Characterization and antimicrobial susceptibility of coagulase-positive Staphylococcus isolated in a veterinary teaching hospital in Chile

array:24 ["pii" => "S0325754122000013" "issn" => "03257541" "doi" => "10.1016/j.ram.2021.12.001" "estado" => "S300" "fechaPublicacion" => "2022-07-01" "aid" => "481" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2022" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2022;54:192-202" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S0325754121000377" "issn" => "03257541" "doi" => "10.1016/j.ram.2021.02.004" "estado" => "S300" "fechaPublicacion" => "2022-07-01" "aid" => "447" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2022;54:203-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "es" => array:14 [ "idiomaDefecto" => true "cabecera" => "INFORME BREVE" "titulo" => "Trichophyton benhamiae, un dermatofito zoofílico emergente en Argentina con reservorio en cobayos: descripción de 7 casos en un hospital de la Ciudad Autónoma de Buenos Aires" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:3 [ 0 => "es" 1 => "es" 2 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "203" "paginaFinal" => "208" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Trichophyton benhamiae, an emergent zoonotic pathogen in Argentina associated with Guinea pigs: Description of 7cases in Buenos Aires" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2352 "Ancho" => 2508 "Tamanyo" => 515400 ] ] "descripcion" => array:1 [ "es" => "A) Examen directo de las escamas obtenidas por raspado de la lesión con KOH al 40% con tinta Parker® azul-negra permanente (400×). B) Aspecto macroscópico de Trichophyton benhamiae. Cultivo primario de escamas de lesión con desarrollo en agar Sabouraud y agar selectivo y diferencial para dermatofitos (DTM). C) Subcultivo en placa de agar Sabouraud, micelio velloso blanco con pigmento amarillo. D. Micromorfología de T. benhamiae en disgregado con azul de lactofenol (400×). Microconidios globosos ovales o claviformes que se originan lateralmente y se disponen formando racimos." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ivana Maldonado, María Elisa Elisiri, Marina Monaco, Alejandra Hevia, Margarita Larralde, Bárbara Fox, Nicolás Refojo, Ricardo Iachini, Andrea Santos Muñoz, Rita Leitner, Paula Luna, Lucrecia Meirama, Eugenia Abad, Neri Ruiz Diaz, Julián Fernández, Liliana Fernández-Canigia" "autores" => array:16 [ 0 => array:2 [ "nombre" => "Ivana" "apellidos" => "Maldonado" ] 1 => array:2 [ "nombre" => "María Elisa" "apellidos" => "Elisiri" ] 2 => array:2 [ "nombre" => "Marina" "apellidos" => "Monaco" ] 3 => array:2 [ "nombre" => "Alejandra" "apellidos" => "Hevia" ] 4 => array:2 [ "nombre" => "Margarita" "apellidos" => "Larralde" ] 5 => array:2 [ "nombre" => "Bárbara" "apellidos" => "Fox" ] 6 => array:2 [ "nombre" => "Nicolás" "apellidos" => "Refojo" ] 7 => array:2 [ "nombre" => "Ricardo" "apellidos" => "Iachini" ] 8 => array:2 [ "nombre" => "Andrea" "apellidos" => "Santos Muñoz" ] 9 => array:2 [ "nombre" => "Rita" "apellidos" => "Leitner" ] 10 => array:2 [ "nombre" => "Paula" "apellidos" => "Luna" ] 11 => array:2 [ "nombre" => "Lucrecia" "apellidos" => "Meirama" ] 12 => array:2 [ "nombre" => "Eugenia" "apellidos" => "Abad" ] 13 => array:2 [ "nombre" => "Neri" "apellidos" => "Ruiz Diaz" ] 14 => array:2 [ "nombre" => "Julián" "apellidos" => "Fernández" ] 15 => array:2 [ "nombre" => "Liliana" "apellidos" => "Fernández-Canigia" ] ] ] ] "resumen" => array:1 [ 0 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">–Primera descripción en Argentina de dermatofitosis por Trichophyton benhamiae.</li><li class="elsevierStyleListItem" id="lsti0010">–El reservorio de T. benhamiae fueron los cobayos.</li><li class="elsevierStyleListItem" id="lsti0015">–Las lesiones por este dermatofito en niños suelen ser inflamatorias.</li><li class="elsevierStyleListItem" id="lsti0020">–El diagnóstico de certeza se debe realizar por proteómica o genómica.</li><li class="elsevierStyleListItem" id="lsti0025">–La mayoría de los casos requirieron tratamiento antifúngico sistémico.</li></ul>" ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754121000377?idApp=UINPBA00004N" "url" => "/03257541/0000005400000003/v1_202209300808/S0325754121000377/v1_202209300808/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754122000190" "issn" => "03257541" "doi" => "10.1016/j.ram.2022.03.002" "estado" => "S300" "fechaPublicacion" => "2022-07-01" "aid" => "485" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2022;54:181-91" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Biosíntesis inducida de fengicina y surfactina en una cepa de Bacillus amyloliquefaciens con actividad oomiceticida sobre zoosporas de Phytophthora capsica" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "181" "paginaFinal" => "191" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Induced biosynthesis of fengycin and surfactin in a strain of Bacillus amyloliquefaciens with oomyceticidal activity on zoospores of Phytophthora capsici" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figura 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1393 "Ancho" => 1505 "Tamanyo" => 175048 ] ] "descripcion" => array:1 [ "es" => "Efectos del extracto crudo producido por B. amyloliquefaciens KX953161.1 sobre la morfología y la germinación de zoosporas de P. capsici. (A) Zoosporas germinadas en ausencia del extracto. (B) Tubo germinativo anormal. (C) Zoosporas sin geminación (enquistadas). (D y E) Las paredes de la zoospora de P. capsici se lisaron al momento del contacto con el extracto crudo que contenía los lipopéptidos producidos por B. amyloliquefaciens KX953161.1. Las imágenes fueron tomadas bajo microscopio, con objetivo de 40× en campo claro." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Nancy Ley-López, José Basilio Heredia, Cesar San Martín-Hernández, J. Ramón Ibarra-Rodríguez, Miguel Ángel Angulo-Escalante, Raymundo Saúl García-Estrada" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Nancy" "apellidos" => "Ley-López" ] 1 => array:2 [ "nombre" => "José" "apellidos" => "Basilio Heredia" ] 2 => array:2 [ "nombre" => "Cesar" "apellidos" => "San Martín-Hernández" ] 3 => array:2 [ "nombre" => "J. Ramón" "apellidos" => "Ibarra-Rodríguez" ] 4 => array:2 [ "nombre" => "Miguel Ángel" "apellidos" => "Angulo-Escalante" ] 5 => array:2 [ "nombre" => "Raymundo Saúl" "apellidos" => "García-Estrada" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000190?idApp=UINPBA00004N" "url" => "/03257541/0000005400000003/v1_202209300808/S0325754122000190/v1_202209300808/es/main.assets" ] "en" => array:22 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Characterization and antimicrobial susceptibility of coagulase-positive Staphylococcus isolated in a veterinary teaching hospital in Chile" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "192" "paginaFinal" => "202" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Francisco Abusleme, Nicolás Galarce, Mario Quezada-Aguiluz, Daniela Iragüen, Gerardo González-Rocha" "autores" => array:5 [ 0 => array:4 [ "nombre" => "Francisco" "apellidos" => "Abusleme" "email" => array:1 [ 0 => "fabusleme@vetdermchile.cl" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Nicolás" "apellidos" => "Galarce" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Mario" "apellidos" => "Quezada-Aguiluz" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 1 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] 2 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 3 => array:3 [ "nombre" => "Daniela" "apellidos" => "Iragüen" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 4 => array:4 [ "nombre" => "Gerardo" "apellidos" => "González-Rocha" "email" => array:1 [ 0 => "ggonzal@udec.cl" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 1 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] 2 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Departamento de Ciencias Clínicas, Facultad de Ciencias Veterinarias y Pecuarias, FAVET, Universidad de Chile, Santiago, Chile" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Departamento de Medicina Preventiva Animal, Facultad de Ciencias Veterinarias y Pecuarias, FAVET, Universidad de Chile, Santiago, Chile" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Laboratorio de Investigación en Agentes Antibacterianos, Departamento de Microbiología, Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción, Chile" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Millennium Initiative for Collaborative Research on Bacterial Resistance (MICROB-R), Santiago, Chile" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Departamento de Medicina Interna, Facultad de Medicina, Universidad de Concepción, Chile" "etiqueta" => "e" "identificador" => "aff0025" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding authors." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Caracterización y sensibilidad antimicrobiana de Staphylococcus coagulasa-positivos aislados en un hospital clínico veterinario en Chile" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1380 "Ancho" => 2508 "Tamanyo" => 129739 ] ] "descripcion" => array:1 [ "en" => "Percentages of resistance of CoPS isolated from a teaching veterinary hospital according methicillin susceptibility. OXA: oxacillin; FOX: cefoxitin; AMC: amoxicillin/clavulanic acid; ENR: enrofloxacin; CIP: ciprofloxacin; GEN: gentamicin; AMK: Amikacina; TET: tetracycline; DOX: doxycycline; CLI: clindamycin; ERY: erythromycin; MR-CoPS: Methicillin-resistance coagulase-positive Staphylococcus; MS-CoPS: Methicillin-sensitive coagulase-positive Staphylococcus." ] ] ] "textoCompleto" => "IntroductionThe skin of mammals is colonized by a large number of microorganisms that are collectively known as normal microbiota, which includes several species of the genus Staphylococcus<a class="elsevierStyleCrossRef" href="#bib0485">47</a>. They are normally considered harmless, but they can be a threat to the health of their hosts by acting as opportunistic pathogens and being reservoirs of antibiotic resistance genes, increasing the potential for resistance to antibiotic therapy<a class="elsevierStyleCrossRef" href="#bib0440">38</a>. The staphylococci with the highest clinical relevance are coagulase producers<a class="elsevierStyleCrossRef" href="#bib0435">37</a>, mainly S. aureus and those from the intermedius group, particularly S. pseudintermedius<a class="elsevierStyleCrossRef" href="#bib0500">50</a>. Despite the fact that S. pseudintermedius rarely causes illness in humans, with reports ranging from soft tissue infections to bacteremia, its prevalence may be underestimated, since S. pseudintermedius may be erroneously identified as S. aureus due to its similar biochemical characteristics<a class="elsevierStyleCrossRefs" href="#bib0285">7,48</a>. Establishing the difference between species is particularly relevant when evaluating behavior against antimicrobials, since the cut-off points to define susceptibility and resistance to methicillin vary according to the species<a class="elsevierStyleCrossRef" href="#bib0285">7</a>, unfortunately the characterization of species is not a routine practice in our region.In general, it can be established that most staphylococcal infections can be easily controlled with antibiotics; however, in recent years different strains of Staphylococcus spp. have proved to be resistant to the most commonly used antibiotics such as macrolides, lincosamides, tetracyclines, gentamicin, cephalosporins and other β-lactams<a class="elsevierStyleCrossRef" href="#bib0385">27</a>. The most relevant resistance in Staphylococcus is the mecA-mediated methicillin resistance, which is globally spread, turning ineffective the most widely used and efficient class of antimicrobials to treat staphylococcal infections<a class="elsevierStyleCrossRef" href="#bib0255">1</a>. This gene is harbored in a mobile genetic element known as Staphylococcal Chromosomal Cassette (SCCmec), and encodes an altered penicillin-binding protein (PBP) with low affinity for β-lactams<a class="elsevierStyleCrossRef" href="#bib0255">1</a>. The emergence and spread of methicillin-resistant Staphylococcus (MRS) in both hospital and community settings pose a major threat to global health<a class="elsevierStyleCrossRef" href="#bib0420">34</a>. In general, the prevalence of methicillin-resistant strains has increased rapidly over time, leading to major human and animal health problems, especially in hospital settings<a class="elsevierStyleCrossRef" href="#bib0300">10</a>. It is well-known that methicillin-resistant strains have higher levels of resistance against various classes of antibiotics compared to methicillin-susceptible strains<a class="elsevierStyleCrossRefs" href="#bib0330">16,43,45</a>, and the direct cost to treat methicillin-resistant Staphylococcus aureus (MRSA) infections versus methicillin-susceptible S. aureus in humans is 1.5 to 3 times higher<a class="elsevierStyleCrossRef" href="#bib0265">3</a>.To date, there are no antimicrobial resistance stewardship programs for any animal species, as well as no published studies of antimicrobial use in companion animals in Chile<a class="elsevierStyleCrossRef" href="#bib0315">13</a>; currently available information regarding antibiotic resistance in South America is mainly focused on human health and studies on determining the prevalence of MRS strains in companion animals in South America are scarce. Among these studies, there is a study carried out in Brazil reporting the presence of MRSA in a cat and a methicillin-resistant S. pseudintermedius (MRSP) in a dog<a class="elsevierStyleCrossRef" href="#bib0425">35</a> and another one from Argentina informing that MRSA prevalence was much higher than in other studies in the United States where prevalence estimates varied from 0% to 6%<a class="elsevierStyleCrossRefs" href="#bib0300">10,39</a> should be highlighted. Moreover, a study carried out in Chile describing 11 strains of coagulase-positive Staphylococcus (CoPS) carrying the mecA gene in cats<a class="elsevierStyleCrossRef" href="#bib0320">14</a> and two studies in Argentina that characterized 10<a class="elsevierStyleCrossRef" href="#bib0310">12</a> and three<a class="elsevierStyleCrossRef" href="#bib0480">46</a> strains of MRSP isolated from canine clinical specimens. Another study in Chile analyzed CoPS strains isolated from dogs with pyoderma and external otitis, not finding any MRS strains<a class="elsevierStyleCrossRef" href="#bib0410">32</a>. Despite the high proximity of pets and humans, the importance of companion animals as reservoirs of human infections is still poorly understood<a class="elsevierStyleCrossRef" href="#bib0385">27</a>.The aim of the present study was to identify and characterize CoPS strains from dogs, owners, veterinary professionals and the environment in a veterinary teaching hospital in Chile, to determine the presence of methicillin-resistant strains and to evaluate the genetic relationship between the CoPS strains.Materials and methodsRegulatory approvalsThe study was approved by the Ethical Committee of Facultad de Ciencias Veterinarias y Pecuarias, Universidad de Chile, authorization code No. 07-2016. An informed consent of the owners and veterinarians was obtained prior to sampling.SamplingThe sampling was conducted during the April-August period, 2016, and samples were obtained from dogs (n=40) and owners (n=40), veterinarians (n=24), and surfaces (n=10) from a teaching veterinary hospital at the Universidad de Chile. In the case of dogs, healthy patients, of any breed, age and sex, taken to the hospital for vaccinations or elective surgical procedures were sampled. They were clinically evaluated by a veterinarian at the hospital, who confirmed the patient's health status at the sampling time. The use of antibiotics and/or corticosteroids 15 days before taking samples was considered an exclusion factor, for both dogs and humans.Prior to sampling, the owner signed an informed consent developed under the recommendations of the World Health Organization (supplementary material). Owners and veterinarians were taught to take their own nasal swab sample as previously described<a class="elsevierStyleCrossRef" href="#bib0415">33</a> and a sample was taken from the canines’ perianal area and their nasal mucosa. All samples were stored at 4°C for up to 6h before processing. Regarding the surfaces, five hospitalization cages, the surgical tables of the two surgical wards, a care table in the procedure room, and the care table of two hospital consultation rooms were sampled. All samples were taken with a sterile swab in amies transport medium (Copan, California, USA). A quadrant of 4cm2 was selected in which the swab was slipped for 30s covering the entire area. The samples were collected 3h after cleaning with quaternary ammonium and were taken as previously described<a class="elsevierStyleCrossRef" href="#bib0305">11</a>. The samples were stored at 4°C for up to 6h until they were processed.All samples were cultured in mannitol salt agar plates (MSA, Becton Dickinson GmbH Heidelberg, Germany) for 24h at 37°C. From each plate, a maximum of three colonies with morphology compatible with Staphylococcus spp. was selected to perform the catalase test, coagulase test and Gram staining, as previously described<a class="elsevierStyleCrossRef" href="#bib0410">32</a>; but only one isolate from each sample was considered for analysis. The catalase and coagulase positive strains, and confirmed Gram-positive round shape bacteria, were stored in a 2:1 mixture of trypticase broth and 50% glycerol (v/v), at −80°C, for subsequent species characterization.Molecular identification of the Staphylococcus speciesIn order to identify species of Staphylococcus, a simple PCR protocol was carried out with primers previously described by Sasaki et al.<a class="elsevierStyleCrossRef" href="#bib0455">41</a> DNA was extracted from 5 fresh colonies grown on MSA, by boiling at 100°C for 15min, and suspended in 500μl of sterile distilled water, DNA concentration and purification were evaluated by spectrophotometry prior to PCR. Subsequently, the suspension was centrifuged at 14000×g for 5min. The amplification program used consisted of an initial denaturation step of 2min at 98°C, 30 cycles with 30s at 95°C (for denaturation), 57°C for 30s and 72°C for 30 s (for annealing and polymerization) to end with a final extension of 2min at 72°C. The products were separated on a 1.5% agarose gel in 1× tris–acetate–EDTA (TAE) buffer (Thermo Scientific™, Vilnius, Lithuania) and taken to a 1× TAE buffer electrophoresis chamber at 90V for 60min. DNA visualization after electrophoresis was performed using a UV transilluminator (UVP transilluminator M-20V, Jena, Germany), after staining the gels for 40min in ethidium bromide (0.5mg/ml). PCR reactions were carried out in a Multigene Gradient thermocycler (Labnet International Inc, New Jersey, USA) using 15μl of master mix (GoTaq Green Master Mix, Promega, Madison, USA), forward and reverse primer at a concentration of 1μM and 5μl of DNA template. The S. aureus ATCC 25923 and S. pseudintermedius ATCC 49444 strains were used as reference strains. A list of primers used in this study is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Determination of phenotypic antimicrobial resistancePhenotypic resistance was determined for all isolated CoPS strains using the agar diffusion method, according to the recommendations of the Clinical and Laboratory Standards Institute documents M100-S-24<a class="elsevierStyleCrossRef" href="#bib0295">9</a> and VET01-S2<a class="elsevierStyleCrossRef" href="#bib0290">8</a>. The following panel of antimicrobials was used: oxacillin (1μg), cefoxitin (30μg), amoxicillin/clavulanic acid (20/10μg), gentamicin (10μg), amikacin (30μg), tetracycline (30μg), doxycycline (30μg), enrofloxacin (5μg), ciprofloxacin (5μg), clindamycin (2μg) and erythromycin (15μg) (Oxoid, Hampshire, United Kingdom). S. aureus ATCC 25923 strain was used as a reference. Methicillin-resistance was evaluated following the CLSI recommendations, considering the different cut off points of the different species, and the oxacillin disk for S. pseudintermedius and cefoxitin disk for S. aureus<a class="elsevierStyleCrossRefs" href="#bib0290">8,9</a>. Additionally, and in order to quantify the level of resistance, the MIC was also determined according to the method standardized by the CLSI<a class="elsevierStyleCrossRefs" href="#bib0290">8,9</a>. The following antimicrobials were tested: oxacillin, cefoxitin, enrofloxacin, clindamycin, and vancomycin. S. aureus ATCC 29213 was used as the reference strain.Detection of the mecA geneThe presence of the mecA gene was determined in all the strains through the amplification of an intragenic fragment of this gene by PCR, yielding a product of 519bp. S. aureus ATCC 43300 was used as the reference strain. Subsequently, the same program and method to identify the species was used. The primers used were those described by Ishihara et al.<a class="elsevierStyleCrossRef" href="#bib0350">20</a>, and are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.Pulsed field gel electrophoresis (PFGE) typing of the CoPS species:The genetic relationship among the isolated CoPS was conducted using a macrorestriction assay of the total DNA of each strain with the SmaI enzyme and the restriction fragments were separated by PFGE at Laboratorio de Investigación en Agentes Antibacterianos of the Universidad de Concepción. For the genotyping of the strains, we used the PFGE methodology described by the Instituto de Salud Pública de Chile which is based on the protocol standardized by CDC Canada for PFGE of SAMR<a class="elsevierStyleCrossRef" href="#bib0390">28</a>. The resulting agarose gel was visualized and photographed in the UVIdoc HD5 photodocumentator (Uvitec, England, United Kingdom). Fingerprint analysis was performed using the BioNumerics® software v.6.611 (Applied Maths). The resulting dendrogram was constructed using the unweighted pair group method for arithmetic averages and the Dice band-based similarity coefficient. Isolates were defined as epidemiologically related (same cluster) if they shared ≥95% similarity on the dendrogram.Statistical analysisThe Chi-square test was used to seek differences in the isolated percentages between veterinarians and ownersResultsStrain identificationA total of 45 CoPS strains were obtained: Eight CoPS strains were obtained from the 24 veterinarians sampled, three strains from 10 hospital surface samples, eight strains from the nasal mucosa of the 40 owners, and 26 from the canines (10 from the nasal mucosa and 16 from the perianal area).Of the 45 strains identified, 18 were S. aureus and 27 were S. pseudintermedius. In the case of the veterinarians, seven were S. aureus and one S. pseudintermedius. The three strains isolated from hospital surfaces were identified as S. pseudintermedius; while seven strains from the owners were S. aureus and one S. pseudintermedius. Twenty-two strains isolated from the canines were S. pseudintermedius and 4 were identified as S. aureus.Determination of phenotypic resistance to antibioticsEight (17.8%) of the analyzed strains were susceptible to all tested antimicrobials, and 15 (33.3%) were characterized as multidrug-resistant isolates (resistant to three or more different groups of antibiotics). Percentages of resistant strains considering both species were 37.8% to erythromycin; 33.3% to clindamycin; 24.4% to enrofloxacin and ciprofloxacin; 17.8% to amoxicillin/clavulanic acid; 15.6% to tetracycline; 13.3% to cefoxitin; and 2.2% to gentamicin. Nine strains (20%) were resistant to oxacillin; six of them were obtained from veterinarians; two from hospitalization cages and one from an owner. The characterization of methicillin-resistant strains is shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. The percentages of resistance according to the source, species and methicillin susceptibility are listed in <a class="elsevierStyleCrossRefs" href="#fig0005">Figures 1–3</a> respectively.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia>Eleven strains were resistant to oxacillin according to their MIC (≥4μg/ml for S. aureus and 0.5μg/ml for S. pseudintermedius), six of them corresponded to strains isolated from the veterinarians (five S. aureus, one S. pseudintermedius), two from hospitalization cages (S. pseudintermedius), one from an owner (S. aureus) and two from the canines; these two strains from canines were S. pseudintermedius-negative for the presence of the mecA gene.Eight strains were resistant to cefoxitin according to the MIC (≥8μg/ml), five of them were isolated from the veterinarians (S. aureus), two from the owners (S. aureus) and one from a canine (S. pseudintermedius). Regarding enrofloxacin, 14 strains were resistant (MIC≥4μg/ml); six of them were isolated from the veterinarians (five S. aureus and one S. pseudintermedius), two from hospitalization cages (S. pseudintermedius), two from the owners (S. aureus) and four from the canines (S. pseudintermedius). Twenty one (21) strains were resistant to clindamycin (MIC≥4μg/ml); six of them were isolated from the veterinarians (five S. aureus and one S. pseudintermedius), two from hospitalization cages (S. pseudintermedius), three from the owners (S. aureus), and 10 from the canines (S. pseudintermedius); while two strains isolated from a veterinarian (S. aureus) and a canine (S. pseudintermedius) exhibited intermediate sensitivity (MIC 1–2μg/ml). Finally, two strains were resistant to vancomycin (MIC≥32μg/ml), both isolated from the owners (S. aureus), while four strains exhibited intermediate susceptibility (MIC 4–8μg/ml), two from the surfaces (S. pseudintermedius) and two from the canines (one of each species). MIC50 and MIC90 results are shown in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>.<elsevierMultimedia ident="tbl0015"></elsevierMultimedia>Presence of the mecA geneEleven strains were positive for the mecA gene (24.4%). Of these strains, six were obtained from the veterinarians, two from hospital surfaces, two from an owner and one from a canine. All methicillin-resistant strains harbored this gene.Genotyping of strains by SmaI and PFGEThe PFGE profile (pulsotype) was obtained in 41 of the 45 strains. Four of the strains were not typable by SmaI enzyme digestion and PFGE, even when the electrophoresis was performed with thiourea. The untyped strains corresponded to one strain of S. aureus and three strains of S. pseudintermedius, all isolated from the canines. Among the pulsotypes identified there was high polyclonal diversity, displaying clonal relationship in two MRSA strains (MV1 and MV2) isolated from the veterinarians and in two S. pseudintermedius strains (C28 and C30) isolated from the canines (Fig. 1, supplementary material).Statistical analysisThe percentage of isolated CoPS strains, and their susceptibility to methicillin from every source was analyzed. No statistical difference was observed in CoPS isolated from canines, veterinarians and owners; the only statistical difference was obtained with the percentage of methicillin-resistant strains isolated from veterinarians (6/8) and owners (1/8) (p<0.001).DiscussionDifferent publications report variable percentages of nasal carriage of Staphylococcus aureus in humans, which vary from 18.5 to 27.7%<a class="elsevierStyleCrossRefs" href="#bib0360">22,33</a>. In the present study a total of 16 CoPS strains were isolated from the 64 samples obtained from humans (25%). It should be noted that when separating the percentages obtained from owners and veterinarians, there was no statistical difference (p<0.35), in agreement with Kottler et al.<a class="elsevierStyleCrossRef" href="#bib0370">24</a>, who found no differences between the general population and people associated with health careers in terms of percentage of isolation of CoPS strains.Two S. pseudintermedius human carriers were found in the present study. To our knowledge, this is the first national study documenting the carriage of this species in humans. Although this bacterium is adapted to living in animals, it is documented that S. pseudintermedius has some properties that make possible the presence of this microorganism in human skin; in fact, Latronico et al.<a class="elsevierStyleCrossRef" href="#bib0375">25</a>, describes a particular sequence type (ST-71) that adheres to the human corneocyte with the same ease as to the canine corneocyte. In general, the isolation percentages of this species in humans are low; however, the most modern and precise identification methods are likely to generate an increase in the number of cases of strains isolated from humans<a class="elsevierStyleCrossRef" href="#bib0460">42</a>, because, given its biochemical similarity, it can be misidentified as S. aureus<a class="elsevierStyleCrossRef" href="#bib0285">7</a>. This is particularly important in methicillin-resistant strains, where interpretation criteria and MICs defined for S. aureus can lead to MRSP isolates being defined as susceptible<a class="elsevierStyleCrossRef" href="#bib0285">7</a>. Nevertheless, transmission of mobile genetic elements such as SCCmec or other resistance determinants from S. pseudintermedius to other Staphylococcus species has been previously reported<a class="elsevierStyleCrossRef" href="#bib0420">34</a>.Regarding canines, CoPS strains were isolated from 26 of the 40 patients sampled (65%), a percentage lower than that described by Muñoz et al.<a class="elsevierStyleCrossRef" href="#bib0410">32</a>, who reported 71.3%, despite analyzing only animals with skin conditions. In total, 26 strains were obtained, 10 from nasal cultures and 16 from the perianal area, in agreement with Hanselman et al.<a class="elsevierStyleCrossRef" href="#bib0335">17</a>, who reported that perianal colonization was significantly more common than nasal colonization. Of the strains isolated from canines, 22 (84.6%) corresponded to S. pseudintermedius and 4 (15.4%) to S. aureus, which is expected because the dog is the natural reservoir of S. pseudintermedius<a class="elsevierStyleCrossRef" href="#bib0380">26</a>.With respect to S. aureus strains, the resistance to erythromycin is 38.9%, similar to that described by Rahman et al.<a class="elsevierStyleCrossRef" href="#bib0430">36</a>, while for S. pseudintermedius strains, resistance was detected in 37% of the strains (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>), similar to that described by Vigo et al.<a class="elsevierStyleCrossRef" href="#bib0480">46</a>, and Gröntal et al.<a class="elsevierStyleCrossRef" href="#bib0330">16</a>, who described 39.3 and 30.5% of resistance, respectively. The slightly higher percentage of resistance in S. aureus may be explained by the limited use of this drug in the veterinary clinical practice in Chile<a class="elsevierStyleCrossRef" href="#bib0315">13</a>. In fact, Awosile et al.<a class="elsevierStyleCrossRef" href="#bib0270">4</a>, described that erythromycin resistance is decreasing over time for CoPS isolated from dogs and Rumi et al.<a class="elsevierStyleCrossRef" href="#bib0445">39</a>, described a clear resistance increment to erythromycin in S. aureus.With regard to clindamycin, 33.3% of the strains were resistant, which acquires great relevance when considering the publication by Hillier et al.<a class="elsevierStyleCrossRef" href="#bib0340">18</a> that describes clindamycin as one of the first-tier antibiotics for the treatment of canine pyoderma, which is caused in the majority of cases by S. pseudintermedius<a class="elsevierStyleCrossRef" href="#bib0380">26</a>, demonstrating the importance of analyzing the behavior of these strains at a local level to establish the best treatment strategy. In this context, Vigo et al.<a class="elsevierStyleCrossRef" href="#bib0480">46</a>, stated that clindamycin should be empirically avoided and Rumi et al.<a class="elsevierStyleCrossRef" href="#bib0445">39</a>, described more than 40% resistance in Staphylococcus spp. Therefore, it is necessary to consider other treatment alternatives, such as topical chlorhexidine therapies, to avoid systemic antimicrobial therapy and decrease the emergence of methicillin-resistant strains that unnecessarily lengthen therapy<a class="elsevierStyleCrossRef" href="#bib0280">6</a>.When considering resistance to fluoroquinolones by species, a higher percentage of resistance was found in S. aureus strains versus S. pseudintermedius strains (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>). Even though there is not a clear explanation of this, it agrees with the literature<a class="elsevierStyleCrossRef" href="#bib0295">9</a>, although a growing fluoroquinolone resistance rate was observed in Staphylococcus spp. recovered mainly from skin and ear samples in companion animals in Argentina<a class="elsevierStyleCrossRef" href="#bib0445">39</a>.With regard to cephalosporins, 13.3% of the strains showed resistance to cefoxitin considering both species. It should be noted that none of the strains isolated from canines exhibited resistance (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>), which differs from Saputra et al.’s study<a class="elsevierStyleCrossRef" href="#bib0450">40</a> that reported 12% resistance against cefoxitin. This difference can be explained by the number of strains analyzed in that study, which was highly superior to those in the present study (888 strains versus 45); therefore, it is likely that if the number of strains studied is increased the resistance percentages may change.With respect to tetracycline, 15.6% of the CoPS strains were resistant. It is important to consider that no S. aureus strains exhibited resistance; however, 25.9% of S. pseudintermedius strains were resistant (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>). Moreover, Saputra et al.<a class="elsevierStyleCrossRef" href="#bib0450">40</a>, and Gröntal et al.<a class="elsevierStyleCrossRef" href="#bib0320">14</a>, reported higher percentages of resistance of S. pseudintermedius versus S. aureus, probably due to the more frequent use of this drug in veterinary settings<a class="elsevierStyleCrossRef" href="#bib0275">5</a>.No resistance was found to doxycycline and amikacin and a lower percentage of resistant strains was found to gentamicin (2.2%), which coincides with that described by Gröntal et al.<a class="elsevierStyleCrossRef" href="#bib0330">16</a>, who reported low levels of resistance against doxycycline (6.1%), amikacin (0%) and gentamicin (6.6%). This low percentage of resistance against gentamicin was also reported by Ventrella et al.<a class="elsevierStyleCrossRef" href="#bib0475">45</a>, who explained it by the limited use of this aminoglycoside due to its high toxicity, which is also valid for doxycycline and amikacin<a class="elsevierStyleCrossRef" href="#bib0315">13</a>. Additionally, Rumi et al.<a class="elsevierStyleCrossRef" href="#bib0445">39</a> reported that resistance to amikacin never exceeded 1% in Staphylococcus isolated from companion animals.Regarding phenotypic susceptibility against oxacillin, nine methicillin-resistant strains were found (20%), all of them harboring the mecA gene. Two other strains, which showed phenotypic susceptibility to oxacillin, were also carriers of this gene (one strain of S. aureus isolated from an owner and a S. pseudintermedius from a canine), which could be explained by the lack of the promoter or other sequences that allow its expression<a class="elsevierStyleCrossRef" href="#bib0495">49</a>. This phenomenon of mecA-harboring strains and susceptible to oxacillin was already described in Chile in strains isolated from cats<a class="elsevierStyleCrossRef" href="#bib0320">14</a>. When considering their MICs, it should be noted that two strains from canines that were susceptible to oxacillin by the agar diffusion test were resistant by MIC; however, these strains did not carry the mecA gene and were susceptible to other β-lactams, thus were considered methicillin-susceptible and probably hyperproducers of beta-lactamases strains<a class="elsevierStyleCrossRef" href="#bib0400">30</a>.Of the eight strains isolated from veterinarians, six were MRS (75%), which is statistically different from the 12.5% of methicillin-resistant strains isolated from owners (p<0.001). This agrees with Rodrigues et al.<a class="elsevierStyleCrossRef" href="#bib0435">37</a>; Pomba et al.<a class="elsevierStyleCrossRef" href="#bib0420">34</a>, and Kottler et al.<a class="elsevierStyleCrossRef" href="#bib0370">24</a>, who established that carrying methicillin-resistant strains could be considered an occupational risk. Regarding S. pseudintermedius, we found one veterinarian carrying a methicillin-resistant strain, which represents 4.1% of all the veterinarians sampled, similar to that reported by Febler et al.<a class="elsevierStyleCrossRef" href="#bib0305">11</a>, who described 3.6% of veterinary personnel carrying MRSP strains. No MRSP strains were isolated from owners, in accordance with Gómez-Sanz et al.<a class="elsevierStyleCrossRef" href="#bib0325">15</a>, who did not find any MRSP from 67 owners, and to the review published by Pomba et al.<a class="elsevierStyleCrossRef" href="#bib0420">34</a>, who described that colonization of MRSP in humans seems to be rare and transient. This is the first report in Chile of a human harboring MRSP.Regarding the 10 hospital surfaces sampled, two MRSP were found, both from hospitalization cages, highlighting the importance of the environment in the possible transmission of these strains between humans and pets. In fact, Hogan et al.<a class="elsevierStyleCrossRef" href="#bib0345">19</a>, asserted that the search for MRS strains exclusively in humans is inadequate, since the environment is increasingly recognized as a reservoir of these strains.The results obtained confirmed that the cefoxitin disk is not a good predictor of the presence of the gene in S. pseudointermedius strains, since the three strains of S. pseudointermedius that carry the mecA gene and are phenotypically resistant to oxacillin are susceptible to cefoxitin, which has been widely described in the literature<a class="elsevierStyleCrossRefs" href="#bib0285">7–9</a>.We did not isolate any MRS from canines, which is in line with the publication of Katakweba et al.<a class="elsevierStyleCrossRef" href="#bib0360">22</a> This accounts for less than the 2.6% described by Kjellman et al.<a class="elsevierStyleCrossRef" href="#bib0365">23</a> (2015) in Norway; 6.5% described by Menandro et al.<a class="elsevierStyleCrossRef" href="#bib0405">31</a> in Italy; and 11.7% described by Couto et al.<a class="elsevierStyleCrossRef" href="#bib0300">10</a> in Portugal, which could be explained by geographic differences, although it must be noted that these studies consider a much higher number of isolates than the 45 strains analyzed in the present study. Another important factor is that this study includes only healthy dogs, and the percentage of methicillin-resistance carriage is higher in patients that have chronic skin diseases<a class="elsevierStyleCrossRef" href="#bib0420">34</a>; therefore, it is relevant to consider diseased animals in future studies. In fact, in the aforementioned studies, Kjellman et al.<a class="elsevierStyleCrossRef" href="#bib0365">23</a>, who only considered healthy animals, described a lower percentage of MRS isolation compared to the studies conducted by Menandro et al.<a class="elsevierStyleCrossRef" href="#bib0405">31</a>, and Couto et al.<a class="elsevierStyleCrossRef" href="#bib0300">10</a>, which only considered animals with skin conditions.Regarding the percentages of drug resistance profiles of the CoPS strains, these are much higher in methicillin-resistant strains versus methicillin-susceptible strains to non-β-lactamic antibiotics in both species analyzed, as reported by Gröntal et al.<a class="elsevierStyleCrossRef" href="#bib0330">16</a>, and Ventrella et al.<a class="elsevierStyleCrossRef" href="#bib0475">45</a>, highlighting 100% resistance against ceftriaxone, enrofloxacin, ciprofloxacin, clindamycin and erythromycin in the present study (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>). It should be noted that all the methicillin-resistant strains analyzed here were susceptible to amikacin, doxycycline and gentamicin.When analyzing the vancomycin MICs, we found 2 resistant strains (both S. aureus methicillin-sensitive isolated from owners) and 4 other strains with intermediate susceptibility (2 MRSP isolated from surfaces and one S. aureus and one S. pseudintermedius isolated from canines, both methicillin sensitive). This finding needs to be analyzed in depth, but it will remain for further analysis, highlighting the great relevance that this phenomenon would have, since until now vancomycin resistance in Staphylococcus has not been described in our country, except for one publication that reported heteroresistance in humans<a class="elsevierStyleCrossRef" href="#bib0470">44</a>; therefore, it is still considered the first treatment alternative in cases of MRS in human medicine in Chile<a class="elsevierStyleCrossRef" href="#bib0395">29</a>.In this study, the PFGE profile of 41 strains was obtained. As in our study, Kadlec et al.<a class="elsevierStyleCrossRef" href="#bib0355">21</a> also reported that it was not possible to determine the PFGE profiles of various S. pseudintermedius strains. In the mentioned study, it was possible to determine the pulsotypes of the strains using the ApaI enzyme, which could not be done in the present study. The identified strains showed great pulsotype diversity, clonality was found in two strains of MRSA isolated from veterinarians and in two strains of S. pseudintermedius isolated from canines. This phenomenon of clonal diversity agrees with that published by Gagetti et al.<a class="elsevierStyleCrossRef" href="#bib0310">12</a>, in S. pseudintermedius strains isolated from ill canines and by Kjellman et al.<a class="elsevierStyleCrossRef" href="#bib0365">23</a>, in S. pseudintermedius strains from healthy canines. Due to the aforementioned clonal diversity, it is not possible to infer transmission of these strains between humans and pets; however, it is possible to find clones by increasing the number of strains analyzed, as described by Kotler et al.<a class="elsevierStyleCrossRef" href="#bib0370">24</a>, who analyzed 586 S. aureus strains and found 4 MRSA strains with indistinguishable strains in owners and their pets.The main constraint of the present study is the limited number of strains analyzed. The samples were taken to work with 50 strains, and studies with more strains are needed to evaluate clindamycin resistance in a more representative manner. It was not possible to use the ApaI enzyme for a better characterization of all strains isolated. Furthermore, there have been more accurate methods for surface samples published after this study<a class="elsevierStyleCrossRef" href="#bib0260">2</a>.ConclusionThis study suggests that veterinarians are at high risk of harboring methicillin-resistant CoPS and provides evidence that clindamycin may not be a good alternative for CoPS in the analyzed hospital, although more studies are needed in this area for better understanding the resistant dynamic in CoPS in Chile.Conflict of interestThe authors declare that they have no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:13 [ 0 => array:3 [ "identificador" => "xres1777036" "titulo" => "Highlights" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:3 [ "identificador" => "xres1777037" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 2 => array:2 [ "identificador" => "xpalclavsec1560246" "titulo" => "Keywords" ] 3 => array:3 [ "identificador" => "xres1777035" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0015" ] ] ] 4 => array:2 [ "identificador" => "xpalclavsec1560245" "titulo" => "Palabras clave" ] 5 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 6 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Regulatory approvals" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Sampling" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Molecular identification of the Staphylococcus species" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Determination of phenotypic antimicrobial resistance" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Detection of the mecA gene" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Pulsed field gel electrophoresis (PFGE) typing of the CoPS species:" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Statistical analysis" ] ] ] 7 => array:3 [ "identificador" => "sec0050" "titulo" => "Results" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0055" "titulo" => "Strain identification" ] 1 => array:2 [ "identificador" => "sec0060" "titulo" => "Determination of phenotypic resistance to antibiotics" ] 2 => array:2 [ "identificador" => "sec0065" "titulo" => "Presence of the mecA gene" ] 3 => array:2 [ "identificador" => "sec0070" "titulo" => "Genotyping of strains by SmaI and PFGE" ] 4 => array:2 [ "identificador" => "sec0075" "titulo" => "Statistical analysis" ] ] ] 8 => array:2 [ "identificador" => "sec0080" "titulo" => "Discussion" ] 9 => array:2 [ "identificador" => "sec0085" "titulo" => "Conclusion" ] 10 => array:2 [ "identificador" => "sec0090" "titulo" => "Conflict of interest" ] 11 => array:2 [ "identificador" => "xack627964" "titulo" => "Acknowledgements" ] 12 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2021-03-31" "fechaAceptado" => "2021-12-02" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1560246" "palabras" => array:4 [ 0 => "Antimicrobial resistance" 1 => "Methicillin-resistant Staphylococcus aureus" 2 => "Methicillin-resistant Staphylococcus pseudintermedius" 3 => "Pets" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1560245" "palabras" => array:4 [ 0 => "Resistencia antimicrobiana" 1 => "Staphylococcus aureus meticilino-resistente" 2 => "Staphylococcus pseudintermedius meticilino-resistente" 3 => "Mascotas" ] ] ] ] "tieneResumen" => true "highlights" => array:2 [ "titulo" => "Highlights" "resumen" => "<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">•Carriage of MRS strains is statistically higher in veterinarians than in owners.</li><li class="elsevierStyleListItem" id="lsti0010">•An important percentage of the strains was resistant to clindamycin.</li><li class="elsevierStyleListItem" id="lsti0015">•This is the first report describing humans carrying MRSP in Chile.</li></ul>" ] "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "There is limited information about the prevalence and antimicrobial susceptibility of coagulase-positive Staphylococcus (CoPS) strains in veterinary settings in Chile. The aim of this observational study was to identify and characterize CoPS strains from dogs, owners, veterinary professionals and surfaces in a veterinary teaching hospital at Universidad de Chile to determine the presence of methicillin-resistant strains and evaluate the genetic relationship among the strains. Veterinarians (n=24), surfaces (n=10), and healthy dogs (n=40) and their respective owners (n=40) were sampled for CoPS. Isolates were identified by PCR and antimicrobial susceptibility was assessed by the disk diffusion method and MIC. The presence of the mecA gene was evaluated by PCR, and the genetic relationship among the strains was established by PFGE. A total of 45 CoPS strains were obtained, eight from veterinary professionals, three from hospital surfaces, eight from owners and 26 from dogs. Nine of the strains were resistant to methicillin (20%), and all of them carried the mecA gene. A high percentage of the strains was resistant to clindamycin (33.3%). Additionally, the isolated CoPS showed high genetic diversity. This study suggests that veterinarians are in high risk of harboring methicillin-resistant CoPS (25% versus 2.5% from owners) and our results provide evidence that clindamycin could not be an empiric alternative for CoPS in the analyzed hospital. This is the first report of methicillin-resistant CoPS in veterinary settings in Chile, considering humans, pets and surfaces." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "Existe información limitada sobre prevalencia y sensibilidad antimicrobiana de cepas de Staphylococcus coagulasa-positivas (CoPS) en entornos veterinarios en Chile. El objetivo de este estudio observacional fue identificar y caracterizar cepas CoPS de perros, dueños, veterinarios y superficies de un hospital veterinario de la Universidad de Chile, determinar la presencia de cepas meticilino-resistentes y evaluar la relación genética entre las cepas. Se colectaron muestras de veterinarios (n=24), de superficies hospitalarias (n=10) y de perros sanos (n=40) y sus respectivos dueños (n=40). Los aislamientos se identificaron mediante PCR y la sensibilidad antimicrobiana se evaluó por difusión en discos y CIM. También se empleó PCR para detectar la presencia del gen mecA; la relación genética entre las cepas se estableció mediante electroforesis de campos pulsantes (PFGE). Se obtuvo un total de 45 cepas de CoPS, 8 de veterinarios, 3 de superficies hospitalarias, 8 de dueños y 26 de perros. Nueve cepas fueron meticilino-resistentes (20%), todas portadoras del gen mecA. Un porcentaje importante de cepas fue resistente a clindamicina (33,3%). Además, las cepas aisladas mostraron una alta diversidad genética. Este estudio sugiere que los veterinarios tienen alto riesgo de portar CoPS resistentes a meticilina (25% versus 2,5% propietarios). Asimismo, nuestros resultados proporcionan evidencia de que la clindamicina podría no ser una alternativa empírica para CoPS en el hospital analizado. Este es el primer estudio de CoPS meticilino-resistentes en entornos veterinarios en Chile que considera humanos, mascotas y superficies." ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following are the supplementary data to this article:<elsevierMultimedia ident="upi0005"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0105" ] ] ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1558 "Ancho" => 2500 "Tamanyo" => 189259 ] ] "descripcion" => array:1 [ "en" => "Percentages of resistance of CoPS strains isolated from a teaching veterinary hospital to the different antimicrobials tested according the source. OXA: oxacillin; FOX: cefoxitin; AMC: amoxicillin/clavulanic acid; ENR: enrofloxacin; CIP: ciprofloxacin; GEN: gentamicin; AMK: amikacin; TET: tetracycline; DOX: doxycycline; CLI: clindamycin; ERY: erythromycin." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1102 "Ancho" => 2500 "Tamanyo" => 105361 ] ] "descripcion" => array:1 [ "en" => "Percentages of resistance of CoPS isolated from a teaching veterinary hospital according the species of Staphylococcus. OXA: oxacillin; FOX: cefoxitin; AMC: amoxicillin/clavulanic acid; ENR: enrofloxacin; CIP: ciprofloxacin; GEN: gentamicin; AMK: Amikacin; TET: tetracycline; DOX: doxycycline; CLI: clindamycin; ERY: erythromycin." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1380 "Ancho" => 2508 "Tamanyo" => 129739 ] ] "descripcion" => array:1 [ "en" => "Percentages of resistance of CoPS isolated from a teaching veterinary hospital according methicillin susceptibility. OXA: oxacillin; FOX: cefoxitin; AMC: amoxicillin/clavulanic acid; ENR: enrofloxacin; CIP: ciprofloxacin; GEN: gentamicin; AMK: Amikacina; TET: tetracycline; DOX: doxycycline; CLI: clindamycin; ERY: erythromycin; MR-CoPS: Methicillin-resistance coagulase-positive Staphylococcus; MS-CoPS: Methicillin-sensitive coagulase-positive Staphylococcus." ] ] 3 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Target species or gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence (5′→3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Molecular weight (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reference \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">au-F3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCGCTTGCTATGATTGTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">359 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sasaki et al. (2010)</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">au-nucR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCCAATGTTCTACCATAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. pseudintermedius</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">pse-F2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGGGCAGTAGGATTCGTA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">926 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sasaki et al. (2010)</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">pse-R5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTTTGTGCTTCCTTTTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">mecA</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">mecA1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGTCCGTAACCTGAATCAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">519 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ishihara et al. (2010)</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">mecA2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGCTATCCACCCTCAAACAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "List of the primers used for species identification and detection of the mecA gene." ] ] 4 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "V: Veterinarian; S: surfaces; O: owner; OXA: oxacillin; ENR: enrofloxacin; CIP: ciprofloxacin; ERI: erytromicin; FOX: cefoxitin; AMC: amoxicillin/cavulanic acid; CLI: clyndamicin; KB: Kirby–Bauer; CIM: Minimal Inhibitory Concentration; R: resistant; S: susceptible." "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n \t\t\t\t\ttable-head\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">ID \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Source \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Species \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">mecA \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Resistant profile \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Oxacillin</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cefoxitin</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">KB (mm) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CIM (μg/ml) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">KB (mm) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CIM (μg/ml) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32/R \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. pseudintermedius \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI DOX AMC CLI TET \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26/S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4/S \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32/R \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 18 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32/R \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MV 21 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">V \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Equi 9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. pseudintermedius \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28/S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4/S \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Equi 10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. pseudintermedius \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI DOX AMC CLI TET \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>64/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26/S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4/S \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Prop 36 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">O \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S. aureus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15/R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16/R \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Characteristic of methicillin-resistant strains isolates from veterinary settings in Chile." ] ] 5 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n \t\t\t\t\ttable-head\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Species \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="3" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">S. aureus (n=18)</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="3" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">S. pseudintermedius (n=27)</th></tr><tr title="table-row"><th class="td-with-role" title="\n \t\t\t\t\ttable-head\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Antimicrobials \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="6" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC (μg/ml)</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC50 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC90 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC50 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC90 \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Oxacillin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–>64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–>64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cefoxitin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2–32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5–16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Enrofloxacin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Clindamycin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.25–32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Vancomycin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2–>64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2–4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Minimal Inhibitory Concentration (MIC) of CoPS isolated from a veterinary teaching hospital against antimicrobial agents." ] ] 6 => array:5 [ "identificador" => "upi0005" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc1.pdf" "ficheroTamanyo" => 152328 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:50 [ 0 => array:3 [ "identificador" => "bib0255" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bases moleculares de la resistencia a meticilina en Staphylococcus aureus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "A. Aguayo-Reyes" 1 => "M. Quezada-Aguiluz" 2 => "S. Mella" 3 => "G. Riedel" 4 => "A. Opazo-Capurro" 5 => "H. Bello-Toledo" 6 => "M. Dominguez" 7 => "G. Gonzalez-Rocha" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4067/s0716-10182018000100007" "Revista" => array:6 [ "tituloSerie" => "Rev Chilena Infectol" "fecha" => "2018" "volumen" => "35" "paginaInicial" => "7" "paginaFinal" => "14" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29652966" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0260" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evaluation of different screening methodologies for the detection of methicillin-resistant Staphylococcus aureus from environmental surfaces: swabs, gauzes, and polywipes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Aires de Souza" 1 => "S. Rodrigues" 2 => "T. Conceicao" 3 => "H. Lencastre" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/mdr.2017.0349" "Revista" => array:6 [ "tituloSerie" => "Microb Drug Resist" "fecha" => "2018" "volumen" => "24" "paginaInicial" => "585" "paginaFinal" => "589" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29653476" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0265" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Economic features of antibiotic resistance: the case of methicillin-resistant Staphylococcus aureus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F. Antonanzas" 1 => "C. Lozano" 2 => "C. Torres" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Pharmacoecon Open" "fecha" => "2014" "volumen" => "33" "paginaInicial" => "285" "paginaFinal" => "325" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0270" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial resistance in bacteria isolated from cats dogs from the Atlantic Provinces, Canada from 1994–2013" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B. Awosile" 1 => "T. McClure" 2 => "M. Saab" 3 => "L. Heider" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Can Vet J" "fecha" => "2018" "volumen" => "59" "paginaInicial" => "885" "paginaFinal" => "893" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30104781" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0275" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Carriage rate antibiotic susceptibility of coagulase-positive staphylococci isolated from healthy dogs in Victoria, Australia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D. Bean" 1 => "S. Wigmore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/avj.12528" "Revista" => array:6 [ "tituloSerie" => "Aust Vet J" "fecha" => "2016" "volumen" => "94" "paginaInicial" => "456" "paginaFinal" => "460" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27804112" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0280" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effectiveness of a combined (4% chlorhexidine digluconate shampoo and solution) protocol in MRS and non-MRS canine superficial pyoderma: a randomized, blinded, antibiotic-controlled study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Borio" 1 => "S. Colombo" 2 => "G. La Rosa" 3 => "M. De Lucia" 4 => "P. Damborg" 5 => "L. Guardabassi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/vde.12233" "Revista" => array:6 [ "tituloSerie" => "Vet Dermatol" "fecha" => "2015" "volumen" => "26" "paginaInicial" => "339" "paginaFinal" => "344" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26140535" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0285" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Staphylococcus pseudintermedius can be misdiagnosed as Staphylococcus aureus in humans with dog bite wounds" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Börjesson" 1 => "E. Gómez-Sanz" 2 => "K. Ekström" 3 => "C. Torres" 4 => "U. Grönlund" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10096-014-2300-y" "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "2014" "volumen" => "34" "paginaInicial" => "839" "paginaFinal" => "844" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25532507" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0290" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Performance Standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from Animals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "CLSI" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "edicion" => "3rd ed. CLSI supplement VET01S" "fecha" => "2015" "editorial" => "Clinical and Laboratory Standards Institute" "editorialLocalizacion" => "Wayne (PA)" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0295" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "CLSI. Performance standards for antimicrobial susceptibility testing, 28th ed. CLSI supplement M100. Wayne (PA): Clinical and Laboratory Standards Institute." ] ] ] 9 => array:3 [ "identificador" => "bib0300" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trends and molecular mechanisms of antimicrobial resistance in clinical staphylococci isolated from companion animals over a 16-year period" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "N. Couto" 1 => "C. Monchique" 2 => "A. Belas" 3 => "C. Marques" 4 => "L. Gama" 5 => "C. Pomba" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkw029" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2016" "volumen" => "71" "paginaInicial" => "1479" "paginaFinal" => "1487" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26944924" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0305" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant Staphylococcus pseudintermedius (MRSP) among employees and in the environment of a small animal hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "T. Feßler" 1 => "R. Schuenemann" 2 => "K. Kadlec" 3 => "V. Hensel" 4 => "J. Brombach" 5 => "J. Murugaiyan" 6 => "G. Oechtering" 7 => "I. Burgener" 8 => "S. Schwarz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2018.06.001" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2018" "volumen" => "221" "paginaInicial" => "153" "paginaFinal" => "158" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29981702" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0310" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification and molecular epidemiology of methicillin resistant Staphylococcus pseudintermedius strains isolated from canine clinical samples in Argentina" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "P. Gagetti" 1 => "A. Wattam" 2 => "G. Giacoboni" 3 => "A. De Paulis" 4 => "E. Bertona" 5 => "A. Corso" 6 => "A. Rosato" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12917-019-1990-x" "Revista" => array:6 [ "tituloSerie" => "BMC Vet Res" "fecha" => "2019" "volumen" => "15" "paginaInicial" => "264" "paginaFinal" => "276" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31351494" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0315" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial use in companion animals: assessing veterinarians’ prescription patterns through the first national survey in Chile" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "N. Galarce" 1 => "G. Arriagada" 2 => "F. Sánchez" 3 => "V. Venegas" 4 => "J. Cornejo" 5 => "L. Lapierre" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/ani11020348" "Revista" => array:6 [ "tituloSerie" => "Animals" "fecha" => "2021" "volumen" => "11" "paginaInicial" => "348" "paginaFinal" => "361" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33573203" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0320" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detección del gen mecA en cepas de Syaphylococcus coagulasa positiva aisladas desde gatos" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "N. Galarce" 1 => "L. Muñoz" 2 => "M. Jara" 3 => "P. Lubí" 4 => "A. Sepúlveda" 5 => "S. Anticevic" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4067/S0716-10182016000400005" "Revista" => array:7 [ "tituloSerie" => "Rev Chilena Infectol" "fecha" => "2016" "volumen" => "33" "paginaInicial" => "410" "paginaFinal" => "418" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27905624" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0016508512005094" "estado" => "S300" "issn" => "00165085" ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0325" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "High diversity of Staphylococcus aureus and Staphylococcus pseudintermedius lineages and toxigenic traits in healthy pet-owning household members Underestimating normal household contact?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "E. Gómez-Sanz" 1 => "C. Torres" 2 => "C. Lozano" 3 => "M. Zarazaga" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Comp Immunol Microbiol Infect Dis" "fecha" => "2013" "volumen" => "36" "paginaInicial" => "83" "paginaFinal" => "94" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0330" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial resistance in Staphylococcus pseudintermedius and the molecular epidemiology of methicillin-resistant S. pseudintermedius in small animals in Finland" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "T. Gröntal" 1 => "M. Eklund" 2 => "K. Thomsom" 3 => "H. Piiparinen" 4 => "T. Sironen" 5 => "M. Rantala" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkw559" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2017" "volumen" => "72" "paginaInicial" => "1021" "paginaFinal" => "1030" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28065889" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0335" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Coagulase positive staphylococcal colonization of humans their household pets" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B. Hanselman" 1 => "S. Kruth" 2 => "J. Rousseau" 3 => "S. Wesse" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Can Vet J" "fecha" => "2009" "volumen" => "50" "paginaInicial" => "954" "paginaFinal" => "958" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19949556" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0340" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "autores" => array:1 [ 0 => array:3 [ "colaboracion" => "Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis (Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases)" "etal" => false "autores" => array:11 [ 0 => "A. Hillier" 1 => "D. Lloyd" 2 => "J. Weese" 3 => "J. Blondeau" 4 => "D. Boothe" 5 => "E. Breitschwerdt" 6 => "L. Guardabassi" 7 => "M. Papich" 8 => "S. Rankin" 9 => "J. Turnidge" 10 => "J. Sikes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/vde.12118" "Revista" => array:6 [ "tituloSerie" => "Vet Dermatol" "fecha" => "2014" "volumen" => "25" "paginaInicial" => "163" "paginaFinal" => "175" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24720433" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0345" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interplay of personal, pet, and environmental colonization in households affected by community-associated methicillin-resistant Staphylococcus aureus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:14 [ 0 => "P. Hogan" 1 => "R. Mork" 2 => "M. Boyle" 3 => "C. Muenks" 4 => "J. Morelli" 5 => "R. Thompson" 6 => "M. Sullivan" 7 => "S. Gehlert" 8 => "J. Merlo" 9 => "M. McKenzie" 10 => "J. Wardenburg" 11 => "A. Rzhetsky" 12 => "C. Burnham" 13 => "S. Fritz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jinf.2018.11.006" "Revista" => array:6 [ "tituloSerie" => "J Infect" "fecha" => "2018" "volumen" => "78" "paginaInicial" => "200" "paginaFinal" => "207" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30503843" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0350" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Occurrence and molecular characteristics of methicillin-resistant Staphylococcus aureus and methicillin-resistant Staphylococcus pseudintermedius in an academic veterinary hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:11 [ 0 => "K. Ishihara" 1 => "N. Shimokubo" 2 => "A. Sakagami" 3 => "H. Ueno" 4 => "Y. Muratsu" 5 => "T. Kadosawa" 6 => "C. Yanagisawa" 7 => "H. Hanaki" 8 => "C. Nakahima" 9 => "Y. Susuki" 10 => "Y. Tamura" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Appl Environ Microbiol" "fecha" => "2010" "volumen" => "76" "paginaInicial" => "5165" "paginaFinal" => "5174" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0355" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of canine and feline methicillin-resistant Staphylococcus pseudintermedius (MRSP) from Thailand" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "K. Kadlec" 1 => "S. Weib" 2 => "S. Wendlandt" 3 => "S. Schwartz" 4 => "W. Tonpitak" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2016.04.015" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2016" "volumen" => "194" "paginaInicial" => "93" "paginaFinal" => "97" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27160358" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0360" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "spa typing and antimicrobial resistance of Staphylococcus aureus from healthy humans, pigs and dogs in Tanzania" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Katakweba" 1 => "A. Muhairwa" 2 => "C. Espinosa-Gongora" 3 => "L. Guardabassi" 4 => "M. Mtambo" 5 => "J. Olsen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3855/jidc.6790" "Revista" => array:6 [ "tituloSerie" => "J Infect Dev Ctries" "fecha" => "2016" "volumen" => "10" "paginaInicial" => "143" "paginaFinal" => "148" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26927455" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0365" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methicillin-resistant Staphylococcus pseudintermedius (MRSP) from healthy dogs in Norway – occurrence, genotypes and comparison to clinical MRSP" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "E. Kjellman" 1 => "J. Slettemeas" 2 => "H. Small" 3 => "M. Sunde" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/mbo3.258" "Revista" => array:6 [ "tituloSerie" => "Microbiologyopen" "fecha" => "2015" "volumen" => "4" "paginaInicial" => "857" "paginaFinal" => "866" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26423808" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0370" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus carriage in three populations" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Kottler" 1 => "J.R. Middleton" 2 => "J. Perry" 3 => "J.S. Weese" 4 => "L.A. Cohn" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1939-1676.2009.0424.x" "Revista" => array:6 [ "tituloSerie" => "J Vet Intern Med" "fecha" => "2012" "volumen" => "24" "paginaInicial" => "132" "paginaFinal" => "139" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20002557" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0375" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Enhanced adherence of methicillin-resistant Staphylococcus pseudintermedius sequence type 71 to canine and human corneocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "F. Latronico" 1 => "A. Moodley" 2 => "S. Nielsen" 3 => "L. Guardabassi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Vet Res" "fecha" => "2014" "volumen" => "45" "paginaInicial" => "70" "paginaFinal" => "77" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0380" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "What has changed in canine pyoderma? A narrative review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Loeffler" 1 => "D.H. Lloyd" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.tvjl.2018.04.002" "Revista" => array:6 [ "tituloSerie" => "Vet J" "fecha" => "2018" "volumen" => "235" "paginaInicial" => "73" "paginaFinal" => "82" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29704943" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0385" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of methicillin-resistant Staphylococcus sp (MRS) in different companion animals and determination of risk factors for colonization with MRS" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "I. Loncaric" 1 => "A. Tichy" 2 => "S. Handler" 3 => "M. Szostak" 4 => "M. Tickert" 5 => "M. Diab-Elschahaw" 6 => "J. Spergser" 7 => "F. Künzel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Antibiotics (Basel)" "fecha" => "2019" "volumen" => "8" "paginaInicial" => "39" "paginaFinal" => "45" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0390" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L. McDougal" 1 => "C. Steward" 2 => "G. Killgore" 3 => "J. Chaitram" 4 => "S. McAllister" 5 => "F. Tenover" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.41.11.5113-5120.2003" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2003" "volumen" => "41" "paginaInicial" => "5113" "paginaFinal" => "5120" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14605147" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0395" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of hospital-onset methicillin-resistant Staphylococcus aureus infections in southern Chile" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "G. Medina" 1 => "A.L. Egea" 2 => "C. Otth" 3 => "L. Otth" 4 => "H. Fernandez" 5 => "L. Bocco" 6 => "M. Wilson" 7 => "C. Sola" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10096-013-1907-8" "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "2013" "volumen" => "32" "paginaInicial" => "1533" "paginaFinal" => "1540" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23765159" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0400" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Short Communication: β-lactam resistance and vancomycin heteroresistance in Staphylococcus spp Isolated from bovine subclinical mastitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "P. Mello" 1 => "L. Pinheiro" 2 => "L. Martins" 3 => "M. Brito" 4 => "M. Souza da Cunha" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3168/jds.2016-12329" "Revista" => array:6 [ "tituloSerie" => "J Dairy Sci" "fecha" => "2017" "volumen" => "100" "paginaInicial" => "6567" "paginaFinal" => "6571" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28624285" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0405" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence and characterization of methicillin-resistant Staphylococcus pseudintermedius from symptomatic companion animals in northern Italy: clonal diversity and novel sequence types" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.L. Menandro" 1 => "G. Dotto" 2 => "A. Mondin" 3 => "M. Martini" 4 => "L. Ceglie" 5 => "D. Pasotto" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cimid.2019.101331" "Revista" => array:5 [ "tituloSerie" => "Comp Immunol Microbiol Infect Dis" "fecha" => "2019" "volumen" => "66" "paginaInicial" => "101331" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31437680" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0410" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Primer reporte de aislamiento de Staphylococcus schleiferi subsp. coagulans en perros con pioderma y otitis externa en Chile" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "L. Muñoz" 1 => "M. Molina" 2 => "M. Heresmann" 3 => "F. Abusleme" 4 => "M. Ulloa" 5 => "C. Borie" 6 => "B. San Martin" 7 => "V. Silva" 8 => "S. Anticevic" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arch Med Vet" "fecha" => "2012" "volumen" => "44" "paginaInicial" => "261" "paginaFinal" => "265" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0415" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Colonización nasal bacteriana en población sana de la ciudad de Santiago de Chile: ¿Existe portación de Staphylococcus aureus meticilino resistente comunitario?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "L. Platzer" 1 => "C. Aranis" 2 => "C. Beltran" 3 => "X. Fonseca" 4 => "P. Garcia" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Otorrinolaringol" "fecha" => "2010" "volumen" => "70" "paginaInicial" => "109" "paginaFinal" => "116" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0420" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Public health risk of antimicrobial resistance transfer from companion animals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "C. Pomba" 1 => "M. Rantala" 2 => "C. Greko" 3 => "K. Baptiste" 4 => "B. Catry" 5 => "E. van Duilkeren" 6 => "A. Mateus" 7 => "M. Moreno" 8 => "S. Pyorala" 9 => "K. Törneke" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkw481" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2016" "volumen" => "72" "paginaInicial" => "957" "paginaFinal" => "968" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27999066" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0425" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "First report in South America of companion animal colonization by the USA1100 clone of community-acquired methicillin-resistant Staphylococcus aureus (ST30) and by the European clon of methicicllin-resistant Staphylococcus pseudintermedius (ST71)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "I. Quitoco" 1 => "M. Ramundo" 2 => "M. Silva-carvalho" 3 => "R. Souza" 4 => "C. Beltrame" 5 => "T. de Oliveira" 6 => "R. Araújo" 7 => "P. Fernandez del Peloso" 8 => "L. Rocheto" 9 => "A. Figueiredo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1756-0500-6-336" "Revista" => array:6 [ "tituloSerie" => "BMC Res Notes" "fecha" => "2013" "volumen" => "6" "paginaInicial" => "336" "paginaFinal" => "342" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23981343" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0430" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Investigation of methicillin-resistant Staphylococcus aureus among clinical isolates from humans and animals by culture methods and multiplex PCR" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "M. Rahman" 1 => "K. Amin" 2 => "S. Rahman" 3 => "A. Khair" 4 => "M. Rahman" 5 => "A. Hossain" 6 => "A. Rhaman" 7 => "M. Parvez" 8 => "M. Miura" 9 => "M. Alam" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12917-018-1611-0" "Revista" => array:6 [ "tituloSerie" => "BMC Vet Res" "fecha" => "2018" "volumen" => "14" "paginaInicial" => "300" "paginaFinal" => "306" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30285752" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0435" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors for nasal colonization by methicillin-resistant staphylococci in healthy humans in professional daily contact with companion animals in Portugal" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Rodrigues" 1 => "A. Belas" 2 => "C. Marques" 3 => "L. Cruz" 4 => "L. Gama" 5 => "C. Pomba" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/mdr.2017.0063" "Revista" => array:6 [ "tituloSerie" => "Microb Drug Resist" "fecha" => "2018" "volumen" => "24" "paginaInicial" => "434" "paginaFinal" => "446" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28922060" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0440" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CRISPR tracking reveals global spreading of antimicrobial resistance genes by Staphylococcus of canine origin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C. Rossi" 1 => "A. Oliveira" 2 => "M. Giambiagi-deMarval" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2019.04.009" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2019" "volumen" => "232" "paginaInicial" => "65" "paginaFinal" => "69" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31030846" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0445" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial resistance in bacterial isolates from companion animals in Buenos Aires, Argentina: 2011–2017 retrospective study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.V. Rumi" 1 => "E. Nuske" 2 => "J. Mas" 3 => "A. Argüello" 4 => "G. Gutkind" 5 => "J. Di Conza" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/zph.12842" "Revista" => array:6 [ "tituloSerie" => "Zoonoses Public Health" "fecha" => "2021" "volumen" => "68" "paginaInicial" => "516" "paginaFinal" => "526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33966360" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0450" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial resistance in coagulase-positive staphylococci isolated from companion animals in Australia: a one-year study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "S. Saputra" 1 => "D. Jordan" 2 => "K. Worthing" 3 => "J. Norris" 4 => "H. Wong" 5 => "R. Abraham" 6 => "D. Trott" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0176379" "Revista" => array:5 [ "tituloSerie" => "PLOS ONE" "fecha" => "2017" "volumen" => "12" "paginaInicial" => "e0176379" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28430811" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0455" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiplex-PCR method for species identification of coagulase-positive staphylococci" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "T. Sasaki" 1 => "S. Tsubakishita" 2 => "Y. Tanaka" 3 => "A. Sakusabe" 4 => "M. Ohtsuka" 5 => "S. Hirotaki" 6 => "T. Kawakami" 7 => "T. Fukata" 8 => "K. Hiramatsu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.01232-09" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2010" "volumen" => "48" "paginaInicial" => "765" "paginaFinal" => "769" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20053855" "web" => "Medline" ] ] ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0460" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human infections due to Staphylococcus pseudintermedius, an emerging zoonosis of canine origin: report of 24 cases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R. Somayaji" 1 => "M.A. Priyantha" 2 => "J.E. Rubin" 3 => "D. Church" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.diagmicrobio.2016.05.008" "Revista" => array:6 [ "tituloSerie" => "Diagn Microbiol Infect Dis" "fecha" => "2016" "volumen" => "85" "paginaInicial" => "471" "paginaFinal" => "476" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27241371" "web" => "Medline" ] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0465" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular study on methicillin-resistant Staphylococcus aureus strains isolated from dogs and associated personnel in Jordan" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Tarazi" 1 => "A. Almajali" 2 => "M. Ababneh" 3 => "H. Ahmed" 4 => "A. Jaran" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Asian Pac J Trop Biomed" "fecha" => "2015" "volumen" => "5" "paginaInicial" => "902" "paginaFinal" => "908" ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0470" "etiqueta" => "44" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aislamiento de Staphylococcus aureus hetero-resistente a vancomicina en hospital clínico regional de Concepción, Chile" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "F. Vega" 1 => "P. Alarcón" 2 => "M. Dominguez" 3 => "H. Bello" 4 => "G. Riedel" 5 => "S. Mella" 6 => "A. Aguayo" 7 => "G. Gonzalez-Rocha" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4067/S0716-10182015000600017" "Revista" => array:6 [ "tituloSerie" => "Rev Chilena Infectol" "fecha" => "2015" "volumen" => "32" "paginaInicial" => "588" "paginaFinal" => "590" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26633120" "web" => "Medline" ] ] ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib0475" "etiqueta" => "45" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy; a 3-year retrospective investigation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "G. Ventrella" 1 => "A. Moodley" 2 => "E. Grandolfo" 3 => "A. Parisi" 4 => "M. Corrente" 5 => "D. Bounavoglia" 6 => "L. Guardabassi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2017.09.015" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2017" "volumen" => "211" "paginaInicial" => "103" "paginaFinal" => "106" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29102103" "web" => "Medline" ] ] ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib0480" "etiqueta" => "46" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Resistencia antimicrobiana y epidemiología molecular de aislamientos de Staphylococcus pseudintermedius de muestras clínicas de caninos" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G. Vigo" 1 => "G. Giacoboni" 2 => "P. Gagetti" 3 => "F. Pasterán" 4 => "A. Corso" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ram.2015.06.002" "Revista" => array:6 [ "tituloSerie" => "Rev Argent Microbiol" "fecha" => "2015" "volumen" => "47" "paginaInicial" => "206" "paginaFinal" => "211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26323373" "web" => "Medline" ] ] ] ] ] ] ] ] 46 => array:3 [ "identificador" => "bib0485" "etiqueta" => "47" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors for MRSA infection in companion animals: results from a case-control study within Germany" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "S. Vincze" 1 => "A. Brandenburg" 2 => "W. Espelage" 3 => "I. Stamm" 4 => "L. Wieler" 5 => "P. Kopp" 6 => "A. Lübke-Becker" 7 => "B. Walther" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ijmm.2014.07.007" "Revista" => array:6 [ "tituloSerie" => "Int J Med Microbiol" "fecha" => "2014" "volumen" => "304" "paginaInicial" => "787" "paginaFinal" => "793" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25130703" "web" => "Medline" ] ] ] ] ] ] ] ] 47 => array:3 [ "identificador" => "bib0490" "etiqueta" => "48" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Staphylococcus intermedius infections: case report and literature review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "N. Wang" 1 => "A. Neilan" 2 => "M. Klompas" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4081/idr.2013.s1.e3" "Revista" => array:5 [ "tituloSerie" => "Infect Dis Rep" "fecha" => "2013" "volumen" => "5" "paginaInicial" => "e3" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24470967" "web" => "Medline" ] ] ] ] ] ] ] ] 48 => array:3 [ "identificador" => "bib0495" "etiqueta" => "49" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Carriage of Staphylococcus species in the veterinary visiting dog population in mainland UK: molecular characterization of resistance and virulence" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:11 [ 0 => "A. Wedley" 1 => "S. Dawson" 2 => "T. Maddox" 3 => "K. Coyne" 4 => "G. Pinchbeck" 5 => "P. Clegg" 6 => "D. Jamrozi" 7 => "M. Fielder" 8 => "D. Donovan" 9 => "T. Nutall" 10 => "N. Williams" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2014.01.015" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2014" "volumen" => "170" "paginaInicial" => "81" "paginaFinal" => "88" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24612909" "web" => "Medline" ] ] ] ] ] ] ] ] 49 => array:3 [ "identificador" => "bib0500" "etiqueta" => "50" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methicillin-resistant Staphylococcus aureus and Staphylococcus pseudintermedius in veterinary medicine" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J.S. Weese" 1 => "E. van Duijkeren" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.vetmic.2009.01.039" "Revista" => array:6 [ "tituloSerie" => "Vet Microbiol" "fecha" => "2010" "volumen" => "140" "paginaInicial" => "418" "paginaFinal" => "429" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19246166" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack627964" "titulo" => "Acknowledgements" "texto" => "The authors appreciate the kind collaboration of all staff of Laboratorio de Investigación en Agentes Antibacterianos at Facultad de Ciencias Biológicas, Universidad de Concepción, and the Laboratorio de Microbiología Clínica Veterinaria of the Facultad de Ciencias Veterinarias y Pecuarias of the Universidad de Chile (FAVET). This study was financed by the Conicyt National Doctorate Grant No. 21141033-2014, and by the ANID Millennium Science Initiative/Millennium Initiative for Collaborative Research on Bacterial Resistance, MICROB-R, NCN17_081-2020." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000005400000003/v1_202209300808/S0325754122000013/v1_202209300808/en/main.assets" "Apartado" => array:4 [ "identificador" => "44540" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Agentes antimicrobianos" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000005400000003/v1_202209300808/S0325754122000013/v1_202209300808/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000013?idApp=UINPBA00004N"]

Statistics

Original article

Caracterización y sensibilidad antimicrobiana de Staphylococcus coagulasa-positivos aislados en un hospital clínico veterinario en Chile

Francisco Abuslemea,

Corresponding author

fabusleme@vetdermchile.cl

Corresponding authors.

, Nicolás Galarceb, Mario Quezada-Aguiluzc,d,e, Daniela Iragüena, Gerardo González-Rochac,d,

Corresponding author

ggonzal@udec.cl

Corresponding authors.

a Departamento de Ciencias Clínicas, Facultad de Ciencias Veterinarias y Pecuarias, FAVET, Universidad de Chile, Santiago, Chile

b Departamento de Medicina Preventiva Animal, Facultad de Ciencias Veterinarias y Pecuarias, FAVET, Universidad de Chile, Santiago, Chile

c Laboratorio de Investigación en Agentes Antibacterianos, Departamento de Microbiología, Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción, Chile

d Millennium Initiative for Collaborative Research on Bacterial Resistance (MICROB-R), Santiago, Chile

e Departamento de Medicina Interna, Facultad de Medicina, Universidad de Concepción, Chile

Read

1929

Times
was read the article

349

Total PDF

1580

Total HTML

Share statistics

 array:24 [
  "pii" => "S0325754122000013"
  "issn" => "03257541"
  "doi" => "10.1016/j.ram.2021.12.001"
  "estado" => "S300"
  "fechaPublicacion" => "2022-07-01"
  "aid" => "481"
  "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Rev Argent Microbiol. 2022;54:192-202"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0325754121000377"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2021.02.004"
    "estado" => "S300"
    "fechaPublicacion" => "2022-07-01"
    "aid" => "447"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2022;54:203-8"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:14 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">INFORME BREVE</span>"
      "titulo" => "<span class="elsevierStyleItalic">Trichophyton benhamiae</span>&#44; un dermatofito zoof&#237;lico emergente en Argentina con reservorio en cobayos&#58; descripci&#243;n de 7<span class="elsevierStyleHsp" style=""></span> casos en un hospital de la Ciudad Aut&#243;noma de Buenos Aires"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:3 [
        0 => "es"
        1 => "es"
        2 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "203"
          "paginaFinal" => "208"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "<span class="elsevierStyleItalic">Trichophyton benhamiae</span>&#44; an emergent zoonotic pathogen in Argentina associated with Guinea pigs&#58; Description of 7<span class="elsevierStyleHsp" style=""></span>cases in Buenos Aires"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figura 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 2352
              "Ancho" => 2508
              "Tamanyo" => 515400
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">A&#41; Examen directo de las escamas obtenidas por raspado de la lesi&#243;n con KOH al 40&#37; con tinta Parker&#174; azul-negra permanente &#40;400&#215;&#41;&#46; B&#41; Aspecto macrosc&#243;pico de <span class="elsevierStyleItalic">Trichophyton benhamiae</span>&#46; Cultivo primario de escamas de lesi&#243;n con desarrollo en agar Sabouraud y agar selectivo y diferencial para dermatofitos &#40;DTM&#41;&#46; C&#41; Subcultivo en placa de agar Sabouraud&#44; micelio velloso blanco con pigmento amarillo&#46; D&#46; Micromorfolog&#237;a de <span class="elsevierStyleItalic">T&#46; benhamiae</span> en disgregado con azul de lactofenol &#40;400&#215;&#41;&#46; Microconidios globosos ovales o claviformes que se originan lateralmente y se disponen formando racimos&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ivana Maldonado, Mar&#237;a Elisa Elisiri, Marina Monaco, Alejandra Hevia, Margarita Larralde, B&#225;rbara Fox, Nicol&#225;s Refojo, Ricardo Iachini, Andrea Santos Mu&#241;oz, Rita Leitner, Paula Luna, Lucrecia Meirama, Eugenia Abad, Neri Ruiz Diaz, Juli&#225;n Fern&#225;ndez, Liliana Fern&#225;ndez-Canigia"
          "autores" => array:16 [
            0 => array:2 [
              "nombre" => "Ivana"
              "apellidos" => "Maldonado"
            ]
            1 => array:2 [
              "nombre" => "Mar&#237;a Elisa"
              "apellidos" => "Elisiri"
            ]
            2 => array:2 [
              "nombre" => "Marina"
              "apellidos" => "Monaco"
            ]
            3 => array:2 [
              "nombre" => "Alejandra"
              "apellidos" => "Hevia"
            ]
            4 => array:2 [
              "nombre" => "Margarita"
              "apellidos" => "Larralde"
            ]
            5 => array:2 [
              "nombre" => "B&#225;rbara"
              "apellidos" => "Fox"
            ]
            6 => array:2 [
              "nombre" => "Nicol&#225;s"
              "apellidos" => "Refojo"
            ]
            7 => array:2 [
              "nombre" => "Ricardo"
              "apellidos" => "Iachini"
            ]
            8 => array:2 [
              "nombre" => "Andrea"
              "apellidos" => "Santos Mu&#241;oz"
            ]
            9 => array:2 [
              "nombre" => "Rita"
              "apellidos" => "Leitner"
            ]
            10 => array:2 [
              "nombre" => "Paula"
              "apellidos" => "Luna"
            ]
            11 => array:2 [
              "nombre" => "Lucrecia"
              "apellidos" => "Meirama"
            ]
            12 => array:2 [
              "nombre" => "Eugenia"
              "apellidos" => "Abad"
            ]
            13 => array:2 [
              "nombre" => "Neri"
              "apellidos" => "Ruiz Diaz"
            ]
            14 => array:2 [
              "nombre" => "Juli&#225;n"
              "apellidos" => "Fern&#225;ndez"
            ]
            15 => array:2 [
              "nombre" => "Liliana"
              "apellidos" => "Fern&#225;ndez-Canigia"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8211;</span><p id="par0005" class="elsevierStylePara elsevierViewall">Primera descripci&#243;n en Argentina de dermatofitosis por <span class="elsevierStyleItalic">Trichophyton benhamiae</span>&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#8211;</span><p id="par0010" class="elsevierStylePara elsevierViewall">El reservorio de <span class="elsevierStyleItalic">T&#46; benhamiae</span> fueron los cobayos&#46;</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#8211;</span><p id="par0015" class="elsevierStylePara elsevierViewall">Las lesiones por este dermatofito en ni&#241;os suelen ser inflamatorias&#46;</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">&#8211;</span><p id="par0020" class="elsevierStylePara elsevierViewall">El diagn&#243;stico de certeza se debe realizar por prote&#243;mica o gen&#243;mica&#46;</p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel">&#8211;</span><p id="par0025" class="elsevierStylePara elsevierViewall">La mayor&#237;a de los casos requirieron tratamiento antif&#250;ngico sist&#233;mico&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754121000377?idApp=UINPBA00004N"
    "url" => "/03257541/0000005400000003/v1_202209300808/S0325754121000377/v1_202209300808/es/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0325754122000190"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2022.03.002"
    "estado" => "S300"
    "fechaPublicacion" => "2022-07-01"
    "aid" => "485"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2022;54:181-91"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Bios&#237;ntesis inducida de fengicina y surfactina en una cepa de <span class="elsevierStyleItalic">Bacillus amyloliquefaciens</span> con actividad oomiceticida sobre zoosporas de <span class="elsevierStyleItalic">Phytophthora capsica</span>"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "181"
          "paginaFinal" => "191"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Induced biosynthesis of fengycin and surfactin in a strain of <span class="elsevierStyleItalic">Bacillus amyloliquefaciens</span> with oomyceticidal activity on zoospores of <span class="elsevierStyleItalic">Phytophthora capsici</span>"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Figura 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1393
              "Ancho" => 1505
              "Tamanyo" => 175048
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Efectos del extracto crudo producido por <span class="elsevierStyleItalic">B&#46; amyloliquefaciens</span> KX953161&#46;1 sobre la morfolog&#237;a y la germinaci&#243;n de zoosporas de <span class="elsevierStyleItalic">P&#46; capsici</span>&#46; &#40;A&#41; Zoosporas germinadas en ausencia del extracto&#46; &#40;B&#41; Tubo germinativo anormal&#46; &#40;C&#41; Zoosporas sin geminaci&#243;n &#40;enquistadas&#41;&#46; &#40;D y E&#41; Las paredes de la zoospora de <span class="elsevierStyleItalic">P&#46; capsici</span> se lisaron al momento del contacto con el extracto crudo que conten&#237;a los lipop&#233;ptidos producidos por <span class="elsevierStyleItalic">B&#46; amyloliquefaciens</span> KX953161&#46;1&#46; Las im&#225;genes fueron tomadas bajo microscopio&#44; con objetivo de 40&#215; en campo claro&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Nancy Ley-L&#243;pez, Jos&#233; Basilio Heredia, Cesar San Mart&#237;n-Hern&#225;ndez, J&#46; Ram&#243;n Ibarra-Rodr&#237;guez, Miguel &#193;ngel Angulo-Escalante, Raymundo Sa&#250;l Garc&#237;a-Estrada"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Nancy"
              "apellidos" => "Ley-L&#243;pez"
            ]
            1 => array:2 [
              "nombre" => "Jos&#233;"
              "apellidos" => "Basilio Heredia"
            ]
            2 => array:2 [
              "nombre" => "Cesar"
              "apellidos" => "San Mart&#237;n-Hern&#225;ndez"
            ]
            3 => array:2 [
              "nombre" => "J&#46; Ram&#243;n"
              "apellidos" => "Ibarra-Rodr&#237;guez"
            ]
            4 => array:2 [
              "nombre" => "Miguel &#193;ngel"
              "apellidos" => "Angulo-Escalante"
            ]
            5 => array:2 [
              "nombre" => "Raymundo Sa&#250;l"
              "apellidos" => "Garc&#237;a-Estrada"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000190?idApp=UINPBA00004N"
    "url" => "/03257541/0000005400000003/v1_202209300808/S0325754122000190/v1_202209300808/es/main.assets"
  ]
  "en" => array:22 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Characterization and antimicrobial susceptibility of coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span> isolated in a veterinary teaching hospital in Chile"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "192"
        "paginaFinal" => "202"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Francisco Abusleme, Nicol&#225;s Galarce, Mario Quezada-Aguiluz, Daniela Irag&#252;en, Gerardo Gonz&#225;lez-Rocha"
        "autores" => array:5 [
          0 => array:4 [
            "nombre" => "Francisco"
            "apellidos" => "Abusleme"
            "email" => array:1 [
              0 => "fabusleme@vetdermchile.cl"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Nicol&#225;s"
            "apellidos" => "Galarce"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Mario"
            "apellidos" => "Quezada-Aguiluz"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Daniela"
            "apellidos" => "Irag&#252;en"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:4 [
            "nombre" => "Gerardo"
            "apellidos" => "Gonz&#225;lez-Rocha"
            "email" => array:1 [
              0 => "ggonzal@udec.cl"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:5 [
          0 => array:3 [
            "entidad" => "Departamento de Ciencias Cl&#237;nicas&#44; Facultad de Ciencias Veterinarias y Pecuarias&#44; FAVET&#44; Universidad de Chile&#44; Santiago&#44; Chile"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Departamento de Medicina Preventiva Animal&#44; Facultad de Ciencias Veterinarias y Pecuarias&#44; FAVET&#44; Universidad de Chile&#44; Santiago&#44; Chile"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Laboratorio de Investigaci&#243;n en Agentes Antibacterianos&#44; Departamento de Microbiolog&#237;a&#44; Facultad de Ciencias Biol&#243;gicas&#44; Universidad de Concepci&#243;n&#44; Concepci&#243;n&#44; Chile"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Millennium Initiative for Collaborative Research on Bacterial Resistance &#40;MICROB-R&#41;&#44; Santiago&#44; Chile"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Departamento de Medicina Interna&#44; Facultad de Medicina&#44; Universidad de Concepci&#243;n&#44; Chile"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding authors&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Caracterizaci&#243;n y sensibilidad antimicrobiana de <span class="elsevierStyleItalic">Staphylococcus</span> coagulasa-positivos aislados en un hospital cl&#237;nico veterinario en Chile"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1380
            "Ancho" => 2508
            "Tamanyo" => 129739
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Percentages of resistance of CoPS isolated from a teaching veterinary hospital according methicillin susceptibility&#46; OXA&#58; oxacillin&#59; FOX&#58; cefoxitin&#59; AMC&#58; amoxicillin&#47;clavulanic acid&#59; ENR&#58; enrofloxacin&#59; CIP&#58; ciprofloxacin&#59; GEN&#58; gentamicin&#59; AMK&#58; Amikacina&#59; TET&#58; tetracycline&#59; DOX&#58; doxycycline&#59; CLI&#58; clindamycin&#59; ERY&#58; erythromycin&#59; MR-CoPS&#58; Methicillin-resistance coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span>&#59; MS-CoPS&#58; Methicillin-sensitive coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span>&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Introduction</span><p id="par0020" class="elsevierStylePara elsevierViewall">The skin of mammals is colonized by a large number of microorganisms that are collectively known as normal microbiota&#44; which includes several species of the genus <span class="elsevierStyleItalic">Staphylococcus</span><a class="elsevierStyleCrossRef" href="#bib0485"><span class="elsevierStyleSup">47</span></a>&#46; They are normally considered harmless&#44; but they can be a threat to the health of their hosts by acting as opportunistic pathogens and being reservoirs of antibiotic resistance genes&#44; increasing the potential for resistance to antibiotic therapy<a class="elsevierStyleCrossRef" href="#bib0440"><span class="elsevierStyleSup">38</span></a>&#46; The staphylococci with the highest clinical relevance are coagulase producers<a class="elsevierStyleCrossRef" href="#bib0435"><span class="elsevierStyleSup">37</span></a>&#44; mainly <span class="elsevierStyleItalic">S&#46; aureus</span> and those from the intermedius group&#44; particularly <span class="elsevierStyleItalic">S&#46; pseudintermedius</span><a class="elsevierStyleCrossRef" href="#bib0500"><span class="elsevierStyleSup">50</span></a>&#46; Despite the fact that <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> rarely causes illness in humans&#44; with reports ranging from soft tissue infections to bacteremia&#44; its prevalence may be underestimated&#44; since <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> may be erroneously identified as <span class="elsevierStyleItalic">S&#46; aureus</span> due to its similar biochemical characteristics<a class="elsevierStyleCrossRefs" href="#bib0285"><span class="elsevierStyleSup">7&#44;48</span></a>&#46; Establishing the difference between species is particularly relevant when evaluating behavior against antimicrobials&#44; since the cut-off points to define susceptibility and resistance to methicillin vary according to the species<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">7</span></a>&#44; unfortunately the characterization of species is not a routine practice in our region&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">In general&#44; it can be established that most staphylococcal infections can be easily controlled with antibiotics&#59; however&#44; in recent years different strains of <span class="elsevierStyleItalic">Staphylococcus</span> spp&#46; have proved to be resistant to the most commonly used antibiotics such as macrolides&#44; lincosamides&#44; tetracyclines&#44; gentamicin&#44; cephalosporins and other &#946;-lactams<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">27</span></a>&#46; The most relevant resistance in <span class="elsevierStyleItalic">Staphylococcus</span> is the <span class="elsevierStyleItalic">mecA</span>-mediated methicillin resistance&#44; which is globally spread&#44; turning ineffective the most widely used and efficient class of antimicrobials to treat staphylococcal infections<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">1</span></a>&#46; This gene is harbored in a mobile genetic element known as Staphylococcal Chromosomal Cassette &#40;<span class="elsevierStyleItalic">SCCmec</span>&#41;&#44; and encodes an altered penicillin-binding protein &#40;PBP&#41; with low affinity for &#946;-lactams<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">1</span></a>&#46; The emergence and spread of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus</span> &#40;MRS&#41; in both hospital and community settings pose a major threat to global health<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">34</span></a>&#46; In general&#44; the prevalence of methicillin-resistant strains has increased rapidly over time&#44; leading to major human and animal health problems&#44; especially in hospital settings<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">10</span></a>&#46; It is well-known that methicillin-resistant strains have higher levels of resistance against various classes of antibiotics compared to methicillin-susceptible strains<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">16&#44;43&#44;45</span></a>&#44; and the direct cost to treat methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> &#40;MRSA&#41; infections versus methicillin-susceptible <span class="elsevierStyleItalic">S&#46; aureus</span> in humans is 1&#46;5 to 3 times higher<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">3</span></a>&#46;</p><p id="par0030" class="elsevierStylePara elsevierViewall">To date&#44; there are no antimicrobial resistance stewardship programs for any animal species&#44; as well as no published studies of antimicrobial use in companion animals in Chile<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">13</span></a>&#59; currently available information regarding antibiotic resistance in South America is mainly focused on human health and studies on determining the prevalence of MRS strains in companion animals in South America are scarce&#46; Among these studies&#44; there is a study carried out in Brazil reporting the presence of MRSA in a cat and a methicillin-resistant <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> &#40;MRSP&#41; in a dog<a class="elsevierStyleCrossRef" href="#bib0425"><span class="elsevierStyleSup">35</span></a> and another one from Argentina informing that MRSA prevalence was much higher than in other studies in the United States where prevalence estimates varied from 0&#37; to 6&#37;<a class="elsevierStyleCrossRefs" href="#bib0300"><span class="elsevierStyleSup">10&#44;39</span></a> should be highlighted&#46; Moreover&#44; a study carried out in Chile describing 11 strains of coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span> &#40;CoPS&#41; carrying the <span class="elsevierStyleItalic">mecA</span> gene in cats<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">14</span></a> and two studies in Argentina that characterized 10<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">12</span></a> and three<a class="elsevierStyleCrossRef" href="#bib0480"><span class="elsevierStyleSup">46</span></a> strains of MRSP isolated from canine clinical specimens&#46; Another study in Chile analyzed CoPS strains isolated from dogs with pyoderma and external otitis&#44; not finding any MRS strains<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">32</span></a>&#46; Despite the high proximity of pets and humans&#44; the importance of companion animals as reservoirs of human infections is still poorly understood<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">27</span></a>&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall">The aim of the present study was to identify and characterize CoPS strains from dogs&#44; owners&#44; veterinary professionals and the environment in a veterinary teaching hospital in Chile&#44; to determine the presence of methicillin-resistant strains and to evaluate the genetic relationship between the CoPS strains&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Regulatory approvals</span><p id="par0040" class="elsevierStylePara elsevierViewall">The study was approved by the Ethical Committee of Facultad de Ciencias Veterinarias y Pecuarias&#44; Universidad de Chile&#44; authorization code No&#46; 07-2016&#46; An informed consent of the owners and veterinarians was obtained prior to sampling&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Sampling</span><p id="par0045" class="elsevierStylePara elsevierViewall">The sampling was conducted during the April-August period&#44; 2016&#44; and samples were obtained from dogs &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41; and owners &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41;&#44; veterinarians &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&#44; and surfaces &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#41; from a teaching veterinary hospital at the Universidad de Chile&#46; In the case of dogs&#44; healthy patients&#44; of any breed&#44; age and sex&#44; taken to the hospital for vaccinations or elective surgical procedures were sampled&#46; They were clinically evaluated by a veterinarian at the hospital&#44; who confirmed the patient&#39;s health status at the sampling time&#46; The use of antibiotics and&#47;or corticosteroids 15 days before taking samples was considered an exclusion factor&#44; for both dogs and humans&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">Prior to sampling&#44; the owner signed an informed consent developed under the recommendations of the World Health Organization &#40;supplementary material&#41;&#46; Owners and veterinarians were taught to take their own nasal swab sample as previously described<a class="elsevierStyleCrossRef" href="#bib0415"><span class="elsevierStyleSup">33</span></a> and a sample was taken from the canines&#8217; perianal area and their nasal mucosa&#46; All samples were stored at 4<span class="elsevierStyleHsp" style=""></span>&#176;C for up to 6<span class="elsevierStyleHsp" style=""></span>h before processing&#46; Regarding the surfaces&#44; five hospitalization cages&#44; the surgical tables of the two surgical wards&#44; a care table in the procedure room&#44; and the care table of two hospital consultation rooms were sampled&#46; All samples were taken with a sterile swab in amies transport medium &#40;Copan&#44; California&#44; USA&#41;&#46; A quadrant of 4<span class="elsevierStyleHsp" style=""></span>cm<span class="elsevierStyleSup">2</span> was selected in which the swab was slipped for 30<span class="elsevierStyleHsp" style=""></span>s covering the entire area&#46; The samples were collected 3<span class="elsevierStyleHsp" style=""></span>h after cleaning with quaternary ammonium and were taken as previously described<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">11</span></a>&#46; The samples were stored at 4<span class="elsevierStyleHsp" style=""></span>&#176;C for up to 6<span class="elsevierStyleHsp" style=""></span>h until they were processed&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">All samples were cultured in mannitol salt agar plates &#40;MSA&#44; Becton Dickinson GmbH Heidelberg&#44; Germany&#41; for 24<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; From each plate&#44; a maximum of three colonies with morphology compatible with <span class="elsevierStyleItalic">Staphylococcus</span> spp&#46; was selected to perform the catalase test&#44; coagulase test and Gram staining&#44; as previously described<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">32</span></a>&#59; but only one isolate from each sample was considered for analysis&#46; The catalase and coagulase positive strains&#44; and confirmed Gram-positive round shape bacteria&#44; were stored in a 2&#58;1 mixture of trypticase broth and 50&#37; glycerol &#40;v&#47;v&#41;&#44; at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; for subsequent species characterization&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Molecular identification of the <span class="elsevierStyleItalic">Staphylococcus</span> species</span><p id="par0060" class="elsevierStylePara elsevierViewall">In order to identify species of <span class="elsevierStyleItalic">Staphylococcus</span>&#44; a simple PCR protocol was carried out with primers previously described by Sasaki et al&#46;<a class="elsevierStyleCrossRef" href="#bib0455"><span class="elsevierStyleSup">41</span></a> DNA was extracted from 5 fresh colonies grown on MSA&#44; by boiling at 100<span class="elsevierStyleHsp" style=""></span>&#176;C for 15<span class="elsevierStyleHsp" style=""></span>min&#44; and suspended in 500<span class="elsevierStyleHsp" style=""></span>&#956;l of sterile distilled water&#44; DNA concentration and purification were evaluated by spectrophotometry prior to PCR&#46; Subsequently&#44; the suspension was centrifuged at 14<span class="elsevierStyleHsp" style=""></span>000<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span> for 5<span class="elsevierStyleHsp" style=""></span>min&#46; The amplification program used consisted of an initial denaturation step of 2<span class="elsevierStyleHsp" style=""></span>min at 98<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 30 cycles with 30<span class="elsevierStyleHsp" style=""></span>s at 95<span class="elsevierStyleHsp" style=""></span>&#176;C &#40;for denaturation&#41;&#44; 57<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s and 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 30 s &#40;for annealing and polymerization&#41; to end with a final extension of 2<span class="elsevierStyleHsp" style=""></span>min at 72<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The products were separated on a 1&#46;5&#37; agarose gel in 1&#215; tris&#8211;acetate&#8211;EDTA &#40;TAE&#41; buffer &#40;Thermo Scientific&#8482;&#44; Vilnius&#44; Lithuania&#41; and taken to a 1&#215; TAE buffer electrophoresis chamber at 90<span class="elsevierStyleHsp" style=""></span>V for 60<span class="elsevierStyleHsp" style=""></span>min&#46; DNA visualization after electrophoresis was performed using a UV transilluminator &#40;UVP transilluminator M-20V&#44; Jena&#44; Germany&#41;&#44; after staining the gels for 40<span class="elsevierStyleHsp" style=""></span>min in ethidium bromide &#40;0&#46;5<span class="elsevierStyleHsp" style=""></span>mg&#47;ml&#41;&#46; PCR reactions were carried out in a Multigene Gradient thermocycler &#40;Labnet International Inc&#44; New Jersey&#44; USA&#41; using 15<span class="elsevierStyleHsp" style=""></span>&#956;l of master mix &#40;GoTaq Green Master Mix&#44; Promega&#44; Madison&#44; USA&#41;&#44; forward and reverse primer at a concentration of 1<span class="elsevierStyleHsp" style=""></span>&#956;M and 5<span class="elsevierStyleHsp" style=""></span>&#956;l of DNA template&#46; The <span class="elsevierStyleItalic">S&#46; aureus</span> ATCC 25923 and <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> ATCC 49444 strains were used as reference strains&#46; A list of primers used in this study is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Determination of phenotypic antimicrobial resistance</span><p id="par0065" class="elsevierStylePara elsevierViewall">Phenotypic resistance was determined for all isolated CoPS strains using the agar diffusion method&#44; according to the recommendations of the Clinical and Laboratory Standards Institute documents M100-S-24<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">9</span></a> and VET01-S2<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">8</span></a>&#46; The following panel of antimicrobials was used&#58; oxacillin &#40;1<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; cefoxitin &#40;30<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; amoxicillin&#47;clavulanic acid &#40;20&#47;10<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; gentamicin &#40;10<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; amikacin &#40;30<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; tetracycline &#40;30<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; doxycycline &#40;30<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; enrofloxacin &#40;5<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; ciprofloxacin &#40;5<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; clindamycin &#40;2<span class="elsevierStyleHsp" style=""></span>&#956;g&#41; and erythromycin &#40;15<span class="elsevierStyleHsp" style=""></span>&#956;g&#41; &#40;Oxoid&#44; Hampshire&#44; United Kingdom&#41;&#46; <span class="elsevierStyleItalic">S&#46; aureus</span> ATCC 25923 strain was used as a reference&#46; Methicillin-resistance was evaluated following the CLSI recommendations&#44; considering the different cut off points of the different species&#44; and the oxacillin disk for <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> and cefoxitin disk for <span class="elsevierStyleItalic">S&#46; aureus</span><a class="elsevierStyleCrossRefs" href="#bib0290"><span class="elsevierStyleSup">8&#44;9</span></a>&#46; Additionally&#44; and in order to quantify the level of resistance&#44; the MIC was also determined according to the method standardized by the CLSI<a class="elsevierStyleCrossRefs" href="#bib0290"><span class="elsevierStyleSup">8&#44;9</span></a>&#46; The following antimicrobials were tested&#58; oxacillin&#44; cefoxitin&#44; enrofloxacin&#44; clindamycin&#44; and vancomycin&#46; <span class="elsevierStyleItalic">S&#46; aureus</span> ATCC 29213 was used as the reference strain&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Detection of the <span class="elsevierStyleItalic">mecA</span> gene</span><p id="par0070" class="elsevierStylePara elsevierViewall">The presence of the <span class="elsevierStyleItalic">mecA</span> gene was determined in all the strains through the amplification of an intragenic fragment of this gene by PCR&#44; yielding a product of 519<span class="elsevierStyleHsp" style=""></span>bp&#46; <span class="elsevierStyleItalic">S&#46; aureus</span> ATCC 43300 was used as the reference strain&#46; Subsequently&#44; the same program and method to identify the species was used&#46; The primers used were those described by Ishihara et al&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">20</span></a>&#44; and are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Pulsed field gel electrophoresis &#40;PFGE&#41; typing of the CoPS species&#58;</span><p id="par0075" class="elsevierStylePara elsevierViewall">The genetic relationship among the isolated CoPS was conducted using a macrorestriction assay of the total DNA of each strain with the <span class="elsevierStyleItalic">Sma</span>I enzyme and the restriction fragments were separated by PFGE at Laboratorio de Investigaci&#243;n en Agentes Antibacterianos of the Universidad de Concepci&#243;n&#46; For the genotyping of the strains&#44; we used the PFGE methodology described by the Instituto de Salud P&#250;blica de Chile which is based on the protocol standardized by CDC Canada for PFGE of SAMR<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">28</span></a>&#46; The resulting agarose gel was visualized and photographed in the UVIdoc HD5 photodocumentator &#40;Uvitec&#44; England&#44; United Kingdom&#41;&#46; Fingerprint analysis was performed using the BioNumerics&#174; software v&#46;6&#46;611 &#40;Applied Maths&#41;&#46; The resulting dendrogram was constructed using the unweighted pair group method for arithmetic averages and the Dice band-based similarity coefficient&#46; Isolates were defined as epidemiologically related &#40;same cluster&#41; if they shared &#8805;95&#37; similarity on the dendrogram&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Statistical analysis</span><p id="par0080" class="elsevierStylePara elsevierViewall">The Chi-square test was used to seek differences in the isolated percentages between veterinarians and owners</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Strain identification</span><p id="par0085" class="elsevierStylePara elsevierViewall">A total of 45 CoPS strains were obtained&#58; Eight CoPS strains were obtained from the 24 veterinarians sampled&#44; three strains from 10 hospital surface samples&#44; eight strains from the nasal mucosa of the 40 owners&#44; and 26 from the canines &#40;10 from the nasal mucosa and 16 from the perianal area&#41;&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">Of the 45 strains identified&#44; 18 were <span class="elsevierStyleItalic">S&#46; aureus</span> and 27 were <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#46; In the case of the veterinarians&#44; seven were <span class="elsevierStyleItalic">S&#46; aureus</span> and one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#46; The three strains isolated from hospital surfaces were identified as <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#59; while seven strains from the owners were <span class="elsevierStyleItalic">S&#46; aureus</span> and one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#46; Twenty-two strains isolated from the canines were <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> and 4 were identified as <span class="elsevierStyleItalic">S&#46; aureus</span>&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Determination of phenotypic resistance to antibiotics</span><p id="par0095" class="elsevierStylePara elsevierViewall">Eight &#40;17&#46;8&#37;&#41; of the analyzed strains were susceptible to all tested antimicrobials&#44; and 15 &#40;33&#46;3&#37;&#41; were characterized as multidrug-resistant isolates &#40;resistant to three or more different groups of antibiotics&#41;&#46; Percentages of resistant strains considering both species were 37&#46;8&#37; to erythromycin&#59; 33&#46;3&#37; to clindamycin&#59; 24&#46;4&#37; to enrofloxacin and ciprofloxacin&#59; 17&#46;8&#37; to amoxicillin&#47;clavulanic acid&#59; 15&#46;6&#37; to tetracycline&#59; 13&#46;3&#37; to cefoxitin&#59; and 2&#46;2&#37; to gentamicin&#46; Nine strains &#40;20&#37;&#41; were resistant to oxacillin&#59; six of them were obtained from veterinarians&#59; two from hospitalization cages and one from an owner&#46; The characterization of methicillin-resistant strains is shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The percentages of resistance according to the source&#44; species and methicillin susceptibility are listed in <a class="elsevierStyleCrossRefs" href="#fig0005">Figures 1&#8211;3</a> respectively&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0100" class="elsevierStylePara elsevierViewall">Eleven strains were resistant to oxacillin according to their MIC &#40;&#8805;4<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml for <span class="elsevierStyleItalic">S&#46; aureus</span> and 0&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml for <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; six of them corresponded to strains isolated from the veterinarians &#40;five <span class="elsevierStyleItalic">S&#46; aureus</span>&#44; one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; two from hospitalization cages &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; one from an owner &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41; and two from the canines&#59; these two strains from canines were <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>-negative for the presence of the <span class="elsevierStyleItalic">mecA</span> gene&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">Eight strains were resistant to cefoxitin according to the MIC &#40;&#8805;8<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#44; five of them were isolated from the veterinarians &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41;&#44; two from the owners &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41; and one from a canine &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#46; Regarding enrofloxacin&#44; 14 strains were resistant &#40;MIC<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>4<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#59; six of them were isolated from the veterinarians &#40;five <span class="elsevierStyleItalic">S&#46; aureus</span> and one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; two from hospitalization cages &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; two from the owners &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41; and four from the canines &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#46; Twenty one &#40;21&#41; strains were resistant to clindamycin &#40;MIC<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>4<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#59; six of them were isolated from the veterinarians &#40;five <span class="elsevierStyleItalic">S&#46; aureus</span> and one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; two from hospitalization cages &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41;&#44; three from the owners &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41;&#44; and 10 from the canines &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius&#41;</span>&#59; while two strains isolated from a veterinarian &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41; and a canine &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41; exhibited intermediate sensitivity &#40;MIC 1&#8211;2<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46; Finally&#44; two strains were resistant to vancomycin &#40;MIC<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>32<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#44; both isolated from the owners &#40;<span class="elsevierStyleItalic">S&#46; aureus</span>&#41;&#44; while four strains exhibited intermediate susceptibility &#40;MIC 4&#8211;8<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#44; two from the surfaces &#40;<span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#41; and two from the canines &#40;one of each species&#41;&#46; MIC<span class="elsevierStyleInf">50</span> and MIC<span class="elsevierStyleInf">90</span> results are shown in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Presence of the <span class="elsevierStyleItalic">mecA</span> gene</span><p id="par0110" class="elsevierStylePara elsevierViewall">Eleven strains were positive for the <span class="elsevierStyleItalic">mecA</span> gene &#40;24&#46;4&#37;&#41;&#46; Of these strains&#44; six were obtained from the veterinarians&#44; two from hospital surfaces&#44; two from an owner and one from a canine&#46; All methicillin-resistant strains harbored this gene&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Genotyping of strains by <span class="elsevierStyleItalic">Sma</span>I and PFGE</span><p id="par0115" class="elsevierStylePara elsevierViewall">The PFGE profile &#40;pulsotype&#41; was obtained in 41 of the 45 strains&#46; Four of the strains were not typable by <span class="elsevierStyleItalic">Sma</span>I enzyme digestion and PFGE&#44; even when the electrophoresis was performed with thiourea&#46; The untyped strains corresponded to one strain of <span class="elsevierStyleItalic">S&#46; aureus</span> and three strains of <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#44; all isolated from the canines&#46; Among the pulsotypes identified there was high polyclonal diversity&#44; displaying clonal relationship in two MRSA strains &#40;MV1 and MV2&#41; isolated from the veterinarians and in two <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains &#40;C28 and C30&#41; isolated from the canines &#40;Fig&#46; 1&#44; supplementary material&#41;&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0120" class="elsevierStylePara elsevierViewall">The percentage of isolated CoPS strains&#44; and their susceptibility to methicillin from every source was analyzed&#46; No statistical difference was observed in CoPS isolated from canines&#44; veterinarians and owners&#59; the only statistical difference was obtained with the percentage of methicillin-resistant strains isolated from veterinarians &#40;6&#47;8&#41; and owners &#40;1&#47;8&#41; &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46;</p></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Discussion</span><p id="par0125" class="elsevierStylePara elsevierViewall">Different publications report variable percentages of nasal carriage of <span class="elsevierStyleItalic">Staphylococcus aureus</span> in humans&#44; which vary from 18&#46;5 to 27&#46;7&#37;<a class="elsevierStyleCrossRefs" href="#bib0360"><span class="elsevierStyleSup">22&#44;33</span></a>&#46; In the present study a total of 16 CoPS strains were isolated from the 64 samples obtained from humans &#40;25&#37;&#41;&#46; It should be noted that when separating the percentages obtained from owners and veterinarians&#44; there was no statistical difference &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;35&#41;&#44; in agreement with Kottler et al&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">24</span></a>&#44; who found no differences between the general population and people associated with health careers in terms of percentage of isolation of CoPS strains&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Two <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> human carriers were found in the present study&#46; To our knowledge&#44; this is the first national study documenting the carriage of this species in humans&#46; Although this bacterium is adapted to living in animals&#44; it is documented that <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> has some properties that make possible the presence of this microorganism in human skin&#59; in fact&#44; Latronico et al&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">25</span></a>&#44; describes a particular sequence type &#40;ST-71&#41; that adheres to the human corneocyte with the same ease as to the canine corneocyte&#46; In general&#44; the isolation percentages of this species in humans are low&#59; however&#44; the most modern and precise identification methods are likely to generate an increase in the number of cases of strains isolated from humans<a class="elsevierStyleCrossRef" href="#bib0460"><span class="elsevierStyleSup">42</span></a>&#44; because&#44; given its biochemical similarity&#44; it can be misidentified as <span class="elsevierStyleItalic">S&#46; aureus</span><a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">7</span></a>&#46; This is particularly important in methicillin-resistant strains&#44; where interpretation criteria and MICs defined for <span class="elsevierStyleItalic">S&#46; aureus</span> can lead to MRSP isolates being defined as susceptible<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">7</span></a>&#46; Nevertheless&#44; transmission of mobile genetic elements such as SCC<span class="elsevierStyleItalic">mec</span> or other resistance determinants from <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> to other <span class="elsevierStyleItalic">Staphylococcus</span> species has been previously reported<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">34</span></a>&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Regarding canines&#44; CoPS strains were isolated from 26 of the 40 patients sampled &#40;65&#37;&#41;&#44; a percentage lower than that described by Mu&#241;oz et al&#46;<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">32</span></a>&#44; who reported 71&#46;3&#37;&#44; despite analyzing only animals with skin conditions&#46; In total&#44; 26 strains were obtained&#44; 10 from nasal cultures and 16 from the perianal area&#44; in agreement with Hanselman et al&#46;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">17</span></a>&#44; who reported that perianal colonization was significantly more common than nasal colonization&#46; Of the strains isolated from canines&#44; 22 &#40;84&#46;6&#37;&#41; corresponded to <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> and 4 &#40;15&#46;4&#37;&#41; to <span class="elsevierStyleItalic">S&#46; aureus</span>&#44; which is expected because the dog is the natural reservoir of <span class="elsevierStyleItalic">S&#46; pseudintermedius</span><a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">26</span></a>&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">With respect to <span class="elsevierStyleItalic">S&#46; aureus</span> strains&#44; the resistance to erythromycin is 38&#46;9&#37;&#44; similar to that described by Rahman et al&#46;<a class="elsevierStyleCrossRef" href="#bib0430"><span class="elsevierStyleSup">36</span></a>&#44; while for <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains&#44; resistance was detected in 37&#37; of the strains &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#44; similar to that described by Vigo et al&#46;<a class="elsevierStyleCrossRef" href="#bib0480"><span class="elsevierStyleSup">46</span></a>&#44; and Gr&#246;ntal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">16</span></a>&#44; who described 39&#46;3 and 30&#46;5&#37; of resistance&#44; respectively&#46; The slightly higher percentage of resistance in <span class="elsevierStyleItalic">S&#46; aureus</span> may be explained by the limited use of this drug in the veterinary clinical practice in Chile<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">13</span></a>&#46; In fact&#44; Awosile et al&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">4</span></a>&#44; described that erythromycin resistance is decreasing over time for CoPS isolated from dogs and Rumi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">39</span></a>&#44; described a clear resistance increment to erythromycin in <span class="elsevierStyleItalic">S&#46; aureus</span>&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">With regard to clindamycin&#44; 33&#46;3&#37; of the strains were resistant&#44; which acquires great relevance when considering the publication by Hillier et al&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">18</span></a> that describes clindamycin as one of the first-tier antibiotics for the treatment of canine pyoderma&#44; which is caused in the majority of cases by <span class="elsevierStyleItalic">S&#46; pseudintermedius</span><a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">26</span></a>&#44; demonstrating the importance of analyzing the behavior of these strains at a local level to establish the best treatment strategy&#46; In this context&#44; Vigo et al&#46;<a class="elsevierStyleCrossRef" href="#bib0480"><span class="elsevierStyleSup">46</span></a>&#44; stated that clindamycin should be empirically avoided and Rumi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">39</span></a>&#44; described more than 40&#37; resistance in <span class="elsevierStyleItalic">Staphylococcus</span> spp&#46; Therefore&#44; it is necessary to consider other treatment alternatives&#44; such as topical chlorhexidine therapies&#44; to avoid systemic antimicrobial therapy and decrease the emergence of methicillin-resistant strains that unnecessarily lengthen therapy<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">6</span></a>&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">When considering resistance to fluoroquinolones by species&#44; a higher percentage of resistance was found in <span class="elsevierStyleItalic">S&#46; aureus</span> strains versus <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; Even though there is not a clear explanation of this&#44; it agrees with the literature<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">9</span></a>&#44; although a growing fluoroquinolone resistance rate was observed in <span class="elsevierStyleItalic">Staphylococcus</span> spp&#46; recovered mainly from skin and ear samples in companion animals in Argentina<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">39</span></a>&#46;</p><p id="par0155" class="elsevierStylePara elsevierViewall">With regard to cephalosporins&#44; 13&#46;3&#37; of the strains showed resistance to cefoxitin considering both species&#46; It should be noted that none of the strains isolated from canines exhibited resistance &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#44; which differs from Saputra et al&#46;&#8217;s study<a class="elsevierStyleCrossRef" href="#bib0450"><span class="elsevierStyleSup">40</span></a> that reported 12&#37; resistance against cefoxitin&#46; This difference can be explained by the number of strains analyzed in that study&#44; which was highly superior to those in the present study &#40;888 strains versus 45&#41;&#59; therefore&#44; it is likely that if the number of strains studied is increased the resistance percentages may change&#46;</p><p id="par0160" class="elsevierStylePara elsevierViewall">With respect to tetracycline&#44; 15&#46;6&#37; of the CoPS strains were resistant&#46; It is important to consider that no <span class="elsevierStyleItalic">S&#46; aureus</span> strains exhibited resistance&#59; however&#44; 25&#46;9&#37; of <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains were resistant &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; Moreover&#44; Saputra et al&#46;<a class="elsevierStyleCrossRef" href="#bib0450"><span class="elsevierStyleSup">40</span></a>&#44; and Gr&#246;ntal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">14</span></a>&#44; reported higher percentages of resistance of <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> versus <span class="elsevierStyleItalic">S&#46; aureus</span>&#44; probably due to the more frequent use of this drug in veterinary settings<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">5</span></a>&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">No resistance was found to doxycycline and amikacin and a lower percentage of resistant strains was found to gentamicin &#40;2&#46;2&#37;&#41;&#44; which coincides with that described by Gr&#246;ntal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">16</span></a>&#44; who reported low levels of resistance against doxycycline &#40;6&#46;1&#37;&#41;&#44; amikacin &#40;0&#37;&#41; and gentamicin &#40;6&#46;6&#37;&#41;&#46; This low percentage of resistance against gentamicin was also reported by Ventrella et al&#46;<a class="elsevierStyleCrossRef" href="#bib0475"><span class="elsevierStyleSup">45</span></a>&#44; who explained it by the limited use of this aminoglycoside due to its high toxicity&#44; which is also valid for doxycycline and amikacin<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">13</span></a>&#46; Additionally&#44; Rumi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">39</span></a> reported that resistance to amikacin never exceeded 1&#37; in <span class="elsevierStyleItalic">Staphylococcus</span> isolated from companion animals&#46;</p><p id="par0170" class="elsevierStylePara elsevierViewall">Regarding phenotypic susceptibility against oxacillin&#44; nine methicillin-resistant strains were found &#40;20&#37;&#41;&#44; all of them harboring the <span class="elsevierStyleItalic">mecA</span> gene&#46; Two other strains&#44; which showed phenotypic susceptibility to oxacillin&#44; were also carriers of this gene &#40;one strain of <span class="elsevierStyleItalic">S&#46; aureus</span> isolated from an owner and a <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> from a canine&#41;&#44; which could be explained by the lack of the promoter or other sequences that allow its expression<a class="elsevierStyleCrossRef" href="#bib0495"><span class="elsevierStyleSup">49</span></a>&#46; This phenomenon of <span class="elsevierStyleItalic">mecA</span>-harboring strains and susceptible to oxacillin was already described in Chile in strains isolated from cats<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">14</span></a>&#46; When considering their MICs&#44; it should be noted that two strains from canines that were susceptible to oxacillin by the agar diffusion test were resistant by MIC&#59; however&#44; these strains did not carry the <span class="elsevierStyleItalic">mecA</span> gene and were susceptible to other &#946;-lactams&#44; thus were considered methicillin-susceptible and probably hyperproducers of beta-lactamases strains<a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">30</span></a>&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">Of the eight strains isolated from veterinarians&#44; six were MRS &#40;75&#37;&#41;&#44; which is statistically different from the 12&#46;5&#37; of methicillin-resistant strains isolated from owners &#40;<span class="elsevierStyleItalic">p<span class="elsevierStyleHsp" style=""></span></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46; This agrees with Rodrigues et al&#46;<a class="elsevierStyleCrossRef" href="#bib0435"><span class="elsevierStyleSup">37</span></a>&#59; Pomba et al&#46;<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">34</span></a>&#44; and Kottler et al&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">24</span></a>&#44; who established that carrying methicillin-resistant strains could be considered an occupational risk&#46; Regarding <span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&#44; we found one veterinarian carrying a methicillin-resistant strain&#44; which represents 4&#46;1&#37; of all the veterinarians sampled&#44; similar to that reported by Febler et al&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">11</span></a>&#44; who described 3&#46;6&#37; of veterinary personnel carrying MRSP strains&#46; No MRSP strains were isolated from owners&#44; in accordance with G&#243;mez-Sanz et al&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">15</span></a>&#44; who did not find any MRSP from 67 owners&#44; and to the review published by Pomba et al&#46;<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">34</span></a>&#44; who described that colonization of MRSP in humans seems to be rare and transient&#46; This is the first report in Chile of a human harboring MRSP&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">Regarding the 10 hospital surfaces sampled&#44; two MRSP were found&#44; both from hospitalization cages&#44; highlighting the importance of the environment in the possible transmission of these strains between humans and pets&#46; In fact&#44; Hogan et al&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">19</span></a>&#44; asserted that the search for MRS strains exclusively in humans is inadequate&#44; since the environment is increasingly recognized as a reservoir of these strains&#46;</p><p id="par0185" class="elsevierStylePara elsevierViewall">The results obtained confirmed that the cefoxitin disk is not a good predictor of the presence of the gene in <span class="elsevierStyleItalic">S&#46; pseudointermedius</span> strains&#44; since the three strains of <span class="elsevierStyleItalic">S&#46; pseudointermedius</span> that carry the <span class="elsevierStyleItalic">mecA</span> gene and are phenotypically resistant to oxacillin are susceptible to cefoxitin&#44; which has been widely described in the literature<a class="elsevierStyleCrossRefs" href="#bib0285"><span class="elsevierStyleSup">7&#8211;9</span></a>&#46;</p><p id="par0190" class="elsevierStylePara elsevierViewall">We did not isolate any MRS from canines&#44; which is in line with the publication of Katakweba et al&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">22</span></a> This accounts for less than the 2&#46;6&#37; described by Kjellman et al&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">23</span></a> &#40;2015&#41; in Norway&#59; 6&#46;5&#37; described by Menandro et al&#46;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">31</span></a> in Italy&#59; and 11&#46;7&#37; described by Couto et al&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">10</span></a> in Portugal&#44; which could be explained by geographic differences&#44; although it must be noted that these studies consider a much higher number of isolates than the 45 strains analyzed in the present study&#46; Another important factor is that this study includes only healthy dogs&#44; and the percentage of methicillin-resistance carriage is higher in patients that have chronic skin diseases<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">34</span></a>&#59; therefore&#44; it is relevant to consider diseased animals in future studies&#46; In fact&#44; in the aforementioned studies&#44; Kjellman et al&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">23</span></a>&#44; who only considered healthy animals&#44; described a lower percentage of MRS isolation compared to the studies conducted by Menandro et al&#46;<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">31</span></a>&#44; and Couto et al&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">10</span></a>&#44; which only considered animals with skin conditions&#46;</p><p id="par0195" class="elsevierStylePara elsevierViewall">Regarding the percentages of drug resistance profiles of the CoPS strains&#44; these are much higher in methicillin-resistant strains versus methicillin-susceptible strains to non-&#946;-lactamic antibiotics in both species analyzed&#44; as reported by Gr&#246;ntal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">16</span></a>&#44; and Ventrella et al&#46;<a class="elsevierStyleCrossRef" href="#bib0475"><span class="elsevierStyleSup">45</span></a>&#44; highlighting 100&#37; resistance against ceftriaxone&#44; enrofloxacin&#44; ciprofloxacin&#44; clindamycin and erythromycin in the present study &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; It should be noted that all the methicillin-resistant strains analyzed here were susceptible to amikacin&#44; doxycycline and gentamicin&#46;</p><p id="par0200" class="elsevierStylePara elsevierViewall">When analyzing the vancomycin MICs&#44; we found 2 resistant strains &#40;both <span class="elsevierStyleItalic">S&#46; aureus</span> methicillin-sensitive isolated from owners&#41; and 4 other strains with intermediate susceptibility &#40;2 MRSP isolated from surfaces and one <span class="elsevierStyleItalic">S&#46; aureus</span> and one <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> isolated from canines&#44; both methicillin sensitive&#41;&#46; This finding needs to be analyzed in depth&#44; but it will remain for further analysis&#44; highlighting the great relevance that this phenomenon would have&#44; since until now vancomycin resistance in <span class="elsevierStyleItalic">Staphylococcus</span> has not been described in our country&#44; except for one publication that reported heteroresistance in humans<a class="elsevierStyleCrossRef" href="#bib0470"><span class="elsevierStyleSup">44</span></a>&#59; therefore&#44; it is still considered the first treatment alternative in cases of MRS in human medicine in Chile<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">29</span></a>&#46;</p><p id="par0205" class="elsevierStylePara elsevierViewall">In this study&#44; the PFGE profile of 41 strains was obtained&#46; As in our study&#44; Kadlec et al&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">21</span></a> also reported that it was not possible to determine the PFGE profiles of various <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains&#46; In the mentioned study&#44; it was possible to determine the pulsotypes of the strains using the <span class="elsevierStyleItalic">Apa</span>I enzyme&#44; which could not be done in the present study&#46; The identified strains showed great pulsotype diversity&#44; clonality was found in two strains of MRSA isolated from veterinarians and in two strains of <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> isolated from canines&#46; This phenomenon of clonal diversity agrees with that published by Gagetti et al&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">12</span></a>&#44; in <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains isolated from ill canines and by Kjellman et al&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">23</span></a>&#44; in <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> strains from healthy canines&#46; Due to the aforementioned clonal diversity&#44; it is not possible to infer transmission of these strains between humans and pets&#59; however&#44; it is possible to find clones by increasing the number of strains analyzed&#44; as described by Kotler et al&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">24</span></a>&#44; who analyzed 586 <span class="elsevierStyleItalic">S&#46; aureus</span> strains and found 4 MRSA strains with indistinguishable strains in owners and their pets&#46;</p><p id="par0210" class="elsevierStylePara elsevierViewall">The main constraint of the present study is the limited number of strains analyzed&#46; The samples were taken to work with 50 strains&#44; and studies with more strains are needed to evaluate clindamycin resistance in a more representative manner&#46; It was not possible to use the <span class="elsevierStyleItalic">ApaI</span> enzyme for a better characterization of all strains isolated<span class="elsevierStyleItalic">&#46;</span> Furthermore&#44; there have been more accurate methods for surface samples published after this study<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">2</span></a>&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Conclusion</span><p id="par0215" class="elsevierStylePara elsevierViewall">This study suggests that veterinarians are at high risk of harboring methicillin-resistant CoPS and provides evidence that clindamycin may not be a good alternative for CoPS in the analyzed hospital&#44; although more studies are needed in this area for better understanding the resistant dynamic in CoPS in Chile&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Conflict of interest</span><p id="par0220" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres1777036"
          "titulo" => "Highlights"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:3 [
          "identificador" => "xres1777037"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0010"
            ]
          ]
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1560246"
          "titulo" => "Keywords"
        ]
        3 => array:3 [
          "identificador" => "xres1777035"
          "titulo" => "Resumen"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0015"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1560245"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        6 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Regulatory approvals"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Sampling"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Molecular identification of the Staphylococcus species"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Determination of phenotypic antimicrobial resistance"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Detection of the mecA gene"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Pulsed field gel electrophoresis &#40;PFGE&#41; typing of the CoPS species&#58;"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0050"
          "titulo" => "Results"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Strain identification"
            ]
            1 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Determination of phenotypic resistance to antibiotics"
            ]
            2 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Presence of the mecA gene"
            ]
            3 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Genotyping of strains by SmaI and PFGE"
            ]
            4 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Conclusion"
        ]
        10 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Conflict of interest"
        ]
        11 => array:2 [
          "identificador" => "xack627964"
          "titulo" => "Acknowledgements"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2021-03-31"
    "fechaAceptado" => "2021-12-02"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1560246"
          "palabras" => array:4 [
            0 => "Antimicrobial resistance"
            1 => "Methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span>"
            2 => "Methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span>"
            3 => "Pets"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1560245"
          "palabras" => array:4 [
            0 => "Resistencia antimicrobiana"
            1 => "<span class="elsevierStyleItalic">Staphylococcus aureus</span> meticilino-resistente"
            2 => "<span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> meticilino-resistente"
            3 => "Mascotas"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "highlights" => array:2 [
      "titulo" => "Highlights"
      "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8226;</span><p id="par0005" class="elsevierStylePara elsevierViewall">Carriage of MRS strains is statistically higher in veterinarians than in owners&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#8226;</span><p id="par0010" class="elsevierStylePara elsevierViewall">An important percentage of the strains was resistant to clindamycin&#46;</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#8226;</span><p id="par0015" class="elsevierStylePara elsevierViewall">This is the first report describing humans carrying MRSP in Chile&#46;</p></li></ul></p></span>"
    ]
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">There is limited information about the prevalence and antimicrobial susceptibility of coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span> &#40;CoPS&#41; strains in veterinary settings in Chile&#46; The aim of this observational study was to identify and characterize CoPS strains from dogs&#44; owners&#44; veterinary professionals and surfaces in a veterinary teaching hospital at Universidad de Chile to determine the presence of methicillin-resistant strains and evaluate the genetic relationship among the strains&#46; Veterinarians &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&#44; surfaces &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#41;&#44; and healthy dogs &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41; and their respective owners &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41; were sampled for CoPS&#46; Isolates were identified by PCR and antimicrobial susceptibility was assessed by the disk diffusion method and MIC&#46; The presence of the <span class="elsevierStyleItalic">mecA</span> gene was evaluated by PCR&#44; and the genetic relationship among the strains was established by PFGE&#46; A total of 45 CoPS strains were obtained&#44; eight from veterinary professionals&#44; three from hospital surfaces&#44; eight from owners and 26 from dogs&#46; Nine of the strains were resistant to methicillin &#40;20&#37;&#41;&#44; and all of them carried the <span class="elsevierStyleItalic">mecA</span> gene&#46; A high percentage of the strains was resistant to clindamycin &#40;33&#46;3&#37;&#41;&#46; Additionally&#44; the isolated CoPS showed high genetic diversity&#46; This study suggests that veterinarians are in high risk of harboring methicillin-resistant CoPS &#40;25&#37; versus 2&#46;5&#37; from owners&#41; and our results provide evidence that clindamycin could not be an empiric alternative for CoPS in the analyzed hospital&#46; This is the first report of methicillin-resistant CoPS in veterinary settings in Chile&#44; considering humans&#44; pets and surfaces&#46;</p></span>"
      ]
      "es" => array:2 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0015" class="elsevierStyleSection elsevierViewall"><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Existe informaci&#243;n limitada sobre prevalencia y sensibilidad antimicrobiana de cepas de <span class="elsevierStyleItalic">Staphylococcus</span> coagulasa-positivas &#40;CoPS&#41; en entornos veterinarios en Chile&#46; El objetivo de este estudio observacional fue identificar y caracterizar cepas CoPS de perros&#44; due&#241;os&#44; veterinarios y superficies de un hospital veterinario de la Universidad de Chile&#44; determinar la presencia de cepas meticilino-resistentes y evaluar la relaci&#243;n gen&#233;tica entre las cepas&#46; Se colectaron muestras de veterinarios &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>24&#41;&#44; de superficies hospitalarias &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#41; y de perros sanos &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41; y sus respectivos due&#241;os &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>40&#41;&#46; Los aislamientos se identificaron mediante PCR y la sensibilidad antimicrobiana se evalu&#243; por difusi&#243;n en discos y CIM&#46; Tambi&#233;n se emple&#243; PCR para detectar la presencia del gen <span class="elsevierStyleItalic">mecA</span>&#59; la relaci&#243;n gen&#233;tica entre las cepas se estableci&#243; mediante electroforesis de campos pulsantes &#40;PFGE&#41;&#46; Se obtuvo un total de 45 cepas de CoPS&#44; 8 de veterinarios&#44; 3 de superficies hospitalarias&#44; 8 de due&#241;os y 26 de perros&#46; Nueve cepas fueron meticilino-resistentes &#40;20&#37;&#41;&#44; todas portadoras del gen <span class="elsevierStyleItalic">mecA</span>&#46; Un porcentaje importante de cepas fue resistente a clindamicina &#40;33&#44;3&#37;&#41;&#46; Adem&#225;s&#44; las cepas aisladas mostraron una alta diversidad gen&#233;tica&#46; Este estudio sugiere que los veterinarios tienen alto riesgo de portar CoPS resistentes a meticilina &#40;25&#37; versus 2&#44;5&#37; propietarios&#41;&#46; Asimismo&#44; nuestros resultados proporcionan evidencia de que la clindamicina podr&#237;a no ser una alternativa emp&#237;rica para CoPS en el hospital analizado&#46; Este es el primer estudio de CoPS meticilino-resistentes en entornos veterinarios en Chile que considera humanos&#44; mascotas y superficies&#46;</p></span>"
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0240" class="elsevierStylePara elsevierViewall">The following are the supplementary data to this article&#58;<elsevierMultimedia ident="upi0005"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0105"
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1558
            "Ancho" => 2500
            "Tamanyo" => 189259
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Percentages of resistance of CoPS strains isolated from a teaching veterinary hospital to the different antimicrobials tested according the source&#46; OXA&#58; oxacillin&#59; FOX&#58; cefoxitin&#59; AMC&#58; amoxicillin&#47;clavulanic acid&#59; ENR&#58; enrofloxacin&#59; CIP&#58; ciprofloxacin&#59; GEN&#58; gentamicin&#59; AMK&#58; amikacin&#59; TET&#58; tetracycline&#59; DOX&#58; doxycycline&#59; CLI&#58; clindamycin&#59; ERY&#58; erythromycin&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1102
            "Ancho" => 2500
            "Tamanyo" => 105361
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Percentages of resistance of CoPS isolated from a teaching veterinary hospital according the species of <span class="elsevierStyleItalic">Staphylococcus</span>&#46; OXA&#58; oxacillin&#59; FOX&#58; cefoxitin&#59; AMC&#58; amoxicillin&#47;clavulanic acid&#59; ENR&#58; enrofloxacin&#59; CIP&#58; ciprofloxacin&#59; GEN&#58; gentamicin&#59; AMK&#58; Amikacin&#59; TET&#58; tetracycline&#59; DOX&#58; doxycycline&#59; CLI&#58; clindamycin&#59; ERY&#58; erythromycin&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1380
            "Ancho" => 2508
            "Tamanyo" => 129739
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Percentages of resistance of CoPS isolated from a teaching veterinary hospital according methicillin susceptibility&#46; OXA&#58; oxacillin&#59; FOX&#58; cefoxitin&#59; AMC&#58; amoxicillin&#47;clavulanic acid&#59; ENR&#58; enrofloxacin&#59; CIP&#58; ciprofloxacin&#59; GEN&#58; gentamicin&#59; AMK&#58; Amikacina&#59; TET&#58; tetracycline&#59; DOX&#58; doxycycline&#59; CLI&#58; clindamycin&#59; ERY&#58; erythromycin&#59; MR-CoPS&#58; Methicillin-resistance coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span>&#59; MS-CoPS&#58; Methicillin-sensitive coagulase-positive <span class="elsevierStyleItalic">Staphylococcus</span>&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Target species or gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence &#40;5&#8242;<span class="elsevierStyleHsp" style=""></span>&#8594;<span class="elsevierStyleHsp" style=""></span>3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Molecular weight &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">au-F3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCGCTTGCTATGATTGTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">359&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sasaki et al&#46; &#40;2010&#41;</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">au-nucR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCAATGTTCTACCATAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; pseudintermedius</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">pse-F2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGGCAGTAGGATTCGTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">926&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sasaki et al&#46; &#40;2010&#41;</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">pse-R5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTTTGTGCTTCCTTTTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">mecA</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">mecA1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTCCGTAACCTGAATCAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">519&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ishihara et al&#46; &#40;2010&#41;</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">mecA2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCTATCCACCCTCAAACAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">List of the primers used for species identification and detection of the <span class="elsevierStyleItalic">mecA</span> gene&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">V&#58; Veterinarian&#59; S&#58; surfaces&#59; O&#58; owner&#59; OXA&#58; oxacillin&#59; ENR&#58; enrofloxacin&#59; CIP&#58; ciprofloxacin&#59; ERI&#58; erytromicin&#59; FOX&#58; cefoxitin&#59; AMC&#58; amoxicillin&#47;cavulanic acid&#59; CLI&#58; clyndamicin&#59; KB&#58; Kirby&#8211;Bauer&#59; CIM&#58; Minimal Inhibitory Concentration&#59; R&#58; resistant&#59; S&#58; susceptible&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">ID&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Source&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Species&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleItalic">mecA</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Resistant profile&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Oxacillin</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cefoxitin</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">KB &#40;mm&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CIM &#40;&#956;g&#47;ml&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">KB &#40;mm&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CIM &#40;&#956;g&#47;ml&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI DOX AMC CLI TET&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#62;64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MV 21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">V&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Equi 9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#62;64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Equi 10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; pseudintermedius</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI DOX AMC CLI TET&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#62;64&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#47;S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Prop 36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">O&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">S&#46; aureus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OXA ENR CIP ERI FOX AMC CLI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#47;R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Characteristic of methicillin-resistant strains isolates from veterinary settings in Chile&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Species&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="3" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">S&#46; aureus</span> &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>18&#41;</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="3" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">S&#46; pseudintermedius</span> &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>27&#41;</th></tr><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Antimicrobials&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="6" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC &#40;&#956;g&#47;ml&#41;</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC<span class="elsevierStyleInf">50</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC<span class="elsevierStyleInf">90</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC<span class="elsevierStyleInf">50</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">MIC<span class="elsevierStyleInf">90</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Oxacillin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;&#62;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;&#62;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cefoxitin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#8211;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&#8211;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Enrofloxacin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Clindamycin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;25&#8211;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Vancomycin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#8211;&#62;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#8211;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Minimal Inhibitory Concentration &#40;MIC&#41; of CoPS isolated from a veterinary teaching hospital against antimicrobial agents&#46;</p>"
        ]
      ]
      6 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc1.pdf"
          "ficheroTamanyo" => 152328
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:50 [
            0 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bases moleculares de la resistencia a meticilina en <span class="elsevierStyleItalic">Staphylococcus aureus</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "A&#46; Aguayo-Reyes"
                            1 => "M&#46; Quezada-Aguiluz"
                            2 => "S&#46; Mella"
                            3 => "G&#46; Riedel"
                            4 => "A&#46; Opazo-Capurro"
                            5 => "H&#46; Bello-Toledo"
                            6 => "M&#46; Dominguez"
                            7 => "G&#46; Gonzalez-Rocha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4067/s0716-10182018000100007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Chilena Infectol"
                        "fecha" => "2018"
                        "volumen" => "35"
                        "paginaInicial" => "7"
                        "paginaFinal" => "14"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29652966"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of different screening methodologies for the detection of methicillin-resistant Staphylococcus aureus from environmental surfaces&#58; swabs&#44; gauzes&#44; and polywipes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Aires de Souza"
                            1 => "S&#46; Rodrigues"
                            2 => "T&#46; Conceicao"
                            3 => "H&#46; Lencastre"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/mdr.2017.0349"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microb Drug Resist"
                        "fecha" => "2018"
                        "volumen" => "24"
                        "paginaInicial" => "585"
                        "paginaFinal" => "589"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29653476"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Economic features of antibiotic resistance&#58; the case of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "F&#46; Antonanzas"
                            1 => "C&#46; Lozano"
                            2 => "C&#46; Torres"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Pharmacoecon Open"
                        "fecha" => "2014"
                        "volumen" => "33"
                        "paginaInicial" => "285"
                        "paginaFinal" => "325"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial resistance in bacteria isolated from cats dogs from the Atlantic Provinces&#44; Canada from 1994&#8211;2013"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46; Awosile"
                            1 => "T&#46; McClure"
                            2 => "M&#46; Saab"
                            3 => "L&#46; Heider"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Can Vet J"
                        "fecha" => "2018"
                        "volumen" => "59"
                        "paginaInicial" => "885"
                        "paginaFinal" => "893"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30104781"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Carriage rate antibiotic susceptibility of coagulase-positive staphylococci isolated from healthy dogs in Victoria&#44; Australia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Bean"
                            1 => "S&#46; Wigmore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/avj.12528"
                      "Revista" => array:6 [
                        "tituloSerie" => "Aust Vet J"
                        "fecha" => "2016"
                        "volumen" => "94"
                        "paginaInicial" => "456"
                        "paginaFinal" => "460"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27804112"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effectiveness of a combined &#40;4&#37; chlorhexidine digluconate shampoo and solution&#41; protocol in MRS and non-MRS canine superficial pyoderma&#58; a randomized&#44; blinded&#44; antibiotic-controlled study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46; Borio"
                            1 => "S&#46; Colombo"
                            2 => "G&#46; La Rosa"
                            3 => "M&#46; De Lucia"
                            4 => "P&#46; Damborg"
                            5 => "L&#46; Guardabassi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/vde.12233"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Dermatol"
                        "fecha" => "2015"
                        "volumen" => "26"
                        "paginaInicial" => "339"
                        "paginaFinal" => "344"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26140535"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> can be misdiagnosed as <span class="elsevierStyleItalic">Staphylococcus aureus</span> in humans with dog bite wounds"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; B&#246;rjesson"
                            1 => "E&#46; G&#243;mez-Sanz"
                            2 => "K&#46; Ekstr&#246;m"
                            3 => "C&#46; Torres"
                            4 => "U&#46; Gr&#246;nlund"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10096-014-2300-y"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Clin Microbiol Infect Dis"
                        "fecha" => "2014"
                        "volumen" => "34"
                        "paginaInicial" => "839"
                        "paginaFinal" => "844"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25532507"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Performance Standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from Animals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "CLSI"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "edicion" => "3rd ed&#46; CLSI supplement VET01S"
                        "fecha" => "2015"
                        "editorial" => "Clinical and Laboratory Standards Institute"
                        "editorialLocalizacion" => "Wayne &#40;PA&#41;"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "CLSI&#46; <span class="elsevierStyleItalic">Performance standards for antimicrobial susceptibility testing</span>&#44; 28th ed&#46; CLSI supplement M100&#46; Wayne &#40;PA&#41;&#58; Clinical and Laboratory Standards Institute&#46;"
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Trends and molecular mechanisms of antimicrobial resistance in clinical staphylococci isolated from companion animals over a 16-year period"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Couto"
                            1 => "C&#46; Monchique"
                            2 => "A&#46; Belas"
                            3 => "C&#46; Marques"
                            4 => "L&#46; Gama"
                            5 => "C&#46; Pomba"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jac/dkw029"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Antimicrob Chemother"
                        "fecha" => "2016"
                        "volumen" => "71"
                        "paginaInicial" => "1479"
                        "paginaFinal" => "1487"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26944924"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> &#40;MRSA&#41; and methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> &#40;MRSP&#41; among employees and in the environment of a small animal hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:9 [
                            0 => "T&#46; Fe&#223;ler"
                            1 => "R&#46; Schuenemann"
                            2 => "K&#46; Kadlec"
                            3 => "V&#46; Hensel"
                            4 => "J&#46; Brombach"
                            5 => "J&#46; Murugaiyan"
                            6 => "G&#46; Oechtering"
                            7 => "I&#46; Burgener"
                            8 => "S&#46; Schwarz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2018.06.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2018"
                        "volumen" => "221"
                        "paginaInicial" => "153"
                        "paginaFinal" => "158"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29981702"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification and molecular epidemiology of methicillin resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> strains isolated from canine clinical samples in Argentina"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "P&#46; Gagetti"
                            1 => "A&#46; Wattam"
                            2 => "G&#46; Giacoboni"
                            3 => "A&#46; De Paulis"
                            4 => "E&#46; Bertona"
                            5 => "A&#46; Corso"
                            6 => "A&#46; Rosato"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12917-019-1990-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMC Vet Res"
                        "fecha" => "2019"
                        "volumen" => "15"
                        "paginaInicial" => "264"
                        "paginaFinal" => "276"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31351494"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial use in companion animals&#58; assessing veterinarians&#8217; prescription patterns through the first national survey in Chile"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Galarce"
                            1 => "G&#46; Arriagada"
                            2 => "F&#46; S&#225;nchez"
                            3 => "V&#46; Venegas"
                            4 => "J&#46; Cornejo"
                            5 => "L&#46; Lapierre"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ani11020348"
                      "Revista" => array:6 [
                        "tituloSerie" => "Animals"
                        "fecha" => "2021"
                        "volumen" => "11"
                        "paginaInicial" => "348"
                        "paginaFinal" => "361"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33573203"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detecci&#243;n del gen <span class="elsevierStyleItalic">mecA</span> en cepas de <span class="elsevierStyleItalic">Syaphylococcus</span> coagulasa positiva aisladas desde gatos"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Galarce"
                            1 => "L&#46; Mu&#241;oz"
                            2 => "M&#46; Jara"
                            3 => "P&#46; Lub&#237;"
                            4 => "A&#46; Sep&#250;lveda"
                            5 => "S&#46; Anticevic"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4067/S0716-10182016000400005"
                      "Revista" => array:7 [
                        "tituloSerie" => "Rev Chilena Infectol"
                        "fecha" => "2016"
                        "volumen" => "33"
                        "paginaInicial" => "410"
                        "paginaFinal" => "418"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27905624"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0016508512005094"
                          "estado" => "S300"
                          "issn" => "00165085"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "High diversity of <span class="elsevierStyleItalic">Staphylococcus aureus</span> and <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> lineages and toxigenic traits in healthy pet-owning household members Underestimating normal household contact&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "E&#46; G&#243;mez-Sanz"
                            1 => "C&#46; Torres"
                            2 => "C&#46; Lozano"
                            3 => "M&#46; Zarazaga"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Comp Immunol Microbiol Infect Dis"
                        "fecha" => "2013"
                        "volumen" => "36"
                        "paginaInicial" => "83"
                        "paginaFinal" => "94"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial resistance in <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> and the molecular epidemiology of methicillin-resistant <span class="elsevierStyleItalic">S&#46; pseudintermedius</span> in small animals in Finland"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "T&#46; Gr&#246;ntal"
                            1 => "M&#46; Eklund"
                            2 => "K&#46; Thomsom"
                            3 => "H&#46; Piiparinen"
                            4 => "T&#46; Sironen"
                            5 => "M&#46; Rantala"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jac/dkw559"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Antimicrob Chemother"
                        "fecha" => "2017"
                        "volumen" => "72"
                        "paginaInicial" => "1021"
                        "paginaFinal" => "1030"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28065889"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Coagulase positive staphylococcal colonization of humans their household pets"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46; Hanselman"
                            1 => "S&#46; Kruth"
                            2 => "J&#46; Rousseau"
                            3 => "S&#46; Wesse"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Can Vet J"
                        "fecha" => "2009"
                        "volumen" => "50"
                        "paginaInicial" => "954"
                        "paginaFinal" => "958"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19949556"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:1 [
                      "autores" => array:1 [
                        0 => array:3 [
                          "colaboracion" => "Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis &#40;Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases&#41;"
                          "etal" => false
                          "autores" => array:11 [
                            0 => "A&#46; Hillier"
                            1 => "D&#46; Lloyd"
                            2 => "J&#46; Weese"
                            3 => "J&#46; Blondeau"
                            4 => "D&#46; Boothe"
                            5 => "E&#46; Breitschwerdt"
                            6 => "L&#46; Guardabassi"
                            7 => "M&#46; Papich"
                            8 => "S&#46; Rankin"
                            9 => "J&#46; Turnidge"
                            10 => "J&#46; Sikes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/vde.12118"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Dermatol"
                        "fecha" => "2014"
                        "volumen" => "25"
                        "paginaInicial" => "163"
                        "paginaFinal" => "175"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24720433"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interplay of personal&#44; pet&#44; and environmental colonization in households affected by community-associated methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:14 [
                            0 => "P&#46; Hogan"
                            1 => "R&#46; Mork"
                            2 => "M&#46; Boyle"
                            3 => "C&#46; Muenks"
                            4 => "J&#46; Morelli"
                            5 => "R&#46; Thompson"
                            6 => "M&#46; Sullivan"
                            7 => "S&#46; Gehlert"
                            8 => "J&#46; Merlo"
                            9 => "M&#46; McKenzie"
                            10 => "J&#46; Wardenburg"
                            11 => "A&#46; Rzhetsky"
                            12 => "C&#46; Burnham"
                            13 => "S&#46; Fritz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jinf.2018.11.006"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Infect"
                        "fecha" => "2018"
                        "volumen" => "78"
                        "paginaInicial" => "200"
                        "paginaFinal" => "207"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30503843"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Occurrence and molecular characteristics of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> and methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> in an academic veterinary hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:11 [
                            0 => "K&#46; Ishihara"
                            1 => "N&#46; Shimokubo"
                            2 => "A&#46; Sakagami"
                            3 => "H&#46; Ueno"
                            4 => "Y&#46; Muratsu"
                            5 => "T&#46; Kadosawa"
                            6 => "C&#46; Yanagisawa"
                            7 => "H&#46; Hanaki"
                            8 => "C&#46; Nakahima"
                            9 => "Y&#46; Susuki"
                            10 => "Y&#46; Tamura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Appl Environ Microbiol"
                        "fecha" => "2010"
                        "volumen" => "76"
                        "paginaInicial" => "5165"
                        "paginaFinal" => "5174"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of canine and feline methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> &#40;MRSP&#41; from Thailand"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "K&#46; Kadlec"
                            1 => "S&#46; Weib"
                            2 => "S&#46; Wendlandt"
                            3 => "S&#46; Schwartz"
                            4 => "W&#46; Tonpitak"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2016.04.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2016"
                        "volumen" => "194"
                        "paginaInicial" => "93"
                        "paginaFinal" => "97"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27160358"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">spa</span> typing and antimicrobial resistance of <span class="elsevierStyleItalic">Staphylococcus aureus</span> from healthy humans&#44; pigs and dogs in Tanzania"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Katakweba"
                            1 => "A&#46; Muhairwa"
                            2 => "C&#46; Espinosa-Gongora"
                            3 => "L&#46; Guardabassi"
                            4 => "M&#46; Mtambo"
                            5 => "J&#46; Olsen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3855/jidc.6790"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Infect Dev Ctries"
                        "fecha" => "2016"
                        "volumen" => "10"
                        "paginaInicial" => "143"
                        "paginaFinal" => "148"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26927455"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> &#40;MRSP&#41; from healthy dogs in Norway &#8211; occurrence&#44; genotypes and comparison to clinical MRSP"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "E&#46; Kjellman"
                            1 => "J&#46; Slettemeas"
                            2 => "H&#46; Small"
                            3 => "M&#46; Sunde"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/mbo3.258"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microbiologyopen"
                        "fecha" => "2015"
                        "volumen" => "4"
                        "paginaInicial" => "857"
                        "paginaFinal" => "866"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26423808"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of <span class="elsevierStyleItalic">Staphylococcus aureus</span> and methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> carriage in three populations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Kottler"
                            1 => "J&#46;R&#46; Middleton"
                            2 => "J&#46; Perry"
                            3 => "J&#46;S&#46; Weese"
                            4 => "L&#46;A&#46; Cohn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1939-1676.2009.0424.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Vet Intern Med"
                        "fecha" => "2012"
                        "volumen" => "24"
                        "paginaInicial" => "132"
                        "paginaFinal" => "139"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20002557"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Enhanced adherence of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> sequence type 71 to canine and human corneocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "F&#46; Latronico"
                            1 => "A&#46; Moodley"
                            2 => "S&#46; Nielsen"
                            3 => "L&#46; Guardabassi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Vet Res"
                        "fecha" => "2014"
                        "volumen" => "45"
                        "paginaInicial" => "70"
                        "paginaFinal" => "77"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "What has changed in canine pyoderma&#63; A narrative review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Loeffler"
                            1 => "D&#46;H&#46; Lloyd"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.tvjl.2018.04.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet J"
                        "fecha" => "2018"
                        "volumen" => "235"
                        "paginaInicial" => "73"
                        "paginaFinal" => "82"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29704943"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus</span> sp &#40;MRS&#41; in different companion animals and determination of risk factors for colonization with MRS"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "I&#46; Loncaric"
                            1 => "A&#46; Tichy"
                            2 => "S&#46; Handler"
                            3 => "M&#46; Szostak"
                            4 => "M&#46; Tickert"
                            5 => "M&#46; Diab-Elschahaw"
                            6 => "J&#46; Spergser"
                            7 => "F&#46; K&#252;nzel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Antibiotics &#40;Basel&#41;"
                        "fecha" => "2019"
                        "volumen" => "8"
                        "paginaInicial" => "39"
                        "paginaFinal" => "45"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pulsed-field gel electrophoresis typing of oxacillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> isolates from the United States&#58; establishing a national database"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46; McDougal"
                            1 => "C&#46; Steward"
                            2 => "G&#46; Killgore"
                            3 => "J&#46; Chaitram"
                            4 => "S&#46; McAllister"
                            5 => "F&#46; Tenover"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.41.11.5113-5120.2003"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2003"
                        "volumen" => "41"
                        "paginaInicial" => "5113"
                        "paginaFinal" => "5120"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14605147"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular epidemiology of hospital-onset methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> infections in southern Chile"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "G&#46; Medina"
                            1 => "A&#46;L&#46; Egea"
                            2 => "C&#46; Otth"
                            3 => "L&#46; Otth"
                            4 => "H&#46; Fernandez"
                            5 => "L&#46; Bocco"
                            6 => "M&#46; Wilson"
                            7 => "C&#46; Sola"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10096-013-1907-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Clin Microbiol Infect Dis"
                        "fecha" => "2013"
                        "volumen" => "32"
                        "paginaInicial" => "1533"
                        "paginaFinal" => "1540"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23765159"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Short Communication&#58; &#946;-lactam resistance and vancomycin heteroresistance in <span class="elsevierStyleItalic">Staphylococcus</span> spp Isolated from bovine subclinical mastitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P&#46; Mello"
                            1 => "L&#46; Pinheiro"
                            2 => "L&#46; Martins"
                            3 => "M&#46; Brito"
                            4 => "M&#46; Souza da Cunha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3168/jds.2016-12329"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dairy Sci"
                        "fecha" => "2017"
                        "volumen" => "100"
                        "paginaInicial" => "6567"
                        "paginaFinal" => "6571"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28624285"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0405"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence and characterization of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> from symptomatic companion animals in northern Italy&#58; clonal diversity and novel sequence types"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;L&#46; Menandro"
                            1 => "G&#46; Dotto"
                            2 => "A&#46; Mondin"
                            3 => "M&#46; Martini"
                            4 => "L&#46; Ceglie"
                            5 => "D&#46; Pasotto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cimid.2019.101331"
                      "Revista" => array:5 [
                        "tituloSerie" => "Comp Immunol Microbiol Infect Dis"
                        "fecha" => "2019"
                        "volumen" => "66"
                        "paginaInicial" => "101331"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31437680"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0410"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Primer reporte de aislamiento de <span class="elsevierStyleItalic">Staphylococcus schleiferi subsp&#46; coagulans</span> en perros con pioderma y otitis externa en Chile"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:9 [
                            0 => "L&#46; Mu&#241;oz"
                            1 => "M&#46; Molina"
                            2 => "M&#46; Heresmann"
                            3 => "F&#46; Abusleme"
                            4 => "M&#46; Ulloa"
                            5 => "C&#46; Borie"
                            6 => "B&#46; San Martin"
                            7 => "V&#46; Silva"
                            8 => "S&#46; Anticevic"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arch Med Vet"
                        "fecha" => "2012"
                        "volumen" => "44"
                        "paginaInicial" => "261"
                        "paginaFinal" => "265"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0415"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Colonizaci&#243;n nasal bacteriana en poblaci&#243;n sana de la ciudad de Santiago de Chile&#58; &#191;Existe portaci&#243;n de <span class="elsevierStyleItalic">Staphylococcus aureus</span> meticilino resistente comunitario&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Platzer"
                            1 => "C&#46; Aranis"
                            2 => "C&#46; Beltran"
                            3 => "X&#46; Fonseca"
                            4 => "P&#46; Garcia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Otorrinolaringol"
                        "fecha" => "2010"
                        "volumen" => "70"
                        "paginaInicial" => "109"
                        "paginaFinal" => "116"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0420"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Public health risk of antimicrobial resistance transfer from companion animals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "C&#46; Pomba"
                            1 => "M&#46; Rantala"
                            2 => "C&#46; Greko"
                            3 => "K&#46; Baptiste"
                            4 => "B&#46; Catry"
                            5 => "E&#46; van Duilkeren"
                            6 => "A&#46; Mateus"
                            7 => "M&#46; Moreno"
                            8 => "S&#46; Pyorala"
                            9 => "K&#46; T&#246;rneke"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jac/dkw481"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Antimicrob Chemother"
                        "fecha" => "2016"
                        "volumen" => "72"
                        "paginaInicial" => "957"
                        "paginaFinal" => "968"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27999066"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0425"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "First report in South America of companion animal colonization by the USA1100 clone of community-acquired methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> &#40;ST30&#41; and by the European clon of methicicllin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> &#40;ST71&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "I&#46; Quitoco"
                            1 => "M&#46; Ramundo"
                            2 => "M&#46; Silva-carvalho"
                            3 => "R&#46; Souza"
                            4 => "C&#46; Beltrame"
                            5 => "T&#46; de Oliveira"
                            6 => "R&#46; Ara&#250;jo"
                            7 => "P&#46; Fernandez del Peloso"
                            8 => "L&#46; Rocheto"
                            9 => "A&#46; Figueiredo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1756-0500-6-336"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMC Res Notes"
                        "fecha" => "2013"
                        "volumen" => "6"
                        "paginaInicial" => "336"
                        "paginaFinal" => "342"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23981343"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0430"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Investigation of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> among clinical isolates from humans and animals by culture methods and multiplex PCR"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "M&#46; Rahman"
                            1 => "K&#46; Amin"
                            2 => "S&#46; Rahman"
                            3 => "A&#46; Khair"
                            4 => "M&#46; Rahman"
                            5 => "A&#46; Hossain"
                            6 => "A&#46; Rhaman"
                            7 => "M&#46; Parvez"
                            8 => "M&#46; Miura"
                            9 => "M&#46; Alam"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12917-018-1611-0"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMC Vet Res"
                        "fecha" => "2018"
                        "volumen" => "14"
                        "paginaInicial" => "300"
                        "paginaFinal" => "306"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30285752"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0435"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk factors for nasal colonization by methicillin-resistant staphylococci in healthy humans in professional daily contact with companion animals in Portugal"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Rodrigues"
                            1 => "A&#46; Belas"
                            2 => "C&#46; Marques"
                            3 => "L&#46; Cruz"
                            4 => "L&#46; Gama"
                            5 => "C&#46; Pomba"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/mdr.2017.0063"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microb Drug Resist"
                        "fecha" => "2018"
                        "volumen" => "24"
                        "paginaInicial" => "434"
                        "paginaFinal" => "446"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28922060"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0440"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CRISPR tracking reveals global spreading of antimicrobial resistance genes by <span class="elsevierStyleItalic">Staphylococcus</span> of canine origin"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46; Rossi"
                            1 => "A&#46; Oliveira"
                            2 => "M&#46; Giambiagi-deMarval"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2019.04.009"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2019"
                        "volumen" => "232"
                        "paginaInicial" => "65"
                        "paginaFinal" => "69"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31030846"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0445"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial resistance in bacterial isolates from companion animals in Buenos Aires&#44; Argentina&#58; 2011&#8211;2017 retrospective study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;V&#46; Rumi"
                            1 => "E&#46; Nuske"
                            2 => "J&#46; Mas"
                            3 => "A&#46; Arg&#252;ello"
                            4 => "G&#46; Gutkind"
                            5 => "J&#46; Di Conza"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/zph.12842"
                      "Revista" => array:6 [
                        "tituloSerie" => "Zoonoses Public Health"
                        "fecha" => "2021"
                        "volumen" => "68"
                        "paginaInicial" => "516"
                        "paginaFinal" => "526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33966360"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0450"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial resistance in coagulase-positive staphylococci isolated from companion animals in Australia&#58; a one-year study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "S&#46; Saputra"
                            1 => "D&#46; Jordan"
                            2 => "K&#46; Worthing"
                            3 => "J&#46; Norris"
                            4 => "H&#46; Wong"
                            5 => "R&#46; Abraham"
                            6 => "D&#46; Trott"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0176379"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLOS ONE"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "e0176379"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28430811"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0455"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multiplex-PCR method for species identification of coagulase-positive staphylococci"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:9 [
                            0 => "T&#46; Sasaki"
                            1 => "S&#46; Tsubakishita"
                            2 => "Y&#46; Tanaka"
                            3 => "A&#46; Sakusabe"
                            4 => "M&#46; Ohtsuka"
                            5 => "S&#46; Hirotaki"
                            6 => "T&#46; Kawakami"
                            7 => "T&#46; Fukata"
                            8 => "K&#46; Hiramatsu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.01232-09"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2010"
                        "volumen" => "48"
                        "paginaInicial" => "765"
                        "paginaFinal" => "769"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20053855"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0460"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human infections due to <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span>&#44; an emerging zoonosis of canine origin&#58; report of 24 cases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Somayaji"
                            1 => "M&#46;A&#46; Priyantha"
                            2 => "J&#46;E&#46; Rubin"
                            3 => "D&#46; Church"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.diagmicrobio.2016.05.008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diagn Microbiol Infect Dis"
                        "fecha" => "2016"
                        "volumen" => "85"
                        "paginaInicial" => "471"
                        "paginaFinal" => "476"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27241371"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0465"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular study on methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> strains isolated from dogs and associated personnel in Jordan"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Y&#46; Tarazi"
                            1 => "A&#46; Almajali"
                            2 => "M&#46; Ababneh"
                            3 => "H&#46; Ahmed"
                            4 => "A&#46; Jaran"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Asian Pac J Trop Biomed"
                        "fecha" => "2015"
                        "volumen" => "5"
                        "paginaInicial" => "902"
                        "paginaFinal" => "908"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0470"
              "etiqueta" => "44"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Aislamiento de <span class="elsevierStyleItalic">Staphylococcus aureus</span> hetero-resistente a vancomicina en hospital cl&#237;nico regional de Concepci&#243;n&#44; Chile"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "F&#46; Vega"
                            1 => "P&#46; Alarc&#243;n"
                            2 => "M&#46; Dominguez"
                            3 => "H&#46; Bello"
                            4 => "G&#46; Riedel"
                            5 => "S&#46; Mella"
                            6 => "A&#46; Aguayo"
                            7 => "G&#46; Gonzalez-Rocha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4067/S0716-10182015000600017"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Chilena Infectol"
                        "fecha" => "2015"
                        "volumen" => "32"
                        "paginaInicial" => "588"
                        "paginaFinal" => "590"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26633120"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            44 => array:3 [
              "identificador" => "bib0475"
              "etiqueta" => "45"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Frequency&#44; antimicrobial susceptibility and clonal distribution of methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy&#59; a 3-year retrospective investigation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "G&#46; Ventrella"
                            1 => "A&#46; Moodley"
                            2 => "E&#46; Grandolfo"
                            3 => "A&#46; Parisi"
                            4 => "M&#46; Corrente"
                            5 => "D&#46; Bounavoglia"
                            6 => "L&#46; Guardabassi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2017.09.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2017"
                        "volumen" => "211"
                        "paginaInicial" => "103"
                        "paginaFinal" => "106"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29102103"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            45 => array:3 [
              "identificador" => "bib0480"
              "etiqueta" => "46"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Resistencia antimicrobiana y epidemiolog&#237;a molecular de aislamientos de <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> de muestras cl&#237;nicas de caninos"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Vigo"
                            1 => "G&#46; Giacoboni"
                            2 => "P&#46; Gagetti"
                            3 => "F&#46; Paster&#225;n"
                            4 => "A&#46; Corso"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ram.2015.06.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Argent Microbiol"
                        "fecha" => "2015"
                        "volumen" => "47"
                        "paginaInicial" => "206"
                        "paginaFinal" => "211"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26323373"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            46 => array:3 [
              "identificador" => "bib0485"
              "etiqueta" => "47"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk factors for MRSA infection in companion animals&#58; results from a case-control study within Germany"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "S&#46; Vincze"
                            1 => "A&#46; Brandenburg"
                            2 => "W&#46; Espelage"
                            3 => "I&#46; Stamm"
                            4 => "L&#46; Wieler"
                            5 => "P&#46; Kopp"
                            6 => "A&#46; L&#252;bke-Becker"
                            7 => "B&#46; Walther"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ijmm.2014.07.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Med Microbiol"
                        "fecha" => "2014"
                        "volumen" => "304"
                        "paginaInicial" => "787"
                        "paginaFinal" => "793"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25130703"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            47 => array:3 [
              "identificador" => "bib0490"
              "etiqueta" => "48"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Staphylococcus intermedius</span> infections&#58; case report and literature review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "N&#46; Wang"
                            1 => "A&#46; Neilan"
                            2 => "M&#46; Klompas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4081/idr.2013.s1.e3"
                      "Revista" => array:5 [
                        "tituloSerie" => "Infect Dis Rep"
                        "fecha" => "2013"
                        "volumen" => "5"
                        "paginaInicial" => "e3"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24470967"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            48 => array:3 [
              "identificador" => "bib0495"
              "etiqueta" => "49"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Carriage of <span class="elsevierStyleItalic">Staphylococcus</span> species in the veterinary visiting dog population in mainland UK&#58; molecular characterization of resistance and virulence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:11 [
                            0 => "A&#46; Wedley"
                            1 => "S&#46; Dawson"
                            2 => "T&#46; Maddox"
                            3 => "K&#46; Coyne"
                            4 => "G&#46; Pinchbeck"
                            5 => "P&#46; Clegg"
                            6 => "D&#46; Jamrozi"
                            7 => "M&#46; Fielder"
                            8 => "D&#46; Donovan"
                            9 => "T&#46; Nutall"
                            10 => "N&#46; Williams"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2014.01.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2014"
                        "volumen" => "170"
                        "paginaInicial" => "81"
                        "paginaFinal" => "88"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24612909"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            49 => array:3 [
              "identificador" => "bib0500"
              "etiqueta" => "50"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methicillin-resistant <span class="elsevierStyleItalic">Staphylococcus aureus</span> and <span class="elsevierStyleItalic">Staphylococcus pseudintermedius</span> in veterinary medicine"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;S&#46; Weese"
                            1 => "E&#46; van Duijkeren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.vetmic.2009.01.039"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vet Microbiol"
                        "fecha" => "2010"
                        "volumen" => "140"
                        "paginaInicial" => "418"
                        "paginaFinal" => "429"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19246166"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack627964"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0230" class="elsevierStylePara elsevierViewall">The authors appreciate the kind collaboration of all staff of Laboratorio de Investigaci&#243;n en Agentes Antibacterianos at Facultad de Ciencias Biol&#243;gicas&#44; Universidad de Concepci&#243;n&#44; and the Laboratorio de Microbiolog&#237;a Cl&#237;nica Veterinaria of the Facultad de Ciencias Veterinarias y Pecuarias of the Universidad de Chile &#40;FAVET&#41;&#46; This study was financed by the <span class="elsevierStyleGrantSponsor" id="gs1">Conicyt National Doctorate</span> Grant No&#46; <span class="elsevierStyleGrantNumber" refid="gs1">21141033-2014</span>&#44; and by the <span class="elsevierStyleGrantSponsor" id="gs2">ANID Millennium Science Initiative&#47;Millennium Initiative for Collaborative Research on Bacterial Resistance</span>&#44; MICROB-R&#44; <span class="elsevierStyleGrantNumber" refid="gs2">NCN17&#95;081-2020</span>&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03257541/0000005400000003/v1_202209300808/S0325754122000013/v1_202209300808/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "44540"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Agentes antimicrobianos"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03257541/0000005400000003/v1_202209300808/S0325754122000013/v1_202209300808/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000013?idApp=UINPBA00004N"
]

Article information

ISSN: 03257541
Original language: English

DOI:10.1016/j.ram.2021.12.001

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	3	0	3
2024 October	52	10	62
2024 September	54	6	60
2024 August	46	12	58
2024 July	59	5	64
2024 June	49	3	52
2024 May	66	13	79
2024 April	80	14	94
2024 March	91	10	101
2024 February	85	6	91
2024 January	82	7	89
2023 December	115	15	130
2023 November	65	18	83
2023 October	79	14	93
2023 September	32	1	33
2023 August	35	15	50
2023 July	32	8	40
2023 June	54	9	63
2023 May	72	11	83
2023 April	72	9	81
2023 March	36	19	55
2023 February	51	9	60
2023 January	39	13	52
2022 December	47	16	63
2022 November	61	12	73
2022 October	38	25	63
2022 September	15	18	33
2022 August	12	12	24
2022 July	9	6	15
2022 June	8	4	12
2022 May	12	10	22
2022 April	24	14	38
2022 March	5	5	10

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter