Ecology
Prevalence of Haematoloechus pulcher metacercariae (Digenea: Plagiorchioidea) in the crayfish Cambarellus montezumae in Salazar Lagoon, Estado de México
Prevalencia de metacercarias de Haematoloechus pulcher (Digenea: Plagiorchioidea) en el acocil Cambarellus montezumae en la laguna de Salazar, Estado de México
Alicia Pérez-Chia, Jorge Carrillo-Lagunaa, Blanca Rosa Aguilar-Figueroab, Gabriela Ibañez-Cervantesc, Oliver López-Villegasd, Gloria León-Avilaa,
Corresponding author
a Departamento de Biología Celular, Centro de Investigación y de Estudios Avanzados, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico
b Departamento de Parasitología, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico
c Departamento de Biología Celular, Centro de Investigación y de Estudios Avanzados, Instituto Politécnico Nacional, Col. Zacatenco, Delegación Gustavo A. Madero, C.P. 07360, Mexico City, Mexico
d Laboratorio Central de Microscopía, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico
Read
2958
Timeswas read the article
629
Total PDF
2329
Total HTML
Share statistics
array:25 [ "pii" => "S1870345315000780" "issn" => "18703453" "doi" => "10.1016/j.rmb.2015.07.002" "estado" => "S300" "fechaPublicacion" => "2015-09-01" "aid" => "60" "copyright" => "Universidad Nacional Autónoma de México, Instituto de Biología" "copyrightAnyo" => "2015" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Revista Mexicana de Biodiversidad. 2015;86:730-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1301 "formatos" => array:3 [ "EPUB" => 42 "HTML" => 992 "PDF" => 267 ] ] "itemSiguiente" => array:19 [ "pii" => "S1870345315000792" "issn" => "18703453" "doi" => "10.1016/j.rmb.2015.07.003" "estado" => "S300" "fechaPublicacion" => "2015-09-01" "aid" => "61" "copyright" => "Universidad Nacional Autónoma de México, Instituto de Biología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Revista Mexicana de Biodiversidad. 2015;86:737-43" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 799 "formatos" => array:3 [ "EPUB" => 43 "HTML" => 527 "PDF" => 229 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Ecology</span>" "titulo" => "Dimorphism and population size of the Mexican redrump tarantula, <span class="elsevierStyleItalic">Brachypelma vagans</span> (Araneae: Theraphosidae), in Southeast Mexico" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "737" "paginaFinal" => "743" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Dimorfismos y tamaño de poblaciones de la tarántula de cadera roja <span class="elsevierStyleItalic">Brachypelma vagans</span> (Araneae: Theraphosidae), en el sureste de México" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1291 "Ancho" => 1663 "Tamanyo" => 65867 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Mean (±standard error) of morphological measurements (mm) among <span class="elsevierStyleItalic">Brachypelma vagans</span> males (gray) and females (white) for the site in Campeche State. For abbreviations of morphological measurements see <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. Mann–Whitney <span class="elsevierStyleItalic">U</span>-test: ns, not significant; *<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05; **<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.01; ***<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.001.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Yann Hénaut, Salima Machkour-M’Rabet, Holger Weissenberger, Roberto Rojo" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Yann" "apellidos" => "Hénaut" ] 1 => array:2 [ "nombre" => "Salima" "apellidos" => "Machkour-M’Rabet" ] 2 => array:2 [ "nombre" => "Holger" "apellidos" => "Weissenberger" ] 3 => array:2 [ "nombre" => "Roberto" "apellidos" => "Rojo" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1870345315000792?idApp=UINPBA00004N" "url" => "/18703453/0000008600000003/v1_201509250133/S1870345315000792/v1_201509250133/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1870345315000688" "issn" => "18703453" "doi" => "10.1016/j.rmb.2015.06.002" "estado" => "S300" "fechaPublicacion" => "2015-09-01" "aid" => "51" "copyright" => "Universidad Nacional Autónoma de México, Instituto de Biología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Revista Mexicana de Biodiversidad. 2015;86:719-29" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 810 "formatos" => array:3 [ "EPUB" => 30 "HTML" => 486 "PDF" => 294 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Ecología</span>" "titulo" => "Representatividad geográfica y ambiental de los registros de gastrópodos, pteridofitas y plantas acuáticas en el estado de Tamaulipas, México" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "719" "paginaFinal" => "729" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Geographical and environmental representativeness of records of gastropods, pteridophytes and aquatic plants in the state of Tamaulipas, Mexico" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 4178 "Ancho" => 2936 "Tamanyo" => 989665 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Centroides de los registros observados (O) y generados al azar (A) de las especies de gastrópodos (a1), pteridofitas (b1) y plantas acuáticas (c1) en los intervalos de distancia a zonas urbanas (U) y vías de comunicación (V), así como la estructura de las primeras3 raíces para los3 grupos de especies (a2, b2, y c2, respectivamente).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Crystian Sadiel Venegas-Barrera, Alfonso Correa-Sandoval, Arturo Mora-Olivo, Jorge Víctor Horta-Vega" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Crystian Sadiel" "apellidos" => "Venegas-Barrera" ] 1 => array:2 [ "nombre" => "Alfonso" "apellidos" => "Correa-Sandoval" ] 2 => array:2 [ "nombre" => "Arturo" "apellidos" => "Mora-Olivo" ] 3 => array:2 [ "nombre" => "Jorge Víctor" "apellidos" => "Horta-Vega" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1870345315000688?idApp=UINPBA00004N" "url" => "/18703453/0000008600000003/v1_201509250133/S1870345315000688/v1_201509250133/es/main.assets" ] "asociados" => array:1 [ 0 => array:19 [ "pii" => "S1870345316000154" "issn" => "18703453" "doi" => "10.1016/j.rmb.2016.01.006" "estado" => "S300" "fechaPublicacion" => "2016-03-01" "aid" => "120" "copyright" => "Universidad Nacional Autónoma de México, Instituto de Biología" "documento" => "simple-article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "err" "cita" => "Revista Mexicana de Biodiversidad. 2016;87:276" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 604 "formatos" => array:3 [ "EPUB" => 50 "HTML" => 411 "PDF" => 143 ] ] "en" => array:10 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Erratum</span>" "titulo" => "Erratum to “Prevalence of <span class="elsevierStyleItalic">Haematoloechus pulcher</span> metacercariae (Digenea: Plagiorchioidea) in the crayfish <span class="elsevierStyleItalic">Cambarellus montezumae</span> in Salazar Lagoon, Estado de México” [Rev. Mex. Biodivers. 86 (2015) 730–736]" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:1 [ "paginaInicial" => "276" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Fe de errores de ‘<span class="elsevierStyleItalic">Prevalencia de metacercarias de</span> Haematoloechus pulcher <span class="elsevierStyleItalic">(Digenea: Plagiorchioidea) en el acocil</span> Cambarellus montezumae <span class="elsevierStyleItalic">en la laguna de Salazar, Estado de México</span>’" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Alicia Pérez-Chi, Jorge Carrillo-Laguna, Blanca Rosa Aguilar-Figueroa, Gabriela Ibañez-Cervantes, Oliver López-Villegas, Gloria León-Avila" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Alicia" "apellidos" => "Pérez-Chi" ] 1 => array:2 [ "nombre" => "Jorge" "apellidos" => "Carrillo-Laguna" ] 2 => array:2 [ "nombre" => "Blanca Rosa" "apellidos" => "Aguilar-Figueroa" ] 3 => array:2 [ "nombre" => "Gabriela" "apellidos" => "Ibañez-Cervantes" ] 4 => array:2 [ "nombre" => "Oliver" "apellidos" => "López-Villegas" ] 5 => array:2 [ "nombre" => "Gloria" "apellidos" => "León-Avila" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1870345316000154?idApp=UINPBA00004N" "url" => "/18703453/0000008700000001/v1_201603200112/S1870345316000154/v1_201603200112/en/main.assets" ] ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Ecology</span>" "titulo" => "Prevalence of <span class="elsevierStyleItalic">Haematoloechus pulcher</span> metacercariae (Digenea: Plagiorchioidea) in the crayfish <span class="elsevierStyleItalic">Cambarellus montezumae</span> in Salazar Lagoon, Estado de México" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "730" "paginaFinal" => "736" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Alicia Pérez-Chi, Jorge Carrillo-Laguna, Blanca Rosa Aguilar-Figueroa, Gabriela Ibañez-Cervantes, Oliver López-Villegas, Gloria León-Avila" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Alicia" "apellidos" => "Pérez-Chi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Jorge" "apellidos" => "Carrillo-Laguna" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Blanca Rosa" "apellidos" => "Aguilar-Figueroa" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Gabriela" "apellidos" => "Ibañez-Cervantes" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "Oliver" "apellidos" => "López-Villegas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 5 => array:4 [ "nombre" => "Gloria" "apellidos" => "León-Avila" "email" => array:1 [ 0 => "leonavila60@yahoo.com.mx" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Departamento de Biología Celular, Centro de Investigación y de Estudios Avanzados, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Departamento de Parasitología, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Departamento de Biología Celular, Centro de Investigación y de Estudios Avanzados, Instituto Politécnico Nacional, Col. Zacatenco, Delegación Gustavo A. Madero, C.P. 07360, Mexico City, Mexico" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Laboratorio Central de Microscopía, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomás, C.P. 11340, Mexico City, Mexico" "etiqueta" => "d" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Prevalencia de metacercarias de <span class="elsevierStyleItalic">Haematoloechus pulcher</span> (Digenea: Plagiorchioidea) en el acocil <span class="elsevierStyleItalic">Cambarellus montezumae</span> en la laguna de Salazar, Estado de México" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2174 "Ancho" => 1742 "Tamanyo" => 174474 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Maximal likelihood phylogram reconstructed from 28S rRNA fragment gene sequences of the distinct isolates.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Research focusing on the dynamics of the communities of helminthic parasites has traditionally paid more attention to vertebrate definitive hosts (<a class="elsevierStyleCrossRef" href="#bib0030">Esch, Bush, & Aho, 1990</a>) and recently on larval stages of mollusks (<a class="elsevierStyleCrossRef" href="#bib0125">Scholz, Aguirre-Macedo, Díaz-de León, & Ditrich, 2000</a>). Few projects have been carried out regarding intermediate hosts. These hosts because of the predator-prey pathways, which lead to parasite transmission, have a closer ecological association with the definitive host (<a class="elsevierStyleCrossRef" href="#bib0155">Wetzel & Esch, 1996</a>). Many Digenea (Platyhelmintha: Trematoda) use freshwater crayfish as second host intermediate (<a class="elsevierStyleCrossRef" href="#bib0055">Lefebvre & Poulin, 2005</a>). <span class="elsevierStyleItalic">Cambarellus montezumae</span> (Decapoda: Astacidae: Cambarinae) is an endemic species of the benthos of the reservoirs in the Mexican Altiplano (<a class="elsevierStyleCrossRefs" href="#bib0010">Arredondo-Figueroa, Vásquez-González, Nuñez-García, Barriga-Sosa, & Ponce-Palafox, 2011; Villalobos, 1955</a>). Abundant in Salazar Lagoon, it serves as food source for birds, fish and humans in the region (<a class="elsevierStyleCrossRef" href="#bib0120">Rodríguez & Carmona, 2002</a>). It is unknown whether this species acts as an intermediate host or definitive host and if it represents a risk to human health (<a class="elsevierStyleCrossRef" href="#bib0095">Moctezuma, 1996</a>). Different environmental factors such as the increase of tourism on the lakeshore (<a class="elsevierStyleCrossRef" href="#bib0140">Vargas, 1997</a>), overgrazing, and pollution of soil and water by solid waste have made a strong impact on native aquatic fauna. The later including <span class="elsevierStyleItalic">C. montezumae</span>, considered by the National Commission of Natural Protected Areas (Conanp) as a focal species of economical and biological importance in Mexico. Some studies have registered the presence of digeneans in freshwater crayfish (<a class="elsevierStyleCrossRef" href="#bib0025">Edgerton, Evans, Stephen, & Overstreet, 2000</a>). On the other hand, <a class="elsevierStyleCrossRef" href="#bib0130">Sogandares-Bernal (1965)</a> reported parasitized crayfish in Louisiana and <a class="elsevierStyleCrossRef" href="#bib0075">McAllister, Robison and Font (2011)</a> reported 3 species of crayfish parasitized by <span class="elsevierStyleItalic">Alloglossidium corti</span> in Arkansas and Oklahoma. <a class="elsevierStyleCrossRef" href="#bib0040">Lane et al. (2009)</a> described human paragonimiasis by ingestion of raw crayfish in North America. Mexican studies on <span class="elsevierStyleItalic">C. montezumae</span> include population ecology (<a class="elsevierStyleCrossRefs" href="#bib0005">Álvarez & Rangel, 2007; Moctezuma, 1996; Villalobos, 1955</a>), physiology (<a class="elsevierStyleCrossRef" href="#bib0120">Rodríguez & Carmona, 2002</a>), feeding behavior and epibionts (<a class="elsevierStyleCrossRefs" href="#bib0070">López-Ochoterena & Ochoa-Gasca, 1971; Rioja, 1940</a>) among others. In spite of this species being a source of human consumption in many places (<a class="elsevierStyleCrossRef" href="#bib0005">Álvarez & Rangel, 2007</a>), there are no parasitological studies.</p><p id="par0010" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Haematoloechus</span> (Looss, 1899) (Digenea: Plagiorchioidea) has a worldwide distribution with at least 50 different species described, 12 of which have been reported for Mexico (<a class="elsevierStyleCrossRefs" href="#bib0065">León-Règagnon, 2010; León-Règagnon & Brooks, 2003</a>). Among them, <span class="elsevierStyleItalic">Haematoloechus pulcher</span> (<a class="elsevierStyleCrossRef" href="#bib0020">Bravo, 1943</a>) was found in the Central Altiplano (<a class="elsevierStyleCrossRefs" href="#bib0020">Bravo, 1943; Mata-López, García-Prieto, & León-Règagnon, 2002; León-Règagnon & Brooks, 2003; Paredes-León, García-Prieto, Guzmán-Cornejo, León-Règagnon, & Pérez, 2008</a>). Adult <span class="elsevierStyleItalic">Haematoloechus</span> spp. parasitize the lungs of lower vertebrates (frogs and caudates). Nevertheless, presence of <span class="elsevierStyleItalic">H. pulcher</span> metacercariae in crayfish has not been documented. It is unknown whether <span class="elsevierStyleItalic">C. montezumae</span> is an intermediate host of human parasites (<a class="elsevierStyleCrossRef" href="#bib0095">Moctezuma, 1996</a>). This paper shows the temporal dynamics of the metacercariae parasitosis in crayfish <span class="elsevierStyleItalic">C. montezumae</span> and its determining factors, as well as the risk involved in the development of this crayfish population species.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Materials and methods</span><p id="par0015" class="elsevierStylePara elsevierViewall">Salazar Lagoon is located in the Miguel Hidalgo y Costilla National Park in the municipality of Lerma, Estado de México (19°18′13″<span class="elsevierStyleHsp" style=""></span>N, 99°23′11″<span class="elsevierStyleHsp" style=""></span>W). The major axis of the lagoon is around 1<span class="elsevierStyleHsp" style=""></span>km and the lower (north-south) about 300<span class="elsevierStyleHsp" style=""></span>m. The climate of the area is temperate sub-humid with an average temperature of 12–18<span class="elsevierStyleHsp" style=""></span>°C with summer rains, where rainfall exceeds 800<span class="elsevierStyleHsp" style=""></span>mm (<a class="elsevierStyleCrossRef" href="#bib0095">Moctezuma, 1996</a>).</p><p id="par0020" class="elsevierStylePara elsevierViewall">Thirteen monthly samplings were carried out (from February 2008 to February 2009) with a 60<span class="elsevierStyleHsp" style=""></span>×<span class="elsevierStyleHsp" style=""></span>30<span class="elsevierStyleHsp" style=""></span>cm rectangular dredge (mesh size of 0.5<span class="elsevierStyleHsp" style=""></span>mm). Samples were collected along a 3<span class="elsevierStyleHsp" style=""></span>m wide band at a water depth of 90<span class="elsevierStyleHsp" style=""></span>cm. Temperature and oxygen saturation, as well as transparency and pH were recorded.</p><p id="par0025" class="elsevierStylePara elsevierViewall">A total of 221 crayfish were obtained during the 13 months. Each month the crayfish were brought to the laboratory and maintained in a 20<span class="elsevierStyleHsp" style=""></span>L aquarium containing lagoon water at 20<span class="elsevierStyleHsp" style=""></span>°C, with continuous aeration. Each specimen was anesthetized with chloroform (0.7 or 1% depending of the size) and submitted to external examination, measuring and sex determination. The metacercariae number per crayfish and per anatomical unit was registered. The prevalence, intensity and abundance (<a class="elsevierStyleCrossRef" href="#bib0080">Margolis, Esch, Holmes, Kuris, & Shad, 1982</a>) were calculated each month. In order to calculate and demonstrate a difference of parasitosis between both sexes the statistical <span class="elsevierStyleItalic">U</span>-Mann–Whitney test (<a class="elsevierStyleCrossRef" href="#bib0165">Zar, 2010</a>) was performed. In addition, the principal component analysis (PCA) was centered and standardized (<a class="elsevierStyleCrossRef" href="#bib0110">Pielou, 1984</a>) to evaluate the involvement of the abiotic variables in the presence of metacercariae. PCA results were used to determine which of the abiotic variables have more impact on metacercariae parasitization. Prevalence and abundance of metacercarie were related with temperature and oxygen concentration rates by linear regression using Excell to highlight the months of highest infection (<a class="elsevierStyleCrossRef" href="#bib0165">Zar, 2010</a>).</p><p id="par0030" class="elsevierStylePara elsevierViewall">In order to identify the parasites, the crayfish were dissected and each anatomical unit (antennules, antennas, maxillipeds, mandibles, maxils, periopods, pleopods, uropods, telson, gills and internal organs) was examined under stereo and compound microscopes. Once metacercaria cysts were identified and extracted from each anatomical unit, excystation was induced in water at room temperature and by occasional shaking. Photographs of the metarceriae were taken with a digital camera (Pentax-Optio 33 L) and the parasites were fixed for 2 weeks in 4% formaldehyde and then transferred to 70% ethanol. (<a class="elsevierStyleCrossRefs" href="#bib0125">Scholz et al., 2000; Vidal-Martínez, Aguirre-Macedo, Scholz, González-Solis, & Mendoza-Franco, 2002</a>). Some metacercarie were flattened between 2 slide glasses and stained with Delafield's hematoxylin or alcoholic hydrochloric carmine, cleared in clove oil and mounted in synthetic resin (<a class="elsevierStyleCrossRef" href="#bib0145">Vidal-Martínez et al., 2002</a>). The metacercariae were observed under a photomicroscope Axiophot Zeiss.</p><p id="par0035" class="elsevierStylePara elsevierViewall">For scanning electron microscopy (SEM), 10 metacercariae were washed twice with PBS and fixed with 2.5% glutaraldehyde in PBS for 1<span class="elsevierStyleHsp" style=""></span>h. Afterwards, the parasites were washed with PBS, post-fixed with 1% osmium tetroxide solution for 1<span class="elsevierStyleHsp" style=""></span>h, and dehydrated through a graded ethanol series (50–100%). Samples were dried using the critical point method, covered with gold and scanned and analyzed under a Jeol JSM-5800 LV.</p><p id="par0040" class="elsevierStylePara elsevierViewall">To confirm the identification of <span class="elsevierStyleItalic">Haematolechus</span> metacercariae species, 10 specimens were fixed in 90% ethanol and stock DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen). Nineteen 28S Ribosomal RNA gene sequences from different species or isolates (<span class="elsevierStyleItalic">Haematolechus complexus</span> AF133104, sp. AF133114, <span class="elsevierStyleItalic">Haematolechus illimis</span> AF133109, <span class="elsevierStyleItalic">Haematolechus medioplexus</span> AF133113, <span class="elsevierStyleItalic">Haematolechus</span> cf <span class="elsevierStyleItalic">complexus</span> AF532138, <span class="elsevierStyleItalic">H. pulcher</span> AF531866, <span class="elsevierStyleItalic">Haematolechus coloradensis</span> AF133108, <span class="elsevierStyleItalic">Haematolechus longiplexus</span> AF133110, sp. RML California 4 GU191159, California 1 GU191156, California 3 GU191158, <span class="elsevierStyleItalic">Haematolechus abbreviatus</span> AF184251, <span class="elsevierStyleItalic">Haematolechus variegatus</span> AF151916, <span class="elsevierStyleItalic">Haematolechus floedae</span> AY672126, <span class="elsevierStyleItalic">Haematolechus breviplexus</span> AF387800, <span class="elsevierStyleItalic">Haematolechus meridionalis</span> AF531864, <span class="elsevierStyleItalic">Haematolechus danbrooksi</span> AF479652, <span class="elsevierStyleItalic">Haematolechus parviplexus</span> AF479653 and <span class="elsevierStyleItalic">Haematolechus exoterorchis</span> AF531858) were used to perform a multiple sequence alignment using the Clustal-W program (<a class="elsevierStyleCrossRef" href="#bib0045">Larkin et al., 2007</a>) to obtain a set of primers for PCR amplification. A consensus sequence was generated by the alignment of a conservative region flanking a variable region. The primers 28S-F 5′ GAGGGTGAAAGGCCCGTGGG and 28S-R 5′ACGCATGCACACACCTCRAGCCG 3′ were designed. The 28S gene fragment was amplified in a 50<span class="elsevierStyleHsp" style=""></span>μl reaction containing 100<span class="elsevierStyleHsp" style=""></span>ng of DNA template, 8<span class="elsevierStyleHsp" style=""></span>μM forward and reverse primers and Master mix 2X (ROCHE). The cycling was performed as follows: initial denaturing step 94<span class="elsevierStyleHsp" style=""></span>°C/5<span class="elsevierStyleHsp" style=""></span>min followed by 40 cycles: denaturing 94<span class="elsevierStyleHsp" style=""></span>°C/45<span class="elsevierStyleHsp" style=""></span>s, annealing 60<span class="elsevierStyleHsp" style=""></span>°C/30<span class="elsevierStyleHsp" style=""></span>s and extension 72<span class="elsevierStyleHsp" style=""></span>°C/45<span class="elsevierStyleHsp" style=""></span>s and a final extension 72<span class="elsevierStyleHsp" style=""></span>°C/2<span class="elsevierStyleHsp" style=""></span>min. The PCR product (613<span class="elsevierStyleHsp" style=""></span>bp) was analyzed in a 1% agarose gel. The product was sequenced in both strands in the Unidad de Proteogenómica, UNAM, Juriquilla, Mexico. The sequence was viewed in the Chromas program Lite 2.01 and refined by hand. The final sequence (461nt) was analyzed by Blast in the NCBI server. The sequence was registered in GenBank (accession number <a href="ncbi-n:KM821049.1">KM821049.1</a>).</p><p id="par0045" class="elsevierStylePara elsevierViewall">The sequences of 28S Ribosomal RNA gene used for primers design were refined by hand and aligned using Clustas X 1.8 (<a class="elsevierStyleCrossRef" href="#bib0045">Larkin et al., 2007</a>) and visualized in Seaview (Gouy et al., 2010). Maximal likelihood analysis was performed using PhyML (<a class="elsevierStyleCrossRef" href="#bib0035">Guindon et al., 2010</a>).</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Results</span><p id="par0050" class="elsevierStylePara elsevierViewall">The metacercariae were oval (462<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>104<span class="elsevierStyleHsp" style=""></span>×<span class="elsevierStyleHsp" style=""></span>208<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>42<span class="elsevierStyleHsp" style=""></span>μm) with spinosed tegument; oral sucker sub apical (93<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>17<span class="elsevierStyleHsp" style=""></span>μm) and acetabulum post equatorial (66<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>12<span class="elsevierStyleHsp" style=""></span>μm diameter); pharynx lightly oval (47<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleHsp" style=""></span>×<span class="elsevierStyleHsp" style=""></span>42<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleHsp" style=""></span>μm) and intestinal ceca ending blindly and extended to the half 1/3 the posterior end of the body, the excretory vesicle was Y shaped forming 2 collecting tubes reaching the pharynx and the distance between the oral sucker and the acetabulum was 249.19<span class="elsevierStyleHsp" style=""></span>μm (<a class="elsevierStyleCrossRefs" href="#fig0005">Figs. 1 and 2</a>): it was not possible to observe other structures.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0055" class="elsevierStylePara elsevierViewall">The blast analysis revealed a 99% identity (457/461) with <span class="elsevierStyleItalic">Haematoloechus pulcher.</span> The <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a> shows the maximum likelihood phylogram tree generated. The phylogenetic relationship among the experimental and <span class="elsevierStyleItalic">H. pulcher</span> sequence confirm the identification. The phenogram showed 2 main branches. In the upper branch are clustered the California, experimental, <span class="elsevierStyleItalic">H. pulcher, H. complexus H. variegatus, H. abbbreviatus</span>, <span class="elsevierStyleItalic">H. exoterorchis</span> and <span class="elsevierStyleItalic">H. longiplexus.</span></p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0060" class="elsevierStylePara elsevierViewall">The prevalence of the metacercariae in crayfish was 42.5% (94/221). The maximum intensity of metacercariae (26) was recorded in a male crayfish with a size of 25.7<span class="elsevierStyleHsp" style=""></span>mm, collected in September 2008. The metacercarie were located mainly in the gills, podites and telson. Other anatomical units include: front, exoskeleton and internal organs (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 4</a>). The average intensity was 6 metacercariae by crayfish in both sexes. Metacercarie abundance was higher in females (2.6%) than in males (2.4%), however, the difference was not significant (<span class="elsevierStyleItalic">U</span>-Mann–Whitney <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.93). The sizes of crayfish analyzed ranged from 11.4 to 35<span class="elsevierStyleHsp" style=""></span>mm of length. The size at which the presence of parasites was detected in females was 13.94<span class="elsevierStyleHsp" style=""></span>mm, furthermore, an alteration in the intensity of infestation by cohorts was found. The parasite number in females increased gradually with size up to 32<span class="elsevierStyleHsp" style=""></span>mm (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 5</a>a). The male size range was 11.76–30.49<span class="elsevierStyleHsp" style=""></span>mm. The smallest parasitized specimen was 13.78<span class="elsevierStyleHsp" style=""></span>mm and the peek intensity of parasites was found in the size class from 26 to 30<span class="elsevierStyleHsp" style=""></span>mm of length (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 5</a>b).</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia><elsevierMultimedia ident="fig0030"></elsevierMultimedia><p id="par0065" class="elsevierStylePara elsevierViewall">Both male and female crayfish were parasitized throughout the year (except January) (<a class="elsevierStyleCrossRef" href="#fig0035">Fig. 6</a>). The abundance of metacercariae per crayfish was higher from March to June (<a class="elsevierStyleCrossRef" href="#fig0035">Fig. 6</a>a). The prevalence was higher from March to June (<a class="elsevierStyleCrossRef" href="#fig0035">Fig. 6</a>b). This results in a potentially active and ongoing infection. The average of the intensity increased from February to June (<a class="elsevierStyleCrossRef" href="#fig0035">Fig. 6</a>c).</p><elsevierMultimedia ident="fig0035"></elsevierMultimedia><p id="par0070" class="elsevierStylePara elsevierViewall">The abiotic factors recorded were as follows: the water temperature ranged from 10<span class="elsevierStyleHsp" style=""></span>°C in November and December, to 24<span class="elsevierStyleHsp" style=""></span>°C in May (at 15<span class="elsevierStyleHsp" style=""></span>h), with a global average of 16<span class="elsevierStyleHsp" style=""></span>°C. The pH ranged from 5 (December 2008) to 9.3 (February 2010), the average being 6.4. On the other hand, the oxygen concentration range was 4.4<span class="elsevierStyleHsp" style=""></span>mg/l (October) to 11.7<span class="elsevierStyleHsp" style=""></span>mg/l (May) with an average of 6.75<span class="elsevierStyleHsp" style=""></span>mg/l. The minimum transparency was 1.1<span class="elsevierStyleHsp" style=""></span>m (August and September) and the maximum was 3.67<span class="elsevierStyleHsp" style=""></span>m (February 2009). The catch per unit effort (CPUE) ranged from 3.5 (June and July) to 45 (August), with an average of 12 crayfish per sampling unit. The increase in the number of metacercariae in crayfish was related to the increase in temperature (<a class="elsevierStyleCrossRef" href="#fig0040">Fig. 7</a>a and c) and concentration of dissolved oxygen in water (<a class="elsevierStyleCrossRef" href="#fig0040">Fig. 7</a>b and d), present in warmer months (March to June). The correlation between temperature and abundance was not significant at 95% confidence level (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.059).</p><elsevierMultimedia ident="fig0040"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Discussion</span><p id="par0075" class="elsevierStylePara elsevierViewall">The purpose of this project was to analyze the presence of metacercariae infection in crayfish. Furthermore, if it is considered that almost 49.5% of the metacercariae were found in the gills, it is possible to conclude that the crayfish are parasited through the gill epithelium. The presence of metacercariae in such proportion, as epizoic organisms in gills of decapods, could reduce respiratory efficiency and result in a reduction of potential utilization, particularly in the case of crayfish (<a class="elsevierStyleCrossRef" href="#bib0095">Moctezuma, 1996</a>). Since the podites and telson structures had a similar parasite load intensity as the gills, another possibility of penetration by metacercarie presents itself in the joining membranes and the rectum, as happens in Odonata nymphs (Anisoptera) (<a class="elsevierStyleCrossRef" href="#bib0160">Yamaguti, 1975</a>). The maximum intensity of 26 metacercariae found in a male crayfish of 25.7<span class="elsevierStyleHsp" style=""></span>mm in length was mainly located in the cephalothorax, pereiopods, and antennules. Therefore, as well as the joint membranes, the exoskeleton can be considered as an alternative pathway, such as in the case of dragonflies (Zygoptera) infected by <span class="elsevierStyleItalic">H. complexus</span> (<a class="elsevierStyleCrossRef" href="#bib0160">Yamaguti, 1975</a>).</p><p id="par0080" class="elsevierStylePara elsevierViewall">The highest parasitemia was observed in the warmer months, providing suitable conditions for the development of crayfish: temperature of 21<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2<span class="elsevierStyleHsp" style=""></span>°C and O<span class="elsevierStyleInf">2</span> concentration of 4–6<span class="elsevierStyleHsp" style=""></span>mg/l (<a class="elsevierStyleCrossRef" href="#bib0050">Latournerié, Osorio, Cárdenas, & Romero, 2006</a>). This time interval is characterized by high ecdysis that results in the softening of the exoskeleton of the crayfish, rendering them subject to infestation. In addition, the lack of rain may increase the concentration of infective stages. On the other hand, metacercariae mainly parasitized crayfish structures which are in contact with the substrate. Apparently, the crayfish are excellent hosts for metacercariae since their benthic habits promote the infection (<a class="elsevierStyleCrossRef" href="#bib0155">Wetzel & Esch, 1996</a>). The crayfish cohabit with the first intermediate host, the snail <span class="elsevierStyleItalic">Physa</span> (<a class="elsevierStyleCrossRef" href="#bib0085">Mata-López et al., 2002</a>).</p><p id="par0085" class="elsevierStylePara elsevierViewall">The alternation in the intensity of infestation observed in cohorts could be related with the release of cercariae from the first host by pulses and the transition phase to a new host characterized by intermittent activity. This intermittent behavior is a mechanism used by many phyla whose advantage is to conserve energy and reduce predation (<a class="elsevierStyleCrossRef" href="#bib0135">Sukhdeo & Sukhdeo, 2004</a>).</p><p id="par0090" class="elsevierStylePara elsevierViewall">The direct relation between an increase of parasite intensity and the size of crayfish may be related to the body bulk “available” for the metacercariae, indeed, individuals with a total length smaller than 13.8<span class="elsevierStyleHsp" style=""></span>mm showed no metarcercariae, but an accumulation over time.</p><p id="par0095" class="elsevierStylePara elsevierViewall">The average values of temperature (16<span class="elsevierStyleHsp" style=""></span>°C) and dissolved oxygen (6.75<span class="elsevierStyleHsp" style=""></span>mg/l) recorded in the Salazar Lagoon, suggest a lentic environment, cooler and more oxygenated for <span class="elsevierStyleItalic">C. montezumae</span>, as the one recorded in Xochimilco, D.F. (<a class="elsevierStyleCrossRef" href="#bib0005">Álvarez & Rangel, 2007</a>), within the tolerance limits of this species (10–35<span class="elsevierStyleHsp" style=""></span>°C and 2<span class="elsevierStyleHsp" style=""></span>mg/l dissolved oxygen as minimum) (<a class="elsevierStyleCrossRef" href="#bib0095">Moctezuma, 1996</a>).</p><p id="par0100" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#bib0015">Bolek (2006)</a> demonstrated that <span class="elsevierStyleItalic">Rana pipiens</span> was infected with <span class="elsevierStyleItalic">Haematoloechus coloradensis</span> and <span class="elsevierStyleItalic">H. complexus</span> by feeding on non-odonate arthropods that act as secondary intermediate hosts. The adult stage of <span class="elsevierStyleItalic">H. pulcher</span> was registered in lungs of: <span class="elsevierStyleItalic">Ambystoma lermaensis</span> (<a class="elsevierStyleCrossRef" href="#bib0085">Mata-López et al., 2002</a>), <span class="elsevierStyleItalic">Ambystoma tigrinum</span> and <span class="elsevierStyleItalic">Lithobates montezumae</span> (=<span class="elsevierStyleItalic">Rana montezumae</span>) (<a class="elsevierStyleCrossRef" href="#bib0105">Pérez-Ponce De León, García-Prieto, & Mendoza-Garfias, 2007</a>) in the Cienega of Lerma, Estado de México (<a class="elsevierStyleCrossRef" href="#bib0020">Bravo, 1943</a>). Additionally, <span class="elsevierStyleItalic">L. montezumae</span> consumes mollusks and crustacean (<a class="elsevierStyleCrossRef" href="#bib0090">Mendoza, Lara, & Castro, 2008</a>), therefore both species could be the definitive host and the crayfish <span class="elsevierStyleItalic">C. montezumae</span>, the second intermediate host of the digenean <span class="elsevierStyleItalic">H. pulcher</span>.</p><p id="par0105" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">H. pulcher</span> was identified by taxonomic characters and DNA sequencing. Taking into account the variations that resulted from the abiotic factors, we conclude that <span class="elsevierStyleItalic">C. montezumae</span> should be considered a second intermediate host of the digenean in the Salazar Lagoon in Mexico due to the prevalence and presence of this parasite throughout the year.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres558877" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec574632" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres558876" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec574633" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:2 [ "identificador" => "sec0010" "titulo" => "Materials and methods" ] 6 => array:2 [ "identificador" => "sec0015" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0020" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "xack188088" "titulo" => "Acknowledgements" ] 9 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2014-03-28" "fechaAceptado" => "2015-05-14" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec574632" "palabras" => array:4 [ 0 => "Second host" 1 => "28S ribosomal RNA PCR identification" 2 => "Salazar Lake" 3 => "Crayfish prevalence" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec574633" "palabras" => array:4 [ 0 => "Segundo hospedero" 1 => "Identificación por PCR 28S RNA ribosomal" 2 => "Laguna Salazar" 3 => "Prevalencia de acocil" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Crayfish can be intermediate hosts of larval digeneans. <span class="elsevierStyleItalic">Cambarellus montezumae</span> is a crustacean endemic of the Mexican plateau and is part of the diet of the inhabitants of Lerma; nonetheless, this municipality lacks parasitological studies on the species of hosts. This work is an analysis of 13 samples collected monthly proceeding from the lakeshore. Two hundred and twenty one crayfish were examined externally and internally. The metacercariae number per crayfish and per anatomical unit was registered. The prevalence, intensity and abundance were recorded each month. Ninety four crayfish were parasitized by metacercariae encysted mainly in the gills. The highest prevalence was observed in March, May and June. In spite of the slight difference in abundance between females (2.6) and males (2.4), there was no significant difference (<span class="elsevierStyleItalic">U</span>-Mann–Whitney test). The highest parasite burden was 26, with an average of 6 metacercariae per crayfish. In addition, all specimens with a size larger than 14<span class="elsevierStyleHsp" style=""></span>mm presented metacercariae, the only larval stage detected. <span class="elsevierStyleItalic">C. montezumae</span> could be considered a second intermediate host of the digenean <span class="elsevierStyleItalic">Haematoloechus pulcher</span> in the Salazar Lake in Mexico due to the prevalence and presence of this parasite throughout the year.</p></span>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">El acocil puede ser hospedero intermediario de estados larvarios de digéneos. <span class="elsevierStyleItalic">Cambarellus montezumae</span> es un crustáceo endémico del altiplano mexicano y es parte de la dieta de los habitantes de Lerma; sin embargo, en este municipio se carece de estudios parasitológicos. Este trabajo es un análisis de 13 muestras recolectadas mensualmente procedentes de la orilla del lago. Se examinaron 221 acociles externa e internamente. Se registró el número de metacercarias por acocil y por unidad anatómica. La prevalencia, intensidad y abundancia se registraron mensualmente. Noventa y cuatro acociles fueron positivos a la infección, principalmente en branquias. La mayor prevalencia se observó en marzo, mayo y junio. A pesar de que resultó una ligera diferencia en la abundancia entre hembras (2.6) y machos (2.4), ésta no fue significativa (prueba <span class="elsevierStyleItalic">U</span>-Mann–Whitney). La mayor carga de parásitos fue 26, con un promedio de 6 metacercarias por acocil, única fase larvaria encontrada. Además, todos los individuos con una longitud mayor a 14<span class="elsevierStyleHsp" style=""></span>mm resultaron parasitados. <span class="elsevierStyleItalic">Cambarellus montezumae</span> podría considerarse un hospedero intermediario de <span class="elsevierStyleItalic">Haematoloechus pulcher</span> en el lago de Salazar en el Estado de México debido a su prevalencia a lo largo del año.</p></span>" ] ] "NotaPie" => array:1 [ 0 => array:1 [ "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Peer Review under the responsibility of Universidad Nacional Autónoma de México.</p>" ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1449 "Ancho" => 1800 "Tamanyo" => 338951 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Metacercariae de <span class="elsevierStyleItalic">Haematoloechus pulcher.</span> (A) Light microscopy image of excysted metacercaria, scale bar<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>μ; (B) SEM image of excysted metacercaria, scale bar<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>50<span class="elsevierStyleHsp" style=""></span>μm; (C) SEM image of the acetabulum scale bar<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>2<span class="elsevierStyleHsp" style=""></span>μm; (D) SEM image of the excretory pore scale bar<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5<span class="elsevierStyleHsp" style=""></span>μm.</p>" ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 616 "Ancho" => 980 "Tamanyo" => 90556 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Metacercariae de <span class="elsevierStyleItalic">Haematoloechus pulcher</span> showing the distance between the oral sucker and the acetabulum.</p>" ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2174 "Ancho" => 1742 "Tamanyo" => 174474 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Maximal likelihood phylogram reconstructed from 28S rRNA fragment gene sequences of the distinct isolates.</p>" ] ] 3 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1199 "Ancho" => 1627 "Tamanyo" => 62269 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Number of <span class="elsevierStyleItalic">Haematoloechus pulcher</span> metacercariae per anatomical unit of <span class="elsevierStyleItalic">Cambarellus montezumae</span>.</p>" ] ] 4 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2252 "Ancho" => 1618 "Tamanyo" => 132302 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Intensity of <span class="elsevierStyleItalic">Haematoloechus pulcher</span> metacercariae versus carapace length (mm) in <span class="elsevierStyleItalic">Cambarellus montezumae</span>. (A) Females; (B) males.</p>" ] ] 5 => array:7 [ "identificador" => "fig0035" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 3017 "Ancho" => 1616 "Tamanyo" => 201142 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Presence of <span class="elsevierStyleItalic">Haematoloechus pulcher</span> metacercariae during months of sampling collection. (A) Abundance; (B) prevalence; (C) intensity.</p>" ] ] 6 => array:7 [ "identificador" => "fig0040" "etiqueta" => "Figure 7" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr7.jpeg" "Alto" => 2063 "Ancho" => 3338 "Tamanyo" => 301371 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Association of abiotic variables and the presence of metacercariae in the crayfish <span class="elsevierStyleItalic">Cambarellus montezumae.</span> (A) Abundance of metacercariae (%) and association with the water temperature (°C); (B) abundance of metacercariae (%) and association with oxygen concentration (ppm); C: prevalence of metacercariae (%) and association with the water temperature (°C); D: prevalence of metacercariae (%) and association with oxygen concentration (ppm).</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:33 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "Álvarez and Rangel, 2007" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Estudio poblacional del acocil <span class="elsevierStyleItalic">Cambarellus montezumae</span> (Crustacea: Decapoda: Cambaridae) en Xochimilco, México" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F. Álvarez" 1 => "R. Rangel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Revista Mexicana de Biodiversidad" "fecha" => "2007" "volumen" => "78" "paginaInicial" => "4" "paginaFinal" => "31" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "Arredondo-Figueroa et al., 2011" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aspectos reproductivos del acocil <span class="elsevierStyleItalic">Cambarellus (Cambarellus) montezumae</span> (Crustacea: Decápoda: Cambaridae) bajo condiciones controladas" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.L. Arredondo-Figueroa" 1 => "A. Vásquez-González" 2 => "L.G. Nuñez-García" 3 => "I.A. Barriga-Sosa" 4 => "J.T. Ponce-Palafox" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Revista Mexicana de Biodiversidad" "fecha" => "2011" "volumen" => "82" "paginaInicial" => "169" "paginaFinal" => "178" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "Bolek, 2006" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of arthropod second intermediate hosts as a venues for and constraints on the transmission of frog lung flukes (Digenea: Haematolochodae)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M.G. Bolek" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "2006" "editorial" => "University of Nebraska" "editorialLocalizacion" => "Lincoln" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "Bravo, 1943" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Bravo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "fecha" => "1943" "paginaInicial" => "141" "paginaFinal" => "159" "editorial" => "Universidad Nacional Autónoma de México, Serie Zoología" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "Edgerton et al., 2000" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Synopsis of freshwater crayfish diseases and comensal organisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B.F. Edgerton" 1 => "L.H. Evans" 2 => "F.J. Stephen" 3 => "R.M. Overstreet" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Aquaculture" "fecha" => "2000" "volumen" => "206" "paginaInicial" => "57" "paginaFinal" => "135" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "Esch et al., 1990" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Parasite communities: patterns and process" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G.W. Esch" 1 => "A.O. Bush" 2 => "J.M. Aho" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1990" "editorial" => "Chapman and Hall" "editorialLocalizacion" => "New York" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "Guindon et al., 2010" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Guindon" 1 => "J.F. Dufayard" 2 => "V. Lefort" 3 => "M. Anisimova" 4 => "W. Hordijk" 5 => "O. Gascuel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/sysbio/syq010" "Revista" => array:6 [ "tituloSerie" => "Systematic Biology" "fecha" => "2010" "volumen" => "59" "paginaInicial" => "307" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20525638" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "Lane et al., 2009" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human paragonimiasis in North America following ingestion of raw crayfish" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.A. Lane" 1 => "M.C. Barsanti" 2 => "C.A. Santos" 3 => "M. Yeung" 4 => "S.J. Lubner" 5 => "G.J. Weil" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clinical Infectious Diseases" "fecha" => "2009" "volumen" => "15" "paginaInicial" => "55" "paginaFinal" => "61" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "Larkin et al., 2007" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clustal W and Clustal X version 2.0" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.A. Larkin" 1 => "G. Blackshields" 2 => "N.P. Brown" 3 => "R. Chenna" 4 => "P. McGettigan" 5 => "H. McWilliam" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/bioinformatics/btm404" "Revista" => array:6 [ "tituloSerie" => "Bioinformatics" "fecha" => "2007" "volumen" => "23" "paginaInicial" => "2947" "paginaFinal" => "2948" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17846036" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "Latournerié et al., 2006" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Crecimiento, producción y eficiencias de energía de crías de acocil <span class="elsevierStyleItalic">Cambarellus montezumae</span> (Saussure) alimentadas con detritus de <span class="elsevierStyleItalic">Egeria densa</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C.J.R. Latournerié" 1 => "N. Osorio" 2 => "R.J. Cárdenas" 3 => "J. Romero" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Revista Electrónica de Veterinaria" "fecha" => "2006" "volumen" => "12" "paginaInicial" => "1" "paginaFinal" => "12" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "Lefebvre and Poulin, 2005" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Progenesis in digenean trematodes: a taxonomic and synthetic overview of species reproducing in their second intermediate hosts" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F. Lefebvre" 1 => "R. Poulin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Parasitology" "fecha" => "2005" "volumen" => "130" "paginaInicial" => "587" "paginaFinal" => "605" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15977895" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "León-Règagnon and Brooks, 2003" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular phylogeny of <span class="elsevierStyleItalic">Haematoloechus</span> Looss, 1899 (Digenea: Plagiorchiidae), with emphasis on North American species" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "V. León-Règagnon" 1 => "D.R. Brooks" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1645/GE-95R" "Revista" => array:6 [ "tituloSerie" => "Journal of Parasitology" "fecha" => "2003" "volumen" => "89" "paginaInicial" => "1206" "paginaFinal" => "1211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14740911" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "León-Règagnon, 2010" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evidence of new species of <span class="elsevierStyleItalic">Haematoloechus</span> (Platyhelminthes: Digenea) using partial <span class="elsevierStyleItalic">cox1</span> sequences" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "V. León-Règagnon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/19401736.2010.523700" "Revista" => array:7 [ "tituloSerie" => "Mitochondrial DNA" "fecha" => "2010" "volumen" => "21" "numero" => "S1" "paginaInicial" => "12" "paginaFinal" => "17" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21271853" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "López-Ochoterena and Ochoa-Gasca, 1971" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Protozoarios ciliados de México. XVII. Algunos aspectos biológicos de veinte especies epizoicas del crustáceo <span class="elsevierStyleItalic">Cambarellus montezumae zempoalensis</span> Villalobos" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E. López-Ochoterena" 1 => "E. Ochoa-Gasca" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Revista Latinoamericana de Microbiología" "fecha" => "1971" "volumen" => "13" "paginaInicial" => "221" "paginaFinal" => "231" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/5003548" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "McAllister et al., 2011" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metacercaria of <span class="elsevierStyleItalic">Alloglossidium corti</span> (Digenea: Macroderoididae) from 3 species of crayfish (Decapoda: Cambaridae) in Arkansas and Oklahoma, USA" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C.T. McAllister" 1 => "H.W. Robison" 2 => "W.F. Font" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Comparative Parasitology" "fecha" => "2011" "volumen" => "78" "paginaInicial" => "382" "paginaFinal" => "386" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "Margolis et al., 1982" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The use of ecological terms in parasitology (report of an ad hoc committee of the American Society of Parasitologists)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "L. Margolis" 1 => "G.W. Esch" 2 => "J.C. Holmes" 3 => "A.M. Kuris" 4 => "G.A. Shad" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Journal of Parasitology" "fecha" => "1982" "volumen" => "68" "paginaInicial" => "131" "paginaFinal" => "133" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "Mata-López et al., 2002" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Infracomunidades de helmintos parásitos de <span class="elsevierStyleItalic">Ambystoma lermaensis</span> (Caudata: Ambystomatidae) en Lerma, México" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Mata-López" 1 => "L. García-Prieto" 2 => "V. León-Règagnon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Revista de Biología Tropical" "fecha" => "2002" "volumen" => "50" "paginaInicial" => "303" "paginaFinal" => "307" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12298257" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "Mendoza et al., 2008" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dieta de <span class="elsevierStyleItalic">Lithobates zweifeli</span> Hillis, Frost y Webb 1984 (Anura:Ranidae) en un río estacional del centro de México" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L.J. Mendoza" 1 => "R. Lara" 2 => "R. Castro" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Acta Zoológica Mexicana (n.s.)" "fecha" => "2008" "volumen" => "241" "paginaInicial" => "169" "paginaFinal" => "197" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "Moctezuma, 1996" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bases biológicas y técnicas para el cultivo del acocil <span class="elsevierStyleItalic">Cambarellus montezumae</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M.A. Moctezuma" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1996" "editorial" => "Facultad de Ciencias Marinas, Universidad de Colima" "editorialLocalizacion" => "Colima" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "Paredes-León et al., 2008" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metazoan parasites of Mexican amphibians and reptiles" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R. Paredes-León" 1 => "L. García-Prieto" 2 => "C. Guzmán-Cornejo" 3 => "V. León-Règagnon" 4 => "T.M. Pérez" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Zootaxa" "fecha" => "2008" "volumen" => "1904" "paginaInicial" => "1" "paginaFinal" => "166" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "Pérez-Ponce De León et al., 2007" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trematode parasites (Platyhelminthes) of wildlife vertebrates in Mexico" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G. Pérez-Ponce De León" 1 => "L. García-Prieto" 2 => "B. Mendoza-Garfias" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Zootaxa" "fecha" => "2007" "volumen" => "1534" "paginaInicial" => "1" "paginaFinal" => "247" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "Pielou, 1984" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The interpretation of ecological data: a primer on classification and ordination" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "E.C. Pielou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1984" "editorial" => "Wiley & Sons" "editorialLocalizacion" => "New York" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "Rioja, 1940" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Rioja, E. (1940). Estudios carcinológicos V. Morfología de un ostrácodo epizoario observado sobre <span class="elsevierStyleItalic">Cambarus (Cambarellus) montezumae</span> Sauss. de México, <span class="elsevierStyleItalic">Entocythere heterodonta</span> n. sp. y descripción de algunos de sus estados larvarios. <span class="elsevierStyleItalic">Anales del Instituto de Biología, Universidad Nacional Autónoma de México XI, 2</span>, 593-609." ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "Rodríguez and Carmona, 2002" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Balance energético de acocil <span class="elsevierStyleItalic">Cambarellus montezumae</span> (Saussure) (Crustacea: Astacidae: Cambaridae): pérdida de energía en la tasa metabólica" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Rodríguez" 1 => "C. Carmona" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Universidad y Ciencia" "fecha" => "2002" "volumen" => "36" "paginaInicial" => "128" "paginaFinal" => "134" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "Scholz et al., 2000" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Larval stages of trematodes in Mexican freshwater mollusks: a review of present state and methodology for future research" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T. Scholz" 1 => "M.L. Aguirre-Macedo" 2 => "A.T.S.F. Díaz de León" 3 => "O. Ditrich" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:2 [ "titulo" => "Metazoan parasites in the neotropics: a systematic and ecological perspective" "serieFecha" => "2000" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "Sogandares-Bernal, 1965" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Parasites from Louisiana crayfishes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F. Sogandares-Bernal" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Tulane Studies in Zoology" "fecha" => "1965" "volumen" => "12" "paginaInicial" => "79" "paginaFinal" => "85" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "Sukhdeo and Sukhdeo, 2004" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trematode behaviours and the perceptual worlds of parasites" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.V.K. Sukhdeo" 1 => "S.C. Sukhdeo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Canadian Journal of Zoology" "fecha" => "2004" "volumen" => "82" "paginaInicial" => "292" "paginaFinal" => "315" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "Vargas, 1997" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Vargas, M. F. (1997). <span class="elsevierStyleItalic">Parques Nacionales de México</span>. Vol. I. Zonas Centro, Occidente y Oriente. México, D.F.: Instituto Nacional de Ecología." ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "Vidal-Martínez et al., 2002" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Atlas de los helmintos parásitos de cíclidos de México" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "V. Vidal-Martínez" 1 => "L.M. Aguirre-Macedo" 2 => "T. Scholz" 3 => "D. González-Solis" 4 => "F. Mendoza-Franco" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "2002" "editorial" => "Instituto Politécnico Nacional" "editorialLocalizacion" => "México, D.F." ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "Villalobos, 1955" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cambarinos de la fauna mexicana (Crustacea: Decapoda)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F.A. Villalobos" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1955" "editorial" => "Facultad de Ciencias, UNAM" "editorialLocalizacion" => "México D.F." ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "Wetzel and Esch, 1996" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of odonate intermediate host ecology on the infection dynamics of <span class="elsevierStyleItalic">Halipegus</span> spp., <span class="elsevierStyleItalic">Haematoloechus longiplexus</span>, and <span class="elsevierStyleItalic">Haematoloechus complexus</span> (Trematoda: Digenea)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E.J. Wetzel" 1 => "G.W. Esch" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Journal of Helminthological Society of Washington" "fecha" => "1996" "volumen" => "63" "paginaInicial" => "1" "paginaFinal" => "7" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "Yamaguti, 1975" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A synoptic review of life histories of digenetic trematodes of vertebrates" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "S. Yamaguti" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1975" "editorial" => "Keigaku Publishing Co." "editorialLocalizacion" => "Tokyo" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "Zar, 2010" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biostatistical analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J.H. Zar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "edicion" => "5th ed." "fecha" => "2010" "editorial" => "Pearson Prentice-Hall" "editorialLocalizacion" => "Englewood Cliffs, NJ" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack188088" "titulo" => "Acknowledgements" "texto" => "<p id="par0110" class="elsevierStylePara elsevierViewall">To Yolotzi Morales-Gómez for helping in specimen collects and Jimena Hernández-León for the critical review of the manuscript.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/18703453/0000008600000003/v1_201509250133/S1870345315000780/v1_201509250133/en/main.assets" "Apartado" => array:4 [ "identificador" => "41749" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Ecología/Ecology" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/18703453/0000008600000003/v1_201509250133/S1870345315000780/v1_201509250133/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1870345315000780?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 5 | 1 | 6 |
| 2024 October | 18 | 1 | 19 |
| 2024 September | 20 | 1 | 21 |
| 2024 August | 16 | 0 | 16 |
| 2024 July | 18 | 3 | 21 |
| 2024 June | 11 | 6 | 17 |
| 2024 May | 8 | 7 | 15 |
| 2024 April | 11 | 7 | 18 |
| 2024 March | 54 | 4 | 58 |
| 2024 February | 20 | 6 | 26 |
| 2024 January | 17 | 2 | 19 |
| 2023 December | 13 | 7 | 20 |
| 2023 November | 21 | 4 | 25 |
| 2023 October | 18 | 8 | 26 |
| 2023 September | 25 | 1 | 26 |
| 2023 August | 14 | 2 | 16 |
| 2023 July | 9 | 3 | 12 |
| 2023 June | 13 | 3 | 16 |
| 2023 May | 42 | 4 | 46 |
| 2023 April | 31 | 1 | 32 |
| 2023 March | 27 | 3 | 30 |
| 2023 February | 42 | 0 | 42 |
| 2023 January | 26 | 2 | 28 |
| 2022 December | 46 | 8 | 54 |
| 2022 November | 28 | 9 | 37 |
| 2022 October | 23 | 12 | 35 |
| 2022 September | 37 | 5 | 42 |
| 2022 August | 21 | 19 | 40 |
| 2022 July | 19 | 10 | 29 |
| 2022 June | 17 | 8 | 25 |
| 2022 May | 19 | 14 | 33 |
| 2022 April | 23 | 12 | 35 |
| 2022 March | 25 | 6 | 31 |
| 2022 February | 49 | 4 | 53 |
| 2022 January | 27 | 9 | 36 |
| 2021 December | 45 | 3 | 48 |
| 2021 November | 30 | 6 | 36 |
| 2021 October | 36 | 10 | 46 |
| 2021 September | 24 | 6 | 30 |
| 2021 August | 28 | 7 | 35 |
| 2021 July | 17 | 6 | 23 |
| 2021 June | 33 | 7 | 40 |
| 2021 May | 33 | 8 | 41 |
| 2021 April | 59 | 21 | 80 |
| 2021 March | 16 | 15 | 31 |
| 2021 February | 19 | 13 | 32 |
| 2021 January | 17 | 5 | 22 |
| 2020 December | 14 | 13 | 27 |
| 2020 November | 13 | 9 | 22 |
| 2020 October | 13 | 7 | 20 |
| 2020 September | 18 | 7 | 25 |
| 2020 August | 24 | 6 | 30 |
| 2020 July | 11 | 9 | 20 |
| 2020 June | 9 | 2 | 11 |
| 2020 May | 21 | 2 | 23 |
| 2020 April | 15 | 3 | 18 |
| 2020 March | 22 | 4 | 26 |
| 2020 February | 14 | 3 | 17 |
| 2020 January | 22 | 3 | 25 |
| 2019 December | 28 | 11 | 39 |
| 2019 November | 18 | 5 | 23 |
| 2019 October | 24 | 4 | 28 |
| 2019 September | 28 | 6 | 34 |
| 2019 August | 20 | 1 | 21 |
| 2019 July | 30 | 1 | 31 |
| 2019 June | 64 | 4 | 68 |
| 2019 May | 111 | 15 | 126 |
| 2019 April | 93 | 7 | 100 |
| 2019 March | 24 | 0 | 24 |
| 2019 February | 37 | 5 | 42 |
| 2019 January | 46 | 3 | 49 |
| 2018 December | 48 | 8 | 56 |
| 2018 November | 39 | 4 | 43 |
| 2018 October | 49 | 10 | 59 |
| 2018 September | 8 | 5 | 13 |
| 2018 August | 5 | 11 | 16 |
| 2018 July | 5 | 0 | 5 |
| 2018 June | 6 | 3 | 9 |
| 2018 May | 9 | 6 | 15 |
| 2018 April | 9 | 9 | 18 |
| 2018 March | 9 | 0 | 9 |
| 2018 February | 2 | 1 | 3 |
| 2018 January | 2 | 1 | 3 |
| 2017 December | 8 | 0 | 8 |
| 2017 November | 5 | 1 | 6 |
| 2017 October | 8 | 7 | 15 |
| 2017 September | 18 | 1 | 19 |
| 2017 August | 5 | 1 | 6 |
| 2017 July | 7 | 1 | 8 |
| 2017 June | 8 | 10 | 18 |
| 2017 May | 7 | 6 | 13 |
| 2017 April | 7 | 28 | 35 |
| 2017 March | 6 | 67 | 73 |
| 2017 February | 10 | 1 | 11 |
| 2017 January | 8 | 1 | 9 |
| 2016 December | 16 | 4 | 20 |
| 2016 November | 26 | 4 | 30 |
| 2016 October | 35 | 3 | 38 |
| 2016 September | 33 | 2 | 35 |
| 2016 August | 25 | 4 | 29 |
| 2016 July | 17 | 1 | 18 |
Show all