Identification of Helicobacter pylori in tumor biopsies obtained from patients with colorectal cancer: Indication for a prophylactic vaccine?

array:24 ["pii" => "S1576988720300674" "issn" => "15769887" "doi" => "10.1016/j.vacun.2020.09.008" "estado" => "S300" "fechaPublicacion" => "2021-05-01" "aid" => "170" "copyright" => "Elsevier España, S.L.U.. All rights reserved" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Vacunas. 2021;22:62-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "Traduccion" => array:1 [ "en" => array:19 [ "pii" => "S2445146021000248" "issn" => "24451460" "doi" => "10.1016/j.vacune.2020.09.004" "estado" => "S300" "fechaPublicacion" => "2021-05-01" "aid" => "170" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Vacunas. 2021;22:62-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Identification of Helicobacter pylori in tumor biopsies obtained from patients with colorectal cancer: Indication for a prophylactic vaccine?" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "62" "paginaFinal" => "67" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Identificación de Helicobacter pylori en biopsias tumorales obtenidas de pacientes con cáncer colorrectal: ¿indicación de una vacuna profiláctica?" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1075 "Ancho" => 2167 "Tamanyo" => 90219 ] ] "descripcion" => array:1 [ "en" => "Gel electrophoresis showing the glmM PCR products. Lane 1: 100-bp DNA ladder, Lane 2: negative control, Lane 3: positive control, Lanes: 4, 6, 8, 9, 10, 11, 12 glmM-positive samples, and Lane 5 and 7: glmM-negative samples." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "N. Kamali, A. Talebi Bezmin Abadi, F. Rahimi, M. Forootan" "autores" => array:4 [ 0 => array:2 [ "nombre" => "N." "apellidos" => "Kamali" ] 1 => array:2 [ "nombre" => "A." "apellidos" => "Talebi Bezmin Abadi" ] 2 => array:2 [ "nombre" => "F." "apellidos" => "Rahimi" ] 3 => array:2 [ "nombre" => "M." "apellidos" => "Forootan" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1576988720300674" "doi" => "10.1016/j.vacun.2020.09.008" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988720300674?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2445146021000248?idApp=UINPBA00004N" "url" => "/24451460/0000002200000002/v1_202106241110/S2445146021000248/v1_202106241110/en/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1576988720300479" "issn" => "15769887" "doi" => "10.1016/j.vacun.2020.09.004" "estado" => "S300" "fechaPublicacion" => "2021-05-01" "aid" => "166" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Vacunas. 2021;22:68-73" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Evaluation of hepatitis B vaccination status and immune response among health care workers in a tertiary care hospital in western India" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "68" "paginaFinal" => "73" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Evaluación del estatus de la vacunación frente a la hepatitis B y de la respuesta inmune entre los trabajadores sanitarios de un hospital de atención terciaria del Oeste de India" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "K. Mehta Tanmay, D. Shah Parul" "autores" => array:2 [ 0 => array:2 [ "nombre" => "K." "apellidos" => "Mehta Tanmay" ] 1 => array:2 [ "nombre" => "D." "apellidos" => "Shah Parul" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2445146021000212" "doi" => "10.1016/j.vacune.2020.09.002" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2445146021000212?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988720300479?idApp=UINPBA00004N" "url" => "/15769887/0000002200000002/v1_202106120702/S1576988720300479/v1_202106120702/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1576988721000121" "issn" => "15769887" "doi" => "10.1016/j.vacun.2021.04.001" "estado" => "S300" "fechaPublicacion" => "2021-05-01" "aid" => "183" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "sco" "cita" => "Vacunas. 2021;22:59-61" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:10 [ "idiomaDefecto" => true "cabecera" => "Editorial" "titulo" => "Impacto de las variantes genéticas de la espícula en las vacunas frente al SARS-CoV-2" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "59" "paginaFinal" => "61" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Impact of spike genetic variants in vaccines against SARS-CoV-2" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "J. Reina, P. Fraile-Ribot" "autores" => array:2 [ 0 => array:2 [ "nombre" => "J." "apellidos" => "Reina" ] 1 => array:2 [ "nombre" => "P." "apellidos" => "Fraile-Ribot" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2445146021000157" "doi" => "10.1016/j.vacune.2021.05.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2445146021000157?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988721000121?idApp=UINPBA00004N" "url" => "/15769887/0000002200000002/v1_202106120702/S1576988721000121/v1_202106120702/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Identification of Helicobacter pylori in tumor biopsies obtained from patients with colorectal cancer: Indication for a prophylactic vaccine?" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "62" "paginaFinal" => "67" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "N. Kamali, A. Talebi Bezmin Abadi, F. Rahimi, M. Forootan" "autores" => array:4 [ 0 => array:3 [ "nombre" => "N." "apellidos" => "Kamali" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:4 [ "nombre" => "A." "apellidos" => "Talebi Bezmin Abadi" "email" => array:1 [ 0 => "Amin.talebi@modares.ac.ir" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 2 => array:3 [ "nombre" => "F." "apellidos" => "Rahimi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "M." "apellidos" => "Forootan" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Research School of Biology, The Australian National University, Canberra, Australia" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Identificación de Helicobacter pylori en biopsias tumorales obtenidas de pacientes con cáncer colorrectal: ¿indicación de una vacuna profiláctica?" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1075 "Ancho" => 2167 "Tamanyo" => 90219 ] ] "descripcion" => array:1 [ "en" => "Gel electrophoresis showing the glmM PCR products. Lane 1: 100-bp DNA ladder, Lane 2: negative control, Lane 3: positive control, Lanes: 4, 6, 8, 9, 10, 11, 12 glmM-positive samples, and Lane 5 and 7: glmM-negative samples." ] ] ] "textoCompleto" => "IntroductionHelicobacter pylori is a Gram-negative microorganism that colonizes the human gastric mucosa and causes occasional gastroduodenal diseases, driven by a Th1-mediated immune response, chronic leukocyte infiltration and chronic inflammation, and generation of reactive oxygen and reactive nitrogen species.<a class="elsevierStyleCrossRef" href="#bib0180">1</a>H. pylori is thought to be colonizing the human stomach mainly, but other sites also have been identified. Cumulative evidence shows that dental plaques may be a permanent H. pylori source in positive subjects. However, using different methods to detect H. pylori may potentially lead to diverse findings. The persistent production of reactive oxygen and reactive nitrogen species leads to cumulative production of N-nitroso compounds that cause DNA damage and mutations, leading to the development of gastric cancer in humans.<a class="elsevierStyleCrossRefs" href="#bib0185">2–4</a> Additionally, bacterial interactions with the mammalian cells through the blood group antigen-binding adhesin (babA) leads to double-strand breaks in DNA.<a class="elsevierStyleCrossRef" href="#bib0200">5</a> Subsequently, continual DNA damage, saturation of DNA-repair mechanisms, and imprecise DNA repair over time leads to carcinogenesis.<a class="elsevierStyleCrossRef" href="#bib0200">5</a> Thus, this bacterium is the first and only one confirmed to cause gastric carcinogenesis.<a class="elsevierStyleCrossRef" href="#bib0205">6</a>Colorectal cancer (CRC) is the third cause of cancer-related deaths worldwide.<a class="elsevierStyleCrossRefs" href="#bib0210">7,8</a> While host genetics and several environmental factors, including diet, are considered as major risk factors for CRC,<a class="elsevierStyleCrossRef" href="#bib0220">9</a> infectious risk factors of CRC have been explored and debated.<a class="elsevierStyleCrossRef" href="#bib0225">10</a> Speculatively, carcinogenic effects due to H. pylori may not be limited to the stomach because recent reports have suggested some direct or indirect effects of H. pylori in the development of CRC.<a class="elsevierStyleCrossRefs" href="#bib0230">11–13</a> For example, the roles of H. pylori in the formation of precancerous colorectal lesions and CRC development were investigated in case-control, metagenomic, and correlation/association studies, suggesting positive associations.<a class="elsevierStyleCrossRefs" href="#bib0245">14–18</a> Therefore, colorectum is likely the second most affected organ by H. pylori infection.<a class="elsevierStyleCrossRef" href="#bib0270">19</a> However, epidemiological studies so far cannot support a role for H. pylori as a risk factor for CRC development.<a class="elsevierStyleCrossRef" href="#bib0275">20</a>Because preventive strategies to reduce the global prevalence of CRC have generally been unsuccessful, learning more about the causal roles of H. pylori in the CRC development will lead to establishing novel, targeted therapeutic measures for CRC. We aimed to investigate the possible associations between H. pylori infection and CRC in the biopsy samples taken from Iranian CRC patients.MethodsParticipants, ethics, and sample collectionThirty-nine patients diagnosed with symptoms and histopathological features of CRC were enrolled. Ten subjects without CRC, as confirmed by colonoscopy findings and pathology reports, were included as control subjects; they did not have any polyps or colorectal inflammation. The exclusion criteria were incomplete colonoscopy, suboptimal bowel preparation, treatment with proton-pump inhibitors, treatment against H. pylori three months before colonoscopy, presence of non-adenomatous polyps, and pregnancy. Biopsy samples were collected from March 2017 to 1 August 2019. All CRC and control samples were collected at the Mehrad Hospital, Tehran, Iran, following standard surgical protocols performed by a practicing gastroenterologist. Two biopsy samples were taken from the tumor tissues by colonoscopy. Both samples were kept in a saline solution (0.9% w/v, pH 7). The first biopsy specimen was sent to the pathology department, while the second was transferred to the microbiology laboratory, Tarbiat Modares University, for further PCR analysis. All biopsy samples were examined by staining with hematoxylin and eosin (H&E) while Giemsa staining was used to confirm the positivity for H. pylori. All the experiments were performed in the department of pathology under supervision of an expert pathologist with>20 years’ experience. The study protocols were reviewed and approved by the ethics committee of Tarbiat Modares University, Tehran, Iran (Ethics code: IR.MODARES.REC.1397.240). All participating subjects signed the informed consent forms before undergoing colonoscopic surgery. Participation in the study was voluntary, and subjects were informed that they could disenroll whenever they wished. The participants filled in a questionnaire for demographic data (gender, history of surgery, alcohol consumption, and age).DNA extraction and PCRGenomic DNA was extracted from the tumor biopsy samples by using a commercially available kit (ROJE Technologies/15105/Yazd, Iran) without modifications. Purified DNA was measured at 260nm using a spectrophotometer (WPA, Biochrom, UK). Extracted DNA was kept at −20°C before PCR experiments. Primer sequences for detection and confirmation of glmM included f-5′AAGCTTTTAGGGGTGTTAGGGGTTT and r-5′AAGCTTACTTTCTAACACTAACGC for confirming H. pylori infection. PCR conditions were 95°C for 1min; 58°C, 1min; and 72°C, 1min, for 37 cycles. glmM PCR was performed in a 20-μL mixture containing at least 100ng DNA, 150μM of each dNTPs (Gibco BRL, USA), 1× PCR buffer (20mM Tris–HCl, pH 8.5), 50mM KCl, 2mM MgCl2, 0.75μM of each primer, and 2 units of Taq polymerase (Gibco BRL, USA). PCR was performed in a T100 Thermal Cycler (Bio-Rad, Berkeley, California). A previously confirmed sample was used as the positive control, and distilled water was used instead of the DNA template to serve as the negative control.Gel electrophoresisPCR products were electrophoresed in 1% agarose (CinnaGen, Tehran, Iran) gels in 1× TAE buffer (40mM Tris, 20mM acetic acid, and 1mM EDTA, pH 8.0) and visualized under an ultraviolet transilluminator (Biometra, Germany). The PCR product was at approximately 294bp after electrophoresis.<a class="elsevierStyleCrossRef" href="#bib0280">21</a> Two independent operators determined the positivity of the PCR reactions.Statistical analysesWe used the SPSS version 18 for statistical analyses. The distribution of positive samples in each group and the colonization with H. pylori was investigated using a two-tailed Fisher's exact test. The significance level was considered as 0.05.ResultsFrom 49 patients included in our study, 39 were diagnosed with CRC; 10 had no record of CRC and were included as the control group. The mean age of the participants was 54, ranging from 38 to 79 years. In the CRC group, 18 (46.1%) were female, whereas six (60%) were female in the control group. No significant association was observed between family history of cancer, age, and gender. Of the 49 biopsies, 20 (40%) samples were positive for H. pylori by glmM-specific PCR (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). Among the CRC biopsy samples, 20 of 39 (51%) were positive; however, we found none of the control biopsies to be positive for H. pylori (P=0.003). The categorization of the CRC cases based on pathology reports and based on the level of active inflammation is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Thirty-one (79%) of the CRC samples presented with severe inflammation. Out of the 31 CRC patients with severe inflammation, 18 (58%) were positive for H. pylori (P<0.05). One positive case each was categorized as presenting mild or moderate inflammation.<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0005"></elsevierMultimedia>DiscussionAlthough a positive association between gastric cancer and H. pylori infection has been confirmed, the clinical and mechanistic correlations between CRC and H. pylori infection are still unknown. We found a relatively high incidence of H. pylori infection, 20 out of 39 (51%) cases, in the tumor tissues of the CRC patients. Such an incidence of H. pylori in association with CRC had not been reported previously, thus highlighting the importance of strengthening the relevant gastroenterological research efforts.We used a highly specific and sensitive method for detection of H. pylori based on glmM PCR. Previously, mainly serological tests were used to determine the association between H. pylori infection and the CRC cases.<a class="elsevierStyleCrossRefs" href="#bib0285">22–25</a> Grahn et al. used the 16s rDNA PCR, reporting that 27% of tumor tissues were infected with H.pylori<a class="elsevierStyleCrossRef" href="#bib0305">26</a> (almost half of the 51% rate we report here). Additionally, Monstein et al. reported that five out of 19 (26%) biopsy specimens were infected with H. pylori, but they investigated microscopic colitis not CRC.<a class="elsevierStyleCrossRef" href="#bib0310">27</a> Butt et al. studied a large consortium of cohorts and used serological testing for VacA of H. pylori, reporting an increased risk of developing CRC.<a class="elsevierStyleCrossRef" href="#bib0260">17</a> However, they did not confirm the presence of H. pylori in the tumor tissues. In contrast, we found the presence of H. pylori in almost half of the tumor samples obtained from CRC patients.Altogether our results and the previous literature suggest that identifying H. pylori in tumor tissues derived from CRC may not represent a causal relationship. So far, identification of H. pylori in other tumor tissues had not been translated into a direct causal relationship, but the high probability of such a causal association should not be discounted. Deciphering and confirming such an etiological association are relevant in countries like Iran where CRC is highly prevalent and leads to high mortality rates. Likewise, reconsidering the current therapeutic strategies and updating them are important. We speculate that treatment against H. pylori may hold promise in the management of CRC patients; this will need to be confirmed by clinical trials. The global fight for reducing the CRC prevalence will require international attempts to control and remove all the relevant risk factors, including H. pylori infection, in patients and their first-line relatives.To present a clearer conclusion, we could have collected antral biopsies from both control subjects and patients for comparison; however, our ethics conditions were limited to taking specimens by colonoscopic surgery. Confirming the presence of H. pylori in colon tumors and in the antral biopsy samples would constitute valuable data in this high-risk population.Although the majority of the CRC patients are older than 60, at least, in the developing countries such as Iran,<a class="elsevierStyleCrossRefs" href="#bib0215">8,25</a> we did not find a significant association between the risk of CRC and old age among the study subjects between 50 to 60 years of age; this observation may be due to the limited sample size used in our study. Unfortunately, recent global trends indicate an increasing prevalence of CRC among younger patients.<a class="elsevierStyleCrossRef" href="#bib0315">28</a> Thus, to screen the high-risk populations for H. pylori infection may be important also in the management of CRC. Screening by using colonoscopic surgery may be unfeasible routinely, but alternative practical diagnostic tests, for example, urea breath testing or determining seropositivity in fecal samples, could be developed to facilitate the subsequent, appropriate treatment measures against H. pylori during the management of CRC.Presently, four critical pathological explanations may be offered to rationalize the association between H. pylori and CRC:First, some of the cell-wall components of H. pylori may act as carcinogens following interactions with mammalian cells.<a class="elsevierStyleCrossRef" href="#bib0200">5</a> The turnover of H. pylori in the human gastroduodenal tract has made this rationale logical because the epithelial cells are exposed to many of the secreted proteins or polysaccharides derived from the surface of H. pylori.Second, the initial T-cell infiltration following the primary inflammation in the gastric mucosal cells is relatively high, whereas this infiltration wanes after successful eradication of this bacterium.<a class="elsevierStyleCrossRef" href="#bib0320">29</a> Additionally, chronic inflammation following the gastric colonization by H. pylori increases the chance of cyclooxygenase-2 production, resulting in a severe prognosis for colorectal polyps.<a class="elsevierStyleCrossRefs" href="#bib0325">30,31</a> Adenomatous colorectal polyps tend to develop into CRC foci.<a class="elsevierStyleCrossRef" href="#bib0335">32</a>Third, hypergastrinemia, caused by H. pylori in the gastric mucosa by increased production of gastrin, is a major predisposing factor for gastrointestinal carcinogenesis.<a class="elsevierStyleCrossRefs" href="#bib0340">33,34</a> Broadly defined, H. pylori infection is closely associated with exaggerated gastrin release in the human stomach, and thereafter, in the colons.Fourth, infection with the virulent H. pylori strains may be predisposing to, or preceding, the development of CRC. For instance, infection with CagA-positive H. pylori was shown to increase the risk of CRC.<a class="elsevierStyleCrossRef" href="#bib0350">35</a> However, we included the patients without gastric cancer in our study; whereas, all subjects in the study by Shumuely et al. were confirmed to have gastric cancer.<a class="elsevierStyleCrossRef" href="#bib0350">35</a>Antibiotic therapy has been suggested to help in the management of H. pylori infections while H. pylori eradication also has been the healthcare focus in the previous decade. However, no prophylactic vaccine against the H. pylori infection has been validated. The CRC patients are usually diagnosed at their 50s; thus, such early diagnosis allows for sufficient time to eliminate the infection and lower the chance of CRC progression to severe stages. Our findings highlight the importance of the prophylactic measures and pave the way to future research in this arena.ConclusionPreventive and therapeutic strategies to manage the CRC patients may need to be revised. A promising approach would be to consider a prophylactic vaccine for subjects who are the first-line relatives of the CRC patients and are positive for H. pylori. Screening for H. pylori infections in the CRC patients and their relatives should be considered as an early strategy for CRC detection and management.Authors’ contributionsConceptualization: Amin Talebi Bezmin Abadi; Methodology: Amin Talebi Bezmin Abadi, Negin Kamali; Formal analysis and investigation: Amin Talebi Bezmin Abadi, Negin Kamali, Mojgan Forootan, Farid Rahimi; Writing – initial drafting: Amin Talebi Bezmin Abadi, Negin Kamali; Writing – review and editing: Amin Talebi Bezmin Abadi, Negin Kamali, Farid Rahimi, Mojgan Forootan; Funding acquisition: Amin Talebi Bezmin Abadi; Resources: Amin Talebi Bezmin Abadi; Supervision: Amin Talebi Bezmin Abadi. All authors equally contributed to finalizing the paper and approved it for submission.Ethical approvalAll procedures were done according to the ethical standards of the institutional and/or national research committee and abiding by the 1964 Declaration of Helsinki and its later amendments. The study was approved by the institutional Ethics Committee (IR.MODARES.REC.1397.240).Informed consentParticipants signed the informed consent forms.FundingThe authors acknowledge the research deputy of Tarbiat Modares University, Iran, for financially supporting this project.Conflict of interestThe authors have no potential conflict of interest to declare." "textoCompletoSecciones" => array:1 [ "secciones" => array:15 [ 0 => array:3 [ "identificador" => "xres1525297" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1382874" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1525296" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1382873" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Methods" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Participants, ethics, and sample collection" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "DNA extraction and PCR" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Gel electrophoresis" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Statistical analyses" ] ] ] 6 => array:2 [ "identificador" => "sec0035" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0040" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0045" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0050" "titulo" => "Authors’ contributions" ] 10 => array:2 [ "identificador" => "sec0055" "titulo" => "Ethical approval" ] 11 => array:2 [ "identificador" => "sec0060" "titulo" => "Informed consent" ] 12 => array:2 [ "identificador" => "sec0065" "titulo" => "Funding" ] 13 => array:2 [ "identificador" => "sec0070" "titulo" => "Conflict of interest" ] 14 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-07-31" "fechaAceptado" => "2020-09-28" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1382874" "palabras" => array:7 [ 0 => "Colorectal cancer" 1 => "Helicobacter pylori" 2 => "PCR" 3 => "Prevention" 4 => "Screening program" 5 => "Tumor" 6 => "Vaccine" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1382873" "palabras" => array:7 [ 0 => "Cáncer colorrectal" 1 => "Helicobacter pylori" 2 => "PCR" 3 => "Prevención" 4 => "Programa de cribado" 5 => "Tumor" 6 => "Vacuna" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "The association between H. pylori infection and colorectal cancer (CRC) has been controversial, and despite the undisputed roles of H. pylori in the etiology of gastric cancer, its involvement as a causative agent of CRC is unknown. We aimed to investigate the potential associations between H. pylori infection and CRC in biopsy samples taken from tumors of Iranian patients. Patients (n=49; aged 38–79 years, mean age=49) with diagnosed CRC were enrolled. Biopsies from control (n=10) and suspected CRC patients were collected from March 2017 to 1 August 2019 at the Mehrad Hospital, Tehran, Iran. The diagnosis of CRC was confirmed by pathology and colonoscopic examinations. An expert gastroenterologist performed the colonoscopic surgery and sample collection. DNA was extracted from the samples, and H. pylori infection was detected and confirmed by PCR using the glmM sequence as the species-specific gene. SPSS version 18 was used to determine the significant associations by using the two-tailed Fisher's exact test. Eighteen (46.1%) and 6 (60%) patients were female in the CRC and control groups, respectively. No significant associations were observed between H. pylori infection and family history of cancer, age, or gender. Thirty-one (79%) CRC samples showed severe inflammation. Out of the 31 CRC samples with severe inflammation, 18 (58%) were positive for H. pylori (P<0.05). We conclude that H. pylori may be involved in the CRC pathogenesis or progression. Our findings suggest that a prophylactic vaccine against H. pylori may be promising in reducing the CRC incidence." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "La asociación entre la infección por H. pylori y el cáncer colorrectal (CCR) ha sido controversial y, a pesar del papel indiscutible de H. pylori en la etiología del cáncer gástrico, se desconoce su participación como agente causante del CCR. Nuestro objetivo consistió en investigar las posibles asociaciones entre la infección por H. pylori y el CCR en muestras de biopsia tomadas de tumores de pacientes iraníes. Pacientes (n = 49) de 38 a 79 años de edad (edad media = 49) con diagnóstico de CCR fueron admitidos. Las biopsias de los pacientes de control (n = 10) y sospechosos de CCR se recolectaron desde marzo de 2017 hasta el 1 de agosto de 2019 en el Hospital Mehrad, Teherán, Irán. El diagnóstico de CCR se confirmó mediante exámenes anatomopatológicos y colonoscópicos. Un gastroenterólogo experto realizó la cirugía colonoscópica y la toma de muestras. Se extrajo ADN de las muestras y se detectó y confirmó la infección por H. pylori mediante PCR utilizando la secuencia glmM como gen específico de la especie. Se utilizó la versión 18 de SPSS para determinar las asociaciones significativas mediante la prueba exacta de Fisher de dos colas. Dieciocho (46,1%) y 6 (60%) pacientes en el grupo de CCR y de control, respectivamente, fueron mujeres. No se observaron asociaciones significativas entre la infección por H. pylori y los antecedentes familiares de cáncer, la edad o el sexo. Treinta y una (79%) muestras de CRC mostraron inflamación severa. De las 31 muestras de CCR con inflamación severa, 18 (58%) fueron positivas para H. pylori (P < 0,05). Concluimos que H. pylori puede estar involucrado en la patogénesis o progresión del CCR. Nuestros hallazgos sugieren que una vacuna profiláctica contra H. pylori puede ser prometedora para reducir la incidencia de CCR." ] ] "multimedia" => array:2 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1075 "Ancho" => 2167 "Tamanyo" => 90219 ] ] "descripcion" => array:1 [ "en" => "Gel electrophoresis showing the glmM PCR products. Lane 1: 100-bp DNA ladder, Lane 2: negative control, Lane 3: positive control, Lanes: 4, 6, 8, 9, 10, 11, 12 glmM-positive samples, and Lane 5 and 7: glmM-negative samples." ] ] 1 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Pathology report (n=39) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">P-value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Severe</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 (79%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Moderate</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (12.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Mild</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (7.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2621554.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Distribution of levels of active inflammation in the 39 biopsy samples." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:35 [ 0 => array:3 [ "identificador" => "bib0180" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori: molecular basis for colonization and survival in gastric environment and resistance to antibiotics. A short review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S. Fagoonee" 1 => "R. Pellicano" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Infect Dis (Lond)" "fecha" => "2019" "volumen" => "51" "paginaInicial" => "399" "paginaFinal" => "408" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0185" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection causes characteristic DNA damage patterns in human cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Koeppel" 1 => "F. Garcia-Alcalde" 2 => "F. Glowinski" 3 => "P. Schlaermann" 4 => "T.F. Meyer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.celrep.2015.05.030" "Revista" => array:6 [ "tituloSerie" => "Cell Rep" "fecha" => "2015" "volumen" => "11" "paginaInicial" => "1703" "paginaFinal" => "1713" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26074077" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0190" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathobiology of Helicobacter pylori-induced gastric cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Amieva" 1 => "R.M. Peek Jr." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2015.09.004" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2016" "volumen" => "150" "paginaInicial" => "64" "paginaFinal" => "78" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26385073" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0195" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnosis of Helicobacter pylori infection: a look into molecular aspects of urea breath test" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C. Marinoni" 1 => "D.G. Ribaldone" 2 => "C. Rosso" 3 => "M. Astegiano" 4 => "G.P. Caviglia" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Minerva Biotecnol" "fecha" => "2019" "volumen" => "31" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0200" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Carcinogenic bacterial pathogen Helicobacter pylori triggers DNA double-strand breaks and a DNA damage response in its host cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I.M. Toller" 1 => "K.J. Neelsen" 2 => "M. Steger" 3 => "M.L. Hartung" 4 => "M.O. Hottiger" 5 => "M. Stucki" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.1100959108" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2011" "volumen" => "108" "paginaInicial" => "14944" "paginaFinal" => "14949" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21896770" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0205" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "titulo" => "Schistosomes I. liver flukes and Helicobacter pylori IARC working group on the evaluation of carcinogenic risks to humans. Lyon, 7–14 June 1994" ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "IARC Monogr Eval Carcinog Risks Hum" "fecha" => "1994" "volumen" => "61" "paginaInicial" => "1" "paginaFinal" => "241" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7715068" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0210" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The molecular characteristics of colorectal cancer: implications for diagnosis and therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "H.T. Nguyen" 1 => "H.Q. Duong" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Oncol Lett" "fecha" => "2018" "volumen" => "16" "paginaInicial" => "9" "paginaFinal" => "18" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0215" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Five common cancers in Iran" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A.R. Radmard" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arch Iran Med" "fecha" => "2010" "volumen" => "13" "paginaInicial" => "143" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20187669" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0220" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between STAT3 rs1053004 polymorphism and cancer risk: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Moazeni-Roodi" 1 => "M. Hashemi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.22099/mbrc.2018.29688.1323" "Revista" => array:5 [ "tituloSerie" => "Mol Biol Res Commun" "fecha" => "2018" "volumen" => "7" "paginaInicial" => "119" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30426029" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0225" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori and colorectal cancer—a bacterium going abroad?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Butt" 1 => "M. Epplein" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.ppat.1007861" "Revista" => array:5 [ "tituloSerie" => "PLoS Pathog" "fecha" => "2019" "volumen" => "15" "paginaInicial" => "e1007861" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31393968" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0230" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Synergistic effect of hyperglycemia and Helicobacter pylori infection status on colorectal adenoma risk" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K.C. Hu" 1 => "M.S. Wu" 2 => "C.H. Chu" 3 => "H.Y. Wang" 4 => "S.C. Lin" 5 => "S.C. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2017-00257" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab" "fecha" => "2017" "volumen" => "102" "paginaInicial" => "2744" "paginaFinal" => "2750" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28475740" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0235" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of screening colonoscopy for colorectal tumors in Helicobacter pylori-related chronic gastritis with MDM2 SNP309 G/G homozygous: a prospective cross-sectional study in Thailand" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Tongtawee" 1 => "T. Simawaranon" 2 => "W. Wattanawongdon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.5152/tjg.2018.17608" "Revista" => array:6 [ "tituloSerie" => "Turk J Gastroenterol" "fecha" => "2018" "volumen" => "29" "paginaInicial" => "555" "paginaFinal" => "560" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30260777" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0240" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection and the risk of colorectal carcinoma: a systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F. Yang" 1 => "Y.L. Xu" 2 => "R.F. Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.23736/S0026-4806.19.05942-1" "Revista" => array:6 [ "tituloSerie" => "Minerva Med" "fecha" => "2019" "volumen" => "110" "paginaInicial" => "464" "paginaFinal" => "470" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31368293" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0245" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori seropositivity is positively associated with colorectal neoplasms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "K.W. Nam" 1 => "M.K. Baeg" 2 => "J.H. Kwon" 3 => "S.H. Cho" 4 => "S.J. Na" 5 => "M.G. Choi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4166/kjg.2013.61.5.259" "Revista" => array:6 [ "tituloSerie" => "Korean J Gastroenterol" "fecha" => "2013" "volumen" => "61" "paginaInicial" => "259" "paginaFinal" => "264" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23756667" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0250" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori is a risk factor for colonic neoplasms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Sonnenberg" 1 => "R.M. Genta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ajg.2012.407" "Revista" => array:6 [ "tituloSerie" => "Am J Gastroenterol" "fecha" => "2013" "volumen" => "108" "paginaInicial" => "208" "paginaFinal" => "215" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23208272" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0255" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori associated gastritis increases risk of colorectal polyps: a hospital based-cross-sectional study in Nakhon Ratchasima Province, northeastern Thailand" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Tongtawee" 1 => "S. Kaewpitoon" 2 => "N. Kaewpitoon" 3 => "C. Dechsukhum" 4 => "W. Leeanansaksiri" 5 => "R.A. Loyd" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7314/apjcp.2016.17.1.341" "Revista" => array:6 [ "tituloSerie" => "Asian Pac J Cancer Prev" "fecha" => "2016" "volumen" => "17" "paginaInicial" => "341" "paginaFinal" => "345" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26838234" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0260" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serologic response to Helicobacter pylori proteins associated with risk of colorectal cancer among diverse populations in the United States" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Butt" 1 => "M.G. Varga" 2 => "W.J. Blot" 3 => "L. Teras" 4 => "K. Visvanathan" 5 => "L. Le Marchand" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2018.09.054" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2019" "volumen" => "156" "paginaInicial" => "175" "paginaFinal" => "186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30296434" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0265" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection and the risk of colorectal cancer: a nationwide population-based cohort study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I.L. Liu" 1 => "C.H. Tsai" 2 => "C.H. Hsu" 3 => "J.M. Hu" 4 => "Y.C. Chen" 5 => "Y.F. Tian" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/qjmed/hcz157" "Revista" => array:6 [ "tituloSerie" => "QJM" "fecha" => "2019" "volumen" => "112" "paginaInicial" => "787" "paginaFinal" => "792" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31250012" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0270" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of Helicobacter pylori with colorectal cancer development" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F.F. Alsamak" 1 => "A.S. Abdulamir" 2 => "L.K. Mahdi" 3 => "K. Alnaib" 4 => "F.A. Bakar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Asian Biomed (Res Rev News)" "fecha" => "2010" "volumen" => "4" "paginaInicial" => "609" "paginaFinal" => "618" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0275" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection and colorectal carcinoma risk: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y. Zhao" 1 => "X. Wang" 2 => "Y. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4103/0973-1482.191621" "Revista" => array:7 [ "tituloSerie" => "J Cancer Res Ther" "fecha" => "2016" "volumen" => "12" "numero" => "Suppl." "paginaInicial" => "15" "paginaFinal" => "18" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27721244" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0280" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.-J. Lu" 1 => "C.-L. Perng" 2 => "R.-Y. Shyu" 3 => "C.-H. Chen" 4 => "Q. Lou" 5 => "S.K. Chong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.37.3.772-774.1999" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1999" "volumen" => "37" "paginaInicial" => "772" "paginaFinal" => "774" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9986850" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0285" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection and colorectal cancer risk: evidence from a large population-based case-control study in Germany" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Zhang" 1 => "M. Hoffmeister" 2 => "M.N. Weck" 3 => "J. Chang-Claude" 4 => "H. Brenner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/aje/kwr331" "Revista" => array:6 [ "tituloSerie" => "Am J Epidemiol" "fecha" => "2012" "volumen" => "175" "paginaInicial" => "441" "paginaFinal" => "450" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22294430" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0290" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Infectious agents and colorectal cancer: a review of Helicobacter pylori, Streptococcus bovis, JC virus, and human papillomavirus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A.N. Burnett-Hartman" 1 => "P.A. Newcomb" 2 => "J.D. Potter" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/1055-9965.EPI-08-0571" "Revista" => array:7 [ "tituloSerie" => "Cancer Epidemiol Biomarkers Prev" "fecha" => "2008" "volumen" => "17" "paginaInicial" => "2970" "paginaFinal" => "2979" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18990738" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0002937802000741" "estado" => "S300" "issn" => "00029378" ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0295" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prediagnostic Helicobacter pylori antibodies and colorectal cancer risk in an elderly Caucasian population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.L. Blase" 1 => "P.T. Campbell" 2 => "S.M. Gapstur" 3 => "M. Pawlita" 4 => "A. Michel" 5 => "T. Waterboer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/hel.12305" "Revista" => array:6 [ "tituloSerie" => "Helicobacter" "fecha" => "2016" "volumen" => "21" "paginaInicial" => "488" "paginaFinal" => "492" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27006167" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0300" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Colorectal cancer in Iran: molecular epidemiology and screening strategies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R. Dolatkhah" 1 => "M.H. Somi" 2 => "M.J. Bonyadi" 3 => "I. Asvadi Kermani" 4 => "F. Farassati" 5 => "S. Dastgiri" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1155/2015/643020" "Revista" => array:5 [ "tituloSerie" => "J Cancer Epidemiol" "fecha" => "2015" "volumen" => "2015" "paginaInicial" => "643020" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25685149" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0305" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular identification of Helicobacter DNA present in human colorectal adenocarcinomas by 16S rDNA PCR amplification and pyrosequencing analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "N. Grahn" 1 => "M. Hmani-Aifa" 2 => "K. Fransen" 3 => "P. Soderkvist" 4 => "H.J. Monstein" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1099/jmm.0.46122-0" "Revista" => array:7 [ "tituloSerie" => "J Med Microbiol" "fecha" => "2005" "volumen" => "54" "numero" => "Pt 11" "paginaInicial" => "1031" "paginaFinal" => "1035" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16192433" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0310" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiple displacement amplification of DNA from human colon and rectum biopsies: bacterial profiling and identification of Helicobacter pylori-DNA by means of 16S rDNA-based TTGE and pyrosequencing analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H.J. Monstein" 1 => "C. Olsson" 2 => "I. Nilsson" 3 => "N. Grahn" 4 => "C. Benoni" 5 => "S. Ahrne" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.mimet.2005.03.012" "Revista" => array:6 [ "tituloSerie" => "J Microbiol Methods" "fecha" => "2005" "volumen" => "63" "paginaInicial" => "239" "paginaFinal" => "247" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15935494" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0315" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Global burden of colorectal cancer: emerging trends, risk factors and prevention strategies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "N. Keum" 1 => "E. Giovannucci" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41575-019-0189-8" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Gastroenterol Hepatol" "fecha" => "2019" "volumen" => "16" "paginaInicial" => "713" "paginaFinal" => "732" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31455888" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0320" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gastric pathology associated with Helicobacter pylori" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J.R. Warren" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0889-8553(05)70139-4" "Revista" => array:6 [ "tituloSerie" => "Gastroenterol Clin North Am" "fecha" => "2000" "volumen" => "29" "paginaInicial" => "705" "paginaFinal" => "751" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11030082" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0325" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Steinbach" 1 => "P.M. Lynch" 2 => "R.K. Phillips" 3 => "M.H. Wallace" 4 => "E. Hawk" 5 => "G.B. Gordon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJM200006293422603" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2000" "volumen" => "342" "paginaInicial" => "1946" "paginaFinal" => "1952" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10874062" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0330" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cyclooxygenase-2 expression: a significant prognostic indicator for patients with colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L.T. Soumaoro" 1 => "H. Uetake" 2 => "T. Higuchi" 3 => "Y. Takagi" 4 => "M. Enomoto" 5 => "K. Sugihara" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/1078-0432.CCR-04-0653" "Revista" => array:6 [ "tituloSerie" => "Clin Cancer Res" "fecha" => "2004" "volumen" => "10" "paginaInicial" => "8465" "paginaFinal" => "8471" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15623626" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0335" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of large serrated polyps with synchronous advanced colorectal neoplasia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Li" 1 => "C. Jin" 2 => "C. McCulloch" 3 => "S. Kakar" 4 => "B.M. Berger" 5 => "T.F. Imperiale" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ajg.2008.166" "Revista" => array:6 [ "tituloSerie" => "Am J Gastroenterol" "fecha" => "2009" "volumen" => "104" "paginaInicial" => "695" "paginaFinal" => "702" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19223889" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0340" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Combination of sulindac and antimicrobial eradication of Helicobacter pylori prevents progression of gastric cancer in hypergastrinemic INS-GAS mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.W. Lee" 1 => "B. Rickman" 2 => "A.B. Rogers" 3 => "S. Muthupalani" 4 => "S. Takaishi" 5 => "P. Yang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/0008-5472.CAN-08-3856" "Revista" => array:6 [ "tituloSerie" => "Cancer Res" "fecha" => "2009" "volumen" => "69" "paginaInicial" => "8166" "paginaFinal" => "8174" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19826057" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0345" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Helicobacter pylori infection and exaggerated gastrin release. Effects of inflammation and progastrin processing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D.Y. Graham" 1 => "M.F. Go" 2 => "G.M. Lew" 3 => "R.M. Genta" 4 => "J.F. Rehfeld" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/00365529309098274" "Revista" => array:6 [ "tituloSerie" => "Scand J Gastroenterol" "fecha" => "1993" "volumen" => "28" "paginaInicial" => "690" "paginaFinal" => "694" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8210984" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0350" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Relationship between Helicobacter pylori CagA status and colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Shmuely" 1 => "D. Passaro" 2 => "A. Figer" 3 => "Y. Niv" 4 => "S. Pitlik" 5 => "Z. Samra" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1572-0241.2001.05342.x" "Revista" => array:6 [ "tituloSerie" => "Am J Gastroenterol" "fecha" => "2001" "volumen" => "96" "paginaInicial" => "3406" "paginaFinal" => "3410" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11774957" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15769887/0000002200000002/v1_202106120702/S1576988720300674/v1_202106120702/en/main.assets" "Apartado" => array:4 [ "identificador" => "10130" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/15769887/0000002200000002/v1_202106120702/S1576988720300674/v1_202106120702/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988720300674?idApp=UINPBA00004N"]