 4.47loggEq/105 OLT cells, respectively. EBV DNA detection in plasma showed high specificity but low (all categories) or high (advanced/neoplastic categories) sensitivity for PTLD identification. Diagnostic performance was greater when: (1) a load variation in PBMC or plasma was identified; (2) combining the measure of EBV load in PBMC and plasma.The best diagnostic ability to identify early PTLD stages was achieved by monitoring EBV load in PBMC and plasma simultaneously; an algorithm was proposed." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "La carga alta del virus Epstein-Barr se utiliza como un marcador de desórdenes linfoproliferativos postrasplante (post-transplant lymphoproliferative disorders [PTLD]). El objetivo de este estudio fue validar clínicamente un ensayo de cuantificación del virus Epstein-Barr para la detección temprana de PTLD.Se efectuó un estudio transversal en el que se analizaron muestras pareadas de células mononucleares periféricas (CMP), de plasma y de tejido linfoide orofaríngeo de niños con trasplante de órgano sólido, con PTLD (n=58) y sin PTLD (n=47). En el seguimiento retrospectivo se incluyeron 71 muestras pareadas de CMP y de plasma de trasplantados, con PTLD (n=6) y sin PTLD (n=6). La carga viral se determinó por PCR en tiempo real. Se estimó la capacidad diagnóstica para detectar PTLD (categorías: todas vs. avanzadas vs. neoplásicas) analizando diferentes valores de corte o una variación de carga mayor de 0,5 logaritmos.El mayor desempeño diagnóstico para identificar todos los PTLD, los avanzados y los neoplásicos, se obtuvo con valores de corte de 1,08; 1,60 y 2,47 log copias/105 en CMP y de 2,30; 2,60 y 4,48 log copias/105 en células de tejido linfoide orofaríngeo, respectivamente. La detección del ADN del virus Epstein-Barr en el plasma mostró una especificidad alta, pero una sensibilidad baja (todas las categorías) o alta (categorías avanzadas o neoplásicas) para identificar PTLD. Se observó el desempeño diagnóstico más alto en las siguientes condiciones: 1) al identificar una variación de carga en CMP o en plasma; 2) combinando la medición de la carga viral en CMP y en plasma.La mejor capacidad diagnóstica para identificar las etapas tempranas de los PTLD se logró mediante el seguimiento simultáneo de la carga viral en CMP y en plasma; se propone un algoritmo." ] ] "multimedia" => array:9 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1401 "Ancho" => 2522 "Tamanyo" => 137904 ] ] "descripcion" => array:1 [ "en" => "EBV load in the transplanted population. (A) EBV load in peripheral blood mononuclear cells, PBMC; (B) EBV load in plasma; (C) EBV load in oropharyngeal lymphoid tissue cells, OLT." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1485 "Ancho" => 2530 "Tamanyo" => 228506 ] ] "descripcion" => array:1 [ "en" => "Analysis of the EBV load from PBMC samples. The best diagnostic performance of the PBMC EBV load to detect different PTLD categories required increasing cut-off values. (A) Total PTLD: included categories 1–4; (B) advanced PTLD: categories 2–4; (C) neoplastic PTLD: categories 3 and 4." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 697 "Ancho" => 2532 "Tamanyo" => 132852 ] ] "descripcion" => array:1 [ "en" => "Analysis of the EBV load from plasma samples. The plasma EBV load showed high specificity to detect all PTLD; while an increasing sensitivity was noted as PTLD stages progressed. Total PTLD: included categories 1–4 (A); advanced PTLD: categories 2–4 (B)." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1824 "Ancho" => 3396 "Tamanyo" => 442879 ] ] "descripcion" => array:1 [ "en" => "Kinetics of EBV load in PBMC and plasma from transplant patients. Recipients with PTLD history: (A–F) Patients without PTLD history: (G–L) FLH: follicular lymphoid hyperplasia. PH: plasmacytic hyperplasia. HL: Hodgkin lymphoma. DLCBL: Diffuse large B cell lymphoma. IS: immunosuppression. IM: infectious mononucleosis. KS: Kaposi's sarcoma. Tx: time of transplantation. EBV: detection of primary EBV infection. (■) EBV load from PBMC; (▴) EBV load from plasma; x axis: sampling times." ] ] 4 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "The age of the transplant population ranged between 1 and 18 years (mean: 9.0 years) and the male to female rate was 1.1." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Transplanted organ \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">Mean of the age at transplant (years) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Histology</th><th class="td" title="table-head " align="left" valign="top" scope="col">Mean of the time between transplant and PTLD diagnosis (month) \t\t\t\t\t\t\n \t\t\t\t</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Non-PTLD<a class="elsevierStyleCrossRef" href="#tblfn0005">a</a> (n) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PTLD<a class="elsevierStyleCrossRef" href="#tblfn0010">b</a> (n) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">LIVER (n=79) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3.0 (0.5–11) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">42 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">37 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">66 (20–156) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">KIDNEY (n=24) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">8.4 (2–12) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">54 (6–132) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HEART (n=2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">9.5 (9–10) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">66 (60–72) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1116578.png" ] ] ] "notaPie" => array:2 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "All patients presented a histological diagnosis of follicular lymphoid hyperplasia." ] 1 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "b" "nota" => "The PTLD cases included: Category 1: 40 lymphoid hyperplasia and 2 infectious mononucleosis-like PTLD; Category 2: 8 polymorphic and polyclonal hyperplasia; Category 3: 4 immunoblastic and 2 Burkitt lymphomas, and Category 4: 2 Hodgkin lymphomas." ] ] ] "descripcion" => array:1 [ "en" => "Description of the transplant population" ] ] 5 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "gEq: EBV genome equivalents." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Cut-off value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity<a class="elsevierStyleCrossRef" href="#tblfn0015">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity<a class="elsevierStyleCrossRef" href="#tblfn0020">b</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PPV<a class="elsevierStyleCrossRef" href="#tblfn0025">c</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">NPV<a class="elsevierStyleCrossRef" href="#tblfn0030">d</a> \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≥Log1.08gEq/105 PBMC+≥Log2.00/ml plasma \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">87.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">60.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">70.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">60.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≥Log1.08gEq/105 PBMC+≥Log2.30gEq/105 OLT<a class="elsevierStyleCrossRef" href="#tblfn0035">e</a> cells \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">67.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">52.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">80.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">35.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≥Log1.08gEq/105 PBMC+≥Log2.00gEq/ml plasma+≥Log2.30gEq/105 OLT<a class="elsevierStyleCrossRef" href="#tblfn0035">e</a> cells \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">72.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">47.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">79.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">34.6 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1116576.png" ] ] ] "notaPie" => array:5 [ 0 => array:3 [ "identificador" => "tblfn0015" "etiqueta" => "a" "nota" => "Sensitivity=[Number of true positives/(Number of true positives+Number of false negatives)]×100." ] 1 => array:3 [ "identificador" => "tblfn0020" "etiqueta" => "b" "nota" => "Specificity=[Number of true negatives/(Number of true negatives+Number of false positives)]×100." ] 2 => array:3 [ "identificador" => "tblfn0025" "etiqueta" => "c" "nota" => "Positive predictive value=[Number of true positives/(Number of true positives+Number of false positives)]×100." ] 3 => array:3 [ "identificador" => "tblfn0030" "etiqueta" => "d" "nota" => "Negative predictive value=[Number of true negatives/(Number of true negatives+Number of false negatives)]×100. For calculations, the histological diagnosis was considered the gold standard to which the EBV quantification load was compared." ] 4 => array:3 [ "identificador" => "tblfn0035" "etiqueta" => "e" "nota" => "OLT: oropharyngeal lymphoid tissue." ] ] ] "descripcion" => array:1 [ "en" => "Diagnostic performance of the EBV load measured on several sample types for PTLD detection" ] ] 6 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "PH: plasmacytic hyperplasia (Category 1 of PTLD); HL: Hodgkin lymphoma (Category 4 of PTLD); DLCBL: Diffuse large B cell lymphoma (Category 3 of PTLD).NA: Not applicable because EBV load remained not detectable." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Patients \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Histological diagnosis \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0040">a</a> PBMC (log differences) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0040">a</a> Plasma (log differences) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">PH HL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−1.34) Positive (0.70) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (1.73) Negative (0.30)<a class="elsevierStyleCrossRef" href="#tblfn0045">b</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">DLCBL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (0.37) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (1.16) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">DLCBL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.55) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (2.47) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">D \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">PH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.56) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.98) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">E \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">DLCBL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (0.15) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">PH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.77) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1116577.png" ] ] ] "notaPie" => array:2 [ 0 => array:3 [ "identificador" => "tblfn0040" "etiqueta" => "a" "nota" => "Positive kinetic variation: ≥0.5log rise in EBV load; Negative kinetic variation: <0.5log rise or a decrease (indicated by a minus sign) in EBV load." ] 1 => array:3 [ "identificador" => "tblfn0045" "etiqueta" => "b" "nota" => "Although EBV load did not show a positive kinetic variation, when HL was diagnosed it remained in high levels, similar to those detected at the moment of PH identification." ] ] ] "descripcion" => array:1 [ "en" => "Description of the kinetic variation of EBV load in PBMC and plasma from transplant patients at PTLD diagnosis" ] ] 7 => array:8 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at4" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "FLH: follicular lymphoid hyperplasia.NA: Not applicable because viral load remained not detectable." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Patients \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Histological diagnosis \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0050">a</a> PBMC (log differences) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0050">a</a> Plasma (log differences) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−0.96) Positive (1.46) Negative (−0.74) Positive (0.64) Negative (−0.03) Negative (−0.93) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NA NA NA NA NA NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">H \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−0.97) Positive (2.45) Negative (−1.33) Negative (−0.60) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NA NA NA NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">I \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.54) Negative (−0.11) Positive (1.48) Negative (−0.34) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive (0.63) Negative (−0.63) NA NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">J \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−1.24) Negative (−1.73) Positive (2.78) Negative (−0.95) Positive (0.13) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−2.13) NA NA NA Negative (0.12) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">K \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−1.39) Positive (0.74) Negative (0.31) Negative (−0.62) Negative (−0.61) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (0.37) Negative (−0.37) NA NA NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">L \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">FLH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (0.12) Negative (−0.97) Negative (0.40) Negative (0.04) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative (−0.37) Positive (1.10) Negative (−1.10) NA \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1116579.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0050" "etiqueta" => "a" "nota" => "Positive kinetic variation: ≥0.5log rise in EBV load. Negative kinetic variation: <0.5log rise or a decrease (indicated by a minus sign) in EBV load." ] ] ] "descripcion" => array:1 [ "en" => "Description of the kinetic variation of EBV load in PBMC and plasma from transplant patients without a PTLD diagnosis" ] ] 8 => array:8 [ "identificador" => "tbl0025" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at5" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PPV<a class="elsevierStyleCrossRef" href="#tblfn0055">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">NPV<a class="elsevierStyleCrossRef" href="#tblfn0060">b</a> \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PBMC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">83.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">57.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">31.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">93.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Plasma \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">80 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">80.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">44.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">95.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PBMC+Plasma \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">83.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">81.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">55.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">94.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1116575.png" ] ] ] "notaPie" => array:2 [ 0 => array:3 [ "identificador" => "tblfn0055" "etiqueta" => "a" "nota" => "Positive predictive value." ] 1 => array:3 [ "identificador" => "tblfn0060" "etiqueta" => "b" "nota" => "Negative predictive value." ] ] ] "descripcion" => array:1 [ "en" => "Diagnostic performance of the kinetic variation of EBV load for PTLD detection" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:23 [ 0 => array:3 [ "identificador" => "bib0120" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantification of Epstein–Barr virus-DNA load in lung transplant recipients: a comparison of plasma versus whole blood" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "N.A. Bakker" 1 => "E.A. Verschuuren" 2 => "N.J. Veeger" 3 => "W. van der Bij" 4 => "G.W. van Imhoff" 5 => "C.G. Kallenberg" 6 => "B.G. Hepkema" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.healun.2007.10.008" "Revista" => array:6 [ "tituloSerie" => "J Heart Lung Transplant" "fecha" => "2008" "volumen" => "27" "paginaInicial" => "7" "paginaFinal" => "10" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18187080" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0125" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chronic high Epstein–Barr viral load state and risk for late-onset posttransplant lymphoproliferative disease/lymphoma in children" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "M.A. Bingler" 1 => "B. Feingold" 2 => "S.A. Miller" 3 => "M.G. Michaels" 4 => "M. Green" 5 => "R.M. Wadowsky" 6 => "D.T. Rowe" 7 => "S.A. Webber" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1600-6143.2007.02080.x" "Revista" => array:6 [ "tituloSerie" => "Am J Transplant" "fecha" => "2008" "volumen" => "8" "paginaInicial" => "442" "paginaFinal" => "445" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18211510" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0130" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A prospective study on modulation of immunosuppression for Epstein–Barr virus reactivation in pediatric patients who underwent unrelated hematopoietic stem-cell transplantation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:11 [ 0 => "S. Cesaro" 1 => "A. Pegoraro" 2 => "G. Tridello" 3 => "E. Calore" 4 => "M. Pillon" 5 => "S. Varotto" 6 => "D. Abate" 7 => "L. Barzon" 8 => "C. Mengoli" 9 => "M. Carli" 10 => "C. Messina" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/TP.0b013e3181dd6c0a" "Revista" => array:6 [ "tituloSerie" => "Transplantation" "fecha" => "2010" "volumen" => "89" "paginaInicial" => "1533" "paginaFinal" => "1540" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20463647" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0135" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A semi-quantitative PCR method (SQ-PCR) to measure Epstein–Barr virus load: its application in transplant patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "M.D. Fellner" 1 => "K. Durand" 2 => "M. Correa" 3 => "D. Bes" 4 => "L.V. Alonio" 5 => "A.R. Teyssié" 6 => "M.A. Picconi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Virol" "fecha" => "2003" "volumen" => "28" "paginaInicial" => "323" "paginaFinal" => "330" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14522071" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0140" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Duplex realtime PCR method for Epstein–Barr virus and human DNA quantification: its application for post-transplant lymphoproliferative disorders detection" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.D. Fellner" 1 => "K.A. Durand" 2 => "M.A. Rodríguez" 3 => "L. Irazu" 4 => "L.V. Alonio" 5 => "M.A. Picconi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bjid.2013.07.011" "Revista" => array:6 [ "tituloSerie" => "Braz J Infect Dis" "fecha" => "2014" "volumen" => "18" "paginaInicial" => "271" "paginaFinal" => "280" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24389276" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0145" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Viral dynamics in transplant patients: implications for disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G.A. Funk" 1 => "R. Gosert" 2 => "H.H. Hirsch" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Lancet Inf Dis" "fecha" => "2007" "volumen" => "7" "paginaInicial" => "460" "paginaFinal" => "472" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0150" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "EBV viral load detection in clinical virology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Gärtner" 1 => "J.K. Preiksaitis" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jcv.2010.03.016" "Revista" => array:6 [ "tituloSerie" => "J Clin Virol" "fecha" => "2010" "volumen" => "48" "paginaInicial" => "82" "paginaFinal" => "90" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20395167" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0155" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Posttransplantation lymphoproliferative disorders" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Green" 1 => "S. Webber" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pediatr Clin North Am" "fecha" => "2003" "volumen" => "50" "paginaInicial" => "1471" "paginaFinal" => "1491" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14710788" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0160" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Developing a quality system for quantitative laboratory-developed tests" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "T.E. Grys" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Microbiol Newsl" "fecha" => "2011" "volumen" => "33" "paginaInicial" => "179" "paginaFinal" => "185" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0165" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Using Epstein–Barr viral load assays to diagnose, monitor, and prevent posttransplant lymphoproliferative disorder" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.L. Gulley" 1 => "W. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.00006-09" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2010" "volumen" => "23" "paginaInicial" => "350" "paginaFinal" => "366" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20375356" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0170" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantitative Epstein–Barr virus viral load monitoring in pediatric liver transplantation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.Y. Jang" 1 => "K.M. Kim" 2 => "Y.J. Lee" 3 => "S.G. Lee" 4 => "H.S. Chi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.transproceed.2008.07.014" "Revista" => array:6 [ "tituloSerie" => "Transplant Proc" "fecha" => "2008" "volumen" => "40" "paginaInicial" => "2546" "paginaFinal" => "2548" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18929796" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0175" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The changing face of post-transplant lymphoproliferative disease in the era of molecular EBV monitoring" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "N. Kerkar" 1 => "R.A. Morotti" 2 => "R.P. Madan" 3 => "B. Shneider" 4 => "B.C. Herold" 5 => "C. Dugan" 6 => "T. Miloh" 7 => "I. Karabicak" 8 => "J.A. Strauchen" 9 => "S. Emre" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1399-3046.2009.01258.x" "Revista" => array:6 [ "tituloSerie" => "Pediatr Transplant" "fecha" => "2010" "volumen" => "14" "paginaInicial" => "504" "paginaFinal" => "511" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20070559" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0180" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Measuring Epstein–Barr virus (EBV) load: the significance and application for each EBV-associated disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H. Kimura" 1 => "Y. Ito" 2 => "R. Suzuki" 3 => "Y. Nishiyama" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/rmv.582" "Revista" => array:6 [ "tituloSerie" => "Rev Med Virol" "fecha" => "2008" "volumen" => "18" "paginaInicial" => "305" "paginaFinal" => "319" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18494041" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0185" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Post-transplant lymphoproliferative disease and other Epstein–Barr virus diseases in allogeneic haematopoietic stem cell transplantation after introduction of monitoring of viral load by polymerase chain reaction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Kinch" 1 => "G. Oberg" 2 => "J. Arvidson" 3 => "K.I. Falk" 4 => "A. Linde" 5 => "K. Pauksens" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/00365540600978906" "Revista" => array:6 [ "tituloSerie" => "Scand J Infect Dis" "fecha" => "2007" "volumen" => "39" "paginaInicial" => "235" "paginaFinal" => "244" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17366054" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0190" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Monitoring of Epstein–Barr virus load after hematopoietic stem cell transplantation for early intervention in post-transplant lymphoproliferative disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Meerbach" 1 => "P. Wutzler" 2 => "R. Häfer" 3 => "F. Zintl" 4 => "B. Gruhn" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jmv.21096" "Revista" => array:6 [ "tituloSerie" => "J Med Virol" "fecha" => "2008" "volumen" => "80" "paginaInicial" => "441" "paginaFinal" => "454" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18205222" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0195" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Monitoring and modulation of Epstein–Barr virus loads in pediatric transplant patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R.J. Orentas" 1 => "D.W. Schauer Jr." 2 => "F.W. Ellis" 3 => "J. Walczak" 4 => "J.T. Casper" 5 => "D.A. Margolis" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pediatr Transplant" "fecha" => "2003" "volumen" => "7" "paginaInicial" => "305" "paginaFinal" => "314" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12890010" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0200" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epstein Barr virus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A.B. Rickinson" 1 => "E. Kieff" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:7 [ "editores" => "B.N.FieldsD.M.KnipeP.M.Howley" "paginaInicial" => "2656" "paginaFinal" => "2700" "edicion" => "5th ed." "serieVolumen" => "vol. 2" "serieTitulo" => "Fields virology" "serieFecha" => "2007" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0205" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased levels of circulating Epstein–Barr virus (EBV)-infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of posttransplant lymphoproliferative disease in solid-organ transplant recipients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.A. Riddler" 1 => "M.C. Breinig" 2 => "J.L. McKnight" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "1994" "volumen" => "84" "paginaInicial" => "972" "paginaFinal" => "984" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8043879" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0210" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Early identification of Epstein–Barr virus-associated post-transplantation lymphoproliferative disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C.M. Rooney" 1 => "S.K. Loftin" 2 => "M.S. Holladay" 3 => "M.K. Brenner" 4 => "R.A. Krance" 5 => "H.E. Heslop" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Br J Haematol" "fecha" => "1995" "volumen" => "89" "paginaInicial" => "98" "paginaFinal" => "103" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7833284" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0215" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Use of quantitative competitive PCR to measure Epstein–Barr virus genome load in the peripheral blood of pediatric transplant patients with lymphoproliferative disorders" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "D.T. Rowe" 1 => "L. Qu" 2 => "J. Reyes" 3 => "N. Jabbour" 4 => "E. Yunis" 5 => "P. Putnam" 6 => "S. Todo" 7 => "M. Green" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1997" "volumen" => "35" "paginaInicial" => "1612" "paginaFinal" => "1615" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9163497" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0220" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnosis and treatment of post-transplantation lymphoproliferative disorder in pediatric heart transplant patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "S. Schubert" 1 => "H. Abdul-Khaliq" 2 => "H.B. Lehmkuhl" 3 => "M. Yegitbasi" 4 => "P. Reinke" 5 => "C. Kebelmann-Betzig" 6 => "K. Hauptmann" 7 => "U. Gross-Wieltsch" 8 => "R. Hetzer" 9 => "F. Berger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1399-3046.2008.00969.x" "Revista" => array:6 [ "tituloSerie" => "Pediatr Transplant" "fecha" => "2009" "volumen" => "13" "paginaInicial" => "54" "paginaFinal" => "62" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18518912" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0225" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Post-transplant lymphoproliferative disorders" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.H. Swerdlow" 1 => "S.A. Webber" 2 => "A. Chadburn" 3 => "J.A. Ferry" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:5 [ "titulo" => "WHO classification of tumours of haematopoietic and lymphoid tissues" "paginaInicial" => "343" "paginaFinal" => "350" "edicion" => "4th ed." "serieFecha" => "2008" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0230" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "EBV PCR in the diagnosis and monitoring of posttransplant lymphoproliferative disorder: results of a two-arm prospective trial" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:15 [ 0 => "D.E. Tsai" 1 => "L. Douglas" 2 => "C. Andreadis" 3 => "D.T. Vogl" 4 => "S. Arnoldi" 5 => "R. Kotloff" 6 => "J. Svoboda" 7 => "R.D. Bloom" 8 => "K.M. Olthoff" 9 => "S.C. Brozena" 10 => "S.J. Schuster" 11 => "E.A. Stadtmauer" 12 => "E.S. Robertson" 13 => "M.A. Wasik" 14 => "V.N. Ahya" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1600-6143.2008.02183.x" "Revista" => array:6 [ "tituloSerie" => "Am J Transplant" "fecha" => "2008" "volumen" => "8" "paginaInicial" => "1016" "paginaFinal" => "1024" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18312608" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack229395" "titulo" => "Acknowledgements" "texto" => "The authors are indebted to S. Nuñez and J. Campos, for their technical assistance, Drs: C. Gonzalez Cambaceres, P. Bernáldez, J. Ibañez and A. Turconi (“Prof. Dr Juan P. Garrahan” Pediatric Hospital); J. Gregoresky and M. V. Ávila (Austral University Hospital); T. Gonzalez and S. Besga (“Sor María Ludovica” Children's Hospital), J. Trentadue (Favaloro Foundation) for their generous help during sampling, and their commitment to the prevention of PTLD in transplant patients. This project was partially supported by grants from ANLIS Carlos G. Malbrán (FOCANLIS/2009) (Buenos Aires, Argentina)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000004800000002/v1_201607030039/S0325754116000110/v1_201607030039/en/main.assets" "Apartado" => array:4 [ "identificador" => "37861" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Microbiología clínica y enfermedades infecciosas" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004800000002/v1_201607030039/S0325754116000110/v1_201607030039/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754116000110?idApp=UINPBA00004N"]

Statistics

Original article

Carga de virus Epstein-Barr en pacientes trasplantados: detección temprana de desórdenes linfoproliferativos postrasplante

María Dolores Fellnera,

Corresponding author

oncovir1@anlis.gov.ar

Corresponding author.

, Karina A. Duranda, Veronica Solernoub, Andrea Bosalehb, Ziomara Balbarreyb, María T. García de Dávilab, Marcelo Rodríguezc, Lucía Irazuc, Lidia V. Alonioa, María A. Picconia

a Oncogenic Viruses Service, Virology Department, “Carlos G. Malbrán” National Institute of Infectious Diseases, Av. Vélez Sársfield 563, C1282AFF Buenos Aires, Argentina

b Pathology Service, “Prof. Dr. Juan. P. Garrahan” National Pediatrics Hospital, Pichincha 1890, C1249ABP Buenos Aires, Argentina

c Operational Team Quality Management, Parasitology Department, “Carlos G. Malbrán” National Institute of Infectious Diseases, Av. Vélez Sársfield 563, C1282AFF Buenos Aires, Argentina

Read

4812

Times
was read the article

1221

Total PDF

3591

Total HTML

Share statistics

 array:24 [
  "pii" => "S0325754116000110"
  "issn" => "03257541"
  "doi" => "10.1016/j.ram.2016.02.006"
  "estado" => "S300"
  "fechaPublicacion" => "2016-04-01"
  "aid" => "92"
  "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
  "copyrightAnyo" => "2016"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Rev Argent Microbiol. 2016;48:110-8"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 1716
    "formatos" => array:3 [
      "EPUB" => 30
      "HTML" => 971
      "PDF" => 715
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0325754116000109"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2016.02.005"
    "estado" => "S300"
    "fechaPublicacion" => "2016-04-01"
    "aid" => "91"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2016;48:119-21"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1350
      "formatos" => array:3 [
        "EPUB" => 31
        "HTML" => 887
        "PDF" => 432
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Informe breve</span>"
      "titulo" => "Absceso de psoas por <span class="elsevierStyleItalic">Staphylococcus lugdunensis</span>"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "119"
          "paginaFinal" => "121"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Psoas abscess caused by <span class="elsevierStyleItalic">Staphylococcus lugdunensis</span>"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1275
              "Ancho" => 1700
              "Tamanyo" => 239135
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">A&#41; Artritis infecciosa&#44; dependiendo de la articulaci&#243;n facetaria derecha del nivel L4-L5&#44; con colecciones abscesificadas en el &#225;rea adyacente al m&#250;sculo psoas derecho en L4-L5 &#40;flecha&#41;&#44; y en el espacio epidural izquierdo en L5-S1&#44; con afectaci&#243;n de partes blandas adyacentes &#40;punta de flecha&#41;&#46; B&#41; Desaparici&#243;n de las colecciones abscesificadas &#40;flecha&#41;&#46; Persistencia de alteraci&#243;n de se&#241;al de la articulaci&#243;n facetaria L4-L5&#44; y m&#237;nimo edema de partes blandas &#40;punta de flecha&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Mar&#237;a Tamargo Delp&#243;n, Pablo Demelo-Rodr&#237;guez, Juan Carlos Cano Ballesteros, Laura Vela de la Cruz"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Mar&#237;a"
              "apellidos" => "Tamargo Delp&#243;n"
            ]
            1 => array:2 [
              "nombre" => "Pablo"
              "apellidos" => "Demelo-Rodr&#237;guez"
            ]
            2 => array:2 [
              "nombre" => "Juan Carlos"
              "apellidos" => "Cano Ballesteros"
            ]
            3 => array:2 [
              "nombre" => "Laura"
              "apellidos" => "Vela de la Cruz"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754116000109?idApp=UINPBA00004N"
    "url" => "/03257541/0000004800000002/v1_201607030039/S0325754116000109/v1_201607030039/es/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S032575411600002X"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2015.12.003"
    "estado" => "S300"
    "fechaPublicacion" => "2016-04-01"
    "aid" => "83"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2016;48:105-9"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1430
      "formatos" => array:3 [
        "EPUB" => 40
        "HTML" => 1112
        "PDF" => 278
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Brief reports</span>"
      "titulo" => "<span class="elsevierStyleItalic">Arcobacter butzleri</span> survives within trophozoite of <span class="elsevierStyleItalic">Acanthamoeba castellanii</span>"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "105"
          "paginaFinal" => "109"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "<span class="elsevierStyleItalic">Arcobacter butzleri</span> sobrevive en el interior de trofozoitos de <span class="elsevierStyleItalic">Acanthamoeba castellanii</span>"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1009
              "Ancho" => 2040
              "Tamanyo" => 261224
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Phase contrast microscopy&#46; &#40;A&#41; Trophozoite of <span class="elsevierStyleItalic">A&#46; castellanii</span> showing <span class="elsevierStyleItalic">A&#46; butzleri</span> seen in close association with <span class="elsevierStyleItalic">A&#46; castellanii</span> gathering at one pole of the amoeba cell known as food-cup &#40;30<span class="elsevierStyleHsp" style=""></span>min of co-incubation&#41;&#46; &#40;B&#41; Trophozoite of <span class="elsevierStyleItalic">A&#46; castellanii</span> showing <span class="elsevierStyleItalic">A&#46; butzleri</span> within the amoebic vacuoles &#40;50<span class="elsevierStyleHsp" style=""></span>min of co-incubation&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Mar&#237;a P&#46; Villanueva, Gustavo Medina, Heriberto Fern&#225;ndez"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Mar&#237;a P&#46;"
              "apellidos" => "Villanueva"
            ]
            1 => array:2 [
              "nombre" => "Gustavo"
              "apellidos" => "Medina"
            ]
            2 => array:2 [
              "nombre" => "Heriberto"
              "apellidos" => "Fern&#225;ndez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S032575411600002X?idApp=UINPBA00004N"
    "url" => "/03257541/0000004800000002/v1_201607030039/S032575411600002X/v1_201607030039/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "<span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> load in transplant patients&#58; Early detection of post-transplant lymphoproliferative disorders"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "110"
        "paginaFinal" => "118"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Mar&#237;a Dolores Fellner, Karina A&#46; Durand, Veronica Solernou, Andrea Bosaleh, Ziomara Balbarrey, Mar&#237;a T&#46; Garc&#237;a de D&#225;vila, Marcelo Rodr&#237;guez, Luc&#237;a Irazu, Lidia V&#46; Alonio, Mar&#237;a A&#46; Picconi"
        "autores" => array:10 [
          0 => array:4 [
            "nombre" => "Mar&#237;a Dolores"
            "apellidos" => "Fellner"
            "email" => array:1 [
              0 => "oncovir1&#64;anlis&#46;gov&#46;ar"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Karina A&#46;"
            "apellidos" => "Durand"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Veronica"
            "apellidos" => "Solernou"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Andrea"
            "apellidos" => "Bosaleh"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Ziomara"
            "apellidos" => "Balbarrey"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Mar&#237;a T&#46;"
            "apellidos" => "Garc&#237;a de D&#225;vila"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Marcelo"
            "apellidos" => "Rodr&#237;guez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Luc&#237;a"
            "apellidos" => "Irazu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Lidia V&#46;"
            "apellidos" => "Alonio"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Mar&#237;a A&#46;"
            "apellidos" => "Picconi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Oncogenic Viruses Service&#44; Virology Department&#44; &#8220;Carlos G&#46; Malbr&#225;n&#8221; National Institute of Infectious Diseases&#44; Av&#46; V&#233;lez S&#225;rsfield 563&#44; C1282AFF Buenos Aires&#44; Argentina"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Pathology Service&#44; &#8220;Prof&#46; Dr&#46; Juan&#46; P&#46; Garrahan&#8221; National Pediatrics Hospital&#44; Pichincha 1890&#44; C1249ABP Buenos Aires&#44; Argentina"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Operational Team Quality Management&#44; Parasitology Department&#44; &#8220;Carlos G&#46; Malbr&#225;n&#8221; National Institute of Infectious Diseases&#44; Av&#46; V&#233;lez S&#225;rsfield 563&#44; C1282AFF Buenos Aires&#44; Argentina"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Carga de virus <span class="elsevierStyleItalic">Epstein-Barr</span> en pacientes trasplantados&#58; detecci&#243;n temprana de des&#243;rdenes linfoproliferativos postrasplante"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 697
            "Ancho" => 2532
            "Tamanyo" => 132852
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Analysis of the EBV load from plasma samples&#46; The plasma EBV load showed high specificity to detect all PTLD&#59; while an increasing sensitivity was noted as PTLD stages progressed&#46; Total PTLD&#58; included categories 1&#8211;4 &#40;A&#41;&#59; advanced PTLD&#58; categories 2&#8211;4 &#40;B&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> &#40;EBV&#41; infection is associated with the development of post-transplant lymphoproliferative disorders &#40;PTLD&#41; in solid-organ and stem cell transplant recipients<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">17</span></a>&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">PTLD encompass a wide range of disorders including benign to malignant lymphoproliferations<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">22</span></a>&#46; Briefly&#44; category 1 includes early benign PTLD&#59; category 2&#44; benign and neoplastic PTLD and categories 3 and 4&#44; neoplastic PTLD&#46; It had been noted that a therapeutic intervention&#44; particularly during the early PTLD phases&#44; could reverse lymphoproliferation and prevent progression to the irreversible lymphoma stage<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">3</span></a>&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">The association of PTLD and elevated levels of circulating EBV were first described in the nineties<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">18</span></a>&#46; Since then&#44; different authors showed that PTLD&#44; especially those occurring early after transplantation&#44; are generally associated with an increase in EBV DNA in peripheral blood samples&#46; This has led to using the EBV load as a risk marker for this disease<a class="elsevierStyleCrossRefs" href="#bib0150"><span class="elsevierStyleSup">7&#44;8&#44;10</span></a>&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Initially&#44; many studies explored the clinical usefulness of these tests in a single sample in the presence of disease<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">19&#44;20</span></a>&#46; Then&#44; the importance of surveillance through frequent repetitive monitoring was brought up<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">11</span></a>&#46; At present&#44; a high viral load is used for two purposes&#58; an <span class="elsevierStyleItalic">early diagnosis</span> &#40;indicating when to start the search for disease in a potential site&#41;&#44; and as a <span class="elsevierStyleItalic">prevention strategy</span> &#40;indicating when to therapeutically intervene&#41;<a class="elsevierStyleCrossRefs" href="#bib0145"><span class="elsevierStyleSup">6&#44;10</span></a>&#46; Furthermore&#44; some authors have proposed to calculate an average load in a set time&#44; rather than use a single cut-off value<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">6</span></a>&#46; Thus&#44; a reduction in PTLD morbidity and mortality was reported in centers that had implemented systematic EBV load monitoring&#44; and the viral burden was maintained at levels defined as &#8220;low&#8221;&#44; by regulating the degree of immunosuppression<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">12</span></a>&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">In the literature&#44; the definition of a threshold indicative of a &#8220;high load&#8221; is inconsistent because each laboratory has implemented its own cut-off values to distinguish PTLD from baseline levels<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">13</span></a>&#46; The broad diversity of methods &#40;type of quantitative PCR&#44; amplified viral fragment&#41;&#44; type and quantity of clinical sample analyzed &#40;peripheral blood mononuclear cells&#44; PBMC&#59; whole blood&#59; plasma&#41;&#44; controls used to standardize assays&#44; expression of results &#40;number of viral genome equivalents per number of cells&#44; DNA quantity&#44; volume&#41;&#44; sampling frequency&#44; among others&#44; have made it difficult to compare published data and extrapolate cut-off values from one laboratory to another&#46; Therefore&#44; the overall sensitivity&#44; specificity&#44; positive and negative predictive values obtained by different authors relied on the population studied &#40;adult <span class="elsevierStyleItalic">vs</span>&#46; pediatric&#41;&#44; type of transplanted organ &#40;solid organ <span class="elsevierStyleItalic">vs</span>&#46; stem cells&#41;&#44; pre-transplant infection status&#44; among others&#46;</p><p id="par0030" class="elsevierStylePara elsevierViewall">An assay to quantify EBV by real-time PCR was developed in our laboratory to monitor transplant patients<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">5</span></a>&#46; Thus&#44; considering the lack of consensus on the EBV level that identifies PTLD&#44; the optimal type of clinical sample&#44; and using the logistics implemented to handle transplant patients&#8217; samples in our laboratory &#40;already underway using a semi-quantitative PCR&#41;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">4</span></a>&#44; the EBV load in this report was analyzed in different clinical specimens&#44; which also represent anatomical sites of viral persistence&#46; Therefore&#44; the aim of this study was to clinically validate the developed EBV quantification assay for the early detection of PTLD in transplant patients&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Patients and samples</span><p id="par0035" class="elsevierStylePara elsevierViewall">Pediatric recipients of solid organ transplants treated at &#8220;Prof&#46; Dr Juan P&#46; Garrahan&#8221; Pediatric Hospital&#44; Austral University Hospital&#44; Sor Mar&#237;a Ludovica Children&#39;s Hospital and Favaloro Foundation between 2001 and 2010 were selected for inclusion in the present study&#46; All patients were found to be infected with EBV&#44; as established by the previous detection of IgG antibodies against viral capsid antigen and&#47;or EBV-DNA in PBMC&#46; Samples were obtained according to the monitoring of transplanted patients or treatment protocol and their selection was based on clinical data &#40;presence or absence of signs and symptoms associated with EBV infection&#41;&#44; previous EBV load results acquired by semi-quantitative PCR<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">4</span></a> &#40;including varying EBV load levels&#58; low&#44; high and very high&#41; and histopathological examination of biopsy material &#40;PTLD or a different diagnosis based on the corresponding lymphoid tissue&#41;&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">An informed consent was obtained from all patients in accordance with the Helsinki declaration and other national or international regulations&#46; All procedures were approved by the Ethical Research Committee&#44; National Center of Medical Genetics&#44; ANLIS &#8220;Dr&#46; Carlos G&#46; Malbr&#225;n&#8221;&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Transversal study design</span><p id="par0045" class="elsevierStylePara elsevierViewall">Paired peripheral blood and oropharyngeal lymphoid tissue &#40;OLT&#41; samples from 105 pediatric solid-organ transplant recipients were included&#46; Fifty-eight of them were histologically diagnosed with PTLD&#44; according to the World Health Organization classification&#58; IARC&#44; 2008<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">22</span></a> &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Retrospective follow-up study design</span><p id="par0050" class="elsevierStylePara elsevierViewall">Seventy one paired PBMC and plasma samples were included from six organ recipients with a histological diagnosis of PTLD&#44; and six transplant patients with a variety of clinical conditions associated with EBV&#44; but not with PTLD&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">PBMC and plasma were separated from 2&#46;5 to 5<span class="elsevierStyleHsp" style=""></span>ml of EDTA-anticoagulated whole blood samples by centrifugation on a density gradient &#40;Histopaque-1077&#44; Sigma&#8211;Aldrich&#41; as recommended&#44; and then stored at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The OLT from patients with lymphoid hypertrophy were surgically removed and immediately stored at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">DNA extraction</span><p id="par0060" class="elsevierStylePara elsevierViewall">DNA from PBMC and OLT samples was obtained as previously reported<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">4</span></a>&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">Plasma DNA was extracted using the QIAmp DNA mini kit &#40;QIAgen&#44; Hilden&#44; Germany&#41; following manufacturers&#8217; recommendations for free viral DNA extraction&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">EBV DNA quantification</span><p id="par0070" class="elsevierStylePara elsevierViewall">We applied a duplex real-time PCR assay that simultaneously amplifies an EBNA-1 coding gene portion and one of the human glyceraldehyde 3-phosphate dehydrogenase &#40;GAPDH&#41; encoding genes&#59; the amplification was performed as previously described<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">5</span></a>&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">The primers&#47;probes were as follows&#58;<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><p id="par0080" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">EBV reaction</span>&#58; 5&#8242; CCGCTCCTACCTGCAATATCA 3&#8242; &#40;forward primer&#41; and 5&#8242; GGAAACCAGGGAGGCAAATC 3&#8242; &#40;reverse primer&#41;&#59; 5&#8242; VIC-TGCAGCTTTGACGATGG-MGB 3&#8242; &#40;probe&#41;&#46; They amplified a 73<span class="elsevierStyleHsp" style=""></span>bp fragment&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><p id="par0085" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">GAPDH reaction</span>&#58; 5&#8242; GGTGGTCTCCTCTGACTTCAACA 3&#8242; &#40;forward primer&#41;&#59; 5&#8242; GTGGTCGTTGAGGGCAATG 3&#8242; &#40;reverse primer&#41; and 5&#8242; FAM-CCACTCCTCCACCTTTGACGCTGG-3&#8242; TAMRA &#40;probe&#41;&#46; They amplified a 79<span class="elsevierStyleHsp" style=""></span>bp fragment&#46;</p></li></ul></p><p id="par0090" class="elsevierStylePara elsevierViewall">Amplification was performed in a final reaction volume of 25<span class="elsevierStyleHsp" style=""></span>&#956;l&#44; containing 1&#215; TaqMan Universal Master Mix with AmpErase UNG &#40;Applied Biosystems&#44; New Jersey&#44; USA&#41;&#44; 0&#46;3<span class="elsevierStyleHsp" style=""></span>&#956;M of EBV-primers&#44; 0&#46;05<span class="elsevierStyleHsp" style=""></span>&#956;M of GAPDH-primers&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M of EBV-probe and GAPDH-probe &#40;Applied Biosystems&#44; Foster city&#44; USA&#41; and the DNA to be amplified&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">For each reaction around 366<span class="elsevierStyleHsp" style=""></span>ng of DNA were assayed &#40;corresponding to the amount of DNA of 10<span class="elsevierStyleSup">5</span> human cells<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">4</span></a>&#41; from PBMC or OLT or the extracted DNA from 30<span class="elsevierStyleHsp" style=""></span>&#956;l of plasma&#46; The amplification was performed using a 7500 real-time PCR System &#40;Applied Biosystems&#41; under the following cycle conditions&#58; 50<span class="elsevierStyleHsp" style=""></span>&#176;C 2<span class="elsevierStyleHsp" style=""></span>min&#59; 95<span class="elsevierStyleHsp" style=""></span>&#176;C 10<span class="elsevierStyleHsp" style=""></span>min followed by 45 cycles of 95<span class="elsevierStyleHsp" style=""></span>&#176;C 15<span class="elsevierStyleHsp" style=""></span>s&#44; 60<span class="elsevierStyleHsp" style=""></span>&#176;C 1<span class="elsevierStyleHsp" style=""></span>min&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">The EBV load measured in PBMC DNA was expressed as the number of EBV genome equivalents &#40;gEq&#41; per 10<span class="elsevierStyleSup">5</span> PBMC&#46; The normalized EBV load was estimated from the results of the EBNA-1 and GAPDH reactions &#40;EBNA<span class="elsevierStyleHsp" style=""></span>&#8722;<span class="elsevierStyleHsp" style=""></span>1 load&#47;GAPDH load<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">5</span>&#41;&#46; The EBV load in plasma was expressed as the number of EBV gEq per ml of plasma by multiplying the EBNA-1 load by a factor of 33&#46;3 and correcting by extraction efficiency&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">Kinetic variation was defined as a greater than 0&#46;5<span class="elsevierStyleHsp" style=""></span>log unit increase or decrease with respect to the EBV load measured in a previous sample&#46; This implies a load variation greater than the overall precision of the method<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">5</span></a> and also relies on the concept that a difference higher than 0&#46;5<span class="elsevierStyleHsp" style=""></span>log units is clinically significant<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">9</span></a>&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Clinical validation</span><p id="par0110" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Transversal study&#58;</span> it was done in order to analyze the diagnostic performance of different cut-off values as PTLD indicators&#46; The diagnostic ability of the assay for detecting total PTLD &#40;including categories 1&#8211;4&#41;&#44; advanced PTLD &#40;categories 2&#8211;4&#41;&#44; or neoplastic PTLD &#40;categories 3 and 4&#41; cases &#40;positive reference population&#41; was evaluated analyzing the sensitivity and specificity of different EBV load levels&#46; The organ recipients without PTLD were considered the negative reference population&#46; Paired PBMC&#44; plasma and OLT samples were analyzed&#46; The viral load corresponding to the cross-point between sensitivity and specificity was considered the most efficient cut-off value&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Retrospective follow-up study&#58;</span> the purpose of the retrospective follow-up study was to analyze the usefulness of the EBV load variation as PTLD indicator&#46; The diagnostic ability of the EBV load kinetic variation for detecting total PTLD was evaluated in samples taken before and at the moment of the diagnosis for PTLD cases&#44; and between successive samples for organ recipients without a PTLD history&#46; The analysis was run on paired PBMC and plasma samples&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Statistical analysis</span><p id="par0120" class="elsevierStylePara elsevierViewall">Sensitivity&#44; specificity&#44; positive and negative predictive values were calculated applying the Describe program&#44; version 2&#46;41&#44; from the software package WinPEPI&#44; version 11&#46;14&#46;</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Results</span><p id="par0125" class="elsevierStylePara elsevierViewall">The EBV load measured in PBMC&#44; plasma and OLT samples from transplant patients with and without PTLD diagnosis is shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>A&#8211;C&#44; respectively&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Clinical validation</span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Transversal design</span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Peripheral blood mononuclear cells</span><p id="par0130" class="elsevierStylePara elsevierViewall">The analysis of the ability of PBMC-measured EBV load to identify PTLD is shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#46; The highest diagnostic efficacy for the detection of total PTLD is achieved at a cut-off value of 1&#46;08<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC &#40;A&#41;&#59; for advanced PTLD&#44; at a cut-off of 1&#46;60<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC &#40;B&#41;&#44; and for neoplastic PTLD&#44; at a cut-off of 2&#46;47<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC &#40;C&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Plasma</span><p id="par0135" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a> describes the sensitivity and specificity of EBV levels in plasma samples for PTLD diagnosis&#46; The EBV load in plasma samples showed low sensitivity and high specificity to detect total PTLD &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#41;&#46; While increased sensitivity&#44; maintaining high specificity&#44; was observed for the detection of advanced PTLD &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>B&#41;&#44; similar results were obtained when analyzing only neoplastic PTLD &#40;data not shown&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Lymphoid tissue</span><p id="par0140" class="elsevierStylePara elsevierViewall">The best relations between sensitivity &#40;Se&#41; and specificity &#40;Sp&#41; for the detection of total&#44; advanced or neoplastic PTLD were obtained at cut-off values of 2&#46;30<span class="elsevierStyleHsp" style=""></span>log &#40;Se<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>57&#46;4<span class="elsevierStyleHsp" style=""></span>&#37; and Sp<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>55&#46;5<span class="elsevierStyleHsp" style=""></span>&#37;&#41;&#44; 2&#46;60<span class="elsevierStyleHsp" style=""></span>log &#40;Se<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>63&#46;6<span class="elsevierStyleHsp" style=""></span>&#37; and Sp<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>66&#46;7<span class="elsevierStyleHsp" style=""></span>&#37;&#41; or 4&#46;48<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> cells &#40;Se<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>&#37; and Sp<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>&#37;&#41;&#44; respectively &#40;data not shown&#41;&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Combination of several samples</span><p id="par0145" class="elsevierStylePara elsevierViewall">In order to improve the diagnostic performance for PTLD detection&#44; the combination of the EBV load measured in different anatomical sites of viral persistence was analyzed &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; The most effective total PTLD detection was obtained by co-measuring the EBV load in PBMC and plasma&#46; However&#44; the incorporation of the OLT viral load did not improve diagnostic eficcacy&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Retrospective follow-up</span><p id="par0150" class="elsevierStylePara elsevierViewall">Results from the retrospective follow-up study are shown in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a> and <a class="elsevierStyleCrossRefs" href="#tbl0015">Tables 3 and 4</a>&#46; The determination of the kinetic load variation increased diagnostic efficacy compared to the use of a single cut-off value &#40;<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>&#41;&#46; Moreover&#44; the co-measurement of the kinetic variation in more than one clinical sample improved the diagnostic ability of the assay&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0025"></elsevierMultimedia></span></span></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Discussion</span><p id="par0155" class="elsevierStylePara elsevierViewall">Many of the publications in which EBV load was used to identify PTLD were based on patients diagnosed with neoplastic categories<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">14&#44;15</span></a>&#46; This would explain the high threshold levels applied by different laboratories&#44; which could be considered consistent with those proposed in the present study for identifying neoplastic lymphoproliferations &#40;transversal study&#41;&#46; Thus&#44; considering the present data&#44; the highest EBV levels would be particularly associated with neoplasia&#46; The definition of high load based on a cut-off value that detects neoplastic cases may not be useful for prevention purposes&#46; In such sense&#44; few reports exist that describe the amount of EBV associated with the different categories of PTLD<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">21</span></a>&#46; According to the present results&#44; early PTLD stages tend to show a number of EBV genomes in all anatomical sites of viral persistence&#44; lower than that observed in neoplastic categories &#40;transversal study&#41;&#46;</p><p id="par0160" class="elsevierStylePara elsevierViewall">Therefore&#44; considering that the aim of the EBV quantification in transplant patients is to detect the onset of lymphoproliferation&#44; we wondered which monitoring strategy would be the best&#46; Thus&#44; a cut-off of 2&#46;48<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC would point to neoplastic PTLD patients&#44; but many cases with less advanced stages would be missed&#46; A cut-off value of 1&#46;08<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC would detect the majority of organ recipients with PTLD&#44; but would also include many without PTLD&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">It has already been proposed that a high EBV load in plasma is a more specific PTLD marker than its determination in PBMC<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">23</span></a>&#59; however&#44; it is also less sensitive<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">1</span></a>&#46; According to the present transversal study&#44; the detection of EBV DNA in plasma samples appears to be a sensitive and specific indicator of advanced PTLD&#44; albeit very insensitive to identify early phases&#46; In addition&#44; as noted in the retrospective follow-up &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#44; two patients showed undetectable EBV load in plasma at PTLD diagnosis&#44; one in category 1 &#40;case F&#41; and one even in a neoplastic stage &#40;case E&#41;&#46;</p><p id="par0170" class="elsevierStylePara elsevierViewall">The levels of EBV in lymphoid tissue are not usually analyzed to detect PTLD since peripheral blood samples are less invasive and more easily available&#46; In this respect&#44; the present data showed that a high amount of EBV DNA in lymphoid tissue exhibits the highest ability for neoplastic PTLD detection&#44; but not for less advanced categories&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">In most reports&#44; the determination of an increased EBV load in a single blood sample type is used for PTLD identification<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">1</span></a>&#59; however it has also been suggested that the simultaneous evaluation of whole blood and plasma samples allows for better diagnosis and monitoring&#44; and may be used to rule out their presence<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">23</span></a>&#46; Thus&#44; among all the combinations analyzed in the present report&#44; the simultaneous measurement of EBV load in PBMC and plasma resulted in a greater diagnostic efficacy regarding the quantification of a single sample type &#40;transversal study&#41;&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">Moreover&#44; as the retrospective follow-up showed the kinetic variation of the EBV levels measured in PBMC or plasma&#44; it evidenced a better diagnostic ability than the use of a single cut-off value&#59; these results are consistent with already reported data<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">6</span></a>&#46; Furthermore&#44; an increased risk of PTLD was demonstrated when detecting viral level variations in patients with persistent high EBV loads<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">2</span></a>&#46;</p><p id="par0185" class="elsevierStylePara elsevierViewall">Therefore&#44; it has been concluded that the best strategy to monitor transplant patients&#44; regarding the detection of the early stages of PTLD and the risk of progressing to neoplastic categories would include the following algorithm&#46; Initially&#44; it includes the monitoring of the EBV load in PBMC&#44; taking into account that&#58;<ul class="elsevierStyleList" id="lis0010"><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#40;1&#41;</span><p id="par0190" class="elsevierStylePara elsevierViewall">An EBV load below 1&#46;08<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC implies low risk&#46; Thus&#44; the patient&#39;s routine monitoring should be continued&#46;</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">&#40;2&#41;</span><p id="par0195" class="elsevierStylePara elsevierViewall">An EBV load between 1&#46;08<span class="elsevierStyleHsp" style=""></span>log and 2&#46;48<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC involves an increased risk&#46; A more frequent monitoring of the EBV load in PBMC is required to detect a kinetic variation&#44; plus the monitoring of viral levels in plasma&#46; The detection of a kinetic variation in PBMC and&#47;or an EBV load in plasma greater than 2<span class="elsevierStyleHsp" style=""></span>log gEq&#47;ml involves high PTLD risk&#46;</p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel">&#40;3&#41;</span><p id="par0200" class="elsevierStylePara elsevierViewall">An EBV load above 2&#46;48<span class="elsevierStyleHsp" style=""></span>log gEq per 10<span class="elsevierStyleSup">5</span> PBMC plus the detection of viral levels greater than 2&#46;52<span class="elsevierStyleHsp" style=""></span>log gEq&#47;ml in plasma imply a high risk of neoplastic PTLD&#46; The greater the EBV load and&#47;or the simultaneous detection of a kinetic variation&#44; the greater the risk of neoplastic PTLD stages&#46;</p></li></ul></p><p id="par0205" class="elsevierStylePara elsevierViewall">It should be borne in mind that the algorithm requires some consideration&#46; Firstly&#44; the overlap in the EBV DNA levels in PBMC among transplant patients with and without PTLD&#46; It should be noted that according to the present results and coinciding with other authors<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">14</span></a>&#44; not all EBV loads defined as &#8220;high&#8221; imply the development of PTLD&#46;</p><p id="par0210" class="elsevierStylePara elsevierViewall">Carefully monitoring an organ recipient with a low or moderate EBV load is also suggested&#44; since a small increase in viral levels may be associated with PTLD&#44; as was observed in this study and previously reported ones<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">16</span></a>&#46;</p><p id="par0215" class="elsevierStylePara elsevierViewall">The suggested algorithm aims to identify PTLD in the most effective way&#59; however there are patients with PTLD that remain undetected and recipients without PTLD who are included as risky&#46; This points to the need for more specific markers that&#44; when combined with the viral load&#44; result in a more accurate selection of cases of incipient PTLD&#44; allowing to reverse lymphoproliferation in its initial stages&#46;</p><p id="par0220" class="elsevierStylePara elsevierViewall">It should be mentioned that the study presented some limitations&#46; One of them is the variety of transplanted organs included&#44; as they show different PTLD prevalence&#46; However&#44; as the EBV levels in healthy carriers were known<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">5</span></a>&#44; the initial point of rising load &#40;shared by all the transplanted organ groups&#41; could be identified&#46; Furthermore&#44; the number of patients included into each PTLD category was quite different&#44; being the initial stages of PTLD &#40;category 1&#41; the broader&#46; Such category 1 just depicted the beginning of the lymphoproliferation process&#44; which was the aim of the present study&#59; however&#44; all stages of the process were analyzed separately in order to describe the differences among them&#46;</p><p id="par0225" class="elsevierStylePara elsevierViewall">Finally&#44; considering that the determination of the EBV load lacks a gold standard strategy worldwide&#44; this paper provides an in-house methodology&#44; which is analytical&#44; clinically validated&#44; less expensive and more accessible than commercial assays&#46; Thus&#44; it may represent an initial&#44; but very helpful step for the monitoring of transplant patients&#44; especially in low resource settings&#44; where commercial kits are not affordable&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Ethical disclosures</span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Protection of human and animal subjects</span><p id="par0230" class="elsevierStylePara elsevierViewall">The authors declare that the procedures followed were in accordance with the regulations of the responsible Clinical Research Ethics Committee and in accordance with those of the World Medical Association and the Helsinki Declaration&#46;</p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Confidentiality of data</span><p id="par0235" class="elsevierStylePara elsevierViewall">The authors declare that they have followed the protocols of their work centre on the publication of patient data&#46;</p></span><span id="sec0110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Right to privacy and informed consent</span><p id="par0240" class="elsevierStylePara elsevierViewall">The authors must have obtained the informed consent of the patients and&#47;or subjects mentioned in the article&#46; The author for correspondence must be in possession of this document&#46;</p></span></span><span id="sec0115" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Conflict of interest</span><p id="par0245" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres680254"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec686106"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres680255"
          "titulo" => "Resumen"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0010"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec686105"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Patients and samples"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Transversal study design"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Retrospective follow-up study design"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "DNA extraction"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "EBV DNA quantification"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Clinical validation"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0050"
          "titulo" => "Results"
          "secciones" => array:1 [
            0 => array:3 [
              "identificador" => "sec0055"
              "titulo" => "Clinical validation"
              "secciones" => array:2 [
                0 => array:3 [
                  "identificador" => "sec0060"
                  "titulo" => "Transversal design"
                  "secciones" => array:4 [
                    0 => array:2 [
                      "identificador" => "sec0065"
                      "titulo" => "Peripheral blood mononuclear cells"
                    ]
                    1 => array:2 [
                      "identificador" => "sec0070"
                      "titulo" => "Plasma"
                    ]
                    2 => array:2 [
                      "identificador" => "sec0075"
                      "titulo" => "Lymphoid tissue"
                    ]
                    3 => array:2 [
                      "identificador" => "sec0080"
                      "titulo" => "Combination of several samples"
                    ]
                  ]
                ]
                1 => array:2 [
                  "identificador" => "sec0085"
                  "titulo" => "Retrospective follow-up"
                ]
              ]
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Discussion"
        ]
        8 => array:3 [
          "identificador" => "sec0095"
          "titulo" => "Ethical disclosures"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0100"
              "titulo" => "Protection of human and animal subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0105"
              "titulo" => "Confidentiality of data"
            ]
            2 => array:2 [
              "identificador" => "sec0110"
              "titulo" => "Right to privacy and informed consent"
            ]
          ]
        ]
        9 => array:2 [
          "identificador" => "sec0115"
          "titulo" => "Conflict of interest"
        ]
        10 => array:2 [
          "identificador" => "xack229395"
          "titulo" => "Acknowledgements"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2015-08-21"
    "fechaAceptado" => "2016-02-21"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec686106"
          "palabras" => array:6 [
            0 => "Epstein&#8211;Barr virus"
            1 => "Early PTLD detection"
            2 => "Lymphoma"
            3 => "Real-time PCR"
            4 => "Transplant patients"
            5 => "Viral load"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec686105"
          "palabras" => array:6 [
            0 => "Virus <span class="elsevierStyleItalic">Epstein-Barr</span>"
            1 => "Detecci&#243;n temprana de PTLD"
            2 => "Linfoma"
            3 => "PCR en tiempo real"
            4 => "Pacientes trasplantados"
            5 => "Carga viral"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">High levels of circulating EBV load are used as a marker of post-transplant lymphoproliferative disorders &#40;PTLD&#41;&#46; There is no consensus regarding the threshold level indicative of an increase in peripheral EBV DNA&#46; The aim of the study was to clinically validate a developed EBV quantification assay for early PTLD detection&#46;</p><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Transversal study&#58; paired peripheral blood mononuclear cells &#40;PBMC&#41;&#44; plasma and oropharyngeal lymphoid tissue &#40;OLT&#41; from children undergoing a solid organ transplant with &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>58&#41; and without &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>47&#41; PTLD&#46; Retrospective follow-up&#58; 71 paired PBMC and plasma from recipients with &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#41; and without &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#41; PTLD history&#46; EBV load was determined by real-time PCR&#46; The diagnostic ability to detect all PTLD &#40;categories 1&#8211;4&#41;&#44; advanced PTLD &#40;categories 2&#8211;4&#41; or neoplastic PTLD &#40;categories 3 and 4&#41; was estimated by analyzing the test performance at different cut-off values or with a load variation greater than 0&#46;5<span class="elsevierStyleHsp" style=""></span>log units&#46;</p><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The higher diagnostic performance for identifying all&#44; advanced or neoplastic PTLD&#44; was achieved with cut-off values of 1&#46;08&#59; 1&#46;60 and 2&#46;47<span class="elsevierStyleHsp" style=""></span>log EBV<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> PBMC or 2&#46;30&#59; 2&#46;60&#59; 4&#46;47<span class="elsevierStyleHsp" style=""></span>log<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> OLT cells&#44; respectively&#46; EBV DNA detection in plasma showed high specificity but low &#40;all categories&#41; or high &#40;advanced&#47;neoplastic categories&#41; sensitivity for PTLD identification&#46; Diagnostic performance was greater when&#58; &#40;1&#41; a load variation in PBMC or plasma was identified&#59; &#40;2&#41; combining the measure of EBV load in PBMC and plasma&#46;</p><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The best diagnostic ability to identify early PTLD stages was achieved by monitoring EBV load in PBMC and plasma simultaneously&#59; an algorithm was proposed&#46;</p></span>"
      ]
      "es" => array:2 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La carga alta del virus <span class="elsevierStyleItalic">Epstein-Barr</span> se utiliza como un marcador de des&#243;rdenes linfoproliferativos postrasplante &#40;<span class="elsevierStyleItalic">post-transplant lymphoproliferative disorders</span> &#91;PTLD&#93;&#41;&#46; El objetivo de este estudio fue validar cl&#237;nicamente un ensayo de cuantificaci&#243;n del virus <span class="elsevierStyleItalic">Epstein-Barr</span> para la detecci&#243;n temprana de PTLD&#46;</p><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Se efectu&#243; un estudio transversal en el que se analizaron muestras pareadas de c&#233;lulas mononucleares perif&#233;ricas &#40;CMP&#41;&#44; de plasma y de tejido linfoide orofar&#237;ngeo de ni&#241;os con trasplante de &#243;rgano s&#243;lido&#44; con PTLD &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>58&#41; y sin PTLD &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>47&#41;&#46; En el seguimiento retrospectivo se incluyeron 71 muestras pareadas de CMP y de plasma de trasplantados&#44; con PTLD &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#41; y sin PTLD &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#41;&#46; La carga viral se determin&#243; por PCR en tiempo real&#46; Se estim&#243; la capacidad diagn&#243;stica para detectar PTLD &#40;categor&#237;as&#58; todas <span class="elsevierStyleItalic">vs</span>&#46; avanzadas <span class="elsevierStyleItalic">vs</span>&#46; neopl&#225;sicas&#41; analizando diferentes valores de corte o una variaci&#243;n de carga mayor de 0&#44;5 logaritmos&#46;</p><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El mayor desempe&#241;o diagn&#243;stico para identificar todos los PTLD&#44; los avanzados y los neopl&#225;sicos&#44; se obtuvo con valores de corte de 1&#44;08&#59; 1&#44;60 y 2&#44;47 log copias&#47;10<span class="elsevierStyleSup">5</span> en CMP y de 2&#44;30&#59; 2&#44;60 y 4&#44;48 log copias&#47;10<span class="elsevierStyleSup">5</span> en c&#233;lulas de tejido linfoide orofar&#237;ngeo&#44; respectivamente&#46; La detecci&#243;n del ADN del virus <span class="elsevierStyleItalic">Epstein-Barr</span> en el plasma mostr&#243; una especificidad alta&#44; pero una sensibilidad baja &#40;todas las categor&#237;as&#41; o alta &#40;categor&#237;as avanzadas o neopl&#225;sicas&#41; para identificar PTLD&#46; Se observ&#243; el desempe&#241;o diagn&#243;stico m&#225;s alto en las siguientes condiciones&#58; <span class="elsevierStyleItalic">1</span>&#41; al identificar una variaci&#243;n de carga en CMP o en plasma&#59; <span class="elsevierStyleItalic">2</span>&#41; combinando la medici&#243;n de la carga viral en CMP y en plasma&#46;</p><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La mejor capacidad diagn&#243;stica para identificar las etapas tempranas de los PTLD se logr&#243; mediante el seguimiento simult&#225;neo de la carga viral en CMP y en plasma&#59; se propone un algoritmo&#46;</p></span>"
      ]
    ]
    "multimedia" => array:9 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1401
            "Ancho" => 2522
            "Tamanyo" => 137904
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">EBV load in the transplanted population&#46; &#40;A&#41; EBV load in peripheral blood mononuclear cells&#44; PBMC&#59; &#40;B&#41; EBV load in plasma&#59; &#40;C&#41; EBV load in oropharyngeal lymphoid tissue cells&#44; OLT&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1485
            "Ancho" => 2530
            "Tamanyo" => 228506
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Analysis of the EBV load from PBMC samples&#46; The best diagnostic performance of the PBMC EBV load to detect different PTLD categories required increasing cut-off values&#46; &#40;A&#41; Total PTLD&#58; included categories 1&#8211;4&#59; &#40;B&#41; advanced PTLD&#58; categories 2&#8211;4&#59; &#40;C&#41; neoplastic PTLD&#58; categories 3 and 4&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 697
            "Ancho" => 2532
            "Tamanyo" => 132852
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Analysis of the EBV load from plasma samples&#46; The plasma EBV load showed high specificity to detect all PTLD&#59; while an increasing sensitivity was noted as PTLD stages progressed&#46; Total PTLD&#58; included categories 1&#8211;4 &#40;A&#41;&#59; advanced PTLD&#58; categories 2&#8211;4 &#40;B&#41;&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1824
            "Ancho" => 3396
            "Tamanyo" => 442879
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Kinetics of EBV load in PBMC and plasma from transplant patients&#46; Recipients with PTLD history&#58; &#40;A&#8211;F&#41; Patients without PTLD history&#58; &#40;G&#8211;L&#41; FLH&#58; follicular lymphoid hyperplasia&#46; PH&#58; plasmacytic hyperplasia&#46; HL&#58; Hodgkin lymphoma&#46; DLCBL&#58; Diffuse large B cell lymphoma&#46; IS&#58; immunosuppression&#46; IM&#58; infectious mononucleosis&#46; KS&#58; Kaposi&#39;s sarcoma&#46; Tx&#58; time of transplantation&#46; EBV&#58; detection of primary EBV infection&#46; &#40;&#9632;&#41; EBV load from PBMC&#59; &#40;&#9652;&#41; EBV load from plasma&#59; <span class="elsevierStyleItalic">x</span> axis&#58; sampling times&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">The age of the transplant population ranged between 1 and 18 years &#40;mean&#58; 9&#46;0 years&#41; and the male to female rate was 1&#46;1&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Transplanted organ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col">Mean of the age at transplant &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Histology</th><th class="td" title="table-head  " align="left" valign="top" scope="col">Mean of the time between transplant and PTLD diagnosis &#40;month&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Non-PTLD<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a> &#40;n&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PTLD<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a> &#40;n&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">LIVER &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>79&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;0 &#40;0&#46;5&#8211;11&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">42&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">37&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">66 &#40;20&#8211;156&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">KIDNEY &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#46;4 &#40;2&#8211;12&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">54 &#40;6&#8211;132&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HEART &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">9&#46;5 &#40;9&#8211;10&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">66 &#40;60&#8211;72&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1116578.png"
              ]
            ]
          ]
          "notaPie" => array:2 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">All patients presented a histological diagnosis of follicular lymphoid hyperplasia&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">The PTLD cases included&#58; Category 1&#58; 40 lymphoid hyperplasia and 2 infectious mononucleosis-like PTLD&#59; Category 2&#58; 8 polymorphic and polyclonal hyperplasia&#59; Category 3&#58; 4 immunoblastic and 2 Burkitt lymphomas&#44; and Category 4&#58; 2 Hodgkin lymphomas&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Description of the transplant population</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">gEq&#58; EBV genome equivalents&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Cut-off value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PPV<a class="elsevierStyleCrossRef" href="#tblfn0025"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">NPV<a class="elsevierStyleCrossRef" href="#tblfn0030"><span class="elsevierStyleSup">d</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">&#8805;Log<span class="elsevierStyleHsp" style=""></span>1&#46;08<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> PBMC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>&#8805;Log<span class="elsevierStyleHsp" style=""></span>2&#46;00&#47;ml plasma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">87&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">60&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">70&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">60&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">&#8805;Log<span class="elsevierStyleHsp" style=""></span>1&#46;08<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> PBMC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>&#8805;Log<span class="elsevierStyleHsp" style=""></span>2&#46;30<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> OLT<a class="elsevierStyleCrossRef" href="#tblfn0035"><span class="elsevierStyleSup">e</span></a> cells&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">67&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">52&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">80&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">35&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">&#8805;Log<span class="elsevierStyleHsp" style=""></span>1&#46;08<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> PBMC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>&#8805;Log<span class="elsevierStyleHsp" style=""></span>2&#46;00<span class="elsevierStyleHsp" style=""></span>gEq&#47;ml plasma<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>&#8805;Log<span class="elsevierStyleHsp" style=""></span>2&#46;30<span class="elsevierStyleHsp" style=""></span>gEq&#47;10<span class="elsevierStyleSup">5</span> OLT<a class="elsevierStyleCrossRef" href="#tblfn0035"><span class="elsevierStyleSup">e</span></a> cells&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">72&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">47&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">79&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">34&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1116576.png"
              ]
            ]
          ]
          "notaPie" => array:5 [
            0 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Sensitivity<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>&#91;Number of true positives&#47;&#40;Number of true positives<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Number of false negatives&#41;&#93;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>100&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0020"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Specificity<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>&#91;Number of true negatives&#47;&#40;Number of true negatives<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Number of false positives&#41;&#93;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>100&#46;</p>"
            ]
            2 => array:3 [
              "identificador" => "tblfn0025"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0025">Positive predictive value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>&#91;Number of true positives&#47;&#40;Number of true positives<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Number of false positives&#41;&#93;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>100&#46;</p>"
            ]
            3 => array:3 [
              "identificador" => "tblfn0030"
              "etiqueta" => "d"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0030">Negative predictive value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>&#91;Number of true negatives&#47;&#40;Number of true negatives<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Number of false negatives&#41;&#93;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>100&#46;</p> <p class="elsevierStyleNotepara" id="npar0035">For calculations&#44; the histological diagnosis was considered the gold standard to which the EBV quantification load was compared&#46;</p>"
            ]
            4 => array:3 [
              "identificador" => "tblfn0035"
              "etiqueta" => "e"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0040">OLT&#58; oropharyngeal lymphoid tissue&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Diagnostic performance of the EBV load measured on several sample types for PTLD detection</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0125" class="elsevierStyleSimplePara elsevierViewall">PH&#58; plasmacytic hyperplasia &#40;Category 1 of PTLD&#41;&#59; HL&#58; Hodgkin lymphoma &#40;Category 4 of PTLD&#41;&#59; DLCBL&#58; Diffuse large B cell lymphoma &#40;Category 3 of PTLD&#41;&#46;</p><p id="spar0145" class="elsevierStyleSimplePara elsevierViewall">NA&#58; Not applicable because EBV load remained not detectable&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Histological diagnosis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0040"><span class="elsevierStyleSup">a</span></a> PBMC &#40;log differences&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0040"><span class="elsevierStyleSup">a</span></a> Plasma &#40;log differences&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">PH<br>HL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;1&#46;34&#41;<br>Positive &#40;0&#46;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;1&#46;73&#41;<br>Negative &#40;0&#46;30&#41;<a class="elsevierStyleCrossRef" href="#tblfn0045"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">DLCBL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;0&#46;37&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;1&#46;16&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">DLCBL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;55&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;2&#46;47&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">D&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">PH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;56&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;98&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">E&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">DLCBL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;83&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;0&#46;15&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">PH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;77&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1116577.png"
              ]
            ]
          ]
          "notaPie" => array:2 [
            0 => array:3 [
              "identificador" => "tblfn0040"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0045">Positive kinetic variation&#58; &#8805;0&#46;5<span class="elsevierStyleHsp" style=""></span>log rise in EBV load&#59; Negative kinetic variation&#58; &#60;0&#46;5<span class="elsevierStyleHsp" style=""></span>log rise or a decrease &#40;indicated by a minus sign&#41; in EBV load&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0045"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0050">Although EBV load did not show a positive kinetic variation&#44; when HL was diagnosed it remained in high levels&#44; similar to those detected at the moment of PH identification&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Description of the kinetic variation of EBV load in PBMC and plasma from transplant patients at PTLD diagnosis</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0135" class="elsevierStyleSimplePara elsevierViewall">FLH&#58; follicular lymphoid hyperplasia&#46;</p><p id="spar0140" class="elsevierStyleSimplePara elsevierViewall">NA&#58; Not applicable because viral load remained not detectable&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Histological diagnosis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0050"><span class="elsevierStyleSup">a</span></a> PBMC &#40;log differences&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation<a class="elsevierStyleCrossRef" href="#tblfn0050"><span class="elsevierStyleSup">a</span></a> Plasma &#40;log differences&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;0&#46;96&#41;<br>Positive &#40;1&#46;46&#41;<br>Negative &#40;&#8722;0&#46;74&#41;<br>Positive &#40;0&#46;64&#41;<br>Negative &#40;&#8722;0&#46;03&#41;<br>Negative &#40;&#8722;0&#46;93&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NA<br>NA<br>NA<br>NA<br>NA<br>NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">H&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;0&#46;97&#41;<br>Positive &#40;2&#46;45&#41;<br>Negative &#40;&#8722;1&#46;33&#41;<br>Negative &#40;&#8722;0&#46;60&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NA<br>NA<br>NA<br>NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">I&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;54&#41;<br>Negative &#40;&#8722;0&#46;11&#41;<br>Positive &#40;1&#46;48&#41;<br>Negative &#40;&#8722;0&#46;34&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Positive &#40;0&#46;63&#41;<br>Negative &#40;&#8722;0&#46;63&#41;<br>NA<br>NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">J&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;1&#46;24&#41;<br>Negative &#40;&#8722;1&#46;73&#41;<br>Positive &#40;2&#46;78&#41;<br>Negative &#40;&#8722;0&#46;95&#41;<br>Positive &#40;0&#46;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;2&#46;13&#41;<br>NA<br>NA<br>NA<br>Negative &#40;0&#46;12&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">K&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;1&#46;39&#41;<br>Positive &#40;0&#46;74&#41;<br>Negative &#40;0&#46;31&#41;<br>Negative &#40;&#8722;0&#46;62&#41;<br>Negative &#40;&#8722;0&#46;61&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;0&#46;37&#41;<br>Negative &#40;&#8722;0&#46;37&#41;<br>NA<br>NA<br>NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">L&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">FLH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;0&#46;12&#41;<br>Negative &#40;&#8722;0&#46;97&#41;<br>Negative &#40;0&#46;40&#41;<br>Negative &#40;0&#46;04&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Negative &#40;&#8722;0&#46;37&#41;<br>Positive &#40;1&#46;10&#41;<br>Negative &#40;&#8722;1&#46;10&#41;<br>NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1116579.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0050"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0055">Positive kinetic variation&#58; &#8805;0&#46;5<span class="elsevierStyleHsp" style=""></span>log rise in EBV load&#46; Negative kinetic variation&#58; &#60;0&#46;5<span class="elsevierStyleHsp" style=""></span>log rise or a decrease &#40;indicated by a minus sign&#41; in EBV load&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0105" class="elsevierStyleSimplePara elsevierViewall">Description of the kinetic variation of EBV load in PBMC and plasma from transplant patients without a PTLD diagnosis</p>"
        ]
      ]
      8 => array:8 [
        "identificador" => "tbl0025"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at5"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Kinetic load variation&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PPV<a class="elsevierStyleCrossRef" href="#tblfn0055"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">NPV<a class="elsevierStyleCrossRef" href="#tblfn0060"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PBMC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">83&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">57&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">31&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">93&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Plasma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">80&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">80&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">44&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">95&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PBMC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Plasma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">83&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">81&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">55&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">94&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1116575.png"
              ]
            ]
          ]
          "notaPie" => array:2 [
            0 => array:3 [
              "identificador" => "tblfn0055"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0060">Positive predictive value&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0060"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0065">Negative predictive value&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0120" class="elsevierStyleSimplePara elsevierViewall">Diagnostic performance of the kinetic variation of EBV load for PTLD detection</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:23 [
            0 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantification of <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span>-DNA load in lung transplant recipients&#58; a comparison of plasma versus whole blood"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "N&#46;A&#46; Bakker"
                            1 => "E&#46;A&#46; Verschuuren"
                            2 => "N&#46;J&#46; Veeger"
                            3 => "W&#46; van der Bij"
                            4 => "G&#46;W&#46; van Imhoff"
                            5 => "C&#46;G&#46; Kallenberg"
                            6 => "B&#46;G&#46; Hepkema"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.healun.2007.10.008"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Heart Lung Transplant"
                        "fecha" => "2008"
                        "volumen" => "27"
                        "paginaInicial" => "7"
                        "paginaFinal" => "10"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18187080"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chronic high <span class="elsevierStyleItalic">Epstein&#8211;Barr viral</span> load state and risk for late-onset posttransplant lymphoproliferative disease&#47;lymphoma in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "M&#46;A&#46; Bingler"
                            1 => "B&#46; Feingold"
                            2 => "S&#46;A&#46; Miller"
                            3 => "M&#46;G&#46; Michaels"
                            4 => "M&#46; Green"
                            5 => "R&#46;M&#46; Wadowsky"
                            6 => "D&#46;T&#46; Rowe"
                            7 => "S&#46;A&#46; Webber"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1600-6143.2007.02080.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Transplant"
                        "fecha" => "2008"
                        "volumen" => "8"
                        "paginaInicial" => "442"
                        "paginaFinal" => "445"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18211510"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A prospective study on modulation of immunosuppression for <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> reactivation in pediatric patients who underwent unrelated hematopoietic stem-cell transplantation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:11 [
                            0 => "S&#46; Cesaro"
                            1 => "A&#46; Pegoraro"
                            2 => "G&#46; Tridello"
                            3 => "E&#46; Calore"
                            4 => "M&#46; Pillon"
                            5 => "S&#46; Varotto"
                            6 => "D&#46; Abate"
                            7 => "L&#46; Barzon"
                            8 => "C&#46; Mengoli"
                            9 => "M&#46; Carli"
                            10 => "C&#46; Messina"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/TP.0b013e3181dd6c0a"
                      "Revista" => array:6 [
                        "tituloSerie" => "Transplantation"
                        "fecha" => "2010"
                        "volumen" => "89"
                        "paginaInicial" => "1533"
                        "paginaFinal" => "1540"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20463647"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A semi-quantitative PCR method &#40;SQ-PCR&#41; to measure <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> load&#58; its application in transplant patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "M&#46;D&#46; Fellner"
                            1 => "K&#46; Durand"
                            2 => "M&#46; Correa"
                            3 => "D&#46; Bes"
                            4 => "L&#46;V&#46; Alonio"
                            5 => "A&#46;R&#46; Teyssi&#233;"
                            6 => "M&#46;A&#46; Picconi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Virol"
                        "fecha" => "2003"
                        "volumen" => "28"
                        "paginaInicial" => "323"
                        "paginaFinal" => "330"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14522071"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Duplex realtime PCR method for <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> and human DNA quantification&#58; its application for post-transplant lymphoproliferative disorders detection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;D&#46; Fellner"
                            1 => "K&#46;A&#46; Durand"
                            2 => "M&#46;A&#46; Rodr&#237;guez"
                            3 => "L&#46; Irazu"
                            4 => "L&#46;V&#46; Alonio"
                            5 => "M&#46;A&#46; Picconi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bjid.2013.07.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Braz J Infect Dis"
                        "fecha" => "2014"
                        "volumen" => "18"
                        "paginaInicial" => "271"
                        "paginaFinal" => "280"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24389276"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Viral dynamics in transplant patients&#58; implications for disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "G&#46;A&#46; Funk"
                            1 => "R&#46; Gosert"
                            2 => "H&#46;H&#46; Hirsch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Lancet Inf Dis"
                        "fecha" => "2007"
                        "volumen" => "7"
                        "paginaInicial" => "460"
                        "paginaFinal" => "472"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "EBV viral load detection in clinical virology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "B&#46; G&#228;rtner"
                            1 => "J&#46;K&#46; Preiksaitis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jcv.2010.03.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Virol"
                        "fecha" => "2010"
                        "volumen" => "48"
                        "paginaInicial" => "82"
                        "paginaFinal" => "90"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20395167"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Posttransplantation lymphoproliferative disorders"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Green"
                            1 => "S&#46; Webber"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Clin North Am"
                        "fecha" => "2003"
                        "volumen" => "50"
                        "paginaInicial" => "1471"
                        "paginaFinal" => "1491"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14710788"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Developing a quality system for quantitative laboratory-developed tests"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "T&#46;E&#46; Grys"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Microbiol Newsl"
                        "fecha" => "2011"
                        "volumen" => "33"
                        "paginaInicial" => "179"
                        "paginaFinal" => "185"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Using <span class="elsevierStyleItalic">Epstein&#8211;Barr viral</span> load assays to diagnose&#44; monitor&#44; and prevent posttransplant lymphoproliferative disorder"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;L&#46; Gulley"
                            1 => "W&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/CMR.00006-09"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Microbiol Rev"
                        "fecha" => "2010"
                        "volumen" => "23"
                        "paginaInicial" => "350"
                        "paginaFinal" => "366"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20375356"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantitative <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> viral load monitoring in pediatric liver transplantation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;Y&#46; Jang"
                            1 => "K&#46;M&#46; Kim"
                            2 => "Y&#46;J&#46; Lee"
                            3 => "S&#46;G&#46; Lee"
                            4 => "H&#46;S&#46; Chi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.transproceed.2008.07.014"
                      "Revista" => array:6 [
                        "tituloSerie" => "Transplant Proc"
                        "fecha" => "2008"
                        "volumen" => "40"
                        "paginaInicial" => "2546"
                        "paginaFinal" => "2548"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18929796"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The changing face of post-transplant lymphoproliferative disease in the era of molecular EBV monitoring"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "N&#46; Kerkar"
                            1 => "R&#46;A&#46; Morotti"
                            2 => "R&#46;P&#46; Madan"
                            3 => "B&#46; Shneider"
                            4 => "B&#46;C&#46; Herold"
                            5 => "C&#46; Dugan"
                            6 => "T&#46; Miloh"
                            7 => "I&#46; Karabicak"
                            8 => "J&#46;A&#46; Strauchen"
                            9 => "S&#46; Emre"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1399-3046.2009.01258.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Transplant"
                        "fecha" => "2010"
                        "volumen" => "14"
                        "paginaInicial" => "504"
                        "paginaFinal" => "511"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20070559"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Measuring <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> &#40;EBV&#41; load&#58; the significance and application for each EBV-associated disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H&#46; Kimura"
                            1 => "Y&#46; Ito"
                            2 => "R&#46; Suzuki"
                            3 => "Y&#46; Nishiyama"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/rmv.582"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Med Virol"
                        "fecha" => "2008"
                        "volumen" => "18"
                        "paginaInicial" => "305"
                        "paginaFinal" => "319"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18494041"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Post-transplant lymphoproliferative disease and other <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> diseases in allogeneic haematopoietic stem cell transplantation after introduction of monitoring of viral load by polymerase chain reaction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Kinch"
                            1 => "G&#46; Oberg"
                            2 => "J&#46; Arvidson"
                            3 => "K&#46;I&#46; Falk"
                            4 => "A&#46; Linde"
                            5 => "K&#46; Pauksens"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/00365540600978906"
                      "Revista" => array:6 [
                        "tituloSerie" => "Scand J Infect Dis"
                        "fecha" => "2007"
                        "volumen" => "39"
                        "paginaInicial" => "235"
                        "paginaFinal" => "244"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17366054"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Monitoring of <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> load after hematopoietic stem cell transplantation for early intervention in post-transplant lymphoproliferative disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Meerbach"
                            1 => "P&#46; Wutzler"
                            2 => "R&#46; H&#228;fer"
                            3 => "F&#46; Zintl"
                            4 => "B&#46; Gruhn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jmv.21096"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Med Virol"
                        "fecha" => "2008"
                        "volumen" => "80"
                        "paginaInicial" => "441"
                        "paginaFinal" => "454"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18205222"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Monitoring and modulation of <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> loads in pediatric transplant patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "R&#46;J&#46; Orentas"
                            1 => "D&#46;W&#46; Schauer Jr&#46;"
                            2 => "F&#46;W&#46; Ellis"
                            3 => "J&#46; Walczak"
                            4 => "J&#46;T&#46; Casper"
                            5 => "D&#46;A&#46; Margolis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Transplant"
                        "fecha" => "2003"
                        "volumen" => "7"
                        "paginaInicial" => "305"
                        "paginaFinal" => "314"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12890010"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Epstein Barr virus</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46;B&#46; Rickinson"
                            1 => "E&#46; Kieff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:7 [
                        "editores" => "B&#46;N&#46;FieldsD&#46;M&#46;KnipeP&#46;M&#46;Howley"
                        "paginaInicial" => "2656"
                        "paginaFinal" => "2700"
                        "edicion" => "5th ed&#46;"
                        "serieVolumen" => "vol&#46; 2"
                        "serieTitulo" => "Fields virology"
                        "serieFecha" => "2007"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased levels of circulating <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> &#40;EBV&#41;-infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of posttransplant lymphoproliferative disease in solid-organ transplant recipients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46;A&#46; Riddler"
                            1 => "M&#46;C&#46; Breinig"
                            2 => "J&#46;L&#46; McKnight"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Blood"
                        "fecha" => "1994"
                        "volumen" => "84"
                        "paginaInicial" => "972"
                        "paginaFinal" => "984"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8043879"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Early identification of <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span>-associated post-transplantation lymphoproliferative disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46;M&#46; Rooney"
                            1 => "S&#46;K&#46; Loftin"
                            2 => "M&#46;S&#46; Holladay"
                            3 => "M&#46;K&#46; Brenner"
                            4 => "R&#46;A&#46; Krance"
                            5 => "H&#46;E&#46; Heslop"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Haematol"
                        "fecha" => "1995"
                        "volumen" => "89"
                        "paginaInicial" => "98"
                        "paginaFinal" => "103"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7833284"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Use of quantitative competitive PCR to measure <span class="elsevierStyleItalic">Epstein&#8211;Barr virus</span> genome load in the peripheral blood of pediatric transplant patients with lymphoproliferative disorders"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "D&#46;T&#46; Rowe"
                            1 => "L&#46; Qu"
                            2 => "J&#46; Reyes"
                            3 => "N&#46; Jabbour"
                            4 => "E&#46; Yunis"
                            5 => "P&#46; Putnam"
                            6 => "S&#46; Todo"
                            7 => "M&#46; Green"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1997"
                        "volumen" => "35"
                        "paginaInicial" => "1612"
                        "paginaFinal" => "1615"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9163497"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnosis and treatment of post-transplantation lymphoproliferative disorder in pediatric heart transplant patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "S&#46; Schubert"
                            1 => "H&#46; Abdul-Khaliq"
                            2 => "H&#46;B&#46; Lehmkuhl"
                            3 => "M&#46; Yegitbasi"
                            4 => "P&#46; Reinke"
                            5 => "C&#46; Kebelmann-Betzig"
                            6 => "K&#46; Hauptmann"
                            7 => "U&#46; Gross-Wieltsch"
                            8 => "R&#46; Hetzer"
                            9 => "F&#46; Berger"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1399-3046.2008.00969.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Transplant"
                        "fecha" => "2009"
                        "volumen" => "13"
                        "paginaInicial" => "54"
                        "paginaFinal" => "62"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18518912"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Post-transplant lymphoproliferative disorders"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46;H&#46; Swerdlow"
                            1 => "S&#46;A&#46; Webber"
                            2 => "A&#46; Chadburn"
                            3 => "J&#46;A&#46; Ferry"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:5 [
                        "titulo" => "WHO classification of tumours of haematopoietic and lymphoid tissues"
                        "paginaInicial" => "343"
                        "paginaFinal" => "350"
                        "edicion" => "4th ed&#46;"
                        "serieFecha" => "2008"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "EBV PCR in the diagnosis and monitoring of posttransplant lymphoproliferative disorder&#58; results of a two-arm prospective trial"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:15 [
                            0 => "D&#46;E&#46; Tsai"
                            1 => "L&#46; Douglas"
                            2 => "C&#46; Andreadis"
                            3 => "D&#46;T&#46; Vogl"
                            4 => "S&#46; Arnoldi"
                            5 => "R&#46; Kotloff"
                            6 => "J&#46; Svoboda"
                            7 => "R&#46;D&#46; Bloom"
                            8 => "K&#46;M&#46; Olthoff"
                            9 => "S&#46;C&#46; Brozena"
                            10 => "S&#46;J&#46; Schuster"
                            11 => "E&#46;A&#46; Stadtmauer"
                            12 => "E&#46;S&#46; Robertson"
                            13 => "M&#46;A&#46; Wasik"
                            14 => "V&#46;N&#46; Ahya"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1600-6143.2008.02183.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Transplant"
                        "fecha" => "2008"
                        "volumen" => "8"
                        "paginaInicial" => "1016"
                        "paginaFinal" => "1024"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18312608"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack229395"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0255" class="elsevierStylePara elsevierViewall">The authors are indebted to S&#46; Nu&#241;ez and J&#46; Campos&#44; for their technical assistance&#44; Drs&#58; C&#46; Gonzalez Cambaceres&#44; P&#46; Bern&#225;ldez&#44; J&#46; Iba&#241;ez and A&#46; Turconi &#40;&#8220;Prof&#46; Dr Juan P&#46; Garrahan&#8221; Pediatric Hospital&#41;&#59; J&#46; Gregoresky and M&#46; V&#46; &#193;vila &#40;Austral University Hospital&#41;&#59; T&#46; Gonzalez and S&#46; Besga &#40;&#8220;Sor Mar&#237;a Ludovica&#8221; Children&#39;s Hospital&#41;&#44; J&#46; Trentadue &#40;Favaloro Foundation&#41; for their generous help during sampling&#44; and their commitment to the prevention of PTLD in transplant patients&#46; This project was partially supported by grants from <span class="elsevierStyleGrantSponsor" id="gs1">ANLIS Carlos G&#46; Malbr&#225;n</span> &#40;FOCANLIS&#47;2009&#41; &#40;Buenos Aires&#44; Argentina&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03257541/0000004800000002/v1_201607030039/S0325754116000110/v1_201607030039/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "37861"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Microbiolog&#237;a cl&#237;nica y enfermedades infecciosas"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004800000002/v1_201607030039/S0325754116000110/v1_201607030039/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754116000110?idApp=UINPBA00004N"
]

Article information

ISSN: 03257541
Original language: English

DOI:10.1016/j.ram.2016.02.006

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	5	1	6
2024 October	58	5	63
2024 September	92	5	97
2024 August	69	9	78
2024 July	65	7	72
2024 June	62	7	69
2024 May	61	3	64
2024 April	68	3	71
2024 March	76	9	85
2024 February	41	5	46
2024 January	41	3	44
2023 December	49	11	60
2023 November	57	6	63
2023 October	73	5	78
2023 September	41	4	45
2023 August	54	6	60
2023 July	74	6	80
2023 June	70	3	73
2023 May	93	6	99
2023 April	73	5	78
2023 March	44	6	50
2023 February	51	5	56
2023 January	33	3	36
2022 December	36	11	47
2022 November	43	7	50
2022 October	38	14	52
2022 September	37	9	46
2022 August	43	10	53
2022 July	54	12	66
2022 June	32	6	38
2022 May	87	19	106
2022 April	76	10	86
2022 March	76	13	89
2022 February	69	12	81
2022 January	67	8	75
2021 December	35	19	54
2021 November	40	13	53
2021 October	37	15	52
2021 September	29	11	40
2021 August	34	12	46
2021 July	24	12	36
2021 June	25	14	39
2021 May	18	13	31
2021 April	55	15	70
2021 March	29	15	44
2021 February	15	11	26
2021 January	33	16	49
2020 December	21	11	32
2020 November	16	7	23
2020 October	13	9	22
2020 September	19	13	32
2020 August	20	6	26
2020 July	16	6	22
2020 June	21	8	29
2020 May	36	10	46
2020 April	25	7	32
2020 March	39	7	46
2020 February	32	10	42
2020 January	37	10	47
2019 December	38	16	54
2019 November	27	23	50
2019 October	25	7	32
2019 September	38	16	54
2019 August	16	7	23
2019 July	15	19	34
2019 June	36	27	63
2019 May	56	63	119
2019 April	36	19	55
2019 March	15	6	21
2019 February	18	11	29
2019 January	23	13	36
2018 December	17	11	28
2018 November	24	18	42
2018 October	26	25	51
2018 September	29	8	37
2018 August	9	6	15
2018 July	5	9	14
2018 June	15	4	19
2018 May	7	23	30
2018 April	5	4	9
2018 March	8	5	13
2018 February	3	13	16
2018 January	12	7	19
2017 December	4	15	19
2017 November	9	3	12
2017 October	16	17	33
2017 September	11	8	19
2017 August	5	23	28
2017 July	10	5	15
2017 June	19	11	30
2017 May	16	17	33
2017 April	14	15	29
2017 March	20	76	96
2017 February	17	8	25
2017 January	9	12	21
2016 December	22	12	34
2016 November	27	17	44
2016 October	39	29	68
2016 September	50	22	72
2016 August	77	31	108
2016 July	46	16	62

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter