Letter to the Editor
A search for cryptic Aspergillus species in South Brazil
Búsqueda de especies crípticas de Aspergillus en el sur de Brasil
Read
555
Timeswas read the article
186
Total PDF
369
Total HTML
Share statistics
array:22 [ "pii" => "S1130140621000358" "issn" => "11301406" "doi" => "10.1016/j.riam.2021.04.008" "estado" => "S300" "fechaPublicacion" => "2021-07-01" "aid" => "608" "copyright" => "Asociación Española de Micología" "copyrightAnyo" => "2021" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "cor" "cita" => "Rev Iberoam Micol. 2021;38:154" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemAnterior" => array:18 [ "pii" => "S1130140621000061" "issn" => "11301406" "doi" => "10.1016/j.riam.2020.12.003" "estado" => "S300" "fechaPublicacion" => "2021-07-01" "aid" => "586" "copyright" => "Asociación Española de Micología" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "cor" "cita" => "Rev Iberoam Micol. 2021;38:153" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Letter to the Editor</span>" "titulo" => "<span class="elsevierStyleItalic">Tinea capitis</span> caused by <span class="elsevierStyleItalic">Nannizzia gypsea</span> after playing by a river" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:1 [ "paginaInicial" => "153" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "<span class="elsevierStyleItalic">Tinea capitis</span> por <span class="elsevierStyleItalic">Nannizzia gypsea</span> tras jugar junto a un río" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 680 "Ancho" => 905 "Tamanyo" => 108713 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Colonies on Sabouraud glucose agar.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Elisabeth Gómez-Moyano, María Gasca-Santiyán, Alberto Andamoyo-Castañeda, Leandro Martínez-Pilar" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Elisabeth" "apellidos" => "Gómez-Moyano" ] 1 => array:2 [ "nombre" => "María" "apellidos" => "Gasca-Santiyán" ] 2 => array:2 [ "nombre" => "Alberto" "apellidos" => "Andamoyo-Castañeda" ] 3 => array:2 [ "nombre" => "Leandro" "apellidos" => "Martínez-Pilar" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140621000061?idApp=UINPBA00004N" "url" => "/11301406/0000003800000003/v2_202109250626/S1130140621000061/v2_202109250626/en/main.assets" ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Letter to the Editor</span>" "titulo" => "A search for cryptic <span class="elsevierStyleItalic">Aspergillus</span> species in South Brazil" "tieneTextoCompleto" => true "saludo" => "Dear Editor," "paginas" => array:1 [ 0 => array:1 [ "paginaInicial" => "154" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Izadora Vasconcellos, Juliano Silveira, Cecília Severo, Odelta Allende, Alessandro Pasqualotto" "autores" => array:5 [ 0 => array:3 [ "nombre" => "Izadora" "apellidos" => "Vasconcellos" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "Juliano" "apellidos" => "Silveira" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "Cecília" "apellidos" => "Severo" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Odelta" "apellidos" => "Allende" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 4 => array:4 [ "nombre" => "Alessandro" "apellidos" => "Pasqualotto" "email" => array:1 [ 0 => "pasqualotto@santacasa.org.br" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, Brazil" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Santa Casa de Misericórdia de Porto Alegre, Porto Alegre, Brazil" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Búsqueda de especies crípticas de <span class="elsevierStyleItalic">Aspergillus</span> en el sur de Brasil" ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">Cryptic <span class="elsevierStyleItalic">Aspergillus</span> species have become more relevant in clinical practice due to their increased resistance to first-line antifungal agents.<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">1</span></a> Mycologists used to rely on morphological characteristics to identify fungi at the species level, but in the last decade molecular analyses of DNA have been used for achieving a correct identification.<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">8</span></a> Such methodologies are not yet widely used in developing countries such as Brazil. Therefore, several clinical isolates belonging to <span class="elsevierStyleItalic">Aspegillus</span> genus were identified by sequencing the β-tubulin gene in order to find cryptic <span class="elsevierStyleItalic">Aspergillus</span> species.</p><p id="par0010" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Aspergillus</span> isolates were obtained from cultures of clinical samples of patients attending Santa Casa de Misericordia de Porto Alegre for any medical reason between June and December 2019. Fungal DNA was extracted from pure cultures using Maxwell® 16 Blood Nucleic Acid Purification Kit (Promega, Brazil), and β-tubulin gene was amplified using, as previously described,<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">2</span></a> the following primers, purchased from Invitrogen (ThermoFisher Scientific, Brazil): GGTAACCAAATCGGTGCTGCTTTC (forward) and ACCCTCAGTGTAGTGACCCTTGGC (reverse). The amplification products were analyzed in 1.5% agarose gels. Amplicons were purified using ExoSAP-IT (Applied Biosystems) and sent for DNA Sanger sequencing. Sequencing results were aligned by ClustalW in the MegaX software, and the contigs were used for BlastN with NCBI database in search of the most similar sequence using parameters of percentage of identity >99% and E-value of 0.0.</p><p id="par0015" class="elsevierStylePara elsevierViewall">Throughout six months, twenty isolates of <span class="elsevierStyleItalic">Aspergillus</span> were included in the study, but some had to be excluded due to the molecular results: four had many unresolved bases that impaired the proper assemble of the contigs, and very short readings (2–15 nucleotides) were obtained from the other three. Of the 13 isolates identified, <span class="elsevierStyleItalic">Aspergillus fumigatus</span> represented 69.2% of the cases (GenBank accession numbers MW478809, MW478810, MW478811, MW478812, MW478813, MW478814, MW478815, MW478818, MW478819) and <span class="elsevierStyleItalic">Aspergillus niger</span> 30.7% (GenBank accession numbers MW464654, MW478816, MW478817, MW478820).</p><p id="par0020" class="elsevierStylePara elsevierViewall">Molecular techniques have become the cornerstone for the accurate identification of moulds at the species level. Despite that, such technologies are frequently not afordable for the clinical mycology laboratory. Only two studies have evaluated the frequency of cryptic species in hospital settings in Brazil. One of the studies evaluated a large culture collection made of <span class="elsevierStyleItalic">Aspergillus</span> isolates obtained from 12 medical centers, and found that cryptic species represented 19% (25/133) of the strains, with 90% of this cryptic isolates showing susceptibility to the three triazoles tested.<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">4</span></a> A study evaluating the epidemiology of <span class="elsevierStyleItalic">Aspergillus</span> in patients with cystic fibrosis found that 96% (51/53) of the isolates recovered were <span class="elsevierStyleItalic">A. fumigatus sensu stricto</span>, but no cryptic species were identified.<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">6</span></a> Multinational studies show that the prevalence of <span class="elsevierStyleItalic">Aspergillus</span> is around 10–15%.<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">5</span></a> Studies describing cryptic species of <span class="elsevierStyleItalic">Aspergillus</span> spent a long time for collecting the isolates or recruiting multiple centres, which resulted in a large number of strains.<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">5,9</span></a> Some studies recommend the use of more targets to identify cryptic species of <span class="elsevierStyleItalic">Aspergillus</span>, such as ITS, considered a universal target for filamentous fungi, and calmodulin (CaM), which is a more specific marker, as β-tubulin, and the combination of at least two of these markers shows better performance in the identification of cryptic species.<a class="elsevierStyleCrossRefs" href="#bib0060"><span class="elsevierStyleSup">3,7</span></a> This is the first study to evaluate <span class="elsevierStyleItalic">Aspergillus</span> cultures from South Brazil using fungal DNA sequencing. Cryptic <span class="elsevierStyleItalic">Aspergillus</span> species were not found, which is probably related to the small sample size.</p><p id="par0025" class="elsevierStylePara elsevierViewall">In conclusion, the characterization of fungal genes, such as β-tubulin, allow the proper identification of the <span class="elsevierStyleItalic">Aspergillus</span> at the species level. Hospitals should check their own culture collection to determine the frequency of cryptic species in the <span class="elsevierStyleItalic">Aspergillus</span> genus, as well as within other medically important fungal species complexes, particularly if antifungal resistance is already described.</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0005">Funding</span><p id="par0030" class="elsevierStylePara elsevierViewall">None to declare.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0005" "titulo" => "Funding" ] 1 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:9 [ 0 => array:3 [ "identificador" => "bib0050" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antifungal susceptibility profile of cryptic species of <span class="elsevierStyleItalic">Aspergillus</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A. Alastruey-Izquierdo" 1 => "L. Alcazar-Fuoli" 2 => "M. Cuenca-Estrella" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mycopathologia" "fecha" => "2015" "volumen" => "179" "paginaInicial" => "3" "paginaFinal" => "4" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0055" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "N.L. Glass" 1 => "G.C. Donaldson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/aem.61.4.1323-1330.1995" "Revista" => array:6 [ "tituloSerie" => "Appl Environ Microbiol" "fecha" => "1995" "volumen" => "61" "paginaInicial" => "1323" "paginaFinal" => "1330" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7747954" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0060" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multi-centric evaluation of the online MSI platform for the identification of cryptic and rare species of <span class="elsevierStyleItalic">Aspergillus</span> by MALDI-TOF" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Imbert" 1 => "A.C. Normand" 2 => "F. Gabriel" 3 => "S. Cassaing" 4 => "C. Bonnal" 5 => "D. Costa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/mmy/myz004" "Revista" => array:2 [ "tituloSerie" => "Med Mycol" "fecha" => "2019" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0065" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cryptic and rare <span class="elsevierStyleItalic">Aspergillus</span> species in Brazil: prevalence in clinical samples and in vitro susceptibility to triazoles" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.E. Negri" 1 => "S.S. Gonçalves" 2 => "H. Xafranski" 3 => "M.D. Bergamasco" 4 => "V.R. Aquino" 5 => "P.T. Castro" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.01582-14" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2014" "volumen" => "52" "paginaInicial" => "3633" "paginaFinal" => "3640" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25078909" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0070" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A prospective international <span class="elsevierStyleItalic">Aspergillus terreus</span> survey: an EFISG ISHAM and ECMM joint study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Risslegger" 1 => "T. Zoran" 2 => "M. Lackner" 3 => "M. Aigner" 4 => "F. Sánchez-Reus" 5 => "A. Rezusta" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Microbiol Infect" "fecha" => "2017" "volumen" => "23" "paginaInicial" => "776e1" "paginaFinal" => "776e5" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0075" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of <span class="elsevierStyleItalic">Aspergillus</span> collected from cystic fibrosis patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Sabino" 1 => "J.A. Ferreira" 2 => "R.B. Moss" 3 => "J. Valente" 4 => "C. Veríssimo" 5 => "E. Carolino" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jcf.2014.10.005" "Revista" => array:6 [ "tituloSerie" => "J Cyst Fibros" "fecha" => "2015" "volumen" => "14" "paginaInicial" => "474" "paginaFinal" => "481" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25459562" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0080" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phylogeny, identification and nomenclature of the genus <span class="elsevierStyleItalic">Aspergillus</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.A. Samson" 1 => "C.M. Visagie" 2 => "J. Houbraken" 3 => "S.B. Hong" 4 => "V. Hubka" 5 => "C.H. Klaassen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.simyco.2014.07.004" "Revista" => array:6 [ "tituloSerie" => "Stud Mycol" "fecha" => "2014" "volumen" => "78" "paginaInicial" => "141" "paginaFinal" => "173" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25492982" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0085" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antifungal susceptibilities to amphotericin B, triazoles and echinocandins of 77 clinical isolates of cryptic <span class="elsevierStyleItalic">Aspergillus</span> species in multicenter surveillance in Korea" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.J. Won" 1 => "J.H. Shin" 2 => "S.H. Kim" 3 => "M.J. Choi" 4 => "S.A. Byun" 5 => "M.N. Kim" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/mmy/myx067" "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2018" "volumen" => "56" "paginaInicial" => "501" "paginaFinal" => "505" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28992138" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0090" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Azole-resistance in <span class="elsevierStyleItalic">Aspergillus terreus</span> and related species: An emerging problem or a rare phenomenon?" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Zoran" 1 => "B. Sartori" 2 => "L. Sappl" 3 => "M. Aigner" 4 => "F. Sánchez-Reus" 5 => "A. Rezusta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fmicb.2018.00001" "Revista" => array:6 [ "tituloSerie" => "Front Microbiol" "fecha" => "2018" "volumen" => "9" "paginaInicial" => "1" "paginaFinal" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29403456" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/11301406/0000003800000003/v2_202109250626/S1130140621000358/v2_202109250626/en/main.assets" "Apartado" => array:4 [ "identificador" => "8081" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Carta a los Directores" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/11301406/0000003800000003/v2_202109250626/S1130140621000358/v2_202109250626/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140621000358?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 3 | 3 | 6 |
| 2024 October | 15 | 3 | 18 |
| 2024 September | 10 | 3 | 13 |
| 2024 August | 10 | 5 | 15 |
| 2024 July | 14 | 6 | 20 |
| 2024 June | 9 | 4 | 13 |
| 2024 May | 6 | 5 | 11 |
| 2024 April | 15 | 10 | 25 |
| 2024 March | 15 | 4 | 19 |
| 2024 February | 4 | 1 | 5 |
| 2024 January | 6 | 3 | 9 |
| 2023 December | 9 | 3 | 12 |
| 2023 November | 13 | 8 | 21 |
| 2023 October | 20 | 1 | 21 |
| 2023 September | 8 | 1 | 9 |
| 2023 August | 10 | 1 | 11 |
| 2023 July | 8 | 3 | 11 |
| 2023 June | 13 | 4 | 17 |
| 2023 May | 15 | 1 | 16 |
| 2023 April | 29 | 3 | 32 |
| 2023 March | 22 | 12 | 34 |
| 2023 February | 16 | 5 | 21 |
| 2023 January | 13 | 13 | 26 |
| 2022 December | 17 | 11 | 28 |
| 2022 November | 14 | 9 | 23 |
| 2022 October | 13 | 4 | 17 |
| 2022 September | 15 | 24 | 39 |
| 2022 August | 17 | 29 | 46 |
| 2022 July | 9 | 5 | 14 |
| 2021 December | 1 | 0 | 1 |
| 2021 October | 0 | 2 | 2 |
Show all
