Effects of sub-inhibitory concentration of antibiotic and heat stress on the expression of type II TA system genes in Brucella spp.

array:22 ["pii" => "S1576988723000249" "issn" => "15769887" "doi" => "10.1016/j.vacun.2023.03.002" "estado" => "S300" "fechaPublicacion" => "2023-10-01" "aid" => "288" "copyrightAnyo" => "2023" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Vacunas. 2023;24:266-72" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S1576988723000298" "issn" => "15769887" "doi" => "10.1016/j.vacun.2023.04.002" "estado" => "S300" "fechaPublicacion" => "2023-10-01" "aid" => "290" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Vacunas. 2023;24:273-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "The polymorphisms of TNF-α related-gene and antibody production following third dose of COVID-19 vaccination: A pilot study" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "273" "paginaFinal" => "277" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Los polimorfismos del gen relacionado con el TNF-α y la producción de anticuerpos después de la tercera dosis de la vacuna contra el COVID-19: Un estudio piloto" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Phey Liana, Zen Hafy, Soilia Fertilita, Ella Amalia, Veny Larasati, Tungki Pratama Umar" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Phey" "apellidos" => "Liana" ] 1 => array:2 [ "nombre" => "Zen" "apellidos" => "Hafy" ] 2 => array:2 [ "nombre" => "Soilia" "apellidos" => "Fertilita" ] 3 => array:2 [ "nombre" => "Ella" "apellidos" => "Amalia" ] 4 => array:2 [ "nombre" => "Veny" "apellidos" => "Larasati" ] 5 => array:2 [ "nombre" => "Tungki Pratama" "apellidos" => "Umar" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000298?idApp=UINPBA00004N" "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000298/v1_202311130323/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1576988723000675" "issn" => "15769887" "doi" => "10.1016/j.vacun.2023.08.001" "estado" => "S300" "fechaPublicacion" => "2023-10-01" "aid" => "314" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "sco" "cita" => "Vacunas. 2023;24:261-5" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:10 [ "idiomaDefecto" => true "cabecera" => "Editorial" "titulo" => "Vacunación frente al SARS-CoV-2 en otoño de 2023: ¿a quién y cómo hay que vacunar?" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "261" "paginaFinal" => "265" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Autumn 2023 SARS-CoV-2 immunization: Who should be vaccinated and how?" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fernando Moraga-Llop, Magda Campins-Martí" "autores" => array:2 [ 0 => array:2 [ "nombre" => "Fernando" "apellidos" => "Moraga-Llop" ] 1 => array:2 [ "nombre" => "Magda" "apellidos" => "Campins-Martí" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2445146023000547" "doi" => "10.1016/j.vacune.2023.10.003" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2445146023000547?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000675?idApp=UINPBA00004N" "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000675/v1_202311130323/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Effects of sub-inhibitory concentration of antibiotic and heat stress on the expression of type II TA system genes in Brucella spp." "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "266" "paginaFinal" => "272" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Fatemeh Amraei, Negar Narimisa, Shiva Mirkalantari, Shabnam Razavi, Behrooz Sadeghi Kalani, Faramarz Masjedian Jazi" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Fatemeh" "apellidos" => "Amraei" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "af0010" ] ] ] 1 => array:3 [ "nombre" => "Negar" "apellidos" => "Narimisa" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "af0010" ] ] ] 2 => array:3 [ "nombre" => "Shiva" "apellidos" => "Mirkalantari" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "af0010" ] ] ] 3 => array:3 [ "nombre" => "Shabnam" "apellidos" => "Razavi" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "af0010" ] ] ] 4 => array:3 [ "nombre" => "Behrooz Sadeghi" "apellidos" => "Kalani" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "af0015" ] 1 => array:2 [ "etiqueta" => "d" "identificador" => "af0020" ] ] ] 5 => array:4 [ "nombre" => "Faramarz Masjedian" "apellidos" => "Jazi" "email" => array:1 [ 0 => "Masjedian.f@iums.ac.ir" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "af0010" ] 2 => array:2 [ "etiqueta" => "*" "identificador" => "cr0005" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Microbial Biotechnology Research Center, University of Medical Sciences, Iran" "etiqueta" => "a" "identificador" => "af0005" ] 1 => array:3 [ "entidad" => "Department of Microbiology, School of Medicine, Iran University of Medical Sciences, Tehran" "etiqueta" => "b" "identificador" => "af0010" ] 2 => array:3 [ "entidad" => "Department of Medical Microbiology, Faculty of Medicine, Ilam University of Medical Sciences, Iran" "etiqueta" => "c" "identificador" => "af0015" ] 3 => array:3 [ "entidad" => "Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran" "etiqueta" => "d" "identificador" => "af0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cr0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Efectos de la Concentración sub-inhibitoria de Antibiótico y Estrés Calórico sobre la expresión de genes del sistema TA tipo II en Brucella spp" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "f0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2244 "Ancho" => 1575 "Tamanyo" => 267523 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "al0010" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Analysis of relative expression levels of the type II TA system genes in the presence of rifampin at sub MIC (a) and heat (b) in Brucella strains. The expression of type II toxin genes (relE, fic, brnT and cogT) as well as the expression of type II antitoxin genes (rhh-like, phd, brnA and cogAT) are shown. Graph data are indicated as the means±SD of three independent replicates. *P < 0.05; **P < 0.01; ***P < 0.001; by One-way ANOVA, Conover's-test and Friedman test for multiple comparisons." ] ] ] "textoCompleto" => "IntroductionBrucella is a facultative intracellular pathogen that causes abortion and infertility in animals and a severe debilitating febrile illness in humans.<a class="elsevierStyleCrossRef" href="#bb0005">1</a>Brucella includes six classical species (Brucella abortus, Brucella canis, Brucella melitensis, Brucella neotomae, Brucella ovis, and Brucella suis) and five novel species (Brucella ceti, Brucella microti, Brucella inopinata, Brucella papionis and Brucella pinnipedialis).<a class="elsevierStyleCrossRef" href="#bb0010">2</a>Brucella organisms invade the reticuloendothelial cells and can be sequestered in infected macrophages in different body parts, such as the spleen, brain, joints, heart, liver, and bone marrow.<a class="elsevierStyleCrossRef" href="#bb0015">3</a> The increased rate of multi-drug resistant bacteria is a significant health concern due to the widespread use of antibiotics.<a class="elsevierStyleCrossRef" href="#bb0020">4</a>,<a class="elsevierStyleCrossRef" href="#bb0025">5</a> Sub-MIC of antibiotics can have various effects on pathogenic bacteria. Many studies have shown that the sub-MICs of antibiotics can act as signal molecules and may alter bacterial physicochemical characteristics and the expression of bacterial virulence genes.<a class="elsevierStyleCrossRef" href="#bb0030">6</a>,<a class="elsevierStyleCrossRef" href="#bb0035">7</a> However, the changes caused by the antibiotic sub-MIC show the conditions that bacteria encounter in the wild environment.<a class="elsevierStyleCrossRef" href="#bb0040">8</a>,<a class="elsevierStyleCrossRef" href="#bb0045">9</a>Like many other pathogens, Brucella is exposed to many stressful conditions during infection and colonization of the human body. Many bacteria show extreme changes in gene expression under conditions such as nutritional deficiency and antibiotic stress. This can alter metabolic and physiology and increase resistance to multiple environmental stresses.<a class="elsevierStyleCrossRef" href="#bb0050">10</a>One of the possible mechanisms involved in bacterial responses to extreme environmental conditions is the TA system. TA systems can be used as antibacterial targets where two components of this system (toxin and antitoxin) are located on a single operon. The toxin of all the characterized bacterial TA systems is protein, while the antitoxin is either protein or a small RNA (sRNA). In general, the toxin component is more stable than the antitoxin. These systems are currently classified into six types (Type I-Type VI) based on the antitoxin component's nature and mechanism of action, which is either protein or antisense RNA.<a class="elsevierStyleCrossRef" href="#bb0055">11</a>,<a class="elsevierStyleCrossRef" href="#bb0060">12</a> The role of chromosomal type II TA systems is not clearly understood yet. However, it seems that these systems are involved in the bacterial response to stress conditions. In stress conditions, the labile antitoxin is degraded by proteases such as Clp and Lon.<a class="elsevierStyleCrossRefs" href="#bb0065">13–15</a> Type II TA systems are the most well-characterized TA system types. The protein antitoxin neutralizes the toxin component by forming a tight toxin-antitoxin complex, which also serves as a transcriptional repressor for the autoregulation of transcription.<a class="elsevierStyleCrossRef" href="#bb0055">11</a>,<a class="elsevierStyleCrossRef" href="#bb0080">16</a> In normal conditions, the toxin component is neutralized by its cognate antitoxin. Different functions are attributed to TA systems, including tolerance to antibiotics, programmed cell death, biofilm formation, stress response, gene regulation, quorum sensing, and antiphage activity.Moreover, several studies have reported the presence of these modules in various bacteria and their role in antibiotic resistance.<a class="elsevierStyleCrossRef" href="#bb0085">17</a> In this study, to provide more information about the role of TA systems in heat and antibiotic stresses, we evaluated the expression levels of type II TA system genes of Brucella spp. were treated with sub-MIC of rifampin and heat stress.Material and methodsBacterial strainsIn this study, two standard strains of Brucella spp., including B. melitensis (16 M) and B. abortus (B19), as well as an animal (25-T, 8-A) and human (22-H) isolates were studied, which were previously characterized and stored in Brain Heart Infusion (BHI) broth containing 20% glycerol at −80 °C in the reference laboratory of School of Medicine, Iran University of Medical Sciences, Tehran, Iran. For our experiments, strains were cultured on Brucella agar (Merck, Darmstadt, Germany) and incubated at 37 °C with 5% CO2 for 48 h.<a class="elsevierStyleCrossRef" href="#bb0090">18</a>Extraction of genomic DNAAccording to the manufacture's instructions, genomic DNA extraction from Brucella isolates was performed using Gene All Kit (South Korea). DNA concentration was determined using a NanoDrop™ spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The absorbance ratio at 260 nm and 280 nm (A260/280) was measured to assess the purity of DNA, and the value of ∼1.8 was considered pure for extracted DNA.DNA was stored at −20 °C until the polymerase chain reaction (PCR) was carried out.<a class="elsevierStyleCrossRef" href="#bb0095">19</a>,<a class="elsevierStyleCrossRef" href="#bb0100">20</a>Identification of type II TA system genes and primer design Nucleotide sequence of Brucella spp. was downloaded from NCBI, and type II TA systems were determined by the TADB database (<a href="http://bioinfomml.sjtu.edu.cn/TADB/">http://bioinfomml.sjtu.edu.cn/TADB/</a>) and TA finder. Finally, specific primers were designed using primer3 software (<a class="elsevierStyleCrossRef" href="#t0005">Table 1</a>). PCR assay was used to detect the presence of type II TA system genes (RelE/RHH-Like, Fic/Phd, Brn T/Brn A, and COGT/COGAT) in Brucella spp. PCR amplifications were performed in a final volume of 25 μL in a DNA thermal cycler (PeqLab, Germany). PCR program consisted of an initial denaturation step at 95 °C for 4 min; 35 × 95 °C for 45 s, annealing at 60 °C for 45 s, and extension at 72 °C for 30 s, with a final extension step at 72 °C for 3 min.<elsevierMultimedia ident="t0005"></elsevierMultimedia>Heat shock responseBrucella isolates were cultivated on Brucella agar and incubated at 37 °C with 5% CO2 for 48 h. For each isolate, one colony from an overnight culture was inoculated in trypticase soy broth (TSB) and incubated for 48 h at 37 °C. A second subculture was diluted 100-fold in TSB and incubated at 37 °C on a shaker at 225 rpm. Once cultures reached the mid-log growth phase (optical density at 600 nm, 0.25), for all experiments, a control culture was grown at 37 °C in TSB in the absence of stress.To induce a heat shock response, the culture temperature was shifted from 37 °C to 42 °C, and samples were incubated for 20 to 30 min.<a class="elsevierStyleCrossRef" href="#bb0085">17</a>,<a class="elsevierStyleCrossRef" href="#bb0105">21</a>Determination of MIC and the effect of a sub-inhibitory concentration of antibiotics on bacterial growthMIC of the rifampin antibiotic was determined according to the National Committee for Clinical Laboratory Standards (NCCLS).<a class="elsevierStyleCrossRef" href="#bb0110">22</a> The microdilution method was carried out in the 96-well microtiter plates inoculated with Brucella isolates for MIC determination. For this purpose, bacterial cultures were diluted 1:100 v/v in fresh sterile Mueller Hinton Broth (MHB) and incubated at 37 °C with 5% CO2 for 48 h. Bacterial cultures were then adjusted with 0.5 McFarland standards to obtain a suspension density of 108 CFU/ml, and different concentrations of antibiotic solution were added to the 96-well microtiter plates. The plate were then incubated at 37 °C with 5% CO2 for 48 h. MIC was defined as the lowest concentration of antibiotic that caused bacterial growth inhibition characterized by a lack of turbidity after 48 h of incubation. MIC assays were performed in triplicates.<a class="elsevierStyleCrossRef" href="#bb0115">23</a>After MIC determination, Brucella isolates were exposed to the sub- MIC concentration of rifampin to induce antibiotic stress. A sub-MIC concentration of rifampin was added to treated sample and incubated at 37 ° C and 5% CO2 for one h with shaking at 220 rpm. Finally, total RNA was extracted from treated and control samples using an RNA isolation kit (Roche kit, Germany). Also, for the bacterial survival at 1, 2, 3, 4, 5, and 18 h, estimating turbidimetrically and colony count were performed. Untreated bacterial cells were used as controls at different time intervals. All experiments were performed at least three times<a class="elsevierStyleCrossRef" href="#bb0120">24</a> independently.Real-time PCRTotal RNA from Brucella isolates was extracted using a high pure RNA isolation kit (Roche kit, Germany) for heat and antibiotic stresses. Total RNA of untreated Brucella isolates was also extracted as control. The quantity and quality of RNA were assessed using the NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) and gel electrophoresis analysis. In order to remove DNA contamination, extracted RNA was treated with DNase1 (Roche, Germany) according to the manufacturer's protocols. Total RNA was reverse transcribed to cDNA using the cDNA Synthesis Kit (Takara, Japan).The qRT-PCR (three replicates) assay for each gene was performed on Rotor-Gene thermal cycler according to the following program: one cycle of 95 °C for 12 min, 40 cycles of 95 °C for 10 s, and one cycle of 60 °C for 45 s.A housekeeping gene called 16SrRNA was used as the internal control for normalization mRNA levels and fold changes. mRNA expression was calculated by the 2^ (−∆∆CT) method.<a class="elsevierStyleCrossRef" href="#bb0125">25</a>Statistical analysesData obtained from the mRNA expression analysis are presented as means ± standard error of three independent assessments. Values obtained for the expression of each gene exposed to antibiotics and heat were compared using a one-way analysis of variance (ANOVA) test followed by Conover's test and Friedman test for multiple comparisons by Prism 8 (GraphPad Software, Inc). P value of less than 0.05 was considered statistically significant.ResultsIdentification of type II TA systemsIn this study, we investigated the existence of type II TA systems in Brucella isolates. Our results revealed the presence of all the studied genes of type II TA system in these strains.Growth curves and viability assessments for Brucella sppIn this study, we first determined the MIC ranges of rifampin against B. melitensis (16 M) and B. abortus (B19) as well as in animal (25-T, 8-A) and human (22-H) isolates using the broth microdilution assay. The MIC of the selected antibiotic for 16 M and 22-H was 2 μg/ml, and for B19, 25-T, and 8-A, it was 4 μg/ml.Brucella isolates at exponential phase were exposed to sub-MIC of this antibiotic to evaluate the effects of rifampin on cell survival. Both the viable counts and OD600 values were measured at different times.As shown in <a class="elsevierStyleCrossRef" href="#f0005">Fig. 1</a> the growth of Brucella isolates was inhibited in the presence of 1/2 MIC of rifampin. After 18 h exposure to rifampin, log10 CFU/ml and the value of OD600 reduced compared to the control sample for all strains. Generally, the results showed that the sub-MIC concentration of rifampin could reduce bacterial growth.<elsevierMultimedia ident="f0005"></elsevierMultimedia>Relative gene expressionTo evaluate the expression of type II TA system genes under antibiotic stress, Brucella isolates were exposed to sub-MIC of the selected antibiotic for one hour. Our results showed that for all samples, the expression levels of genes coding for type II TA systems (RelE/RHH-Like, Fic/Phd, Brn T/Brn A, and COGT/COGAT) increased in the presence of rifampin (<a class="elsevierStyleCrossRef" href="#f0010">Fig. 2</a>).<elsevierMultimedia ident="f0010"></elsevierMultimedia>Furthermore, our qRT-PCR data analysis showed that following heat stress, the studied type II TA systems (RelE/RHH-Like, Fic/Phd, and COGT/COGAT) in the selected strains showed higher expression levels compared to the control sample. However, the expression of the Brn T/Brn A TA system decreased compared to the control sample (<a class="elsevierStyleCrossRef" href="#f0010">Fig. 2</a>).DiscussionThe TA system is a potential target for new prophylactic and therapeutic approaches that are needed in antibiotic resistance. The study presented new evidence linking TA to the pathogenic profile of various critical bacterial pathogens that cause severe human illness.<a class="elsevierStyleCrossRef" href="#bb0055">11</a>,<a class="elsevierStyleCrossRef" href="#bb0130">26</a> Although several mechanisms have been attributed to stress responses for Brucella spp., few studies have investigated the contribution of the TA systems. Therefore, the goal of this study was to determine the effects of heat and sub-MIC of rifampin on the growth and expression of the type II TA system genes in Brucella spp. Our results showed bacterial cell reduction following exposure to the sub-MIC of rifampin, suggesting the effect of this antibiotic on Brucella growth. Our study investigated the effects of heat and sub-MIC of rifampin on the expression of genes coding for type II TA systems. According to the results of the qRT-PCR assay, the presence of rifampin could increase the expression of TA system genes. Moreover, results of the qRT-PCR assay showed that under heat stress conditions, the expression levels of some of these systems decreased compared to the control sample. The bacterial TA system is responsible for cell cycle arrest and survival against environmental stresses such as nutrient deficiency, antibiotic treatment, and immune system attack. Previous studies have shown the role of the TA system in response to environmental stress conditions.<a class="elsevierStyleCrossRef" href="#bb0070">14</a>,<a class="elsevierStyleCrossRef" href="#bb0135">27</a> In a study by Lin et al., GroEL heat shock proteins were in B. abortus were examined. The maximum response of these proteins was observed between 42 °C and 46 °C and within 2 to 3 h following temperature shift. The results showed the roles of these gene products during environmental stress and in protective immunity against brucellosis.<a class="elsevierStyleCrossRef" href="#bb0140">28</a> Gomes et al. also exposed B. melitensis to different thermal, acidic, and oxidative stresses, and according to N-terminal sequence analysis and database searching, they indicated that the 19 proteins regulated following these stress conditions. Their results indicated that B. melitensis could employ specific regulatory mechanisms in response to stress conditions.<a class="elsevierStyleCrossRef" href="#bb0105">21</a>In this study, the expression of the TA system gene Rel E /RHH increased under stress conditions in Brucella isolates. RelE toxin is one of the most well-studied ribosome-dependent toxins that act by degrading mRNA at the stop codon at the ribosome A site.<a class="elsevierStyleCrossRef" href="#bb0150">30</a> Va'zquez-Laslop showed that the ectopic expression of RelE and MazF toxins in E. coli might contribute to antibiotic tolerance and persistence.<a class="elsevierStyleCrossRef" href="#bb0155">31</a> According to these studies, the expression of TA systems could be different under environmental stresses, and many mechanisms are involved in stress responses.<a class="elsevierStyleCrossRef" href="#bb0145">29</a> Generally, bacteria have the potential to activate the TA system and possibly other virulence factors under environmental stress to counteract these conditions. Given the limited information regarding the role of type II TA systems in response to various stresses in Brucella spp., we studied the expression levels of the TA system genes in Brucella spp. under heat and antibiotic stresses.ConclusionOur results show that the expression levels of some of these systems increased following heat treatment, while the expression levels of all the studied TA system genes increased in the presence of rifampin. Therefore, these results indicate the diverse impact of these systems depending on the type of stress and the need for further studies on the role and importance of these systems under different environmental stress conditions.Ethical approvalThis research was approved by the ethics committee of the Iran University of Medical Sciences (the approval number: IR.IUMS.FMD.REC.1397.031).Availability of data and materialsAll the data in this article are included in the manuscript.FundingThis study was financially supported by a research grant (No.33075) for an M.Sc thesis in Iran University of Medical Sciences (Tehran, Iran), for which we are very grateful.CRediT authorship contribution statementFatemeh Amraei: Methodology, Data curation, Writing – original draft, Writing – review & editing. Negar Narimisa: Conceptualization, Methodology, Writing – review & editing. Shiva Mirkalantari: Visualization, Investigation, Writing – review & editing. Shabnam Razavi: Visualization, Investigation, Writing – review & editing. Behrooz Sadeghi Kalani: Data curation, Writing – original draft, Visualization, Investigation, Writing – review & editing. Faramarz Masjedian Jazi: Supervision, Writing – review & editing." "textoCompletoSecciones" => array:1 [ "secciones" => array:14 [ 0 => array:3 [ "identificador" => "xres2009181" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "as0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "as0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "as0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "as0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1721712" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres2009182" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "as0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "as0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "as0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "as0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1721713" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "s0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "s0010" "titulo" => "Material and methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "s0015" "titulo" => "Bacterial strains" ] 1 => array:2 [ "identificador" => "s0020" "titulo" => "Extraction of genomic DNA" ] 2 => array:2 [ "identificador" => "s0025" "titulo" => "Heat shock response" ] 3 => array:2 [ "identificador" => "s0030" "titulo" => "Determination of MIC and the effect of a sub-inhibitory concentration of antibiotics on bacterial growth" ] 4 => array:2 [ "identificador" => "s0035" "titulo" => "Real-time PCR" ] 5 => array:2 [ "identificador" => "s0040" "titulo" => "Statistical analyses" ] ] ] 6 => array:3 [ "identificador" => "s0045" "titulo" => "Results" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "s0050" "titulo" => "Identification of type II TA systems" ] 1 => array:2 [ "identificador" => "s0055" "titulo" => "Growth curves and viability assessments for Brucella spp" ] 2 => array:2 [ "identificador" => "s0060" "titulo" => "Relative gene expression" ] ] ] 7 => array:2 [ "identificador" => "s0065" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "s0070" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "s0075" "titulo" => "Ethical approval" ] 10 => array:2 [ "identificador" => "s0080" "titulo" => "Availability of data and materials" ] 11 => array:2 [ "identificador" => "s0085" "titulo" => "Funding" ] 12 => array:2 [ "identificador" => "s0090" "titulo" => "CRediT authorship contribution statement" ] 13 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2022-12-20" "fechaAceptado" => "2023-03-21" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1721712" "palabras" => array:5 [ 0 => "Brucella melitensis" 1 => "Brucella abortus" 2 => "Heat stress" 3 => "Toxin-antitoxin systems" 4 => "Real-time PCR" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1721713" "palabras" => array:6 [ 0 => "Brucella melitensis" 1 => "Brucella abortus" 2 => "Concentración subinhibitoria de antibiótico" 3 => "Estrés por calor" 4 => "Sistemas toxina-antitoxina" 5 => "PCR en tiempo real" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "ObjectiveBacteria can react to stress conditions using the Toxin-Antitoxin (TA) system. This study investigated the expression of TA system genes under heat and antibiotic stresses in Brucella spp. MethodsTo determine the effects of sub-inhibitory concentration (sub-MIC) of rifampin on bacterial survival and growth, a colony-forming unit was quantitated, and turbidity was assessed following the treatment of Brucella isolates, with ½ minimum inhibitory concentration (MIC) of antibiotic at different time intervals. Also, Brucella isolates were exposed to heat stress (42 °C) compared to the control (37 °C). Finally, the expression of TA system genes in Brucella isolates was evaluated one hour after treatment using the quantitative reverse transcription PCR (qRT-PCR) method. ResultsOur results showed that the growth of the Brucella isolates reduced in the presence of the sub-MIC of antibiotics compared to the control. The results of the qPCR assay showed that, in the presence of rifampicin the expression of the TA system genes increased and, under the heat stress conditions, the expression of the TA system genes increased compared to controls expect brnT / brnA system. ConclusionAlthough the exact role of the TA system in response to various stresses is not yet fully understood, our study provided information on the effectiveness of the type II TA system under heat and antibiotic stress conditions by examining the gene expression of type II systems in Brucella isolates." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "as0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "as0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "as0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "as0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "ObjetivoLas bacterias pueden reaccionar a condiciones de estrés utilizando el sistema Toxina-Antitoxina (TA). Este estudio investigó la expresión de los genes del sistema TA bajo estrés por calor y antibióticos en Brucella spp. MétodosPara determinar los efectos de la concentración subinhibitoria (sub-MIC) de rifampicina sobre la supervivencia y el crecimiento bacteriano, se cuantificó una unidad formadora de colonias y se evaluó la turbidez después del tratamiento de aislados de Brucella, con la mitad de la concentración inhibitoria mínima (MIC) de antibiótico a diferentes intervalos de tiempo. Además, los aislados de Brucella estuvieron expuestos a estrés por calor (42 °C) en comparación con el control (37 °C). Finalmente, la expresión de genes del sistema TA en aislados de Brucella se evaluó una hora después del tratamiento utilizando el método de PCR de transcripción inversa cuantitativa (qRT-PCR). ResultadosNuestros resultados mostraron que el crecimiento de los aislados de Brucella se redujo en presencia de sub-MIC de antibióticos en comparación con el control. Los resultados del ensayo qPCR mostraron que, en presencia de rifampicina, la expresión de los genes del sistema TA aumentó y, en condiciones de estrés por calor, la expresión de los genes del sistema TA aumentó en comparación con los controles que esperan el sistema brnT / brnA. ConclusiónAunque aún se desconoce el papel exacto del sistema TA en la respuesta al estrés, nuestro estudio proporcionó información sobre la eficacia del sistema TA Tipo II en condiciones de estrés por calor y antibióticos." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "as0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "as0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "as0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "as0040" "titulo" => "Conclusión" ] ] ] ] "multimedia" => array:3 [ 0 => array:8 [ "identificador" => "f0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 4090 "Ancho" => 1703 "Tamanyo" => 331989 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "al0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Effects of sub-MIC of rifampin on the survival of Brucella strains. (a,b) Growth curves (c,d) viability curves. Data are indicated as the means±SD of three independent replicates." ] ] 1 => array:8 [ "identificador" => "f0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2244 "Ancho" => 1575 "Tamanyo" => 267523 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "al0010" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Analysis of relative expression levels of the type II TA system genes in the presence of rifampin at sub MIC (a) and heat (b) in Brucella strains. The expression of type II toxin genes (relE, fic, brnT and cogT) as well as the expression of type II antitoxin genes (rhh-like, phd, brnA and cogAT) are shown. Graph data are indicated as the means±SD of three independent replicates. *P < 0.05; **P < 0.01; ***P < 0.001; by One-way ANOVA, Conover's-test and Friedman test for multiple comparisons." ] ] 2 => array:8 [ "identificador" => "t0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "al0015" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "qRT_PCR, Quantitative Reverse Transcription PCR." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer Name \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer Sequence (5′ → 3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product size (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Annealing temperature \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reference \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rel E</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F:TGCAATTGAGCGAAGATTTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">208</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: TCATCCGGTGGTAAGATTGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rhh-like</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: CTAACGGAGCGAAGCAGAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">82</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: TATCCCTGATCTCCCTGCCT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">fic</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: CATCAGGAACAACTGCGCTT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">111</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: ATCGGGATTGCCATAGGCTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">phd</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: TCGGTGATTCCTATGGGGTA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">158</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: CGCGATTTGCATCTTCTTTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">brn T</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: ACAGACCAACATTGCCAAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">106</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: GATTGCCATCAGGCGATCTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">brn A</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: TCAGGAGGAAGAGGCAGAAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">197</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">58 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: CCTGATCGAGCCGGATAGTA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">cogT</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: ATCTGGAAGCCGTCATGGAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">122</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: GGCCATGACAATGCTGGAAT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">cogAT</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: AAATGGCTGCATACGCCAAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">181</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: CTTCGTCGTGGTAGGGATGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16S rRNA</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">F: CAGATTACGCAAGCAGCCTT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">134</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">58 °C</td><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010">2</a></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">R: TCCTCGACGCTTAGTGTCTC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3336368.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Primers used for both PCR and qRT-PCR studies." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bs0005" "bibliografiaReferencia" => array:31 [ 0 => array:3 [ "identificador" => "bb0005" "etiqueta" => "1." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Brucellosis in Iran: Why Not Eradicated?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H.E. Leylabadlo" 1 => "A.Z. Bialvaei" 2 => "H. Samadi Kafil" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2015" "volumen" => "61" "numero" => "10" "paginaInicial" => "1629" "paginaFinal" => "1630" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bb0010" "etiqueta" => "2." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The expression of type II TA system genes following exposure to the sub-inhibitory concentration of gentamicin and acid stress in Brucella spp" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "F. Amraei" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Microb Pathog" "fecha" => "2020" "paginaInicial" => "262104194" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bb0015" "etiqueta" => "3." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Relationship between γ-interferon gene polymorphisms and susceptibility to brucellosis infection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "E. Eskandari-Nasab" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/1348-0421.12093" "Revista" => array:7 [ "tituloSerie" => "Microbiol Immunol" "fecha" => "2013" "volumen" => "57" "numero" => "11" "paginaInicial" => "785" "paginaFinal" => "791" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24033468" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bb0020" "etiqueta" => "4." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of colonizing and disease-causing Klebsiella pneumoniae in paediatric patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "M.L. Little" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1099/jmm.0.063354-0" "Revista" => array:6 [ "tituloSerie" => "J Med Microbiol" "fecha" => "2014" "volumen" => "63" "numero" => "Pt 4" "paginaInicial" => "610" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24464691" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bb0025" "etiqueta" => "5." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of carbapenem-resistant organisms and other Gram-negative MDRO in German ICUs: first results from the national nosocomial infection surveillance system (KISS)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "F. Maechler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s15010-014-0701-6" "Revista" => array:7 [ "tituloSerie" => "Infection" "fecha" => "2015" "volumen" => "43" "numero" => "2" "paginaInicial" => "163" "paginaFinal" => "168" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25395161" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bb0030" "etiqueta" => "6." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vancomycin modifies the expression of the agr system in multidrug- resistant Staphylococcus aureus clinical isolates" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "V. Cázares-Domínguez" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fmicb.2015.00369" "Revista" => array:5 [ "tituloSerie" => "Front Microbiol" "fecha" => "2015" "volumen" => "6" "paginaInicial" => "369" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25999924" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bb0035" "etiqueta" => "7." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sub-inhibitory concentration of piperacillin–tazobactam may be related to virulence properties of filamentous Escherichia coli" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "J.P.L. de Andrade" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00284-015-0912-9" "Revista" => array:7 [ "tituloSerie" => "Curr Microbiol" "fecha" => "2016" "volumen" => "72" "numero" => "1" "paginaInicial" => "19" "paginaFinal" => "27428" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26364189" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bb0040" "etiqueta" => "8." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Transcriptome analysis reveals AI-2 relevant genes of multi-drug resistant Klebsiella pneumoniae in response to eugenol at sub-MIC" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "Y.-M. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Front Microbiol" "fecha" => "2019" "paginaInicial" => "10" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bb0045" "etiqueta" => "9." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effects of sub-inhibitory concentrations of antibiotics and oxidative stress on the expression of type II toxin-antitoxin system genes in Klebsiella pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "N. Narimisa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Global Antimicrob Resist" "fecha" => "2020" "volumen" => "21" "paginaInicial" => "51" "paginaFinal" => "56" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bb0050" "etiqueta" => "10." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Brucella abortus host factor I (HF-I) protein contributes to stress resistance during stationary phase and is a major determinant of virulence in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G.T. Robertson" 1 => "R.M. Roop" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mol Microbiol" "fecha" => "1999" "volumen" => "28234" "numero" => "4" "paginaInicial" => "690" "paginaFinal" => "700" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bb0055" "etiqueta" => "11." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging roles of toxin-antitoxin modules in bacterial pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Kędzierska" 1 => "F.J. Hayes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/molecules21060790" "Revista" => array:6 [ "tituloSerie" => "Molecules" "fecha" => "2016" "volumen" => "21" "numero" => "6" "paginaInicial" => "790" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27322231" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bb0060" "etiqueta" => "12." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Toxin-antitoxin systems in bacterial growth arrest and persistence" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R. Page" 1 => "W.J. Peti" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nchembio.2044" "Revista" => array:6 [ "tituloSerie" => "Nat Chem Biol" "fecha" => "2016" "volumen" => "12" "numero" => "4" "paginaInicial" => "208" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26991085" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bb0065" "etiqueta" => "13." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Toxins of prokaryotic toxin-antitoxin systems with sequence-specific endoribonuclease activity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "H. Masuda" 1 => "M. Inouye" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Toxins" "fecha" => "2017" "volumen" => "9" "numero" => "4" "paginaInicial" => "140" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bb0070" "etiqueta" => "14." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Toxin–antitoxin systems and their role in disseminating and maintaining antimicrobial resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Q.E. Yang" 1 => "T.R. Walsh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/femsre/fux006" "Revista" => array:7 [ "tituloSerie" => "FEMS Microbiol Rev" "fecha" => "2017" "volumen" => "41" "numero" => "3" "paginaInicial" => "343" "paginaFinal" => "353" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28449040" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bb0075" "etiqueta" => "15." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Persister cells formation and expression of type II Toxin-Antitoxin system genes in Brucella melitensis (16M) and Brucella abortus (B19)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F. Amraei" 1 => "N. Narimisa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.30699/ijp.2020.118902.2294" "Revista" => array:6 [ "tituloSerie" => "Iran J Pathol" "fecha" => "2020" "volumen" => "15" "numero" => "2" "paginaInicial" => "127" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32215028" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bb0080" "etiqueta" => "16." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Type II toxin/antitoxin system genes expression in persister cells of Klebsiella pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "N. Narimisa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Med Microbiol" "fecha" => "2020" "volumen" => "31" "numero" => "4" "paginaInicial" => "215" "paginaFinal" => "220" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bb0085" "etiqueta" => "17." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Putative type II toxin-antitoxin systems in Listeria monocytogenes isolated from clinical, food, and animal samples in Iran" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "B.S. Kalani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.micpath.2018.06.003" "Revista" => array:6 [ "tituloSerie" => "Microb Pathog" "fecha" => "2018" "volumen" => "122" "paginaInicial" => "19" "paginaFinal" => "24" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29879433" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bb0090" "etiqueta" => "18." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of proline racemase/hydroxyproline epimerase gene in human brucella isolates in Iran" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "I. Hashemifar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.14196/mjiri.31.57" "Revista" => array:5 [ "tituloSerie" => "Med J Islam Repub Iran" "fecha" => "2017" "volumen" => "31" "paginaInicial" => "57" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29445686" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bb0095" "etiqueta" => "19." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Real-time PCR and high-resolution melt analysis methods for detection of pathogenic species of Brucella" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "F.M. Jazi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/bjdp.12451" "Revista" => array:6 [ "fecha" => "2017" "volumen" => "41" "numero" => "6" "paginaInicial" => "325" "paginaFinal" => "331" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/37114745" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bb0100" "etiqueta" => "20." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular prevalence of putative virulence-associated genes in Brucella melitensis and Brucella abortus isolates from human and livestock specimens in Iran" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "I. Hashemifar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Microb Pathog" "fecha" => "2017" "volumen" => "105" "paginaInicial" => "21" "paginaFinal" => "334" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bb0105" "etiqueta" => "21." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of heat, oxidative, and acid stress responses in Brucella melitensis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "A.P. Teixeira-Gomes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/IAI.68.5.2954-2961.2000" "Revista" => array:7 [ "tituloSerie" => "Infect Immun" "fecha" => "2000" "volumen" => "68" "numero" => "5" "paginaInicial" => "2954" "paginaFinal" => "2961" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10768994" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bb0110" "etiqueta" => "22." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antimicrobial resistance in leptospira, brucella, and other rarely investigated veterinary and zoonotic pathogens" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D. Trott" 1 => "S. Abraham" 2 => "B. Adler" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Microbiol SpectrMicrobiol Spectr" "fecha" => "2018" "volumen" => "6" "numero" => "4" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bb0115" "etiqueta" => "23." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Archaeal Persisters: Persister Cell Formation as a Stress Response in Haloferax volcanii" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Megaw" 1 => "B.F. Gilmore" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Front Microbiol" "fecha" => "2017" "volumen" => "8" "paginaInicial" => "1589" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bb0120" "etiqueta" => "24." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sub-inhibitory fosmidomycin exposures elicits oxidative stress in Salmonella enterica serovar Typhimurium LT2" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "D.T. Fox" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "PLoS One" "fecha" => "2014" "volumen" => "9" "numero" => "4" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bb0125" "etiqueta" => "25." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K.J. Livak" 1 => "T.D. Schmittgen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1006/meth.2001.1262" "Revista" => array:7 [ "tituloSerie" => "Methods" "fecha" => "2001" "volumen" => "25" "numero" => "4" "paginaInicial" => "402" "paginaFinal" => "408" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bb0130" "etiqueta" => "26." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biofilm establishment, biofilm persister cell formation, and relative gene expression analysis of type II toxin-antitoxin system in Klebsiella pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "N. Narimisa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Gene Rep" "fecha" => "2020" "volumen" => "317" "paginaInicial" => "100846" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bb0135" "etiqueta" => "27." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comprehensive comparative-genomic analysis of type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "K.S. Makarova" 1 => "Y.I. Wolf" 2 => "E.V. Koonin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Biol Direct" "fecha" => "2009" "volumen" => "320 4(1)" "paginaInicial" => "19" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bb0140" "etiqueta" => "28." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of the heat shock response in Brucella abortus and isolation of the genes encoding the GroE heat shock proteins" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "J. Lin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/iai.60.6.2425-2431.1992" "Revista" => array:7 [ "tituloSerie" => "Infect Immun" "fecha" => "1992" "volumen" => "60" "numero" => "6" "paginaInicial" => "2425" "paginaFinal" => "2431" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1350274" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bb0145" "etiqueta" => "29." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular structure and function of the novel BrnT/BrnA toxin-antitoxin system of Brucella abortus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "B.E. Heaton" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M111.332163" "Revista" => array:7 [ "tituloSerie" => "J Biol Chem" "fecha" => "2012" "volumen" => "287" "numero" => "15" "paginaInicial" => "12098" "paginaFinal" => "12110" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22334680" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bb0150" "etiqueta" => "30." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure of the Proteus vulgaris HigB-(HigA) 2-HigB toxin-antitoxin complexes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "M.A. Schureck" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M113.512095" "Revista" => array:7 [ "tituloSerie" => "J Biol Chem" "fecha" => "2014" "volumen" => "289" "numero" => "2" "paginaInicial" => "1060" "paginaFinal" => "1070" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24257752" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bb0155" "etiqueta" => "31." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased persistence in Escherichia coli caused by controlled expression of toxins or other unrelated proteins" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "N. Vázquez-Laslop" 1 => "H. Lee" 2 => "A.A. Neyfakh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Bacteriol" "fecha" => "2006" "volumen" => "188" "numero" => "10" "paginaInicial" => "3494" "paginaFinal" => "3497" ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000249/v1_202311130323/en/main.assets" "Apartado" => array:4 [ "identificador" => "17855" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/15769887/0000002400000004/v1_202311130323/S1576988723000249/v1_202311130323/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000249?idApp=UINPBA00004N"]

Statistics

Original

Effects of sub-inhibitory concentration of antibiotic and heat stress on the expression of type II TA system genes in Brucella spp.

Efectos de la Concentración sub-inhibitoria de Antibiótico y Estrés Calórico sobre la expresión de genes del sistema TA tipo II en Brucella spp

Fatemeh Amraeia,b, Negar Narimisaa,b, Shiva Mirkalantaria,b, Shabnam Razavia,b, Behrooz Sadeghi Kalanic,d, Faramarz Masjedian Jazia,b,

Corresponding author

Masjedian.f@iums.ac.ir

Corresponding author.

a Microbial Biotechnology Research Center, University of Medical Sciences, Iran

b Department of Microbiology, School of Medicine, Iran University of Medical Sciences, Tehran

c Department of Medical Microbiology, Faculty of Medicine, Ilam University of Medical Sciences, Iran

d Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran

Read

246

Times
was read the article

Total PDF

172

Total HTML

Share statistics

 array:22 [
  "pii" => "S1576988723000249"
  "issn" => "15769887"
  "doi" => "10.1016/j.vacun.2023.03.002"
  "estado" => "S300"
  "fechaPublicacion" => "2023-10-01"
  "aid" => "288"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Vacunas. 2023;24:266-72"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1576988723000298"
    "issn" => "15769887"
    "doi" => "10.1016/j.vacun.2023.04.002"
    "estado" => "S300"
    "fechaPublicacion" => "2023-10-01"
    "aid" => "290"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Vacunas. 2023;24:273-7"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "The polymorphisms of TNF-&#945; related-gene and antibody production following third dose of COVID-19 vaccination&#58; A pilot study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "273"
          "paginaFinal" => "277"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Los polimorfismos del gen relacionado con el TNF-&#945; y la producci&#243;n de anticuerpos despu&#233;s de la tercera dosis de la vacuna contra el COVID-19&#58; Un estudio piloto"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Phey Liana, Zen Hafy, Soilia Fertilita, Ella Amalia, Veny Larasati, Tungki Pratama Umar"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Phey"
              "apellidos" => "Liana"
            ]
            1 => array:2 [
              "nombre" => "Zen"
              "apellidos" => "Hafy"
            ]
            2 => array:2 [
              "nombre" => "Soilia"
              "apellidos" => "Fertilita"
            ]
            3 => array:2 [
              "nombre" => "Ella"
              "apellidos" => "Amalia"
            ]
            4 => array:2 [
              "nombre" => "Veny"
              "apellidos" => "Larasati"
            ]
            5 => array:2 [
              "nombre" => "Tungki Pratama"
              "apellidos" => "Umar"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000298?idApp=UINPBA00004N"
    "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000298/v1_202311130323/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1576988723000675"
    "issn" => "15769887"
    "doi" => "10.1016/j.vacun.2023.08.001"
    "estado" => "S300"
    "fechaPublicacion" => "2023-10-01"
    "aid" => "314"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "sco"
    "cita" => "Vacunas. 2023;24:261-5"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:10 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Editorial</span>"
      "titulo" => "Vacunaci&#243;n frente al SARS-CoV-2 en oto&#241;o de 2023&#58; &#191;a qui&#233;n y c&#243;mo hay que vacunar&#63;"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "261"
          "paginaFinal" => "265"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Autumn 2023 SARS-CoV-2 immunization&#58; Who should be vaccinated and how&#63;"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Fernando Moraga-Llop, Magda Campins-Mart&#237;"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "Fernando"
              "apellidos" => "Moraga-Llop"
            ]
            1 => array:2 [
              "nombre" => "Magda"
              "apellidos" => "Campins-Mart&#237;"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2445146023000547"
        "doi" => "10.1016/j.vacune.2023.10.003"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2445146023000547?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000675?idApp=UINPBA00004N"
    "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000675/v1_202311130323/es/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
    "titulo" => "Effects of sub-inhibitory concentration of antibiotic and heat stress on the expression of type II TA system genes in Brucella spp&#46;"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "266"
        "paginaFinal" => "272"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Fatemeh Amraei, Negar Narimisa, Shiva Mirkalantari, Shabnam Razavi, Behrooz Sadeghi Kalani, Faramarz Masjedian Jazi"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Fatemeh"
            "apellidos" => "Amraei"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "af0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "af0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Negar"
            "apellidos" => "Narimisa"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "af0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "af0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Shiva"
            "apellidos" => "Mirkalantari"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "af0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "af0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Shabnam"
            "apellidos" => "Razavi"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "af0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "af0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Behrooz Sadeghi"
            "apellidos" => "Kalani"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "af0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "af0020"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Faramarz Masjedian"
            "apellidos" => "Jazi"
            "email" => array:1 [
              0 => "Masjedian.f@iums.ac.ir"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "af0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "af0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cr0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Microbial Biotechnology Research Center&#44; University of Medical Sciences&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "af0005"
          ]
          1 => array:3 [
            "entidad" => "Department of Microbiology&#44; School of Medicine&#44; Iran University of Medical Sciences&#44; Tehran"
            "etiqueta" => "b"
            "identificador" => "af0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Medical Microbiology&#44; Faculty of Medicine&#44; Ilam University of Medical Sciences&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "af0015"
          ]
          3 => array:3 [
            "entidad" => "Clinical Microbiology Research Center&#44; Ilam University of Medical Sciences&#44; Ilam&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "af0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cr0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Efectos de la Concentraci&#243;n sub-inhibitoria de Antibi&#243;tico y Estr&#233;s Cal&#243;rico sobre la expresi&#243;n de genes del sistema TA tipo II en Brucella spp"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "f0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2244
            "Ancho" => 1575
            "Tamanyo" => 267523
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "al0010"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Analysis of relative expression levels of the type II TA system genes in the presence of rifampin at sub MIC &#40;a&#41; and heat &#40;b&#41; in Brucella strains&#46; The expression of type II toxin genes &#40;relE&#44; fic&#44; brnT and cogT&#41; as well as the expression of type II antitoxin genes &#40;rhh-like&#44; phd&#44; brnA and cogAT&#41; are shown&#46; Graph data are indicated as the means<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent replicates&#46; &#42;P&#8239;&#60;&#8239;0&#46;05&#59; &#42;&#42;P&#8239;&#60;&#8239;0&#46;01&#59; &#42;&#42;&#42;P&#8239;&#60;&#8239;0&#46;001&#59; by One-way ANOVA&#44; Conover&#39;s-test and Friedman test for multiple comparisons&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="s0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0065">Introduction</span><p id="p0005" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Brucella</span> is a facultative intracellular pathogen that causes abortion and infertility in animals and a severe debilitating febrile illness in humans&#46;<a class="elsevierStyleCrossRef" href="#bb0005"><span class="elsevierStyleSup">1</span></a><span class="elsevierStyleItalic">Brucella</span> includes six classical species &#40;<span class="elsevierStyleItalic">Brucella abortus&#44; Brucella canis&#44; Brucella melitensis&#44; Brucella neotomae&#44; Brucella ovis</span>&#44; and <span class="elsevierStyleItalic">Brucella suis</span>&#41; and five novel species &#40;<span class="elsevierStyleItalic">Brucella ceti&#44; Brucella microti&#44; Brucella inopinata&#44; Brucella papionis</span> and <span class="elsevierStyleItalic">Brucella pinnipedialis</span>&#41;&#46;<a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a><span class="elsevierStyleItalic">Brucella</span> organisms invade the reticuloendothelial cells and can be sequestered in infected macrophages in different body parts&#44; such as the spleen&#44; brain&#44; joints&#44; heart&#44; liver&#44; and bone marrow&#46;<a class="elsevierStyleCrossRef" href="#bb0015"><span class="elsevierStyleSup">3</span></a> The increased rate of multi-drug resistant bacteria is a significant health concern due to the widespread use of antibiotics&#46;<a class="elsevierStyleCrossRef" href="#bb0020"><span class="elsevierStyleSup">4</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0025"><span class="elsevierStyleSup">5</span></a> Sub-MIC of antibiotics can have various effects on pathogenic bacteria&#46; Many studies have shown that the sub-MICs of antibiotics can act as signal molecules and may alter bacterial physicochemical characteristics and the expression of bacterial virulence genes&#46;<a class="elsevierStyleCrossRef" href="#bb0030"><span class="elsevierStyleSup">6</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0035"><span class="elsevierStyleSup">7</span></a> However&#44; the changes caused by the antibiotic sub-MIC show the conditions that bacteria encounter in the wild environment&#46;<a class="elsevierStyleCrossRef" href="#bb0040"><span class="elsevierStyleSup">8</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0045"><span class="elsevierStyleSup">9</span></a></p><p id="p0010" class="elsevierStylePara elsevierViewall">Like many other pathogens&#44; <span class="elsevierStyleItalic">Brucella</span> is exposed to many stressful conditions during infection and colonization of the human body&#46; Many bacteria show extreme changes in gene expression under conditions such as nutritional deficiency and antibiotic stress&#46; This can alter metabolic and physiology and increase resistance to multiple environmental stresses&#46;<a class="elsevierStyleCrossRef" href="#bb0050"><span class="elsevierStyleSup">10</span></a></p><p id="p0015" class="elsevierStylePara elsevierViewall">One of the possible mechanisms involved in bacterial responses to extreme environmental conditions is the TA system&#46; TA systems can be used as antibacterial targets where two components of this system &#40;toxin and antitoxin&#41; are located on a single operon&#46; The toxin of all the characterized bacterial TA systems is protein&#44; while the antitoxin is either protein or a small RNA &#40;sRNA&#41;&#46; In general&#44; the toxin component is more stable than the antitoxin&#46; These systems are currently classified into six types &#40;Type I-Type VI&#41; based on the antitoxin component&#39;s nature and mechanism of action&#44; which is either protein or antisense RNA&#46;<a class="elsevierStyleCrossRef" href="#bb0055"><span class="elsevierStyleSup">11</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0060"><span class="elsevierStyleSup">12</span></a> The role of chromosomal type II TA systems is not clearly understood yet&#46; However&#44; it seems that these systems are involved in the bacterial response to stress conditions&#46; In stress conditions&#44; the labile antitoxin is degraded by proteases such as Clp and Lon&#46;<a class="elsevierStyleCrossRefs" href="#bb0065"><span class="elsevierStyleSup">13&#8211;15</span></a> Type II TA systems are the most well-characterized TA system types&#46; The protein antitoxin neutralizes the toxin component by forming a tight toxin-antitoxin complex&#44; which also serves as a transcriptional repressor for the autoregulation of transcription&#46;<a class="elsevierStyleCrossRef" href="#bb0055"><span class="elsevierStyleSup">11</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0080"><span class="elsevierStyleSup">16</span></a> In normal conditions&#44; the toxin component is neutralized by its cognate antitoxin&#46; Different functions are attributed to TA systems&#44; including tolerance to antibiotics&#44; programmed cell death&#44; biofilm formation&#44; stress response&#44; gene regulation&#44; quorum sensing&#44; and antiphage activity&#46;</p><p id="p0020" class="elsevierStylePara elsevierViewall">Moreover&#44; several studies have reported the presence of these modules in various bacteria and their role in antibiotic resistance&#46;<a class="elsevierStyleCrossRef" href="#bb0085"><span class="elsevierStyleSup">17</span></a> In this study&#44; to provide more information about the role of TA systems in heat and antibiotic stresses&#44; we evaluated the expression levels of type II TA system genes of <span class="elsevierStyleItalic">Brucella</span> spp&#46; were treated with sub-MIC of rifampin and heat stress&#46;</p></span><span id="s0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0070">Material and methods</span><span id="s0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0075">Bacterial strains</span><p id="p0025" class="elsevierStylePara elsevierViewall">In this study&#44; two standard strains of <span class="elsevierStyleItalic">Brucella</span> spp&#46;&#44; including <span class="elsevierStyleItalic">B&#46; melitensis</span> &#40;16&#8239;M&#41; and <span class="elsevierStyleItalic">B&#46; abortus</span> &#40;B19&#41;&#44; as well as an animal &#40;25-T&#44; 8-A&#41; and human &#40;22-H&#41; isolates were studied&#44; which were previously characterized and stored in Brain Heart Infusion &#40;BHI&#41; broth containing 20&#37; glycerol at &#8722;<span class="elsevierStyleHsp" style=""></span>80&#8239;&#176;C in the reference laboratory of School of Medicine&#44; Iran University of Medical Sciences&#44; Tehran&#44; Iran&#46; For our experiments&#44; strains were cultured on Brucella agar &#40;Merck&#44; Darmstadt&#44; Germany&#41; and incubated at 37&#8239;&#176;C with 5&#37; CO2 for 48&#8239;h&#46;<a class="elsevierStyleCrossRef" href="#bb0090"><span class="elsevierStyleSup">18</span></a></p></span><span id="s0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0080">Extraction of genomic DNA</span><p id="p0030" class="elsevierStylePara elsevierViewall">According to the manufacture&#39;s instructions&#44; genomic DNA extraction from <span class="elsevierStyleItalic">Brucella</span> isolates was performed using Gene All Kit &#40;South Korea&#41;&#46; DNA concentration was determined using a NanoDrop&#8482; spectrophotometer &#40;Thermo Fisher Scientific&#44; Waltham&#44; MA&#44; USA&#41;&#46; The absorbance ratio at 260&#8239;nm and 280&#8239;nm &#40;A260&#47;280&#41; was measured to assess the purity of DNA&#44; and the value of &#8764;<span class="elsevierStyleHsp" style=""></span>1&#46;8 was considered pure for extracted DNA&#46;</p><p id="p0035" class="elsevierStylePara elsevierViewall">DNA was stored at &#8722;<span class="elsevierStyleHsp" style=""></span>20&#8239;&#176;C until the polymerase chain reaction &#40;PCR&#41; was carried out&#46;<a class="elsevierStyleCrossRef" href="#bb0095"><span class="elsevierStyleSup">19</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0100"><span class="elsevierStyleSup">20</span></a></p><p id="p0040" class="elsevierStylePara elsevierViewall">Identification of type II TA system genes and primer design Nucleotide sequence of <span class="elsevierStyleItalic">Brucella</span> spp&#46; was downloaded from NCBI&#44; and type II TA systems were determined by the TADB database &#40;<a href="http://bioinfomml.sjtu.edu.cn/TADB/">http&#58;&#47;&#47;bioinfomml&#46;sjtu&#46;edu&#46;cn&#47;TADB&#47;</a>&#41; and TA finder&#46; Finally&#44; specific primers were designed using primer3 software &#40;<a class="elsevierStyleCrossRef" href="#t0005">Table 1</a>&#41;&#46; PCR assay was used to detect the presence of type II TA system genes &#40;RelE&#47;RHH-Like&#44; Fic&#47;Phd&#44; Brn T&#47;Brn A&#44; and COGT&#47;COGAT&#41; in <span class="elsevierStyleItalic">Brucella</span> spp&#46; PCR amplifications were performed in a final volume of 25&#8239;&#956;L in a DNA thermal cycler &#40;PeqLab&#44; Germany&#41;&#46; PCR program consisted of an initial denaturation step at 95&#8239;&#176;C for 4&#8239;min&#59; 35&#8239;&#215; 95&#8239;&#176;C for 45&#8239;s&#44; annealing at 60&#8239;&#176;C for 45&#8239;s&#44; and extension at 72&#8239;&#176;C for 30&#8239;s&#44; with a final extension step at 72&#8239;&#176;C for 3&#8239;min&#46;</p><elsevierMultimedia ident="t0005"></elsevierMultimedia></span><span id="s0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0085">Heat shock response</span><p id="p0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Brucella</span> isolates were cultivated on Brucella agar and incubated at 37&#8239;&#176;C with 5&#37; CO2 for 48&#8239;h&#46; For each isolate&#44; one colony from an overnight culture was inoculated in trypticase soy broth &#40;TSB&#41; and incubated for 48&#8239;h at 37&#8239;&#176;C&#46; A second subculture was diluted 100-fold in TSB and incubated at 37&#8239;&#176;C on a shaker at 225&#8239;rpm&#46; Once cultures reached the mid-log growth phase &#40;optical density at 600&#8239;nm&#44; 0&#46;25&#41;&#44; for all experiments&#44; a control culture was grown at 37&#8239;&#176;C in TSB in the absence of stress&#46;</p><p id="p0050" class="elsevierStylePara elsevierViewall">To induce a heat shock response&#44; the culture temperature was shifted from 37&#8239;&#176;C to 42&#8239;&#176;C&#44; and samples were incubated for 20 to 30&#8239;min&#46;<a class="elsevierStyleCrossRef" href="#bb0085"><span class="elsevierStyleSup">17</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0105"><span class="elsevierStyleSup">21</span></a></p></span><span id="s0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0090">Determination of MIC and the effect of a sub-inhibitory concentration of antibiotics on bacterial growth</span><p id="p0055" class="elsevierStylePara elsevierViewall">MIC of the rifampin antibiotic was determined according to the National Committee for Clinical Laboratory Standards &#40;NCCLS&#41;&#46;<a class="elsevierStyleCrossRef" href="#bb0110"><span class="elsevierStyleSup">22</span></a> The microdilution method was carried out in the 96-well microtiter plates inoculated with <span class="elsevierStyleItalic">Brucella</span> isolates for MIC determination&#46; For this purpose&#44; bacterial cultures were diluted 1&#58;100&#8239;<span class="elsevierStyleItalic">v</span>&#47;v in fresh sterile Mueller Hinton Broth &#40;MHB&#41; and incubated at 37&#8239;&#176;C with 5&#37; CO2 for 48&#8239;h&#46; Bacterial cultures were then adjusted with 0&#46;5 McFarland standards to obtain a suspension density of 10<span class="elsevierStyleSup">8</span>&#8239;CFU&#47;ml&#44; and different concentrations of antibiotic solution were added to the 96-well microtiter plates&#46; The plate were then incubated at 37&#8239;&#176;C with 5&#37; CO2 for 48&#8239;h&#46; MIC was defined as the lowest concentration of antibiotic that caused bacterial growth inhibition characterized by a lack of turbidity after 48&#8239;h of incubation&#46; MIC assays were performed in triplicates&#46;<a class="elsevierStyleCrossRef" href="#bb0115"><span class="elsevierStyleSup">23</span></a></p><p id="p0060" class="elsevierStylePara elsevierViewall">After MIC determination&#44; <span class="elsevierStyleItalic">Brucella</span> isolates were exposed to the sub- MIC concentration of rifampin to induce antibiotic stress&#46; A sub-MIC concentration of rifampin was added to treated sample and incubated at 37&#8239;&#176; C and 5&#37; CO2 for one h with shaking at 220&#8239;rpm&#46; Finally&#44; total RNA was extracted from treated and control samples using an RNA isolation kit &#40;Roche kit&#44; Germany&#41;&#46; Also&#44; for the bacterial survival at 1&#44; 2&#44; 3&#44; 4&#44; 5&#44; and 18&#8239;h&#44; estimating turbidimetrically and colony count were performed&#46; Untreated bacterial cells were used as controls at different time intervals&#46; All experiments were performed at least three times<a class="elsevierStyleCrossRef" href="#bb0120"><span class="elsevierStyleSup">24</span></a> independently&#46;</p></span><span id="s0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0095">Real-time PCR</span><p id="p0065" class="elsevierStylePara elsevierViewall">Total RNA from <span class="elsevierStyleItalic">Brucella</span> isolates was extracted using a high pure RNA isolation kit &#40;Roche kit&#44; Germany&#41; for heat and antibiotic stresses&#46; Total RNA of untreated <span class="elsevierStyleItalic">Brucella</span> isolates was also extracted as control&#46; The quantity and quality of RNA were assessed using the NanoDrop spectrophotometer &#40;Thermo Fisher Scientific&#44; USA&#41; and gel electrophoresis analysis&#46; In order to remove DNA contamination&#44; extracted RNA was treated with DNase1 &#40;Roche&#44; Germany&#41; according to the manufacturer&#39;s protocols&#46; Total RNA was reverse transcribed to cDNA using the cDNA Synthesis Kit &#40;Takara&#44; Japan&#41;&#46;</p><p id="p0070" class="elsevierStylePara elsevierViewall">The qRT-PCR &#40;three replicates&#41; assay for each gene was performed on Rotor-Gene thermal cycler according to the following program&#58; one cycle of 95&#8239;&#176;C for 12&#8239;min&#44; 40&#8239;cycles of 95&#8239;&#176;C for 10&#8239;s&#44; and one cycle of 60&#8239;&#176;C for 45&#8239;s&#46;</p><p id="p0075" class="elsevierStylePara elsevierViewall">A housekeeping gene called 16SrRNA was used as the internal control for normalization mRNA levels and fold changes&#46; mRNA expression was calculated by the 2&#94; <span class="elsevierStyleSup">&#40;&#8722;&#8710;&#8710;CT&#41;</span> method&#46;<a class="elsevierStyleCrossRef" href="#bb0125"><span class="elsevierStyleSup">25</span></a></p></span><span id="s0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0100">Statistical analyses</span><p id="p0080" class="elsevierStylePara elsevierViewall">Data obtained from the mRNA expression analysis are presented as means &#177; standard error of three independent assessments&#46; Values obtained for the expression of each gene exposed to antibiotics and heat were compared using a one-way analysis of variance &#40;ANOVA&#41; test followed by Conover&#39;s test and Friedman test for multiple comparisons by Prism 8 &#40;GraphPad Software&#44; Inc&#41;&#46; <span class="elsevierStyleItalic">P</span> value of less than 0&#46;05 was considered statistically significant&#46;</p></span></span><span id="s0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0105">Results</span><span id="s0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0110">Identification of type II TA systems</span><p id="p0085" class="elsevierStylePara elsevierViewall">In this study&#44; we investigated the existence of type II TA systems in <span class="elsevierStyleItalic">Brucella</span> isolates&#46; Our results revealed the presence of all the studied genes of type II TA system in these strains&#46;</p></span><span id="s0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0115">Growth curves and viability assessments for <span class="elsevierStyleItalic">Brucella</span> spp</span><p id="p0090" class="elsevierStylePara elsevierViewall">In this study&#44; we first determined the MIC ranges of rifampin against <span class="elsevierStyleItalic">B&#46; melitensis</span> &#40;16&#8239;M&#41; and <span class="elsevierStyleItalic">B&#46; abortus</span> &#40;B19&#41; as well as in animal &#40;25-T&#44; 8-A&#41; and human &#40;22-H&#41; isolates using the broth microdilution assay&#46; The MIC of the selected antibiotic for 16&#8239;M and 22-H was 2&#8239;&#956;g&#47;ml&#44; and for B19&#44; 25-T&#44; and 8-A&#44; it was 4&#8239;&#956;g&#47;ml&#46;</p><p id="p0095" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Brucella</span> isolates at exponential phase were exposed to sub-MIC of this antibiotic to evaluate the effects of rifampin on cell survival&#46; Both the viable counts and OD600 values were measured at different times&#46;</p><p id="p0100" class="elsevierStylePara elsevierViewall">As shown in <a class="elsevierStyleCrossRef" href="#f0005">Fig&#46; 1</a> the growth of <span class="elsevierStyleItalic">Brucella</span> isolates was inhibited in the presence of 1&#47;2 MIC of rifampin&#46; After 18&#8239;h exposure to rifampin&#44; log10 CFU&#47;ml and the value of OD600 reduced compared to the control sample for all strains&#46; Generally&#44; the results showed that the sub-MIC concentration of rifampin could reduce bacterial growth&#46;</p><elsevierMultimedia ident="f0005"></elsevierMultimedia></span><span id="s0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0120">Relative gene expression</span><p id="p0105" class="elsevierStylePara elsevierViewall">To evaluate the expression of type II TA system genes under antibiotic stress&#44; <span class="elsevierStyleItalic">Brucella</span> isolates were exposed to sub-MIC of the selected antibiotic for one hour&#46; Our results showed that for all samples&#44; the expression levels of genes coding for type II TA systems &#40;RelE&#47;RHH-Like&#44; Fic&#47;Phd&#44; Brn T&#47;Brn A&#44; and COGT&#47;COGAT&#41; increased in the presence of rifampin &#40;<a class="elsevierStyleCrossRef" href="#f0010">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="f0010"></elsevierMultimedia><p id="p0110" class="elsevierStylePara elsevierViewall">Furthermore&#44; our qRT-PCR data analysis showed that following heat stress&#44; the studied type II TA systems &#40;RelE&#47;RHH-Like&#44; Fic&#47;Phd&#44; and COGT&#47;COGAT&#41; in the selected strains showed higher expression levels compared to the control sample&#46; However&#44; the expression of the Brn T&#47;Brn A TA system decreased compared to the control sample &#40;<a class="elsevierStyleCrossRef" href="#f0010">Fig&#46; 2</a>&#41;&#46;</p></span></span><span id="s0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0125">Discussion</span><p id="p0115" class="elsevierStylePara elsevierViewall">The TA system is a potential target for new prophylactic and therapeutic approaches that are needed in antibiotic resistance&#46; The study presented new evidence linking TA to the pathogenic profile of various critical bacterial pathogens that cause severe human illness&#46;<a class="elsevierStyleCrossRef" href="#bb0055"><span class="elsevierStyleSup">11</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0130"><span class="elsevierStyleSup">26</span></a> Although several mechanisms have been attributed to stress responses for <span class="elsevierStyleItalic">Brucella</span> spp&#46;&#44; few studies have investigated the contribution of the TA systems&#46; Therefore&#44; the goal of this study was to determine the effects of heat and sub-MIC of rifampin on the growth and expression of the type II TA system genes in <span class="elsevierStyleItalic">Brucella</span> spp&#46; Our results showed bacterial cell reduction following exposure to the sub-MIC of rifampin&#44; suggesting the effect of this antibiotic on <span class="elsevierStyleItalic">Brucella</span> growth&#46; Our study investigated the effects of heat and sub-MIC of rifampin on the expression of genes coding for type II TA systems&#46; According to the results of the qRT-PCR assay&#44; the presence of rifampin could increase the expression of TA system genes&#46; Moreover&#44; results of the qRT-PCR assay showed that under heat stress conditions&#44; the expression levels of some of these systems decreased compared to the control sample&#46; The bacterial TA system is responsible for cell cycle arrest and survival against environmental stresses such as nutrient deficiency&#44; antibiotic treatment&#44; and immune system attack&#46; Previous studies have shown the role of the TA system in response to environmental stress conditions&#46;<a class="elsevierStyleCrossRef" href="#bb0070"><span class="elsevierStyleSup">14</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bb0135"><span class="elsevierStyleSup">27</span></a> In a study by Lin et al&#46;&#44; GroEL heat shock proteins were in <span class="elsevierStyleItalic">B&#46; abortus</span> were examined&#46; The maximum response of these proteins was observed between 42&#8239;&#176;C and 46&#8239;&#176;C and within 2 to 3&#8239;h following temperature shift&#46; The results showed the roles of these gene products during environmental stress and in protective immunity against brucellosis&#46;<a class="elsevierStyleCrossRef" href="#bb0140"><span class="elsevierStyleSup">28</span></a> Gomes et al&#46; also exposed <span class="elsevierStyleItalic">B&#46; melitensis</span> to different thermal&#44; acidic&#44; and oxidative stresses&#44; and according to N-terminal sequence analysis and database searching&#44; they indicated that the 19 proteins regulated following these stress conditions&#46; Their results indicated that <span class="elsevierStyleItalic">B&#46; melitensis</span> could employ specific regulatory mechanisms in response to stress conditions&#46;<a class="elsevierStyleCrossRef" href="#bb0105"><span class="elsevierStyleSup">21</span></a></p><p id="p0120" class="elsevierStylePara elsevierViewall">In this study&#44; the expression of the TA system gene Rel E &#47;RHH increased under stress conditions in <span class="elsevierStyleItalic">Brucella</span> isolates&#46; RelE toxin is one of the most well-studied ribosome-dependent toxins that act by degrading mRNA at the stop codon at the ribosome A site&#46;<a class="elsevierStyleCrossRef" href="#bb0150"><span class="elsevierStyleSup">30</span></a> Va&#39;zquez-Laslop showed that the ectopic expression of RelE and MazF toxins in <span class="elsevierStyleItalic">E&#46; coli</span> might contribute to antibiotic tolerance and persistence&#46;<a class="elsevierStyleCrossRef" href="#bb0155"><span class="elsevierStyleSup">31</span></a> According to these studies&#44; the expression of TA systems could be different under environmental stresses&#44; and many mechanisms are involved in stress responses&#46;<a class="elsevierStyleCrossRef" href="#bb0145"><span class="elsevierStyleSup">29</span></a> Generally&#44; bacteria have the potential to activate the TA system and possibly other virulence factors under environmental stress to counteract these conditions&#46; Given the limited information regarding the role of type II TA systems in response to various stresses in <span class="elsevierStyleItalic">Brucella</span> spp&#46;&#44; we studied the expression levels of the TA system genes in <span class="elsevierStyleItalic">Brucella</span> spp&#46; under heat and antibiotic stresses&#46;</p></span><span id="s0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0130">Conclusion</span><p id="p0125" class="elsevierStylePara elsevierViewall">Our results show that the expression levels of some of these systems increased following heat treatment&#44; while the expression levels of all the studied TA system genes increased in the presence of rifampin&#46; Therefore&#44; these results indicate the diverse impact of these systems depending on the type of stress and the need for further studies on the role and importance of these systems under different environmental stress conditions&#46;</p></span><span id="s0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0135">Ethical approval</span><p id="p0130" class="elsevierStylePara elsevierViewall">This research was approved by the ethics committee of the Iran University of Medical Sciences &#40;the approval number&#58; IR&#46;IUMS&#46;FMD&#46;REC&#46;1397&#46;031&#41;&#46;</p></span><span id="s0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0140">Availability of data and materials</span><p id="p0135" class="elsevierStylePara elsevierViewall">All the data in this article are included in the manuscript&#46;</p></span><span id="s0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0145">Funding</span><p id="p0140" class="elsevierStylePara elsevierViewall">This study was financially supported by a research grant &#40;No&#46;33075&#41; for an M&#46;Sc thesis in <span class="elsevierStyleGrantSponsor" id="gts0005">Iran University of Medical Sciences</span> &#40;Tehran&#44; Iran&#41;&#44; for which we are very grateful&#46;</p></span><span id="s0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0150">CRediT authorship contribution statement</span><p id="p0145" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">Fatemeh Amraei&#58;</span> Methodology&#44; Data curation&#44; Writing &#8211; original draft&#44; Writing &#8211; review &#38; editing&#46; <span class="elsevierStyleBold">Negar Narimisa&#58;</span> Conceptualization&#44; Methodology&#44; Writing &#8211; review &#38; editing&#46; <span class="elsevierStyleBold">Shiva Mirkalantari&#58;</span> Visualization&#44; Investigation&#44; Writing &#8211; review &#38; editing&#46; <span class="elsevierStyleBold">Shabnam Razavi&#58;</span> Visualization&#44; Investigation&#44; Writing &#8211; review &#38; editing&#46; <span class="elsevierStyleBold">Behrooz Sadeghi Kalani&#58;</span> Data curation&#44; Writing &#8211; original draft&#44; Visualization&#44; Investigation&#44; Writing &#8211; review &#38; editing&#46; <span class="elsevierStyleBold">Faramarz Masjedian Jazi&#58;</span> Supervision&#44; Writing &#8211; review &#38; editing&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:14 [
        0 => array:3 [
          "identificador" => "xres2009181"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "as0005"
              "titulo" => "Objective"
            ]
            1 => array:2 [
              "identificador" => "as0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "as0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "as0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1721712"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres2009182"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "as0025"
              "titulo" => "Objetivo"
            ]
            1 => array:2 [
              "identificador" => "as0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "as0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "as0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1721713"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "s0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "s0010"
          "titulo" => "Material and methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "s0015"
              "titulo" => "Bacterial strains"
            ]
            1 => array:2 [
              "identificador" => "s0020"
              "titulo" => "Extraction of genomic DNA"
            ]
            2 => array:2 [
              "identificador" => "s0025"
              "titulo" => "Heat shock response"
            ]
            3 => array:2 [
              "identificador" => "s0030"
              "titulo" => "Determination of MIC and the effect of a sub-inhibitory concentration of antibiotics on bacterial growth"
            ]
            4 => array:2 [
              "identificador" => "s0035"
              "titulo" => "Real-time PCR"
            ]
            5 => array:2 [
              "identificador" => "s0040"
              "titulo" => "Statistical analyses"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "s0045"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "s0050"
              "titulo" => "Identification of type II TA systems"
            ]
            1 => array:2 [
              "identificador" => "s0055"
              "titulo" => "Growth curves and viability assessments for Brucella spp"
            ]
            2 => array:2 [
              "identificador" => "s0060"
              "titulo" => "Relative gene expression"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "s0065"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "s0070"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "s0075"
          "titulo" => "Ethical approval"
        ]
        10 => array:2 [
          "identificador" => "s0080"
          "titulo" => "Availability of data and materials"
        ]
        11 => array:2 [
          "identificador" => "s0085"
          "titulo" => "Funding"
        ]
        12 => array:2 [
          "identificador" => "s0090"
          "titulo" => "CRediT authorship contribution statement"
        ]
        13 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-12-20"
    "fechaAceptado" => "2023-03-21"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1721712"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Brucella melitensis</span>"
            1 => "<span class="elsevierStyleItalic">Brucella abortus</span>"
            2 => "Heat stress"
            3 => "Toxin-antitoxin systems"
            4 => "Real-time PCR"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1721713"
          "palabras" => array:6 [
            0 => "<span class="elsevierStyleItalic">Brucella melitensis</span>"
            1 => "<span class="elsevierStyleItalic">Brucella abortus</span>"
            2 => "Concentraci&#243;n subinhibitoria de antibi&#243;tico"
            3 => "Estr&#233;s por calor"
            4 => "Sistemas toxina-antitoxina"
            5 => "PCR en tiempo real"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="as0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0010">Objective</span><p id="sp0025" class="elsevierStyleSimplePara elsevierViewall">Bacteria can react to stress conditions using the Toxin-Antitoxin &#40;TA&#41; system&#46; This study investigated the expression of TA system genes under heat and antibiotic stresses in <span class="elsevierStyleItalic">Brucella</span> spp&#46;</p></span> <span id="as0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0015">Methods</span><p id="sp0030" class="elsevierStyleSimplePara elsevierViewall">To determine the effects of sub-inhibitory concentration &#40;sub-MIC&#41; of rifampin on bacterial survival and growth&#44; a colony-forming unit was quantitated&#44; and turbidity was assessed following the treatment of <span class="elsevierStyleItalic">Brucella</span> isolates&#44; with &#189; minimum inhibitory concentration &#40;MIC&#41; of antibiotic at different time intervals&#46; Also&#44; <span class="elsevierStyleItalic">Brucella</span> isolates were exposed to heat stress &#40;42&#8239;&#176;C&#41; compared to the control &#40;37&#8239;&#176;C&#41;&#46; Finally&#44; the expression of TA system genes in <span class="elsevierStyleItalic">Brucella</span> isolates was evaluated one hour after treatment using the quantitative reverse transcription PCR &#40;qRT-PCR&#41; method&#46;</p></span> <span id="as0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0020">Results</span><p id="sp0035" class="elsevierStyleSimplePara elsevierViewall">Our results showed that the growth of the <span class="elsevierStyleItalic">Brucella</span> isolates reduced in the presence of the sub-MIC of antibiotics compared to the control&#46; The results of the qPCR assay showed that&#44; in the presence of rifampicin the expression of the TA system genes increased and&#44; under the heat stress conditions&#44; the expression of the TA system genes increased compared to controls expect brnT &#47; brnA system&#46;</p></span> <span id="as0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0025">Conclusion</span><p id="sp0040" class="elsevierStyleSimplePara elsevierViewall">Although the exact role of the TA system in response to various stresses is not yet fully understood&#44; our study provided information on the effectiveness of the type II TA system under heat and antibiotic stress conditions by examining the gene expression of type II systems in <span class="elsevierStyleItalic">Brucella</span> isolates&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "as0005"
            "titulo" => "Objective"
          ]
          1 => array:2 [
            "identificador" => "as0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "as0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "as0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="as0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0035">Objetivo</span><p id="sp0045" class="elsevierStyleSimplePara elsevierViewall">Las bacterias pueden reaccionar a condiciones de estr&#233;s utilizando el sistema Toxina-Antitoxina &#40;TA&#41;&#46; Este estudio investig&#243; la expresi&#243;n de los genes del sistema TA bajo estr&#233;s por calor y antibi&#243;ticos en Brucella spp&#46;</p></span> <span id="as0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0040">M&#233;todos</span><p id="sp0050" class="elsevierStyleSimplePara elsevierViewall">Para determinar los efectos de la concentraci&#243;n subinhibitoria &#40;sub-MIC&#41; de rifampicina sobre la supervivencia y el crecimiento bacteriano&#44; se cuantific&#243; una unidad formadora de colonias y se evalu&#243; la turbidez despu&#233;s del tratamiento de aislados de Brucella&#44; con la mitad de la concentraci&#243;n inhibitoria m&#237;nima &#40;MIC&#41; de antibi&#243;tico a diferentes intervalos de tiempo&#46; Adem&#225;s&#44; los aislados de Brucella estuvieron expuestos a estr&#233;s por calor &#40;42&#8239;&#176;C&#41; en comparaci&#243;n con el control &#40;37&#8239;&#176;C&#41;&#46; Finalmente&#44; la expresi&#243;n de genes del sistema TA en aislados de Brucella se evalu&#243; una hora despu&#233;s del tratamiento utilizando el m&#233;todo de PCR de transcripci&#243;n inversa cuantitativa &#40;qRT-PCR&#41;&#46;</p></span> <span id="as0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0045">Resultados</span><p id="sp0055" class="elsevierStyleSimplePara elsevierViewall">Nuestros resultados mostraron que el crecimiento de los aislados de Brucella se redujo en presencia de sub-MIC de antibi&#243;ticos en comparaci&#243;n con el control&#46; Los resultados del ensayo qPCR mostraron que&#44; en presencia de rifampicina&#44; la expresi&#243;n de los genes del sistema TA aument&#243; y&#44; en condiciones de estr&#233;s por calor&#44; la expresi&#243;n de los genes del sistema TA aument&#243; en comparaci&#243;n con los controles que esperan el sistema brnT &#47; brnA&#46;</p></span> <span id="as0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0050">Conclusi&#243;n</span><p id="sp0060" class="elsevierStyleSimplePara elsevierViewall">Aunque a&#250;n se desconoce el papel exacto del sistema TA en la respuesta al estr&#233;s&#44; nuestro estudio proporcion&#243; informaci&#243;n sobre la eficacia del sistema TA Tipo II en condiciones de estr&#233;s por calor y antibi&#243;ticos&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "as0025"
            "titulo" => "Objetivo"
          ]
          1 => array:2 [
            "identificador" => "as0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "as0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "as0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:3 [
      0 => array:8 [
        "identificador" => "f0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 4090
            "Ancho" => 1703
            "Tamanyo" => 331989
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "al0005"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0005" class="elsevierStyleSimplePara elsevierViewall">Effects of sub-MIC of rifampin on the survival of <span class="elsevierStyleItalic">Brucella</span> strains&#46; &#40;a&#44;b&#41; Growth curves &#40;c&#44;d&#41; viability curves&#46; Data are indicated as the means<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent replicates&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "f0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2244
            "Ancho" => 1575
            "Tamanyo" => 267523
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "al0010"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Analysis of relative expression levels of the type II TA system genes in the presence of rifampin at sub MIC &#40;a&#41; and heat &#40;b&#41; in Brucella strains&#46; The expression of type II toxin genes &#40;relE&#44; fic&#44; brnT and cogT&#41; as well as the expression of type II antitoxin genes &#40;rhh-like&#44; phd&#44; brnA and cogAT&#41; are shown&#46; Graph data are indicated as the means<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent replicates&#46; &#42;P&#8239;&#60;&#8239;0&#46;05&#59; &#42;&#42;P&#8239;&#60;&#8239;0&#46;01&#59; &#42;&#42;&#42;P&#8239;&#60;&#8239;0&#46;001&#59; by One-way ANOVA&#44; Conover&#39;s-test and Friedman test for multiple comparisons&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "t0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "al0015"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="sp0020" class="elsevierStyleSimplePara elsevierViewall">qRT&#95;PCR&#44; Quantitative Reverse Transcription PCR&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer Name&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer Sequence &#40;5&#8242;&#8239;&#8594;&#8239;3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product size &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Annealing temperature&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">rel E</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58;TGCAATTGAGCGAAGATTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">208</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">57&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; TCATCCGGTGGTAAGATTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">rhh-like</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; CTAACGGAGCGAAGCAGAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">82</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; TATCCCTGATCTCCCTGCCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">fic</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; CATCAGGAACAACTGCGCTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">111</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; ATCGGGATTGCCATAGGCTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">phd</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; TCGGTGATTCCTATGGGGTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">158</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; CGCGATTTGCATCTTCTTTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">brn T</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; ACAGACCAACATTGCCAAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">106</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; GATTGCCATCAGGCGATCTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">brn A</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; TCAGGAGGAAGAGGCAGAAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">197</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">58&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; CCTGATCGAGCCGGATAGTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">cogT</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; ATCTGGAAGCCGTCATGGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">122</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; GGCCATGACAATGCTGGAAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">cogAT</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; AAATGGCTGCATACGCCAAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">181</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; CTTCGTCGTGGTAGGGATGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16S rRNA</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">F&#58; CAGATTACGCAAGCAGCCTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">134</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">58&#8239;&#176;C</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><a class="elsevierStyleCrossRef" href="#bb0010"><span class="elsevierStyleSup">2</span></a></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">R&#58; TCCTCGACGCTTAGTGTCTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3336368.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0015" class="elsevierStyleSimplePara elsevierViewall">Primers used for both PCR and qRT-PCR studies&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bs0005"
          "bibliografiaReferencia" => array:31 [
            0 => array:3 [
              "identificador" => "bb0005"
              "etiqueta" => "1&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Brucellosis in Iran&#58; Why Not Eradicated&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "H&#46;E&#46; Leylabadlo"
                            1 => "A&#46;Z&#46; Bialvaei"
                            2 => "H&#46; Samadi Kafil"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Infect Dis"
                        "fecha" => "2015"
                        "volumen" => "61"
                        "numero" => "10"
                        "paginaInicial" => "1629"
                        "paginaFinal" => "1630"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bb0010"
              "etiqueta" => "2&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The expression of type II TA system genes following exposure to the sub-inhibitory concentration of gentamicin and acid stress in Brucella spp"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "F&#46; Amraei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Microb Pathog"
                        "fecha" => "2020"
                        "paginaInicial" => "262104194"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bb0015"
              "etiqueta" => "3&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Relationship between &#947;-interferon gene polymorphisms and susceptibility to brucellosis infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "E&#46; Eskandari-Nasab"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/1348-0421.12093"
                      "Revista" => array:7 [
                        "tituloSerie" => "Microbiol Immunol"
                        "fecha" => "2013"
                        "volumen" => "57"
                        "numero" => "11"
                        "paginaInicial" => "785"
                        "paginaFinal" => "791"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24033468"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bb0020"
              "etiqueta" => "4&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular epidemiology of colonizing and disease-causing Klebsiella pneumoniae in paediatric patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "M&#46;L&#46; Little"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1099/jmm.0.063354-0"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Med Microbiol"
                        "fecha" => "2014"
                        "volumen" => "63"
                        "numero" => "Pt 4"
                        "paginaInicial" => "610"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24464691"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bb0025"
              "etiqueta" => "5&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of carbapenem-resistant organisms and other Gram-negative MDRO in German ICUs&#58; first results from the national nosocomial infection surveillance system &#40;KISS&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "F&#46; Maechler"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s15010-014-0701-6"
                      "Revista" => array:7 [
                        "tituloSerie" => "Infection"
                        "fecha" => "2015"
                        "volumen" => "43"
                        "numero" => "2"
                        "paginaInicial" => "163"
                        "paginaFinal" => "168"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25395161"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bb0030"
              "etiqueta" => "6&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vancomycin modifies the expression of the agr system in multidrug- resistant Staphylococcus aureus clinical isolates"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "V&#46; C&#225;zares-Dom&#237;nguez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fmicb.2015.00369"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Microbiol"
                        "fecha" => "2015"
                        "volumen" => "6"
                        "paginaInicial" => "369"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25999924"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bb0035"
              "etiqueta" => "7&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sub-inhibitory concentration of piperacillin&#8211;tazobactam may be related to virulence properties of filamentous Escherichia coli"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "J&#46;P&#46;L&#46; de Andrade"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00284-015-0912-9"
                      "Revista" => array:7 [
                        "tituloSerie" => "Curr Microbiol"
                        "fecha" => "2016"
                        "volumen" => "72"
                        "numero" => "1"
                        "paginaInicial" => "19"
                        "paginaFinal" => "27428"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26364189"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bb0040"
              "etiqueta" => "8&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Transcriptome analysis reveals AI-2 relevant genes of multi-drug resistant Klebsiella pneumoniae in response to eugenol at sub-MIC"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "Y&#46;-M&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Front Microbiol"
                        "fecha" => "2019"
                        "paginaInicial" => "10"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bb0045"
              "etiqueta" => "9&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of sub-inhibitory concentrations of antibiotics and oxidative stress on the expression of type II toxin-antitoxin system genes in Klebsiella pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "N&#46; Narimisa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Global Antimicrob Resist"
                        "fecha" => "2020"
                        "volumen" => "21"
                        "paginaInicial" => "51"
                        "paginaFinal" => "56"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bb0050"
              "etiqueta" => "10&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The <span class="elsevierStyleItalic">Brucella abortus</span> host factor I &#40;HF-I&#41; protein contributes to stress resistance during stationary phase and is a major determinant of virulence in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46;T&#46; Robertson"
                            1 => "R&#46;M&#46; Roop"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Microbiol"
                        "fecha" => "1999"
                        "volumen" => "28234"
                        "numero" => "4"
                        "paginaInicial" => "690"
                        "paginaFinal" => "700"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bb0055"
              "etiqueta" => "11&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Emerging roles of toxin-antitoxin modules in bacterial pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "B&#46; K&#281;dzierska"
                            1 => "F&#46;J&#46; Hayes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/molecules21060790"
                      "Revista" => array:6 [
                        "tituloSerie" => "Molecules"
                        "fecha" => "2016"
                        "volumen" => "21"
                        "numero" => "6"
                        "paginaInicial" => "790"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27322231"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bb0060"
              "etiqueta" => "12&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Toxin-antitoxin systems in bacterial growth arrest and persistence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46; Page"
                            1 => "W&#46;J&#46; Peti"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nchembio.2044"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Chem Biol"
                        "fecha" => "2016"
                        "volumen" => "12"
                        "numero" => "4"
                        "paginaInicial" => "208"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26991085"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bb0065"
              "etiqueta" => "13&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Toxins of prokaryotic toxin-antitoxin systems with sequence-specific endoribonuclease activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "H&#46; Masuda"
                            1 => "M&#46; Inouye"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Toxins"
                        "fecha" => "2017"
                        "volumen" => "9"
                        "numero" => "4"
                        "paginaInicial" => "140"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bb0070"
              "etiqueta" => "14&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Toxin&#8211;antitoxin systems and their role in disseminating and maintaining antimicrobial resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Q&#46;E&#46; Yang"
                            1 => "T&#46;R&#46; Walsh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/femsre/fux006"
                      "Revista" => array:7 [
                        "tituloSerie" => "FEMS Microbiol Rev"
                        "fecha" => "2017"
                        "volumen" => "41"
                        "numero" => "3"
                        "paginaInicial" => "343"
                        "paginaFinal" => "353"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28449040"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bb0075"
              "etiqueta" => "15&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Persister cells formation and expression of type II Toxin-Antitoxin system genes in <span class="elsevierStyleItalic">Brucella melitensis</span> &#40;16M&#41; and <span class="elsevierStyleItalic">Brucella abortus</span> &#40;B19&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "F&#46; Amraei"
                            1 => "N&#46; Narimisa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.30699/ijp.2020.118902.2294"
                      "Revista" => array:6 [
                        "tituloSerie" => "Iran J Pathol"
                        "fecha" => "2020"
                        "volumen" => "15"
                        "numero" => "2"
                        "paginaInicial" => "127"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32215028"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bb0080"
              "etiqueta" => "16&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Type II toxin&#47;antitoxin system genes expression in persister cells of Klebsiella pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "N&#46; Narimisa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Med Microbiol"
                        "fecha" => "2020"
                        "volumen" => "31"
                        "numero" => "4"
                        "paginaInicial" => "215"
                        "paginaFinal" => "220"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bb0085"
              "etiqueta" => "17&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Putative type II toxin-antitoxin systems in <span class="elsevierStyleItalic">Listeria monocytogenes</span> isolated from clinical&#44; food&#44; and animal samples in Iran"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "B&#46;S&#46; Kalani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.micpath.2018.06.003"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microb Pathog"
                        "fecha" => "2018"
                        "volumen" => "122"
                        "paginaInicial" => "19"
                        "paginaFinal" => "24"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29879433"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bb0090"
              "etiqueta" => "18&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of proline racemase&#47;hydroxyproline epimerase gene in human brucella isolates in Iran"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "I&#46; Hashemifar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.14196/mjiri.31.57"
                      "Revista" => array:5 [
                        "tituloSerie" => "Med J Islam Repub Iran"
                        "fecha" => "2017"
                        "volumen" => "31"
                        "paginaInicial" => "57"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29445686"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bb0095"
              "etiqueta" => "19&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Real-time PCR and high-resolution melt analysis methods for detection of pathogenic species of Brucella"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "F&#46;M&#46; Jazi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/bjdp.12451"
                      "Revista" => array:6 [
                        "fecha" => "2017"
                        "volumen" => "41"
                        "numero" => "6"
                        "paginaInicial" => "325"
                        "paginaFinal" => "331"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/37114745"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bb0100"
              "etiqueta" => "20&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular prevalence of putative virulence-associated genes in <span class="elsevierStyleItalic">Brucella melitensis</span> and <span class="elsevierStyleItalic">Brucella abortus</span> isolates from human and livestock specimens in Iran"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "I&#46; Hashemifar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Microb Pathog"
                        "fecha" => "2017"
                        "volumen" => "105"
                        "paginaInicial" => "21"
                        "paginaFinal" => "334"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bb0105"
              "etiqueta" => "21&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of heat&#44; oxidative&#44; and acid stress responses in <span class="elsevierStyleItalic">Brucella melitensis</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "A&#46;P&#46; Teixeira-Gomes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/IAI.68.5.2954-2961.2000"
                      "Revista" => array:7 [
                        "tituloSerie" => "Infect Immun"
                        "fecha" => "2000"
                        "volumen" => "68"
                        "numero" => "5"
                        "paginaInicial" => "2954"
                        "paginaFinal" => "2961"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10768994"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bb0110"
              "etiqueta" => "22&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antimicrobial resistance in leptospira&#44; brucella&#44; and other rarely investigated veterinary and zoonotic pathogens"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46; Trott"
                            1 => "S&#46; Abraham"
                            2 => "B&#46; Adler"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Microbiol SpectrMicrobiol Spectr"
                        "fecha" => "2018"
                        "volumen" => "6"
                        "numero" => "4"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bb0115"
              "etiqueta" => "23&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Archaeal Persisters&#58; Persister Cell Formation as a Stress Response in Haloferax volcanii"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Megaw"
                            1 => "B&#46;F&#46; Gilmore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Front Microbiol"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "paginaInicial" => "1589"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bb0120"
              "etiqueta" => "24&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sub-inhibitory fosmidomycin exposures elicits oxidative stress in <span class="elsevierStyleItalic">Salmonella enterica</span> serovar Typhimurium LT2"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "D&#46;T&#46; Fox"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2014"
                        "volumen" => "9"
                        "numero" => "4"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bb0125"
              "etiqueta" => "25&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2<span class="elsevierStyleHsp" style=""></span>&#8722; &#916;&#916;CT method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46;J&#46; Livak"
                            1 => "T&#46;D&#46; Schmittgen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1006/meth.2001.1262"
                      "Revista" => array:7 [
                        "tituloSerie" => "Methods"
                        "fecha" => "2001"
                        "volumen" => "25"
                        "numero" => "4"
                        "paginaInicial" => "402"
                        "paginaFinal" => "408"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bb0130"
              "etiqueta" => "26&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biofilm establishment&#44; biofilm persister cell formation&#44; and relative gene expression analysis of type II toxin-antitoxin system in Klebsiella pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "N&#46; Narimisa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Gene Rep"
                        "fecha" => "2020"
                        "volumen" => "317"
                        "paginaInicial" => "100846"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bb0135"
              "etiqueta" => "27&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comprehensive comparative-genomic analysis of type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K&#46;S&#46; Makarova"
                            1 => "Y&#46;I&#46; Wolf"
                            2 => "E&#46;V&#46; Koonin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Biol Direct"
                        "fecha" => "2009"
                        "volumen" => "320 4&#40;1&#41;"
                        "paginaInicial" => "19"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bb0140"
              "etiqueta" => "28&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of the heat shock response in <span class="elsevierStyleItalic">Brucella abortus</span> and isolation of the genes encoding the GroE heat shock proteins"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "J&#46; Lin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/iai.60.6.2425-2431.1992"
                      "Revista" => array:7 [
                        "tituloSerie" => "Infect Immun"
                        "fecha" => "1992"
                        "volumen" => "60"
                        "numero" => "6"
                        "paginaInicial" => "2425"
                        "paginaFinal" => "2431"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1350274"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bb0145"
              "etiqueta" => "29&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular structure and function of the novel BrnT&#47;BrnA toxin-antitoxin system of Brucella abortus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "B&#46;E&#46; Heaton"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M111.332163"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2012"
                        "volumen" => "287"
                        "numero" => "15"
                        "paginaInicial" => "12098"
                        "paginaFinal" => "12110"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22334680"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bb0150"
              "etiqueta" => "30&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structure of the <span class="elsevierStyleItalic">Proteus vulgaris</span> HigB-&#40;HigA&#41; 2-HigB toxin-antitoxin complexes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "M&#46;A&#46; Schureck"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M113.512095"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2014"
                        "volumen" => "289"
                        "numero" => "2"
                        "paginaInicial" => "1060"
                        "paginaFinal" => "1070"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24257752"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bb0155"
              "etiqueta" => "31&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased persistence in <span class="elsevierStyleItalic">Escherichia coli</span> caused by controlled expression of toxins or other unrelated proteins"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "N&#46; V&#225;zquez-Laslop"
                            1 => "H&#46; Lee"
                            2 => "A&#46;A&#46; Neyfakh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Bacteriol"
                        "fecha" => "2006"
                        "volumen" => "188"
                        "numero" => "10"
                        "paginaInicial" => "3494"
                        "paginaFinal" => "3497"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/15769887/0000002400000004/v1_202311130323/S1576988723000249/v1_202311130323/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "17855"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/15769887/0000002400000004/v1_202311130323/S1576988723000249/v1_202311130323/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1576988723000249?idApp=UINPBA00004N"
]

Article information

ISSN: 15769887
Original language: English

DOI:10.1016/j.vacun.2023.03.002

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	2	2	4
2024 October	8	7	15
2024 September	6	7	13
2024 August	9	7	16
2024 July	10	10	20
2024 June	8	7	15
2024 May	9	8	17
2024 April	7	6	13
2024 March	8	6	14
2024 February	8	3	11
2024 January	6	0	6
2023 December	9	2	11
2023 November	14	6	20
2023 October	28	0	28
2023 September	11	0	11
2023 August	12	0	12
2023 July	13	0	13
2023 June	4	3	7

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter