was read the article
array:24 [ "pii" => "S2359348215300622" "issn" => "23593482" "doi" => "10.1016/S2359-3482(15)30062-2" "estado" => "S300" "fechaPublicacion" => "2014-12-01" "aid" => "30062" "copyright" => "Sociedade de Pediatria de São Paulo. Published by Elsevier Editora Ltda. All rights reserved.. All rights reserved" "copyrightAnyo" => "2014" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Paul Ped. 2014;32:292-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 178 "formatos" => array:3 [ "EPUB" => 13 "HTML" => 106 "PDF" => 59 ] ] "itemSiguiente" => array:19 [ "pii" => "S2359348215300634" "issn" => "23593482" "doi" => "10.1016/S2359-3482(15)30063-4" "estado" => "S300" "fechaPublicacion" => "2014-12-01" "aid" => "30063" "copyright" => "Sociedade de Pediatria de São Paulo. Published by Elsevier Editora Ltda. All rights reserved." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Paul Ped. 2014;32:299-305" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 181 "formatos" => array:3 [ "EPUB" => 6 "HTML" => 106 "PDF" => 69 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Epidemiological profile of exogenous poisoning in children and adolescents from a municipality in the state of Mato Grosso<a class="elsevierStyleCrossRef" href="#fn1"><span class="elsevierStyleSup">*</span></a>" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "299" "paginaFinal" => "305" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Perfil epidemiológico das intoxicações exógenas em crianças e adolescentes em município do mato grosso" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Felipe Ferreira S. Oliveira, Eliane Aparecida Suchara" "autores" => array:2 [ 0 => array:2 [ "nombre" => "Felipe Ferreira S." "apellidos" => "Oliveira" ] 1 => array:2 [ "nombre" => "Eliane Aparecida" "apellidos" => "Suchara" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2359348215300634?idApp=UINPBA00004N" "url" => "/23593482/0000003200000004/v1_201507180038/S2359348215300634/v1_201507180038/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S2359348215300610" "issn" => "23593482" "doi" => "10.1016/S2359-3482(15)30061-0" "estado" => "S300" "fechaPublicacion" => "2014-12-01" "aid" => "30061" "copyright" => "Sociedade de Pediatria de São Paulo. Published by Elsevier Editora Ltda. All rights reserved." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Paul Ped. 2014;32:285-91" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 139 "formatos" => array:3 [ "EPUB" => 8 "HTML" => 89 "PDF" => 42 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Diagnosis of streptococcal pharyngotonsillitis in children and adolescents: clinical picture limitations<a class="elsevierStyleCrossRef" href="#fn1"><span class="elsevierStyleSup">*</span></a>" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "285" "paginaFinal" => "291" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Diagnóstico da faringoamigdalite estreptocócica em crianças e adolescentes: limitações do quadro clínico" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Aurelino Rocha Barbosa, Cláudia Di Lorenzo Oliveira, Maria Jussara Fernandes Fontes, Laura Maria de Lima Bezário Facury Lasmar, Paulo Augusto Moreira Camargos" "autores" => array:5 [ 0 => array:3 [ "nombre" => "Aurelino Rocha" "apellidos" => "Barbosa" "sufijo" => "Júnior" ] 1 => array:2 [ "nombre" => "Cláudia" "apellidos" => "Di Lorenzo Oliveira" ] 2 => array:2 [ "nombre" => "Maria Jussara Fernandes" "apellidos" => "Fontes" ] 3 => array:2 [ "nombre" => "Laura Maria" "apellidos" => "de Lima Bezário Facury Lasmar" ] 4 => array:2 [ "nombre" => "Paulo Augusto" "apellidos" => "Moreira Camargos" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2359348215300610?idApp=UINPBA00004N" "url" => "/23593482/0000003200000004/v1_201507180038/S2359348215300610/v1_201507180038/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Clinical, laboratorial and radiographic predictors of <span class="elsevierStyleItalic">Bordetella pertussis</span> infection<a class="elsevierStyleCrossRef" href="#fn1"><span class="elsevierStyleSup">*</span></a>" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "292" "paginaFinal" => "298" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Camila Vieira Bellettini, Andressa Welter de Oliveira, Cintia Tusset, Ludmila Fiorenzano Baethgen, Sérgio Luís Amantéa, Fabrizio Motta, Aline Gasparotto, Huander Felipe Andreolla, Alessandro C. Pasqualotto" "autores" => array:9 [ 0 => array:3 [ "nombre" => "Camila Vieira" "apellidos" => "Bellettini" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] ] ] 1 => array:3 [ "nombre" => "Andressa Welter" "apellidos" => "de Oliveira" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] ] ] 2 => array:3 [ "nombre" => "Cintia" "apellidos" => "Tusset" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] ] ] 3 => array:3 [ "nombre" => "Ludmila Fiorenzano" "apellidos" => "Baethgen" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] ] ] 4 => array:3 [ "nombre" => "Sérgio Luís" "apellidos" => "Amantéa" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] ] ] 5 => array:3 [ "nombre" => "Fabrizio" "apellidos" => "Motta" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] ] ] 6 => array:3 [ "nombre" => "Aline" "apellidos" => "Gasparotto" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] ] ] 7 => array:3 [ "nombre" => "Huander Felipe" "apellidos" => "Andreolla" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] ] ] 8 => array:4 [ "nombre" => "Alessandro C." "apellidos" => "Pasqualotto" "email" => array:1 [ 0 => "acpasqualotto@hotmail.com" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, RS, Brazil" "etiqueta" => "a" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Irmandade Santa Casa de Misericórdia de Porto Alegre, Porto Alegre, RS, Brazil" "etiqueta" => "b" "identificador" => "aff2" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Corresponding author" ] ] ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Preditores clínicos, laboratoriais e radiográficos para infecção por <span class="elsevierStyleItalic">Bordetella pertussis</span>" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 914 "Ancho" => 1499 "Tamanyo" => 101388 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">Frequency of codetection of other respiratory pathogens in patients with Bordetella pertussis infection</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="cesec10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle130">Introduction</span><p id="para10" class="elsevierStylePara elsevierViewall">Pertussis or whooping cough is an acute respiratory tract infection caused by <span class="elsevierStyleItalic">Bordettella pertussis</span> and ranked among the 10 leading causes of childhood mortality.<a class="elsevierStyleCrossRef" href="#bib1"><span class="elsevierStyleSup">1</span></a> An increasing number of pertussis outbreaks have been reported in the last years despite vaccination coverage. Indeed, in the last decades, the age range of affected individuals appears to have widened and the incidence of pertussis in adolescents and adults has raised.<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2–5</span></a> It is essential the prompt recognition of patients with this condition, because a delay in diagnosis could result in late onset of antibiotic treatment subsequently increasing the potential for secondary transmission.<a class="elsevierStyleCrossRef" href="#bib6"><span class="elsevierStyleSup">6</span></a> However, clinical diagnosis of whooping cough is difficult to perform, once clinical manifestations can vary according to immunization status, patient's age and the disease stages.<a class="elsevierStyleCrossRefs" href="#bib3"><span class="elsevierStyleSup">3,5,7–8</span></a></p><p id="para20" class="elsevierStylePara elsevierViewall">Previous studies have evaluated the impact of concomitant detection of <span class="elsevierStyleItalic">B. pertussis</span> with other respiratory agents<a class="elsevierStyleCrossRefs" href="#bib9"><span class="elsevierStyleSup">9–10</span></a>, suggesting that <span class="elsevierStyleItalic">B. pertussis</span> infection could be more severe in this context.<a class="elsevierStyleCrossRefs" href="#bib11"><span class="elsevierStyleSup">11–13</span></a> Mixed respiratory infections have been reported in children in several countries,<a class="elsevierStyleCrossRef" href="#bib14"><span class="elsevierStyleSup">14</span></a> but its actual incidence is believed to be even higher.<a class="elsevierStyleCrossRefs" href="#bib12"><span class="elsevierStyleSup">12–13</span></a></p><p id="para30" class="elsevierStylePara elsevierViewall">The purpose of this study was to describe the clinical profile of patients with suspected <span class="elsevierStyleItalic">B. pertussis</span> infection, and to identify the clinical, laboratorial and radiographic predictors for <span class="elsevierStyleItalic">B. pertussis</span> infection. We also aimed to determine the frequency of concomitant respiratory tract infections in this population, as well as to determine if co-infections were associated with greater morbidity and/or mortality in patients with <span class="elsevierStyleItalic">B. pertussis</span> infection.</p></span><span id="cesec20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle140">Methods</span><p id="para40" class="elsevierStylePara elsevierViewall">This was a retrospective case series study performed at Santa Casa de Misericórdia de Porto Alegre, Brazil, from September 2011 to January 2013. We studied patients with suspected <span class="elsevierStyleItalic">B. pertussis</span> infection for whom a molecular diagnosis was performed at Molecular Biology Laboratory at Santa Casa. We included hospitalized patients, and patients with suspected infection that attended the emergency room or physician's office in the hospital. All patients who were tested for pertussis by real time polymerase chain reaction (qPCR) in the study period, regardless of age, were studied. Clinical samples consisted of nasopharyngeal aspirates collected by hospital's nursing team. Clinical and laboratorial data were extracted by a standardized clinical form, including information about age, sex, signs/symptoms, length of hospitalization, blood cells count, chest imaging findings, concomitant detection of other respiratory pathogens and clinical outcome. This study was approved by the local Ethic Committee (n. 115333), and all researchers signed a commitment statement to use patient's records, ensuring the confidentiality of this work.</p><p id="para50" class="elsevierStylePara elsevierViewall">The in house qPCR test used in this study has been available in the institution since 2011. In summary, DNA was extracted with QIAamp DNA Mini Kit (Qiagen) and stored at −80ºC. qPCR was performed using Platinum® SYBR® Green qPCR SuperMix-UDG (Invitrogen™). Primers (0.2uM each) were ACGCAGTGGCCTACTACCAG and GCGGTAAGGTCGGGTAAAG. All reactions included a positive control (DNA extracted from Fiocruz ATCC strain), a negative control and an internal control (HuPO), in 25ul reactions. The qPCR conditions were 2 min at 50ºC, 5 min at 95ºC, 45 cycles of 15 sec at 95ºC and 30 sec at 60ºC, followed by 15 sec at 95ºC, 1 min at 60ºC, 30 sec at 95ºC, and 15 sec at 60ºC. A positive qPCR test was assumed as a confirmatory test for pertussis, while a negative qPCR was considered as absence of the disease.</p><p id="para60" class="elsevierStylePara elsevierViewall">Statistical analyzes were performed by SPSS software (version 17.0). Patients with positive and negative qPCR results for <span class="elsevierStyleItalic">B. pertussis</span> were compared. Chi-squared test was used for categorical variables and the Mann-Whitney test was applied for continuous data. Significance was determined at α<0.05. Multivariate analysis was performed in order to identify independent predictors for <span class="elsevierStyleItalic">B. pertussis</span> infection.</p></span><span id="cesec30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle150">Results</span><p id="para70" class="elsevierStylePara elsevierViewall">Medical records of 222 patients with suspected <span class="elsevierStyleItalic">B. pertussis</span> infection were reviewed. Among these, qPCR confirmed <span class="elsevierStyleItalic">B. pertussis</span> infection in 161 (72.5%) patients. The great majority was tested by qPCR only. Four patients were also submitted (and tested negative) to additional diagnostic test, including serology and culture. Among positive qPCR cases, 60.9% were younger than 1 year, and 52.8% were boys. <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a> shows the age distribution according to qPCR results. The most common clinical manifestations were cough (100%), cyanosis (59.6%), plethora (49.7%), posttussive vomiting (37.9%), fever (34.2%), respiratory effort (36%) and whoop (15.5%). Most of patients with cyanosis were up to one year (81.3%), but this sign was also observed in older children and adolescents up to 13 years old. The median time interval between the beginning of symptoms and the sample submission for qPCR testing was 15 days (range, 1–60 days), versus 19 days in qPCR negative group (<span class="elsevierStyleItalic">p</span>=0.49). In the positive qPCR patients, the main alteration on chest X-ray was diffuse infiltrate (58.3%), followed by hyperinflated lungs (22.8%) and atelectasis (16.5%). Mean [range] blood cells (% where indicated) for patients with B. pertussis infection were as follows: 21,607 [6,470–99,700] (white blood cells); 11,515 [367–43,908] (lymphocytes); 53.6% [5.5–78.0%] (percentage of lymphocytes); and 503,205 [150,000–946,000] (platelets). Overall mortality in patients with <span class="elsevierStyleItalic">B. pertussis</span> infection was 2.5%; all occurring in patients 3 months of age or younger. Comparisons of the clinical and laboratorial data of patients with positive and negative qPCR results for pertussis are presented in <a class="elsevierStyleCrossRef" href="#tbl2">Table 2</a>.</p><elsevierMultimedia ident="tbl1"></elsevierMultimedia><elsevierMultimedia ident="tbl2"></elsevierMultimedia><p id="para80" class="elsevierStylePara elsevierViewall">From all of our patients, 164 were hospitalized (73.8%). Hospitalization rate in age up to 6 months was 94% (versus 56.6% of patients older than 6 months; <span class="elsevierStyleItalic">p</span><0.001). Besides age, laboratorial features were also predictors of hospitalization in pertussis: lymphocytosis (<span class="elsevierStyleItalic">p</span>=0.001), leukocytosis (<span class="elsevierStyleItalic">p</span>=0.001) and thrombocytosis (<span class="elsevierStyleItalic">p</span><0.001). There was no statistic significant difference between these groups (hospitalized vs. outpatient) in relation to qPCR result (75.1% in qPCR+ vs. 70.4% in qPCR-; <span class="elsevierStyleItalic">p</span>=0.4) and presence of co-infections (95% in coinfected vs. 91.3% in no coinfected <span class="elsevierStyleItalic">p</span>=0.5).</p><p id="para90" class="elsevierStylePara elsevierViewall">Immunization data was reported only in 54.5% of cases. Data available showed that 62% of positive and 31% of negative cases had received any or only one dose of the vaccine against <span class="elsevierStyleItalic">B. pertussis</span>, while only 6.5% of positive cases (versus 20.7% of negative cases) had complete immunization [in Brazil, this consists in 3 doses and 2 boosters of the vaccine]. Despite this percentage contrast, there was no statistic significant difference between the groups (<span class="elsevierStyleItalic">p</span>=0.068). Immunization received according to age group is demonstrated in <a class="elsevierStyleCrossRef" href="#tbl3">Table 3</a>.</p><elsevierMultimedia ident="tbl3"></elsevierMultimedia><p id="para100" class="elsevierStylePara elsevierViewall">We divided patients in two different groups: children aged 6 months or younger and patients older than 6 months. Predictors of <span class="elsevierStyleItalic">B. pertussis</span> infection at univariate analysis for patients aged 6 months or younger were cyanosis (OR 5.32, CI 95% 1.79–15.8; <span class="elsevierStyleItalic">p</span>=0.001), plethora (OR 4.49, CI 95% 1.54–13.1; <span class="elsevierStyleItalic">p</span>=0.004), leukocyte count (<span class="elsevierStyleItalic">p</span>=0.031), lymphocyte count (<span class="elsevierStyleItalic">p</span><0.0001), and percentage of lymphocytes (<span class="elsevierStyleItalic">p</span>=0.002). At multivariate analysis, cyanosis (OR 8.0, CI 95% 1.8–36.3; <span class="elsevierStyleItalic">p</span>=0.007) and lymphocyte count >10<a class="elsevierStyleCrossRef" href="#bib4"><span class="elsevierStyleSup">4</span></a>/µL (OR 10.0, CI 95% 1.8–54.5; <span class="elsevierStyleItalic">p</span>=0.008) were independent predictors for pertussis in children younger than 6 months of age. The only variables associated with pertussis for patients aged more than 6 months at univariate analysis were leukocyte count (<span class="elsevierStyleItalic">p</span>=0.019) and lymphocyte count (<span class="elsevierStyleItalic">p</span>=0.018). Atelectasis was associated with the presence of diagnoses other than pertussis (OR 0.2, CI 95% 0.07–0.88; <span class="elsevierStyleItalic">p</span>=0.024), in this group of patients. At multivariate analysis, no variable was associated with pertussis in patients older than 6 months of age.</p><p id="para110" class="elsevierStylePara elsevierViewall">A total of 103 patients with confirmed <span class="elsevierStyleItalic">B. pertussis</span> infection were also tested for other respiratory pathogens [also detected by <span class="elsevierStyleItalic">in house</span> qPCR or bacterial culture]. Co-detection was found in 21.4% of these patients, 72.7% of whom were 6 months of age or younger, 13.6% were older than 6 months but younger than 1 year, and 13.6% were between 1 and 4 years old. <a class="elsevierStyleCrossRef" href="#fig1">Fig. 1</a> displays the frequency of co-detection of other respiratory pathogens in patients with pertussis. There was no statistically significant difference between age and pathogens distribution (<span class="elsevierStyleItalic">p</span>=0.71). Patients with co-detection of pertussis and other respiratory pathogens had prolonged stay in the hospital (12 vs. 6 days; <span class="elsevierStyleItalic">p</span>=0.009) and more atelectasis on chest X-ray (38.1% vs. 16.7%; OR 3.3, CI 95% 1.1–9.5; <span class="elsevierStyleItalic">p</span>=0.023).</p><elsevierMultimedia ident="fig1"></elsevierMultimedia></span><span id="cesec40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle160">Discussion</span><p id="para120" class="elsevierStylePara elsevierViewall">In this work, we reviewed the clinical charts of 222 patients suspected of <span class="elsevierStyleItalic">B. pertussis</span> infection. Of these, the diagnosis of pertussis was confirmed in 72.5% by the means of qPCR. Considering that only four patients were also submitted to another diagnostic test for comparison (serology or culture), we assumed that negative qPCR indicated absence of the disease. Even though, all patients were in a similar moment of disease by the time of molecular diagnosis.</p><p id="para130" class="elsevierStylePara elsevierViewall">As expected, most of these children were aged 1 year of age or less (60.9%), which is in accordance with previous data that reported rates between 50% and 64.6% in this age group.<a class="elsevierStyleCrossRefs" href="#bib15"><span class="elsevierStyleSup">15–16</span></a> Recently, it was reported a significant increase in the incidence of pertussis in adolescents and adults.<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2–3</span></a> However, in this study, few individuals with positive qPCR were older than 15 years (1.8%). This fact could be justified by the heterogeneity in the clinical manifestations of pertussis, in association with a low index of suspicion among clinicians for such condition in adults.<a class="elsevierStyleCrossRefs" href="#bib3"><span class="elsevierStyleSup">3,17–20</span></a></p><p id="para140" class="elsevierStylePara elsevierViewall">It is well known that pertussis may present different manifestations according to patients' age, among children.<a class="elsevierStyleCrossRefs" href="#bib3"><span class="elsevierStyleSup">3,5,8,21–22</span></a> In this work, we stratified patients in two separated groups: children aged 6 months or less and patients older than 6 months. Our results suggest that classical manifestations of pertussis vary according to patients' age and presumably to the number of vaccine doses against <span class="elsevierStyleItalic">B. pertussis</span> they receive. For instance, in younger children (i.e., <6 months of age), pertussis was associated with the presence of cyanosis, plethora, leukocyte count, lymphocyte count and lymphocytes percentage. Multivariate analysis showed that cyanosis and lymphocyte count were able to predict pertussis in this patient group. On the other hand, older patients (i.e., >6 months of age) presented with less classical symptoms of pertussis, and no variable could be independently associated with pertussis. This is similar to previously reported data, showing that patients who were immunized against pertussis may develop the disease with atypical presentations.<a class="elsevierStyleCrossRefs" href="#bib5"><span class="elsevierStyleSup">5,6,18–20</span></a> The most common typical finding, which appears to be present in all age groups, is prolonged cough.<a class="elsevierStyleCrossRefs" href="#bib7"><span class="elsevierStyleSup">7,18–19</span></a></p><p id="para150" class="elsevierStylePara elsevierViewall">Cyanosis is already known as a pertussis classic symptom,<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2,8</span></a> and leukocytosis attributable to lymphocytosis is also recognized as a hallmark of pertussis.<a class="elsevierStyleCrossRefs" href="#bib7"><span class="elsevierStyleSup">7,23–25</span></a> In this study, lymphocytosis was not only a hallmark, but also was an independent predictor for <span class="elsevierStyleItalic">B. pertussis</span> infection in young infants. The cutoff point (10<a class="elsevierStyleCrossRef" href="#bib4"><span class="elsevierStyleSup">4</span></a>/µL) was similar with those found in previous studies.<a class="elsevierStyleCrossRefs" href="#bib24"><span class="elsevierStyleSup">24,25</span></a> These data suggest that the occurrence of cyanosis should increase the pediatriciańs suspicion of <span class="elsevierStyleItalic">B. pertussis</span> infection, particularly in the presence of lymphocytosis in a young child.</p><p id="para160" class="elsevierStylePara elsevierViewall">Co-detection of <span class="elsevierStyleItalic">B. pertussis</span> with other respiratory agents has already been reported,<a class="elsevierStyleCrossRefs" href="#bib12"><span class="elsevierStyleSup">12,22,26–29</span></a> and it may be actually underestimated.<a class="elsevierStyleCrossRefs" href="#bib12"><span class="elsevierStyleSup">12–13</span></a> It was reported that pertussis toxin may suppress innate immune response and sensitize the host to a secondary respiratory pathogen.<a class="elsevierStyleCrossRef" href="#bib13"><span class="elsevierStyleSup">13</span></a> In our study, we found an incidence of 21.4% of mixed infections; the most frequent pathogens associated with <span class="elsevierStyleItalic">B. pertussis</span> were adenovirus, RSV and parainfluenza type 3 virus. These viruses (especially RSV) were also prevalent in some previous reports.<a class="elsevierStyleCrossRefs" href="#bib22"><span class="elsevierStyleSup">22,26–29</span></a> The evaluation of laboratorial data of infants up to 6 months showed that lymphocyte percentage is significant different (and higher) among patients with respiratory pathogens co-detection and patients with only pertussis identification. Previous studies related mixed infection with higher severity of the disease.<a class="elsevierStyleCrossRefs" href="#bib11"><span class="elsevierStyleSup">11–13</span></a> In this work, patients with co-detection pathogens had a longer period of hospitalization, reinforcing the relationship between mixed infection and a more severe disease. On the other hand, as reported in other works, we did not reliably distinguish clinical features of infants with mixed infection from those with only pertussis detection.<a class="elsevierStyleCrossRefs" href="#bib11"><span class="elsevierStyleSup">11–12,22,26–27</span></a> Furthermore, it is important to note that less than 50% of our patients were tested to other patogens, and these results must be seen with caution.</p><p id="para170" class="elsevierStylePara elsevierViewall">This study has some limitations that should be mentioned. In view of its retrospective design and the samples were obtained by convenience, some data were missing at analysis, particularly those related to immunization history, clinical and laboratorial exams, and co-infection tests. Despite that were to study a large number of patients, and for most of the other variables data missing was minimal. Another limitation is related to the limited number of adult patients included in the study – therefore, our conclusion cannot be extrapolated to this patient group.</p><p id="para180" class="elsevierStylePara elsevierViewall">An increasing number of pertussis outbreaks have been reported despite vaccination coverage.<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2–5</span></a> It is unclear the factor that contribute to pertussis resurgence, but waning immunity, improved surveillence and diagnosis, as well as adaptation of circulating Bordetella pertussis strains could be involved.<a class="elsevierStyleCrossRef" href="#bib5"><span class="elsevierStyleSup">5</span></a> Even though, the most important and effective way to control pertussis remains vaccination.<a class="elsevierStyleCrossRef" href="#bib5"><span class="elsevierStyleSup">5</span></a> Ensuring wider immunization coverage, as well as developing newer strategies to avoid waning immunity after pertussis vaccination and disease – as booster vaccines in adolescents and adults – is something highly desirable.<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2,4,5</span></a><span class="elsevierStyleItalic">B. pertussis</span> infection is a common disease affecting all ages. Clinicians should be aware of this condition and perform a prompt diagnosis and initiate an early treatment, avoiding secondary transmission of the disease. This work showed that young children may manifest clinical and laboratorial features that may help the clinician to suspect the presence of pertussis. Although children with 6 months or more and adults may present with atypical manifestations of pertussis, the diagnosis must be always considered in these patients, in the presence of prolonged cough.</p></span><span id="cesec50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle170">Conflicts of interest</span><p id="para190" class="elsevierStylePara elsevierViewall">The authors declare no conflitcts of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres534292" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs10" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "ceabs20" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "ceabs30" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "ceabs40" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec554626" "titulo" => "KEYWORDS" ] 2 => array:3 [ "identificador" => "xres534293" "titulo" => "Resumo" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs50" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "ceabs60" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "ceabs70" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "ceabs80" "titulo" => "Conclusões" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec554625" "titulo" => "PALAVRAS-CHAVE" ] 4 => array:2 [ "identificador" => "cesec10" "titulo" => "Introduction" ] 5 => array:2 [ "identificador" => "cesec20" "titulo" => "Methods" ] 6 => array:2 [ "identificador" => "cesec30" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "cesec40" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "cesec50" "titulo" => "Conflicts of interest" ] 9 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2014-03-11" "fechaAceptado" => "2014-06-09" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "KEYWORDS" "identificador" => "xpalclavsec554626" "palabras" => array:4 [ 0 => "Bordetella pertussis" 1 => "Whooping cough" 2 => "Infection" 3 => "Coinfection" ] ] ] "pt" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "PALAVRAS-CHAVE" "identificador" => "xpalclavsec554625" "palabras" => array:4 [ 0 => "Bordetella pertussis" 1 => "Coqueluche" 2 => "Infecção" 3 => "Coinfecção" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="ceabs10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle20">Objective</span><p id="spara80" class="elsevierStyleSimplePara elsevierViewall">To identify clinical, laboratorial and radiographic predictors for <span class="elsevierStyleItalic">Bordetella pertussis</span> infection.</p></span> <span id="ceabs20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle30">Methods</span><p id="spara90" class="elsevierStyleSimplePara elsevierViewall">This was a retrospective study, which analyzed medical records of all patients submitted to a molecular dignosis (qPCR) for <span class="elsevierStyleItalic">B. pertussis</span> from September 2011 to January 2013. Clinical and laboratorial data were reviewed, including information about age, sex, signs/symptoms, length of hospitalization, blood cell counts, imaging findings, coinfection with other respiratory pathogens and clinical outcome.</p></span> <span id="ceabs30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle40">Results</span><p id="spara100" class="elsevierStyleSimplePara elsevierViewall">222 cases were revised. Of these, 72.5% had proven pertussis, and 60.9% were under 1 year old. In patients aging up to six months, independent predictors for <span class="elsevierStyleItalic">B. pertussis</span> infection were (OR 8.0, CI 95% 1.8–36.3; <span class="elsevierStyleItalic">p</span>=0.007) and lymphocyte count >10<a class="elsevierStyleCrossRef" href="#bib4"><span class="elsevierStyleSup">4</span></a>/µL (OR 10.0, CI 95% 1.8–54.5; <span class="elsevierStyleItalic">p</span>=0.008). No independent predictors of <span class="elsevierStyleItalic">B. pertussis</span> infection could be determined for patients older than six months. Co-infection was found in 21.4% of patients, of which 72.7% were up to six months of age. Adenovirus was the most common agent (40.9%). In these patients, we were not able to identify any clinical features to detect patients presenting with a respiratory co-infection, even though longer hospital stay was observed in patients with co-infections (12 vs. 6 days; <span class="elsevierStyleItalic">p</span>=0.009).</p></span> <span id="ceabs40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle50">Conclusions</span><p id="spara110" class="elsevierStyleSimplePara elsevierViewall">Cyanosis and lymphocytosis are independent predictors for pertussis in children up to 6 months old.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs10" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "ceabs20" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "ceabs30" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "ceabs40" "titulo" => "Conclusions" ] ] ] "pt" => array:3 [ "titulo" => "Resumo" "resumen" => "<span id="ceabs50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle70">Objetivo</span><p id="spara120" class="elsevierStyleSimplePara elsevierViewall">Identificar preditores clínicos, laboratoriais e radiológicos da infecção por <span class="elsevierStyleItalic">Bordetella pertussis</span>.</p></span> <span id="ceabs60" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle80">Métodos</span><p id="spara130" class="elsevierStyleSimplePara elsevierViewall">Trabalho retrospectivo, com análise de prontuários clínicos de todos os indivíduos submetidos ao diagnóstico molecular (qPCR) para <span class="elsevierStyleItalic">Bordetella pertussis</span> de setembro de 2011 à janeiro de 2013. Foram revistos dados clínicos e laboratoriais, incluindo informações sobre idade, sexo, sinais/sintomas, tempo de hospitalização, contagens de células sanguíneas, exames de imagem, co-infecção com outros patógenos respiratórios, e evolução clínica.</p></span> <span id="ceabs70" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle90">Resultados</span><p id="spara140" class="elsevierStyleSimplePara elsevierViewall">222 casos foram revistos, do quais 72,5% tinham coqueluche confirmada, sendo 60,9% menores de um ano de idade. Foram observados preditores independentes para <span class="elsevierStyleItalic">Bordetella pertussis</span> em pacientes com menos de seis meses de idade. Nesses casos, os preditores identificados foram cianose (OR 8,0; CI 95% 1,8–36,3; <span class="elsevierStyleItalic">p</span>=0,007) e contagem de linfócitos >10<a class="elsevierStyleCrossRef" href="#bib4"><span class="elsevierStyleSup">4</span></a>/µL (OR 10,0; CI 95% 1,8–54,5; <span class="elsevierStyleItalic">p</span>=0,008). Preditores de coqueluche não puderam ser determinados para crianças maiores de 6 meses de idade. Co-infecção foi encontrada em 21,4% dos pacientes, dos quais 72,7% tinham até seis meses de idade, sendo que o adenovírus foi o agente mais comum (40,9%). Nesses indivíduos, não foram observadas características clíncias capazes de distinguir pacientes com co-infecção, porém foi verificado um maior tempo de internação hospitalar nos pacientes com mais de um agente infeccioso detectado (12 vs. 6 dias; <span class="elsevierStyleItalic">p</span>=0,009).</p></span> <span id="ceabs80" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle100">Conclusões</span><p id="spara150" class="elsevierStyleSimplePara elsevierViewall">Cianose e linfocitose são preditores independentes para coqueluche em crianças com até seis meses de idade.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs50" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "ceabs60" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "ceabs70" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "ceabs80" "titulo" => "Conclusões" ] ] ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "*" "nota" => "<p class="elsevierStyleNotepara" id="cenpara10">Study conducted at Irmandade Santa Casa de Misericórdia de Porto Alegre, Porto Alegre, RS, Brazil.</p>" "identificador" => "fn1" ] ] "multimedia" => array:4 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 914 "Ancho" => 1499 "Tamanyo" => 101388 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">Frequency of codetection of other respiratory pathogens in patients with Bordetella pertussis infection</p>" ] ] 1 => array:7 [ "identificador" => "tbl1" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spara30" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleSup">q</span>PCR, real time polymerase chain reaction test</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">qPcR (n)</th><th class="td" title="table-head " align="" valign="top" scope="col"> \t\t\t\t\t\t\n \t\t\t\t</th></tr><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Age \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Negative \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Positive \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Total \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">0–1 month \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">23 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">27 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">2–6 months \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">75 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">7–12 months \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">28 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">1–4 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">31 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">5–9 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">28 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">10–19 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">18 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">40–59 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Total \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">161 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab858706.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spara20" class="elsevierStyleSimplePara elsevierViewall">Age distribution and qPCR results in patients with suspected pertussis infection.</p>" ] ] 2 => array:7 [ "identificador" => "tbl2" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spara50" class="elsevierStyleSimplePara elsevierViewall">CI, confidence interval; qPCR, real time polymerase chain reaction test</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">n \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">qPCR positive \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">qPcR negative \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p-value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Odds Ratio (95% CI) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Clinical findings \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Age months (median) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.027 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Cyanosis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">96 (59.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">20 (32.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.03 [1.62 – 5.63] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Plethora \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">80 (49.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">14 (23.0%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.31 [1.69 – 6.49] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Whoop \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">25 (15.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">01 (1.60%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">11.02 [1.46 – 83.28] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Post tussive vomiting \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">222 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">61 (37.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">19 (31.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.34 [0.71 – 2.52] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Chest X-ray alterations \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Diffuse infiltrate \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">179 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">74 (58.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">26 (50.0%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.39 [0.73 – 2.66] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Hyperinflated \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">179 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">29 (22.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">07 (13.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.9 [0.77 – 4.66] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Atelectasis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">179 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">21 (16.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">15 (28.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.48 [0.22 – 1.04] \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Laboratorial (mean) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Leukocyte count/μL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">137 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">21.607 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">13.011 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Lymphocyte count/μL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">137 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">11.515 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">4.989 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Percentage of lymphocytes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">137 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">53.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">36.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top"> Platelet count/μL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">137 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">503.205 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">422.971 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.019 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab858708.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spara40" class="elsevierStyleSimplePara elsevierViewall">Clinical and laboratorial data of patients with positive and negative pertussis qPcR.</p>" ] ] 3 => array:7 [ "identificador" => "tbl3" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spara70" class="elsevierStyleSimplePara elsevierViewall">qPCR, real time polymerase chain reaction test</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">None \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">One dose \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Two doses \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Three doses \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">First booster \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Second booster \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Immunization delayed \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">None \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">One dose \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Two doses \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Three doses \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">First booster \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Segundo booster \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Immunization delayed \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " colspan="8" align="center" valign="top" style="border-bottom: 2px solid black">qPCR(+) (n=92)</td><td class="td" title="table-entry " colspan="7" align="center" valign="top" style="border-bottom: 2px solid black">qPCR(−) (n=29)</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">0–1m \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">2–3m \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">39% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">50% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">4–5m \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">53% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">40% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">6–14m \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">41% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">38% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">15m-4y \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">29% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">>4y \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">17% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Total \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">33 (35.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">24 (26.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12 (13%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12 (13%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (5.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 (6.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (17.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (17.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (17.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (17.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3 (10.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 (20.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab858707.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spara60" class="elsevierStyleSimplePara elsevierViewall">Vaccine doses received distributed by age.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec10" "bibliografiaReferencia" => array:29 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "titulo" => "World Health Organization [homepage on the Internet]. Immunization surveillance, assessment and monitoring [cited 2013 Jun 01]" ] ] "host" => array:1 [ 0 => array:1 [ "WWW" => array:1 [ "link" => "Available from: http://www.who.int/immunization_monitoring/diseases/pertussis/en/index.html" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ S Mattoo \n \t\t\t\t\t\t\t\t """ 1 => """ JD Cherry \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.18.2.326-382.2005" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2005" "volumen" => "18" "paginaInicial" => "326" "paginaFinal" => "382" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15831828" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Defining pertussis epidemiology: clinical, microbiologic and serologic perspectives" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ JD Cherry \n \t\t\t\t\t\t\t\t """ 1 => """ E Grimprel \n \t\t\t\t\t\t\t\t """ 2 => """ N Guiso \n \t\t\t\t\t\t\t\t """ 3 => """ U Heininger \n \t\t\t\t\t\t\t\t """ 4 => """ J Mertsola \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Pediatr Infect Dis J" "fecha" => "2005" "volumen" => "24" "numero" => "Suppl 5" "paginaInicial" => "S25" "paginaFinal" => "S34" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15876920" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pertussis: a disease affecting all ages" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => """ DS Gregory \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am Fam Physician" "fecha" => "2006" "volumen" => "74" "paginaInicial" => "420" "paginaFinal" => "426" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16913160" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Update on pertussis and pertussis immunization" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => """ JY Hong \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3345/kjp.2010.53.5.629" "Revista" => array:6 [ "tituloSerie" => "Korean J Pediatr" "fecha" => "2010" "volumen" => "53" "paginaInicial" => "629" "paginaFinal" => "633" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21189928" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical presentation of pertussis in unvaccinated and vaccinated children in the first six years of life" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ AE Tozzi \n \t\t\t\t\t\t\t\t """ 1 => """ L Ravà \n \t\t\t\t\t\t\t\t """ 2 => """ ML Ciofi degli Atti \n \t\t\t\t\t\t\t\t """ 3 => """ S Salmaso \n \t\t\t\t\t\t\t\t """ 4 => """ The Progetto Pertosse Working Group \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pediatrics" "fecha" => "2003" "volumen" => "112" "paginaInicial" => "1069" "paginaFinal" => "1075" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14595048" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnosis and management of pertussis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ AE Tozzi \n \t\t\t\t\t\t\t\t """ 1 => """ LP Celentano \n \t\t\t\t\t\t\t\t """ 2 => """ ML Ciofi degli Atti \n \t\t\t\t\t\t\t\t """ 3 => """ S Salmaso \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1503/cmaj.1040766" "Revista" => array:6 [ "tituloSerie" => "CMAJ" "fecha" => "2005" "volumen" => "172" "paginaInicial" => "509" "paginaFinal" => "515" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15710944" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Predicting pertussis in a pediatric emergency department population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ JE Mackey \n \t\t\t\t\t\t\t\t """ 1 => """ S Wojcik \n \t\t\t\t\t\t\t\t """ 2 => """ R Long \n \t\t\t\t\t\t\t\t """ 3 => """ JM Callahan \n \t\t\t\t\t\t\t\t """ 4 => """ WD Grant \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Pediatr (Phila)" "fecha" => "2007" "volumen" => "46" "paginaInicial" => "437" "paginaFinal" => "440" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of respiratory pathogens by real-time PCR in children with clinical suspicion of pertussis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ AM Van Kruijssen \n \t\t\t\t\t\t\t\t """ 1 => """ KE Templeton \n \t\t\t\t\t\t\t\t """ 2 => """ RN van der Plas \n \t\t\t\t\t\t\t\t """ 3 => """ HR van Doorn \n \t\t\t\t\t\t\t\t """ 4 => """ EC Claas \n \t\t\t\t\t\t\t\t """ 5 => """ RN Sukhai \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00431-006-0378-7" "Revista" => array:6 [ "tituloSerie" => "Eur J Pediatr" "fecha" => "2007" "volumen" => "166" "paginaInicial" => "1189" "paginaFinal" => "1191" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17177069" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Acute RSV bronchiolitis: should we be looking for pertussis?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ E Legru \n \t\t\t\t\t\t\t\t """ 1 => """ M Lubrano \n \t\t\t\t\t\t\t\t """ 2 => """ L Lemée \n \t\t\t\t\t\t\t\t """ 3 => """ C Marquet \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.arcped.2008.12.010" "Revista" => array:7 [ "tituloSerie" => "Arch Pediatr" "fecha" => "2009" "volumen" => "16" "paginaInicial" => "283" "paginaFinal" => "284" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19186038" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0090429508019250" "estado" => "S300" "issn" => "00904295" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Concomitant viral and Bordetella pertussis infections in infants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ KL Moshal \n \t\t\t\t\t\t\t\t """ 1 => """ RL Hodinka \n \t\t\t\t\t\t\t\t """ 2 => """ KL McGowan \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pediatr Infect Dis J" "fecha" => "1998" "volumen" => "17" "paginaInicial" => "353" "paginaFinal" => "354" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9576398" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dual infection with Bordetella pertussis and Mycoplasma pneumonia in three infants: case reports" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ A Zouari \n \t\t\t\t\t\t\t\t """ 1 => """ A Touati \n \t\t\t\t\t\t\t\t """ 2 => """ H Smaoui \n \t\t\t\t\t\t\t\t """ 3 => """ D Brun \n \t\t\t\t\t\t\t\t """ 4 => """ K Kasdaghli \n \t\t\t\t\t\t\t\t """ 5 => """ K Menif \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s15010-011-0179-4" "Revista" => array:7 [ "tituloSerie" => "Infection" "fecha" => "2012" "volumen" => "40" "paginaInicial" => "213" "paginaFinal" => "217" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21861122" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283809004242" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bordetella pertussis infection exacerbates influenza virus infection through pertussis toxin-mediated suppression of innate immunity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ VI Ayala \n \t\t\t\t\t\t\t\t """ 1 => """ JR Teijaro \n \t\t\t\t\t\t\t\t """ 2 => """ DL Farber \n \t\t\t\t\t\t\t\t """ 3 => """ SG Dorsey \n \t\t\t\t\t\t\t\t """ 4 => """ NH Carbonetti \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0019016" "Revista" => array:5 [ "tituloSerie" => "PLoS One" "fecha" => "2011" "volumen" => "6" "paginaInicial" => "e19016" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21533103" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bordetella pertussis and concomitant viral respiratory tract infections are rare in children with cough illness" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ U Heininger \n \t\t\t\t\t\t\t\t """ 1 => """ MA Burckhardt \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/INF.0b013e3182152d28" "Revista" => array:6 [ "tituloSerie" => "Pediatr Infect Dis J" "fecha" => "2011" "volumen" => "30" "paginaInicial" => "640" "paginaFinal" => "644" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21407144" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Severe pertussis: state of the art" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ A Donoso \n \t\t\t\t\t\t\t\t """ 1 => """ D ArrIagada \n \t\t\t\t\t\t\t\t """ 2 => """ P Cruces \n \t\t\t\t\t\t\t\t """ 3 => """ PC Díaz \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4067/S0716-10182012000300007" "Revista" => array:6 [ "tituloSerie" => "Rev Chilena Infectol" "fecha" => "2012" "volumen" => "29" "paginaInicial" => "290" "paginaFinal" => "306" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23096468" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "titulo" => "Brasil – Ministério da Saúde. – SINAN [homepage on the Internet]. Brasília – Acesso ao sistema [cited 2013 May 1]" ] ] "host" => array:1 [ 0 => array:1 [ "WWW" => array:1 [ "link" => "Available from: http://aplicacao.saude.gov.br/sinan" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "titulo" => "Centers for Disease Control and Prevention [homepage on the Internet]. Guidelines for the control of pertussis outbreaks [cited 2013 May 1]" ] ] "host" => array:1 [ 0 => array:1 [ "WWW" => array:1 [ "link" => "Available from: http://www.cdc.gov/pertussis/outbreaks/index.html" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical manifestations of Bordetella pertussis infection in immunized children and young adults" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ E Yaari \n \t\t\t\t\t\t\t\t """ 1 => """ Y Yafe-Zimerman \n \t\t\t\t\t\t\t\t """ 2 => """ SB Schwartz \n \t\t\t\t\t\t\t\t """ 3 => """ PE Slater \n \t\t\t\t\t\t\t\t """ 4 => """ P Shvartzman \n \t\t\t\t\t\t\t\t """ 5 => """ N Andoren \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "1999" "volumen" => "115" "paginaInicial" => "1254" "paginaFinal" => "1258" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10334136" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pertussis is a frequent cause of prolonged cough illness in adults and adolescents" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ LD Senzilet \n \t\t\t\t\t\t\t\t """ 1 => """ SA Halperin \n \t\t\t\t\t\t\t\t """ 2 => """ JS Spika \n \t\t\t\t\t\t\t\t """ 3 => """ M Alagaratnam \n \t\t\t\t\t\t\t\t """ 4 => """ A Morris \n \t\t\t\t\t\t\t\t """ 5 => """ B Smith \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/320754" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2001" "volumen" => "32" "paginaInicial" => "1691" "paginaFinal" => "1697" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11360208" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib20" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pertussis infection in fully vaccinated children in day-care centers, Israel" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ I Srugo \n \t\t\t\t\t\t\t\t """ 1 => """ D Benilevi \n \t\t\t\t\t\t\t\t """ 2 => """ R Madeb \n \t\t\t\t\t\t\t\t """ 3 => """ S Shapiro \n \t\t\t\t\t\t\t\t """ 4 => """ T Shohat \n \t\t\t\t\t\t\t\t """ 5 => """ E Somekh \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3201/eid0605.000512" "Revista" => array:7 [ "tituloSerie" => "Emerg Infect Dis" "fecha" => "2000" "volumen" => "6" "paginaInicial" => "526" "paginaFinal" => "529" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10998384" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022534711002394" "estado" => "S300" "issn" => "00225347" ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib21" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical definitions of pertussis: Summary of a Global Pertussis Initiative roundtable meeting, 2011" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ JD Cherry \n \t\t\t\t\t\t\t\t """ 1 => """ T Tan \n \t\t\t\t\t\t\t\t """ 2 => """ CH Wirsing von König \n \t\t\t\t\t\t\t\t """ 3 => """ KD Forsyth \n \t\t\t\t\t\t\t\t """ 4 => """ U Thisyakorn \n \t\t\t\t\t\t\t\t """ 5 => """ D Greenberg \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/cid/cis302" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2012" "volumen" => "54" "paginaInicial" => "1756" "paginaFinal" => "1764" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22431797" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib22" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pertussis and respiratory syncytial virus infections" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ C Cosnes-Lambe \n \t\t\t\t\t\t\t\t """ 1 => """ J Raymond \n \t\t\t\t\t\t\t\t """ 2 => """ M Chalumeau \n \t\t\t\t\t\t\t\t """ 3 => """ C Pons-Catalano \n \t\t\t\t\t\t\t\t """ 4 => """ F Moulin \n \t\t\t\t\t\t\t\t """ 5 => """ N de Suremain \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00431-007-0633-6" "Revista" => array:7 [ "tituloSerie" => "Eur J Pediatr" "fecha" => "2008" "volumen" => "167" "paginaInicial" => "1017" "paginaFinal" => "1019" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18034357" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283810005944" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib23" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical findings in Bordetella pertussis infections: results of a prospective multicenter surveillance study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ U Heininger \n \t\t\t\t\t\t\t\t """ 1 => """ K Klich \n \t\t\t\t\t\t\t\t """ 2 => """ K Stehr \n \t\t\t\t\t\t\t\t """ 3 => """ JD Cherry \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Pediatrics" "fecha" => "1997" "volumen" => "100" "paginaInicial" => "E10" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9382911" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib24" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical and microbiologic features of children presenting with pertussis to a Canadian pediatric hospital during an eleven-year period" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ M Gordon \n \t\t\t\t\t\t\t\t """ 1 => """ HD Davies \n \t\t\t\t\t\t\t\t """ 2 => """ R Gold \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pediatr Infect Dis J" "fecha" => "1994" "volumen" => "13" "paginaInicial" => "617" "paginaFinal" => "622" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7970950" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib25" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Predicting pertussis in infants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ H Guinto-Ocampo \n \t\t\t\t\t\t\t\t """ 1 => """ JE Bennett \n \t\t\t\t\t\t\t\t """ 2 => """ MW Attia \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/pec.0b013e31815f39b6" "Revista" => array:7 [ "tituloSerie" => "Pediatr Emerg Care" "fecha" => "2008" "volumen" => "24" "paginaInicial" => "16" "paginaFinal" => "20" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18165797" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022534712002613" "estado" => "S300" "issn" => "00225347" ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib26" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bordetella pertussis infection is common in nonvaccinated infants admitted for bronchiolitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => """ K Nuolivirta \n \t\t\t\t\t\t\t\t """ 1 => """ P Koponen \n \t\t\t\t\t\t\t\t """ 2 => """ Q He \n \t\t\t\t\t\t\t\t """ 3 => """ A Halkosalo \n \t\t\t\t\t\t\t\t """ 4 => """ M Korppi \n \t\t\t\t\t\t\t\t """ 5 => """ T Vesikari \n \t\t\t\t\t\t\t\t """ 6 => """ M Helminen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Pediatr Infect Dis J" "fecha" => "2010" "volumen" => "29" "paginaInicial" => "1013" "paginaFinal" => "1015" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21046700" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283811007391" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib27" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Community-acquired pathogens associated with prolonged coughing in children: a prospective cohort study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ FG Versteegh \n \t\t\t\t\t\t\t\t """ 1 => """ GJ Weverling \n \t\t\t\t\t\t\t\t """ 2 => """ MF Peeters \n \t\t\t\t\t\t\t\t """ 3 => """ B Wilbrink \n \t\t\t\t\t\t\t\t """ 4 => """ MT Veenstra-van Schie \n \t\t\t\t\t\t\t\t """ 5 => """ JM van Leeuwen-Gerritsen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1469-0691.2005.01234.x" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Infect" "fecha" => "2005" "volumen" => "11" "paginaInicial" => "801" "paginaFinal" => "807" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16153253" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib28" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Frequency of serological evidence of Bordetella infections and mixed infections with other respiratory pathogens in university students with cough illnesses" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ LA Jackson \n \t\t\t\t\t\t\t\t """ 1 => """ JD Cherry \n \t\t\t\t\t\t\t\t """ 2 => """ SP Wang \n \t\t\t\t\t\t\t\t """ 3 => """ JT Grayston \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/313911" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2000" "volumen" => "31" "paginaInicial" => "3" "paginaFinal" => "6" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10913388" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib29" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of respiratory pathogens by real-time PCR in children with clinical suspicion of pertussis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ AM Van Kruijssen \n \t\t\t\t\t\t\t\t """ 1 => """ KE Templeton \n \t\t\t\t\t\t\t\t """ 2 => """ RN van der Plas \n \t\t\t\t\t\t\t\t """ 3 => """ HR van Doorn \n \t\t\t\t\t\t\t\t """ 4 => """ EC Claas \n \t\t\t\t\t\t\t\t """ 5 => """ RN Sukhai \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00431-006-0378-7" "Revista" => array:6 [ "tituloSerie" => "Eur J Pediatr" "fecha" => "2007" "volumen" => "166" "paginaInicial" => "1189" "paginaFinal" => "1191" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17177069" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/23593482/0000003200000004/v1_201507180038/S2359348215300622/v1_201507180038/en/main.assets" "Apartado" => array:4 [ "identificador" => "42248" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/23593482/0000003200000004/v1_201507180038/S2359348215300622/v1_201507180038/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2359348215300622?idApp=UINPBA00004N" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 October | 20 | 2 | 22 |
2024 September | 50 | 10 | 60 |
2024 August | 35 | 9 | 44 |
2024 July | 25 | 7 | 32 |
2024 June | 21 | 3 | 24 |
2024 May | 20 | 2 | 22 |
2024 April | 36 | 4 | 40 |
2024 March | 43 | 4 | 47 |
2024 February | 34 | 5 | 39 |
2024 January | 25 | 3 | 28 |
2023 December | 34 | 7 | 41 |
2023 November | 30 | 2 | 32 |
2023 October | 34 | 5 | 39 |
2023 September | 21 | 2 | 23 |
2023 August | 19 | 2 | 21 |
2023 July | 23 | 9 | 32 |
2023 June | 12 | 1 | 13 |
2023 May | 25 | 8 | 33 |
2023 April | 11 | 7 | 18 |
2023 March | 16 | 2 | 18 |
2023 February | 7 | 10 | 17 |
2023 January | 16 | 12 | 28 |
2022 December | 16 | 8 | 24 |
2022 November | 12 | 11 | 23 |
2022 October | 12 | 12 | 24 |
2022 September | 9 | 7 | 16 |
2022 August | 11 | 8 | 19 |
2022 July | 16 | 9 | 25 |
2022 June | 13 | 7 | 20 |
2022 May | 15 | 19 | 34 |
2022 April | 17 | 20 | 37 |
2022 March | 15 | 17 | 32 |
2022 February | 26 | 6 | 32 |
2022 January | 8 | 10 | 18 |
2021 December | 12 | 7 | 19 |
2021 November | 13 | 11 | 24 |
2021 October | 23 | 15 | 38 |
2021 September | 15 | 7 | 22 |
2021 August | 5 | 7 | 12 |
2021 July | 6 | 9 | 15 |
2021 June | 10 | 10 | 20 |
2021 May | 17 | 9 | 26 |
2021 April | 22 | 11 | 33 |
2021 March | 10 | 6 | 16 |
2021 February | 7 | 5 | 12 |
2021 January | 12 | 9 | 21 |
2020 December | 6 | 2 | 8 |
2020 November | 3 | 1 | 4 |
2020 October | 4 | 3 | 7 |
2020 September | 10 | 8 | 18 |
2020 August | 5 | 5 | 10 |
2020 July | 7 | 5 | 12 |
2020 June | 5 | 1 | 6 |
2020 May | 7 | 5 | 12 |
2020 April | 4 | 4 | 8 |
2020 March | 1 | 1 | 2 |
2020 February | 9 | 3 | 12 |
2020 January | 8 | 1 | 9 |
2019 December | 8 | 3 | 11 |
2019 November | 11 | 2 | 13 |
2019 October | 4 | 8 | 12 |
2019 September | 3 | 4 | 7 |
2019 August | 3 | 3 | 6 |
2019 July | 3 | 6 | 9 |
2019 June | 9 | 0 | 9 |
2019 May | 9 | 4 | 13 |
2018 December | 1 | 0 | 1 |
2018 September | 1 | 0 | 1 |
2017 February | 0 | 1 | 1 |
2017 January | 16 | 7 | 23 |
2016 December | 8 | 10 | 18 |
2016 November | 3 | 2 | 5 |
2016 October | 2 | 3 | 5 |
2016 September | 4 | 2 | 6 |
2016 August | 6 | 1 | 7 |
2016 July | 3 | 0 | 3 |