Brief report
Cladosporium species causing “Cladosporium rot” on “Bosc” pear fruit in Argentina
Especies de Cladosporium causantes de podredumbre en peras «Bosc» en Argentina
Temperini Carolina Virginiaa,
, Alonso Javier Néstora,c, Colodner Adrián Dariob, Pose Graciela Noemía,c,1
Corresponding author
a Universidad Nacional de Río Negro, Río Negro, Argentina. Mitre 331, (8336) Villa Regina, Provincia de Río Negro, Argentina
b Instituto Nacional de Tecnología Agropecuaria (INTA) - Estación Experimental Agropecuaria Alto Valle. Ruta Nacional 22, Km 1190, (8332) Allen, Río Negro
c Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Argentina
Read
1710
Timeswas read the article
414
Total PDF
1296
Total HTML
Share statistics
array:24 [ "pii" => "S0325754120300316" "issn" => "03257541" "doi" => "10.1016/j.ram.2019.11.006" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "392" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2021;53:75-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S0325754120300614" "issn" => "03257541" "doi" => "10.1016/j.ram.2020.06.008" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "402" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2021;53:78-83" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Brief report</span>" "titulo" => "Evaluation and selection of culture media for the detection of auxin-like compounds and phosphate solubilization on soil yeasts" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "78" "paginaFinal" => "83" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Evaluación y selección de medios de cultivo para detectar compuestos tipo auxinas y la solubilización de fosfato en levaduras de suelo" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "María Cecilia Mestre, María Elena Severino, Sonia Fontenla" "autores" => array:3 [ 0 => array:2 [ "nombre" => "María Cecilia" "apellidos" => "Mestre" ] 1 => array:2 [ "nombre" => "María Elena" "apellidos" => "Severino" ] 2 => array:2 [ "nombre" => "Sonia" "apellidos" => "Fontenla" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754120300614?idApp=UINPBA00004N" "url" => "/03257541/0000005300000001/v1_202103140751/S0325754120300614/v1_202103140751/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754120300304" "issn" => "03257541" "doi" => "10.1016/j.ram.2019.12.005" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "391" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2021;53:64-74" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:14 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original</span>" "titulo" => "Effect of fungicides commonly used for Fusarium head blight management on growth and fumonisin production by <span class="elsevierStyleItalic">Fusarium proliferatum</span>" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:3 [ 0 => "en" 1 => "en" 2 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "64" "paginaFinal" => "74" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Efecto de fungicidas utilizados para el control de la fusariosis de la espiga de trigo sobre el creciemiento de <span class="elsevierStyleItalic">Fusarium proliferatum</span> y la producción de fumonisinas" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2391 "Ancho" => 2495 "Tamanyo" => 276444 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Growth rates (mm/day) for <span class="elsevierStyleItalic">F. proliferatum</span> ITEM 15654 under different a<span class="elsevierStyleInf">W</span> (0.995; 0.97; 0.95), temperatures (15; 25 ̊C), fungicides (D: epoxiconazole + metconazole; T: tebuconazole; O: pyraclostrobin + epoxiconazole; P: prothioconazole), and fungicide concentrations: 0 (<elsevierMultimedia ident="202103140751575331"></elsevierMultimedia>); 0.5 (<elsevierMultimedia ident="202103140751575332"></elsevierMultimedia>); 2.5 (<elsevierMultimedia ident="202103140751575333"></elsevierMultimedia>); 5 (<elsevierMultimedia ident="202103140751575334"></elsevierMultimedia>); 15 (<elsevierMultimedia ident="202103140751575335"></elsevierMultimedia>) μg/mL.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Eugenia Cendoya, María Julia Nichea, María del Pilar Monge, Vanessa G.L. Zachetti, Stella Maris Chiacchiera, María Laura Ramirez" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Eugenia" "apellidos" => "Cendoya" ] 1 => array:2 [ "nombre" => "María Julia" "apellidos" => "Nichea" ] 2 => array:2 [ "nombre" => "María del Pilar" "apellidos" => "Monge" ] 3 => array:2 [ "nombre" => "Vanessa G.L." "apellidos" => "Zachetti" ] 4 => array:2 [ "nombre" => "Stella Maris" "apellidos" => "Chiacchiera" ] 5 => array:2 [ "nombre" => "María Laura" "apellidos" => "Ramirez" ] ] ] ] "resumen" => array:1 [ 0 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">•</span><p id="par0005" class="elsevierStylePara elsevierViewall">All fungicides reduced <span class="elsevierStyleItalic">F. proliferatum</span> growth rates when compared to the control.</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">•</span><p id="par0010" class="elsevierStylePara elsevierViewall">All fungicides reduced fumonisins production when they were used in high doses.</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">•</span><p id="par0015" class="elsevierStylePara elsevierViewall">Fungicides effect in growth and FBs increased, as they concentration increased.</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">•</span><p id="par0020" class="elsevierStylePara elsevierViewall">Except P, all fungicides used in sub-lethal doses enhanced FBs production.</p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel">•</span><p id="par0025" class="elsevierStylePara elsevierViewall">P was the most effective fungicide: inhibited growth and FBs in most conditions.</p></li></ul></p></span>" ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754120300304?idApp=UINPBA00004N" "url" => "/03257541/0000005300000001/v1_202103140751/S0325754120300304/v1_202103140751/en/main.assets" ] "en" => array:22 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Brief report</span>" "titulo" => "<span class="elsevierStyleItalic">Cladosporium</span> species causing “<span class="elsevierStyleItalic">Cladosporium</span> rot” on “Bosc” pear fruit in Argentina" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "75" "paginaFinal" => "77" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Temperini Carolina Virginia, Alonso Javier Néstor, Colodner Adrián Dario, Pose Graciela Noemí" "autores" => array:4 [ 0 => array:4 [ "nombre" => "Temperini" "apellidos" => "Carolina Virginia" "email" => array:1 [ 0 => "ctemperini@unrn.edu.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Alonso" "apellidos" => "Javier Néstor" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "Colodner" "apellidos" => "Adrián Dario" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Pose" "apellidos" => "Graciela Noemí" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">1</span>" "identificador" => "fn0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Universidad Nacional de Río Negro, Río Negro, Argentina. Mitre 331, (8336) Villa Regina, Provincia de Río Negro, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Instituto Nacional de Tecnología Agropecuaria (INTA) - Estación Experimental Agropecuaria Alto Valle. Ruta Nacional 22, Km 1190, (8332) Allen, Río Negro" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Argentina" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Especies de <span class="elsevierStyleItalic">Cladosporium</span> causantes de podredumbre en peras «Bosc» en Argentina" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 560 "Ancho" => 750 "Tamanyo" => 42526 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">External symptoms of <span class="elsevierStyleItalic">Cladosporium</span> rot on Bosc pears.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0020" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Cladosporium</span> species can cause lesions in healthy pears according to <span class="elsevierStyleItalic">in vitro</span> studies<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">5,7,14</span></a>. <span class="elsevierStyleItalic">Cladosporium herbarum</span> was reported as a causal agent of <span class="elsevierStyleItalic">Cladosporium</span> rot on Bosc pear cultivars in the USA<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">9</span></a>. Moreover, the species <span class="elsevierStyleItalic">C. herbarum</span> and <span class="elsevierStyleItalic">Cladosporium</span> sp. were reported as postharvest phytopathogens of pears in the Netherlands<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">15</span></a>. Postharvest <span class="elsevierStyleItalic">Cladosporium</span> rots were also reported in Argentina on Beurré Bosc and Golden Russet Bosc pears in Northern Patagonia<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">5,12</span></a>. A correct and accurate identification of the species is necessary because the name of the species involves a set of characteristics such as growth features, pathogenicity or production of mycotoxins, which allow to predict their behavior<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">1</span></a>.</p><p id="par0025" class="elsevierStylePara elsevierViewall">“Bosc” pears were affected by rot spots during cold storage (2016-2017) in the High Valley of Río Negro, a fruit producing region of Northern Patagonia in Argentina. The symptoms consisted of one or more brownish black circular spots that extended over the rind, light brown on the edges and dark brown to black in the center (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). Therefore, the objective of this work was to determine the <span class="elsevierStyleItalic">Cladosporium</span> species that were involved in this fruit disease.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0030" class="elsevierStylePara elsevierViewall">Fifteen symptomatic “Bosc” pears, stored unprocessed during approximately 2 months in bins inside conventional cold storage chambers at -0.5<span class="elsevierStyleHsp" style=""></span>°C, were obtained from three commercial establishments (5 pieces from each). Fruits were superficially disinfected with a solution of sodium hypochlorite (1:10) for 5<span class="elsevierStyleHsp" style=""></span>minutes and rinsed by immersion twice in sterile distilled water. Infected internal tissue fragments were aseptically extracted from the spots and placed on potato dextrose agar supplemented with 0.1% chloramphenicol (PDA<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>C). Plates were incubated for 7 days at 25<span class="elsevierStyleHsp" style=""></span>°C. The pathogens were identified at the genus level according to Pitt and Hocking<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">8</span></a> as <span class="elsevierStyleItalic">Cladosporium</span> species. Characterization based on macroscopic features of the colonies clustered the isolates into nine different morphological groups (designated as G1 to G9). The microscopic characteristics of the isolates were determined in SNA (synthetic nutrient-poor agar) medium after 14 days of incubation at 25<span class="elsevierStyleHsp" style=""></span>°C under close UV light<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">3</span></a>. DNA extraction was performed using the DNeasy Plant Mini Kit following the manufacturer's instructions (Qiagen, Intl) and genomic DNA was quantified with the Qubit 2.0 fluorometer (Life Technologies, Intl.). The partial sequence of the actin gene (ACT) was amplified using the primers ACT-512F: ATGTGCAAGGCCGGTTTCGC and ACT-783R: TACGAGTCCTTCTGGCCCAT to obtain resolution at the species level<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">3,14</span></a>. Sequencing of the fragments was done by Macrogen Inc. (Seoul, Korea). Pathogenicity tests were performed using the toothpick technique<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">2</span></a> and verified according to Koch's postulates.</p><p id="par0040" class="elsevierStylePara elsevierViewall">After the molecular analysis, the nine different morphological groups were reduced to 3 species as causal agents of the disease. BLAST analysis of 200<span class="elsevierStyleHsp" style=""></span>bp fragments from the isolates with <span class="elsevierStyleItalic">Cladosporium</span> strain reference sequences obtained from the GenBank showed 100% identity to <span class="elsevierStyleItalic">Cladosporium subtilissimum</span> (isolate 53ACT GenBank Accession No. MG680545.1), <span class="elsevierStyleItalic">Cladosporium macrocarpum</span> (isolate 12ACT GenBank Accession No. MG680533.1) and <span class="elsevierStyleItalic">Cladosporium floccosum</span> (culture CPC 17802 GenBank Accession No. MF473823.1). As a result of the pathogenicity tests, the <span class="elsevierStyleItalic">C. subtilissimum</span> isolates produced a 1.5<span class="elsevierStyleHsp" style=""></span>cm lesion on the surface of the fruits with internal necrosis 1.1<span class="elsevierStyleHsp" style=""></span>cm deep (dry tissue that emerges like a plug). <span class="elsevierStyleItalic">C. macrocarpum</span> isolates produced an average lesion of 1.5<span class="elsevierStyleHsp" style=""></span>cm on the surface of the fruit with wet internal necrosis averaging 1.7<span class="elsevierStyleHsp" style=""></span>cm. <span class="elsevierStyleItalic">C. floccosum</span> isolates caused an external average lesion of 1<span class="elsevierStyleHsp" style=""></span>cm surrounded by a brown halo with dark brown internal necrosis extending 1.5<span class="elsevierStyleHsp" style=""></span>cm deep (dry tissue that emerges like a plug).</p><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Cladosporium</span> species are predominant in indoor and outdoor environments<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">4,11,13</span></a>. <span class="elsevierStyleItalic">C. macrocarpun</span> and <span class="elsevierStyleItalic">C. subtilissimum</span> have been reported in a previous study conducted in rural environments of the High Valley of Río Negro productive region in Northern Patagonia in which eleven species were determined. Pathogenicity tests revealed that <span class="elsevierStyleItalic">C. macrocarpun</span> and <span class="elsevierStyleItalic">C. subtilissimum</span>, among other <span class="elsevierStyleItalic">Cladosporium</span> species, caused disease on pears<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">14</span></a>. The presence of these and other potentially phytopathogenic species in the air warns about the potential risk of infections by these causal agents during cold storage and/or growing seasons in the field. Emerging diseases can be expected in the context of climate change, such as that which has been occurring in Northern Patagonia (Argentina)<a class="elsevierStyleCrossRefs" href="#bib0105"><span class="elsevierStyleSup">6,10</span></a>. These findings contribute to implementing appropriate preventive measures to reduce losses in pear production due to <span class="elsevierStyleItalic">Cladosporium</span> rot.</p><p id="par0050" class="elsevierStylePara elsevierViewall">GenBank Accession numbers are MK410437-MK410445 (under examination and processing by the GenBank annotation staff).</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Conflict of interest</span><p id="par0055" class="elsevierStylePara elsevierViewall">None</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:8 [ 0 => array:3 [ "identificador" => "xres1480272" "titulo" => "Highlights" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:3 [ "identificador" => "xres1480273" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 2 => array:2 [ "identificador" => "xpalclavsec1348106" "titulo" => "Keywords" ] 3 => array:3 [ "identificador" => "xres1480274" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0015" ] ] ] 4 => array:2 [ "identificador" => "xpalclavsec1348107" "titulo" => "Palabras clave" ] 5 => array:2 [ "identificador" => "sec0005" "titulo" => "Conflict of interest" ] 6 => array:2 [ "identificador" => "xack519253" "titulo" => "Acknowledgments" ] 7 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2019-07-26" "fechaAceptado" => "2019-11-29" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1348106" "palabras" => array:4 [ 0 => "Cladosporium rot" 1 => "Rot spot" 2 => "“Bosc” pear fruit" 3 => "Pyrus communis" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1348107" "palabras" => array:4 [ 0 => "Pudrición por <span class="elsevierStyleItalic">Cladosporium</span>" 1 => "Manchas por pudrición" 2 => "Peras «Bosc»" 3 => "<span class="elsevierStyleItalic">Pyrus communis</span>" ] ] ] ] "tieneResumen" => true "highlights" => array:2 [ "titulo" => "Highlights" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">•</span><p id="par0005" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Cladosporium</span> rot on Bosc pears has been reported in the valleys of Río Negro and Neuquén.</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">•</span><p id="par0010" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Cladosporium macrocarpum</span>, <span class="elsevierStyleItalic">C. subtilissimum</span> and <span class="elsevierStyleItalic">C. floccosum</span> were the species involved.</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">•</span><p id="par0015" class="elsevierStylePara elsevierViewall">This is the first report of identified <span class="elsevierStyleItalic">Cladosporium</span> species as involved in this pathology.</p></li></ul></p></span>" ] "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">“<span class="elsevierStyleItalic">Cladosporium</span> rot” on “Bosc” pear fruit during cold storage causes significant economic losses and has been reported in recent years in the productive valleys of Río Negro and Neuquén. The species involved were not determined. During 2016-2017, “Bosc” pears (<span class="elsevierStyleItalic">Pyrus communis</span>) in cold storage chambers exhibited external brownish black circular spots caused by <span class="elsevierStyleItalic">Cladosporium</span> spp. The objective of this work was to determine the <span class="elsevierStyleItalic">Cladosporium</span> species that caused the above mentioned symptoms. The morphological and molecular analyses of the partial sequence of the actin gene (ACT) supported the identification. <span class="elsevierStyleItalic">Cladosporium macrocarpum</span>, <span class="elsevierStyleItalic">Cladosporium subtilissimum</span> and <span class="elsevierStyleItalic">Cladosporium floccosum</span> were determined as the species involved in the disease. Although <span class="elsevierStyleItalic">Cladosporium</span> has been reported to cause pear rot, this is the first report to identify these species as causal agents of this fruit disease.</p></span>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<span id="abst0015" class="elsevierStyleSection elsevierViewall"><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">En los valles productivos de Río Negro y Neuquén, se ha reportado en los últimos años la presencia de podredumbre de peras «Bosc» causada por <span class="elsevierStyleItalic">Cladosporium</span>, lo que generó significativas pérdidas económicas. Las especies involucradas no fueron determinadas. Se detectó la aparición de manchas circulares negras parduzcas en peras de dicha variedad en cámaras de almacenamiento en frío durante 2016-2017. El objetivo del presente trabajo fue determinar las especies de <span class="elsevierStyleItalic">Cladosporium</span> causantes de los síntomas mencionados. La identificación fue llevada a cabo por caracterización morfológica y el análisis molecular de la secuencia parcial del gen de actina (ACT). Se pudo determinar que <span class="elsevierStyleItalic">Cladosporium macrocarpum</span>, <span class="elsevierStyleItalic">Cladosporium subtilissimum</span> y <span class="elsevierStyleItalic">Cladosporium floccosum</span> fueron las especies implicadas. Si bien la podredumbre en peras causada por <span class="elsevierStyleItalic">Cladosporium</span> ha sido previamente reportada, este es el primer informe que identifica a estas especies entre los agentes causales de la enfermedad.</p></span>" ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Present address: Universidad Nacional de Quilmes/Laboratorio de Micología y Cultivo de Hongos Comestibles - INTECH (CONICET).</p>" "identificador" => "fn0005" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 560 "Ancho" => 750 "Tamanyo" => 42526 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">External symptoms of <span class="elsevierStyleItalic">Cladosporium</span> rot on Bosc pears.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:15 [ 0 => array:3 [ "identificador" => "bib0080" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemical and morphological segregation of <span class="elsevierStyleItalic">Alternaria alternata</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B. Andersen" 1 => "E. Krøger" 2 => "R. Roberts" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "A. gaisen and A. longipes. Mycological Research." "fecha" => "2001" "volumen" => "105" "paginaInicial" => "291" "paginaFinal" => "299" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0085" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemical and morphological segregation of <span class="elsevierStyleItalic">Alternaria arborescens</span> A. infectoria and A. tenuissima species-groups" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B. Andersen" 1 => "E. Kroger" 2 => "R. Roberts" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mycological Research." "fecha" => "2002" "volumen" => "106" "paginaInicial" => "170" "paginaFinal" => "182" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0090" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The genus <span class="elsevierStyleItalic">Cladosporium</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Bensch" 1 => "U. Braun" 2 => "J. Groenewald" 3 => "P. Crous" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3114/sim0003" "Revista" => array:6 [ "tituloSerie" => "Studies in Mycology." "fecha" => "2012" "volumen" => "72" "paginaInicial" => "1" "paginaFinal" => "401" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22815589" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0095" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">Cladosporium</span> species in indoor environments" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "K. Bensch" 1 => "J. Groenewald" 2 => "M. Meijer" 3 => "J. Dijksterhuis" 4 => "Z. Jurjevi" 5 => "B. Andersen" 6 => "J. Houbraken" 7 => "P. Crous" 8 => "R. Samson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.simyco.2018.03.002" "Revista" => array:6 [ "tituloSerie" => "Studies in Mycology." "fecha" => "2018" "volumen" => "89" "paginaInicial" => "177" "paginaFinal" => "301" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29681671" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0100" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of pre and postharvest application of fungicides on postharvest decay of Bosc pear caused by <span class="elsevierStyleItalic">Alternaria-Cladosporium</span> complex in North Patagonia, Argentina" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Lutz" 1 => "M. Sosa" 2 => "A. Colodner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Scientia horticulturae." "fecha" => "2017" "volumen" => "225" "paginaInicial" => "810" "paginaFinal" => "817" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0105" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Redagraria.com [Internet]. El cambio climático en el Alto Valle; 2006. [Access in: Jan. 2006]. Available from: http://www.redagraria.com/meteorologia/Alto%20Valle%20Clima.html." ] ] ] 6 => array:3 [ "identificador" => "bib0110" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">Cladosporium</span> sp. is the major causal agent in the microbial complex associated with the skin sooty dapple disease of the Asian pear in Korea" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Park" 1 => "K. Kim" 2 => "J. Lee" 3 => "S. Cho" 4 => "Y. Choi" 5 => "Y. Kim" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "The Plant Pathology Journal." "fecha" => "2008" "volumen" => "24" "paginaInicial" => "118" "paginaFinal" => "124" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0115" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Fungi and Food Spoilage" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Pitt" 1 => "A. Hocking" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "edicion" => "3rd edition." "fecha" => "2009" "editorial" => "Springer" "editorialLocalizacion" => "New York" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0120" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Pscheidt J, Ocamb C, senior editors. 2019. Pacific Northwest Plant Disease Management Handbook. Corvallis, OR: Oregon State University. [On-line] <a target="_blank" href="http://pnwhandbooks.org/plantdisease">http://pnwhandbooks.org/plantdisease</a>. (Accessed 31 March 2019)." ] ] ] 9 => array:3 [ "identificador" => "bib0125" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Inta.gob [Internet]. Boletín Agrometeorológico N° 24 /Mayo: Análisis agrometeorológico Temporada 2013-2014; 2014. Available from: http://inta.gob.ar/sites/default/files/script-tmp-inta_boletin_agrometeorologico_n24_2013-2014.pdf." ] ] ] 10 => array:3 [ "identificador" => "bib0130" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Airborne <span class="elsevierStyleItalic">Cladosporium</span> fungal spores and climate change in France" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C. Sindt" 1 => "J. Besancenot" 2 => "M. Thibaudon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Aerobiologia." "fecha" => "2016" "volumen" => "32" "paginaInicial" => "53" "paginaFinal" => "68" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0135" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Desde el campo a la conservación: Nuevos desafíos en el manejo de enfermedades emergentes de los frutales de pepita de la Norpatagonia Argentina" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M.C. Sosa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:2 [ "tituloSerie" => "XV Jornadas Fitosanitarias Argentinas" "fecha" => "2015" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0140" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diversity and abundance of airborne fungal spores in a rural cold dry desert environment in Argentinean Patagonia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C. Temperini" 1 => "M. Franchi" 2 => "M. Benavides Rozo" 3 => "M. Greco" 4 => "A. Pardo" 5 => "G. Pose" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Science of the Total Environment." "fecha" => "2019" "volumen" => "665" "paginaInicial" => "513" "paginaFinal" => "520" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0145" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diversity of airborne <span class="elsevierStyleItalic">Cladosporium</span> species isolated from agricultural environments of northern Argentinean Patagonia: molecular characterization and plant pathogenicity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C. Temperini" 1 => "G. Pardo" 2 => "G. Pose" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Aerobiologia." "fecha" => "2018" "paginaInicial" => "1" "paginaFinal" => "13" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0150" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Postharvest decay of apples and pears in the Netherlands" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Wenneker" 1 => "J. Köhl" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "In Proc.II International Symposium on Discovery and Development of Innovative Strategies for Postharvest Disease Management" "fecha" => "2014" "volumen" => "1053" "paginaInicial" => "107" "paginaFinal" => "112" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack519253" "titulo" => "Acknowledgments" "texto" => "<p id="par0065" class="elsevierStylePara elsevierViewall">To María del Valle Leiva, Soledad Ramírez and María de los Ángeles Pérez. This research was financially supported by Universidad Nacional de Río Negro and CONICET.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000005300000001/v1_202103140751/S0325754120300316/v1_202103140751/en/main.assets" "Apartado" => array:4 [ "identificador" => "37862" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Microbiología agrícola, ambiental e industrial" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000005300000001/v1_202103140751/S0325754120300316/v1_202103140751/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754120300316?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 1 | 0 | 1 |
| 2024 October | 23 | 1 | 24 |
| 2024 September | 27 | 4 | 31 |
| 2024 August | 21 | 6 | 27 |
| 2024 July | 25 | 2 | 27 |
| 2024 June | 29 | 1 | 30 |
| 2024 May | 14 | 1 | 15 |
| 2024 April | 10 | 4 | 14 |
| 2024 March | 32 | 1 | 33 |
| 2024 February | 23 | 1 | 24 |
| 2024 January | 32 | 5 | 37 |
| 2023 December | 38 | 8 | 46 |
| 2023 November | 47 | 14 | 61 |
| 2023 October | 45 | 9 | 54 |
| 2023 September | 21 | 4 | 25 |
| 2023 August | 21 | 5 | 26 |
| 2023 July | 28 | 2 | 30 |
| 2023 June | 26 | 2 | 28 |
| 2023 May | 42 | 8 | 50 |
| 2023 April | 22 | 1 | 23 |
| 2023 March | 38 | 4 | 42 |
| 2023 February | 30 | 2 | 32 |
| 2023 January | 32 | 0 | 32 |
| 2022 December | 38 | 11 | 49 |
| 2022 November | 23 | 5 | 28 |
| 2022 October | 24 | 12 | 36 |
| 2022 September | 24 | 7 | 31 |
| 2022 August | 45 | 11 | 56 |
| 2022 July | 34 | 7 | 41 |
| 2022 June | 29 | 5 | 34 |
| 2022 May | 10 | 12 | 22 |
| 2022 April | 16 | 7 | 23 |
| 2022 March | 46 | 14 | 60 |
| 2022 February | 38 | 8 | 46 |
| 2022 January | 33 | 9 | 42 |
| 2021 December | 24 | 10 | 34 |
| 2021 November | 30 | 13 | 43 |
| 2021 October | 34 | 14 | 48 |
| 2021 September | 29 | 10 | 39 |
| 2021 August | 24 | 8 | 32 |
| 2021 July | 21 | 17 | 38 |
| 2021 June | 27 | 12 | 39 |
| 2021 May | 31 | 11 | 42 |
| 2021 April | 66 | 29 | 95 |
| 2021 March | 23 | 10 | 33 |
| 2021 February | 0 | 5 | 5 |
| 2021 January | 0 | 9 | 9 |
| 2020 December | 0 | 7 | 7 |
| 2020 November | 0 | 8 | 8 |
| 2020 October | 0 | 8 | 8 |
| 2020 September | 0 | 14 | 14 |
| 2020 August | 0 | 20 | 20 |
| 2020 July | 0 | 11 | 11 |
| 2020 June | 0 | 5 | 5 |
Show all
