Differences In Hepatic Expression of Iron, Inflammation and Stress-Related Genes in Patients with Nonalcoholic Steatohepatitis
Read
1462
Timeswas read the article
483
Total PDF
979
Total HTML
Share statistics
array:24 [ "pii" => "S1665268119303643" "issn" => "16652681" "doi" => "10.5604/16652681.1226818" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "70186" "copyright" => "Fundación Clínica Médica Sur, A.C." "copyrightAnyo" => "2017" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2017;16:77-85" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 133 "formatos" => array:3 [ "EPUB" => 12 "HTML" => 79 "PDF" => 42 ] ] "itemSiguiente" => array:19 [ "pii" => "S1665268119303655" "issn" => "16652681" "doi" => "10.5604/16652681.1226819" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "70187" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2017;16:86-93" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 103 "formatos" => array:3 [ "EPUB" => 15 "HTML" => 47 "PDF" => 41 ] ] "en" => array:11 [ "idiomaDefecto" => true "titulo" => "Sofosbuvir and Daclatasvir in Mono- and HIV-coinfected Patients with Recurrent Hepatitis C After Liver Transplant" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "86" "paginaFinal" => "93" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "f0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1394 "Ancho" => 2067 "Tamanyo" => 179589 ] ] "descripcion" => array:1 [ "en" => "<p id="sp0005" class="elsevierStyleSimplePara elsevierViewall">Selected laboratory tests and scores over time. Variables are depicted as median and IQR. EOT: end of treatment. FU: follow-up. IQR: intercuarti-le range.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Lluís Castells, Jordi Llaneras, Isabel Campos-Varela, Itxarone Bilbao, Manel Crespo, Oscar Len, Francisco Rodríguez-Frías, Ramon Charco, Teresa Salcedo, Juan Ignacio Esteban, Rafael Esteban-Mur" "autores" => array:11 [ 0 => array:2 [ "nombre" => "Lluís" "apellidos" => "Castells" ] 1 => array:2 [ "nombre" => "Jordi" "apellidos" => "Llaneras" ] 2 => array:2 [ "nombre" => "Isabel" "apellidos" => "Campos-Varela" ] 3 => array:2 [ "nombre" => "Itxarone" "apellidos" => "Bilbao" ] 4 => array:2 [ "nombre" => "Manel" "apellidos" => "Crespo" ] 5 => array:2 [ "nombre" => "Oscar" "apellidos" => "Len" ] 6 => array:2 [ "nombre" => "Francisco" "apellidos" => "Rodríguez-Frías" ] 7 => array:2 [ "nombre" => "Ramon" "apellidos" => "Charco" ] 8 => array:2 [ "nombre" => "Teresa" "apellidos" => "Salcedo" ] 9 => array:2 [ "nombre" => "Juan" "apellidos" => "Ignacio Esteban" ] 10 => array:2 [ "nombre" => "Rafael" "apellidos" => "Esteban-Mur" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119303655?idApp=UINPBA00004N" "url" => "/16652681/0000001600000001/v1_201905311015/S1665268119303655/v1_201905311015/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268119303631" "issn" => "16652681" "doi" => "10.5604/16652681.1226817" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "70185" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2017;16:71-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 98 "formatos" => array:3 [ "EPUB" => 19 "HTML" => 41 "PDF" => 38 ] ] "en" => array:10 [ "idiomaDefecto" => true "titulo" => "Daclatasvir Plus Asunaprevir Dual Therapy for Chronic HCV Genotype 1b Infection: Results of Turkish Early Access Program" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "71" "paginaFinal" => "76" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Seyfettin Köklü, Iftihar Köksal, Ulus Salih Akarca, Ayhan Balkan, Rahmet Güner, Aylin Demirezen, Memduh Sahin, Sila Akhan, Reşat Ozaras, Ramazan Idilman" "autores" => array:10 [ 0 => array:2 [ "nombre" => "Seyfettin" "apellidos" => "Köklü" ] 1 => array:2 [ "nombre" => "Iftihar" "apellidos" => "Köksal" ] 2 => array:2 [ "nombre" => "Ulus" "apellidos" => "Salih Akarca" ] 3 => array:2 [ "nombre" => "Ayhan" "apellidos" => "Balkan" ] 4 => array:2 [ "nombre" => "Rahmet" "apellidos" => "Güner" ] 5 => array:2 [ "nombre" => "Aylin" "apellidos" => "Demirezen" ] 6 => array:2 [ "nombre" => "Memduh" "apellidos" => "Sahin" ] 7 => array:2 [ "nombre" => "Sila" "apellidos" => "Akhan" ] 8 => array:2 [ "nombre" => "Reşat" "apellidos" => "Ozaras" ] 9 => array:2 [ "nombre" => "Ramazan" "apellidos" => "Idilman" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119303631?idApp=UINPBA00004N" "url" => "/16652681/0000001600000001/v1_201905311015/S1665268119303631/v1_201905311015/en/main.assets" ] "en" => array:17 [ "idiomaDefecto" => true "titulo" => "Differences In Hepatic Expression of Iron, Inflammation and Stress-Related Genes in Patients with Nonalcoholic Steatohepatitis" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "77" "paginaFinal" => "85" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Priya Handa, Bryan D. Maliken, James E. Nelson, Kelly A. Hennessey, L. Akhila Vemulakonda, Vicki Morgan-Stevenson, Barjinder K. Dhillon, Rohit Gupta, Matthew M. Yeh, Kris V. Kowdley" "autores" => array:10 [ 0 => array:3 [ "nombre" => "Priya" "apellidos" => "Handa" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "aff1" ] ] ] 1 => array:3 [ "nombre" => "Bryan D." "apellidos" => "Maliken" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">**</span>" "identificador" => "aff2" ] ] ] 2 => array:3 [ "nombre" => "James E." "apellidos" => "Nelson" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">**</span>" "identificador" => "aff1" ] ] ] 3 => array:3 [ "nombre" => "Kelly A." "apellidos" => "Hennessey" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "aff1" ] ] ] 4 => array:3 [ "nombre" => "L." "apellidos" => "Akhila Vemulakonda" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "aff1" ] ] ] 5 => array:3 [ "nombre" => "Vicki" "apellidos" => "Morgan-Stevenson" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "aff1" ] ] ] 6 => array:3 [ "nombre" => "Barjinder K." "apellidos" => "Dhillon" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">**</span>" "identificador" => "aff2" ] ] ] 7 => array:3 [ "nombre" => "Rohit" "apellidos" => "Gupta" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">**</span>" "identificador" => "aff2" ] ] ] 8 => array:3 [ "nombre" => "Matthew M." "apellidos" => "Yeh" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">***</span>" "identificador" => "aff3" ] ] ] 9 => array:4 [ "nombre" => "Kris V." "apellidos" => "Kowdley" "email" => array:1 [ 0 => "kris.kowdley@swedish.org" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Organ Care Research and Liver Care Network, Swedish Medical Center Seattle WA" "etiqueta" => "*" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Benaroya Research Institute, Seattle WA" "etiqueta" => "**" "identificador" => "aff2" ] 2 => array:3 [ "entidad" => "University of Washington Medical Center, Seattle WA" "etiqueta" => "***" "identificador" => "aff3" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Correspondence and reprint request:" ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "f0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2171 "Ancho" => 1003 "Tamanyo" => 212446 ] ] "descripcion" => array:1 [ "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Effects of excess iron in patients with NAFLD. Hepatic mRNA expression of: <span class="elsevierStyleBold">A.</span> Inflammatory markers IL-6, IL-1 p, TNFa, NFkB, STAT3, IL-6R and SOCS3 (p values; IL-6: 0.008, IL-1f): 0.06, TNFa: 0.13, NFkB: 0.02, STAT3: 0.97 IL-6R: 0.29, SOCS3: 0.07). <span class="elsevierStyleBold">B.</span> Iron regulatory genes HAMP, HJV, FPN1 BMP6 and TMPRSS6 (p values; HAMP: 0.04, HJV: 0.16, FPN1: 0.51, BMP6: 0.47 and TMPRSS6: 0.19), and <span class="elsevierStyleBold">C.</span> Stress-responsive genes CREBH, HO-1 and HIF-1 a (p values; CREBH: 0.007, HO-1: 0.66 and HIF-1 a: 0.35) in NAFLD + iron patients compared to NAFLD-iron patients. All values are shown as medians and statistical significance (p < 0.05) marked* and p < 0.01 is marked.**</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="s0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0015">Introduction</span><p id="p0005" class="elsevierStylePara elsevierViewall">Nonalcoholic fatty liver disease (NAFLD) is the most prevalent chronic liver disease and is strongly associated with obesity and the attendant metabolic syndrome.<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> NAFLD encompasses a broad spectrum of liver disorders, ranging from simple steatosis to its more severe form, nonalcoholic steatohepatitis (NASH), which progresses to cirrhosis or hepatocellular carcinoma in 20-25% of pa-tients.<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Oxidative stress is believed to be an important contributor to the pathogenesis of NASH.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> Excess hepatic iron can promote oxidative stress via Fenton’s reaction and is proposed to be a cofactor in the development of NASH.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> We have previously shown that the presence of hepatic iron and the occurrence of HFE mutations such as C282Y, is associated with more advanced NASH suggesting a role for iron in exacerbating NAFL to NASH.<a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3-5</span></a> Further, we have also shown a strong relationship between hepatic iron deposition pattern and histologic severity of NAFLD wherein iron deposition in hepatic reticuloendothelial system (RES) cells is associated with higher NAFLD activity score (NAS) and advanced fibro-sis.<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Thus, the involvement of iron in the pathogenesis of NASH underscores the need to better understand the iron homeostasis pathway, with emphasis on the regulatory role of hepcidin, a key iron homeostasis protein.<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a></p><p id="p0010" class="elsevierStylePara elsevierViewall">Hepcidin, produced primarily by hepatocytes, regulates intestinal iron absorption, macrophage iron recycling and mobilization of iron from hepatic stores by binding and internalizing the iron transporter, ferroportin.<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Hepci-din expression is enhanced by increased iron stores via hemojuvelin (HJV), bone morphogenetic protein (BMP6) and Sma and Mad related proteins (SMAD) via HJV/ BMP/SMAD pathway<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> and during inflammation via induction of Janus kinase/Signal transducer and activator of transcription (JAK2/STAT3) pathway,<a class="elsevierStyleCrossRefs" href="#bib0040"><span class="elsevierStyleSup">8,9</span></a> conditions commonly seen in NAFLD.<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> Hepcidin is inhibited by anemia, hy-poxia and augmented erythropoiesis via the transcription factor C/EBPa and transmembrane serine protease 6 (TMPRSS6).<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9,11,12-14</span></a> Hepcidin regulatory mechanisms have been investigated in animal models and only a few studies have investigated the role of hepcidin in human NAFLD pa-tients,<a class="elsevierStyleCrossRefs" href="#bib0050"><span class="elsevierStyleSup">10,15-18</span></a> and none have examined the regulatory mechanisms of hepcidin expression in patients with NAFLD.</p><p id="p0015" class="elsevierStylePara elsevierViewall">The aim of this study was to examine the expression profiles of iron regulatory genes, and inflammatory and oxi-dative and other stress-response pathways in patients with NAFLD, with a goal to identify differentially expressed genes in patients who have NASH, and in NAFLD patients with and without hepatic iron overload. Total RNA from liver tissues of patients with NAFLD were analyzed to evaluate expression profiles of candidate genes in the disease states; NAFL <span class="elsevierStyleItalic">vs.</span> NASH, and based on presence or absence of observable iron deposition in liver tissue of NAFLD patients.</p></span><span id="s0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0020">Material and Methods</span><span id="s0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0025">Subjects</span><p id="p0020" class="elsevierStylePara elsevierViewall">Patients were enrolled from University of Washington Medical Center and Virginia Mason Medical center clinics in Seattle, WA in the study. The study was approved by the human subjects institutional review board and written informed consents were obtained from all subjects. Inclusion criteria were: minimal alcohol use (< 20 g/day) reported by the patients and appropriate exclusion of other liver diseases including viral hepatitis, autoimmune hepatitis, drug-induced liver disease, primary biliary cirrhosis, Wilson’s disease, and α1-antitrypsin deficiency. Hematoxylin and eosin staining along with Prussian Blue stain specific for iron were used in the grading of the NAS score. All patients met the criteria for NAFLD as defined by Brunt, <span class="elsevierStyleItalic">et al.</span><a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a></p></span><span id="s0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0030">Baseline laboratory studies</span><p id="p0025" class="elsevierStylePara elsevierViewall">Clinical data included body mass index (BMI), presence of diabetes mellitus, serum aminotransferase levels Aspartate transaminase (AST) and Alanine transaminase (ALT), triglycerides, cholesterol, glucose, iron, ferritin and transferrin iron saturation. Liver tissue was obtained by percutaneous needle biopsy and samples were snap frozen in liquid nitrogen, stored at -70 ºC for subsequent RNA extraction and gene expression analysis.</p></span><span id="s0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0035">RNA preparation and cDNA synthesis</span><p id="p0030" class="elsevierStylePara elsevierViewall">Total RNA was isolated from liver tissue using RNeasy Mini kit (QIAGEN GmbH, Germany). RNA quality was determined using RNA 6000 Nano Chip Kit and Bioanalyzer 2100 (Agilent Technologies). Samples with a RNA Integrity Number (RIN) value of 4.0 or greater were included for gene expression studies. The cDNA first-strand synthesis was performed using Superscript First-Strand Synthesis System (Invitrogen) and oligo (dT) primers with 1 (Xg RNA in 20 (xL reaction volume.</p><p id="p0035" class="elsevierStylePara elsevierViewall">Quantitative real time PCR: Quantitative real time-PCR using SYBR GreenER qPCR super mix (Invitrogen) was performed on the ABI 7900 HT real time PCR machine. Primers were designed to span intronic sequences to avoid amplification of any contaminant genomic DNA. Specific primers were used for RT PCR amplification of HAMP (hepcidin antimicrobial peptide), FPN1 (ferroportin), CREBH (cAMP responsive element-binding protein, hepatocyte specific), IL-6, IL-6R, IL-1|3, TNFcc, NFkB, BMP6 (bone morphogenetic protein), TMPRSS6, SOCS3 (suppressor of cytokine signaling 3), HO-1 (hemeoxygense 1), HIF1cc (hypoxia inducible factor-1a) and STAT3 genes and are tabulated (<a class="elsevierStyleCrossRef" href="#t0005">Table 1</a>) and HJV primers obtained from Applied Biosystems were used. 10 (xL of SYBR GreenER qPCR super mix (Invitrogen), 1 LiM of (forward and reverse) primers and 25 ng of the cDNA template were mixed in a 20 <span class="elsevierStyleItalic">fiL</span> reaction volume. Fold change in gene expression was determined by normalization to glyceralde-hyde phosphate dehydrogenase (GAPDH).</p><elsevierMultimedia ident="t0005"></elsevierMultimedia></span><span id="s0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0040">Serum cytokine analysis</span><p id="p0040" class="elsevierStylePara elsevierViewall">Blood samples from patients were analyzed in duplicates for quantitative measurement of serum cytokines using enzyme-linked immunosorbent assay (ELISA) kit: Bio-Plex Pro Human Cytokine 17-plex Assay (Biorad).</p></span><span id="s0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0045">Statistical analysis</span><p id="p0045" class="elsevierStylePara elsevierViewall">Descriptive statistics of continuous variables were expressed as medians with the interquartile range in parentheses. Continuous variables were compared between groups using the Mann-Whitney <span class="elsevierStyleItalic">U</span> test for nonparametric data. p value < 0.05 was considered to be statistically significant. All statistical analysis was performed using Graphpad Prism 5.03 for Windows, GraphPad Software, San Diego, California, USA.</p></span></span><span id="s0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0050">Results</span><span id="s0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0055">Clinical & laboratory characteristics</span><p id="p0050" class="elsevierStylePara elsevierViewall">Patients were divided into groups based on diagnosis of NAFL or NASH by histological variables, or NAFLD patients with or without hepatic iron deposition (presence of stainable iron on liver biopsy samples). Across all patients, the mean patient age was 47 (± 9yrs) years, 49% were male, and 67% had a BMI greater than 30 kg/m<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>. There were more females (26/45) (p = 0.053) in the NASH group and NASH patients had higher AST (p = 0.01) and more severe histo-logical scoring (steatosis, ballooning, inflammation and fi-brosis, p < 0.0001) (<a class="elsevierStyleCrossRef" href="#t0010">Table 2</a>). Elevated serum ferritin was present in 34% of the patients, 31% had diabetes, 52% had hypertension and 51% had hyperlipidemia.</p><elsevierMultimedia ident="t0010"></elsevierMultimedia><p id="p0055" class="elsevierStylePara elsevierViewall">Analysis revealed that more individuals were males (19/26) (p = 0.008) in the cohort defined as NAFLD with hepatic iron. This group also had a significantly lower BMI (p = 0.03), CRP (p = 0.0093), total iron binding capacity (TIBC) (p = 0.0498), Alkaline phosphatase (p = 0.0128) and HDL (p = 0.0287), and displayed a higher HDL (p = 0.028), serum ferritin (p = 0.0009), serum iron (p = 0.0079), transferrin-iron saturation (p = 0.0005), serum albumin (p = 0.0052), AST (p = 0.001), ALT (p = 0.0045), total cholesterol (p = 0.039), triglycer-ides (p = 0.029), and LDL (p = 0.05) (<a class="elsevierStyleCrossRef" href="#t0015">Table 3</a>).</p><elsevierMultimedia ident="t0015"></elsevierMultimedia></span><span id="s0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0060">Increased hepatic gene expression of proinflammatory cytokines in patients with NASH relative to patients with NAFL</span><p id="p0060" class="elsevierStylePara elsevierViewall">Levels of IL-1β (2.7 fold, p = 0.046), STAT3 (5.5 fold, p = 0.004) and TNFα (3.8 fold, p = 0.01) were upregulated in patients with NASH. While hepatic expression of IL-6, IL-6R and NFkB genes were also higher in NASH subjects, statistical significance was not achieved. SOCS3 expression was significantly reduced in patients with NASH (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>A).</p><elsevierMultimedia ident="f0005"></elsevierMultimedia></span><span id="s0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0065">Hepcidin and TMPRSS6 expression is increased in patients with NASH</span><p id="p0065" class="elsevierStylePara elsevierViewall">Hepatic gene expression levels of hepcidin (HAMP) were higher (2.3 fold, p = 0.02) in patients with NASH compared to NAFL subjects. Analysis of additional iron homeostasis genes within the BMP/SMAD pathway (HJV, FPN and BMP6) did not show significantly elevated expression profile in our patient population, even though HJV expression showed a trend towards increase (p = 0.06) (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>B). Interestingly, we observed that the expression of TMPRSS6, a negative regulator of hepcidin expression, was higher in patients with NASH (8.4 fold, p = 0.003). We also observed a significantly decreased expression of HIF1a (p = 0.004), a redox sensitive gene, in patients with NASH. Expression of HO-1 and CREBH did not show any statistically significant alterations between the two groups (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>C).</p></span><span id="s0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0070">Excess hepatic iron is associated with increased hepcidin and reduced inflammatory cytokine expression in NAFLD patients with stainable iron deposition</span><p id="p0070" class="elsevierStylePara elsevierViewall">A significant increase in hepcidin expression (3.1 fold, p = 0.04) was observed in NAFLD patients with histological evidence of stainable hepatic iron compared to NAFLD patients without iron. Expression of IL-1|3 (4 fold, p = 0.06), TNFcc (3 fold, p = 0.13), IL-6 (8 fold, p = 0.008), NFkB (5 fold, p = 0.02) and SOCS3 (2 fold, p = 0.07) were downregulated in NAFLD patients having hepatic iron overload relative to NAFLD patients lacking hepatic iron overload. Of these, hepatic gene expression of IL-6 and NF-κB were significantly reduced. Further, CREBH, a liver- specific transcription factor which is linked with ER (endoplasmic reticulum) stress, had lower expression (2.5-fold, p = 0.007) in NAFLD patients with iron overload. Expression of TMPRSS6 (p = 0.19) and STAT3 (p = 0.97) were higher in patients who had excess hepatic iron, but not statistically significantly so (<a class="elsevierStyleCrossRef" href="#f0010">Figure 2</a>).</p><elsevierMultimedia ident="f0010"></elsevierMultimedia></span><span id="s0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0075">HAMP expression strongly correlates with HJV expression</span><p id="p0075" class="elsevierStylePara elsevierViewall">Linear regression analyses were performed between the various genes that were tested, and among them, the log mRNA expression of HAMP with HJV gene were observed to show a positive association in a statistically significant manner. As expected, the most significant correlation was found in NAFLD subjects with iron overload (r value = 0.718, p value < 0.0001) although a significant relationship was also found in all NAFLD subjects (r value = 0.652, p value < 0.0001) and all NASH subjects (r value = 0.669, p value < 0.0001) for HAMP with HJV (<a class="elsevierStyleCrossRef" href="#f0015">Figure 3</a>).</p><elsevierMultimedia ident="f0015"></elsevierMultimedia></span><span id="s0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0080">Serum cytokine analysis in patients with NASH relative to NAFL</span><p id="p0080" class="elsevierStylePara elsevierViewall">Of all the cytokines and chemokines measured, IL-6 (0.7 <span class="elsevierStyleItalic">vs.</span> 3.5 ng/mL, p = 0.0001) and IL-8 (2.6 <span class="elsevierStyleItalic">vs.</span> 5.6 ng/ mL, p = 0.003) were significantly elevated in NASH patients relative to NAFL patients. Notably, there was a significant positive correlation between serum IL-6 cy-tokine and hepatic IL-6 gene expression (r = 0.572, p < 0.0067), and between serum IL-6 levels and hepatic he-mojuvelin gene expression (r = 0.756, p < 0.0001) in NAFL patients, but not in NASH patients or NAFLD patients with or without iron overload. In addition, we observed a positive correlation between serum TNF-α levels and hepatic IL-6 gene expression levels (r = 0.602, p < 0.0038), and between serum TNF-α levels and hepatic HJV gene expression (r = 771, p < 0.0001) in NAFL patients, but not in NASH patients, or NALFD patients with iron or without overload. Finally, we observed a positive correlation between serum IL-8 levels and hepatic IL-6 gene expression levels (r = 0.051, p = 0.018), between serum IL-8 levels and hepatic HJV gene expression (r = 0.804, p < 0.0001) and in between serum IL-8 levels and hepatic CREBH gene expression (r = 0.497, p = 0.021) in NAFL patients, but not in NASH patients, or NAFLD patients with or without iron overload.</p></span></span><span id="s0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0085">Discussion</span><p id="p0085" class="elsevierStylePara elsevierViewall">The goal of this study was to identify differential expression of genes involved in iron regulation, inflammation and stress response in patients with NASH compared to NAFL. This information is crucial towards identifying factors that contribute to progression of fatty liver disease. Evidence continues to accumulate strengthening the clin-icopathologic correlation between hepatic iron deposition and more specifically, its deposition pattern and progression of NAFL to NASH. Iron deposition within hepatic RES cells was found to be an independent predictor of worsening fibrosis and advanced liver disease (higher NAS score) in patients with NAFLD.<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Hepcidin is an important regulator of inflammation in the liver<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a>,<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> and along with its key role in iron homeostasis,<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> it could be playing a vital part in NASH pathogenesis. We hypothesized that hepcidin and/or its upstream regulatory factors play a key role in progression of NAFL to NASH. Conflicting data exists regarding hepatic hepcidin expression in NAFLD where both a decreased<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> and increased expression pattern has been reported<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>,<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> compared to controls. In our patient population, hepatic hepcidin expression was significantly elevated in patients with NASH compared to NAFL. Taken together with the increased hepatic gene expression of inflammatory cytokines IL-6, IL-1 <span class="elsevierStyleBold">(3</span> and TNFa, it is plausible that there is increased hepcidin expression that is attributable to its stimulation by IL-6 through the JAK2/ STAT3 pathway.<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9,22</span></a>-<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a> Furthermore, the reduced gene expression of HIF1cc, a hypoxia-inducible negative regulator of hepcidin,<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> could have also contributed to the upregulation of hepcidin expression in the NASH patient population.</p><p id="p0090" class="elsevierStylePara elsevierViewall">Hepcidin expression was also found to be higher in patients with hepatic iron deposition which constitutes a physiological response of the liver to decreased circulating iron levels.<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a>,<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> High ferritin and low expression of hepatic inflammatory cytokines (IL-6; 8 fold, IL-1 <span class="elsevierStyleBold">(3</span>; 4 fold, and NFkB; 5 fold) in patients with NAFLD containing hepatic iron deposition could possibly be suggestive of the notion that in this cohort the increased hepcidin expression is more likely attributable to hepatic iron deposition rather than inflammation. In our patient population, we did not observe upregulation of SOCS3, a known negative regulator of the JAK2/STAT3 signaling pathway<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> and thereby of hepcidin, raising the possibility of other mechanisms distinct from SOCS3 being involved in suppression of inflammatory response. CREBH, a negative regulator of hepatic lipogenesis and a marker of ER stress, was reduced in NAFLD patients with hepatic iron deposition. This finding is consistent with previous reports that hepatic iron directly results in excess hepatic lipid load.</p><p id="p0095" class="elsevierStylePara elsevierViewall">Similar to hepcidin, HJV is detected predominantly in hepatocytes.<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">28,29</span></a> We found a strong association between hepcidin and hemojuvelin mRNA levels in NAFLD patients with hepatic iron deposition, reinforcing its role in hepcidin regulation. HJV plays a central role by interacting with BMP6, TMPRSS6 (also known as matriptase-2), and neogenin, in the regulation of hepatic hepcidin ex-pression.<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a> Expression of TMPRSS6, a negative feedback inhibitor of hepcidin expression,<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a> was significantly higher in patients with NASH compared to NAFL. TMPRSS6 functions to suppress BMP-mediated stimulation of hep-cidin transcription through cell surface proteolytic processing of the BMP co-receptor, HJV. Increased expression of TMPRSS6 in our NAFLD patient population likely represents a potential mechanism involved in the regulation of hepcidin.</p><p id="p0100" class="elsevierStylePara elsevierViewall">Hepatic HAMP gene expression is induced in patients with NASH compared to NAFL, and presumably in response to hepatic iron excess in NAFLD patients with iron overload. Two possible mechanisms for hepcidin expression in patients with NASH are likely IL-6-mediated stimulation of JAK2/STAT3 pathway, which results in up-regulation of hepcidin and reduced gene expression of HIF1α. Furthermore, increased hepatic STAT3 gene expression in NASH patients relative to NAFL patients lends support to this putative hypothesis.</p><p id="p0105" class="elsevierStylePara elsevierViewall">Iron deposition in livers of patients with NAFLD can be hepatocellular, reticuloendothelial, or both. A study of 849 adult biopsy specimens, performed in the United States by us, observed that reticuloendothelial patterns of iron deposition was associated with advanced fibrosis compared with hepatocellular iron. Biopsy specimens with reticuloendothelial iron were also more likely to have definite steatohepatitis.<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> However, an Italian study of 587 patients with NAFLD found that hepatocellular rather than reticuloendothelial iron was associated with an increased likelihood of fibrosis.<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> The discordant results may be explained by differences in the patient populations; the subjects in the US study were more ethnically diverse and had higher body mass indices and more advanced fibrosis than those in the Italian study. Interactions between iron metabolism and NAFLD are complex and under active investigation by others and us.</p><p id="p0110" class="elsevierStylePara elsevierViewall">In this study, we found increased expression levels of in hepcidin in both NAFLD patients with iron and NASH patients. In our studies, the increased hepcidin levels mitigate inflammatory responses through a different pathway other than the well-studied SOSC3 mechanism. Though there is an increase in hepcidin levels in NASH patients, which could be in response to hepatic iron or increase in IL-6/STAT3 or decrease in HIFa, or a combination of these influences, we believe that increase in TMPRSS6, a negative regulator of hepcidin, could have hindered the anti-inflammatory properties of hepcidin and contributed to the transition of NAFL to NASH. However, further studies are required to confirm the anti-inflammatory role of hepcidin, to identify the pathway by which it mitigates the inflammatory response and to identify the mechanism by which TMPRSS6 influences hepcidin expression and interferes with its anti-inflammatory effect in NASH patients. We propose that further studies in a larger independent cohort would increase our understanding of the pathogenesis of NASH and possible pharmacological solutions. Further, undertaking an unbiased approach and performing RNA-seq on NAFL/NASH/ NAFLD with iron overload populations will allow us to uncover novel regulatory proteins associated with this complex disease.</p><p id="p0115" class="elsevierStylePara elsevierViewall">While this study has provided us with a number of important insights regarding the regulatory pathways such as iron homeostatic pathways, inflammation and stress responses that could be influencing NAFL to NASH patho-genesis and provided us with information about pathways that could be targeted, there are several limitations of the study, in that, we did not perform an <span class="elsevierStyleItalic">a priori</span> power calculation, since we had sufficient numbers of patients to perform a powered study. In addition, we did not record the intake of iron from both dietary sources and supplements. No information was collected on other medication and diseases that may affect iron metabolism. Our study is also limited by the lack of serum hepcidin measurements and HFE genotyping, which may have provided additional valuable insights into hepatic iron regulation in our patient population.</p><p id="p0120" class="elsevierStylePara elsevierViewall">In conclusion, we observed that HAMP expression is elevated in NASH patients and in NAFLD patients with hepatic iron deposits. Our data allowed us to study the interdependence of various regulatory signals such as hepatic iron stores, inflammation and hypoxia or oxidative/ ER stress on the expression of hepcidin and inflammatory cytokines. It is likely that the increased hepcidin expression is a protective response, which attempts to sequester excess iron thereby reducing oxidative stress. This effect might also play a role in mitigating the inflammatory response as seen in our NAFLD patients with hepatic iron overload. Examination of hepcidin regulatory mechanisms in a larger patient population will help us to understand the pathogenesis of NASH and in turn help identify potential ‘druggable’ targets to halt its progression.</p></span><span id="s0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0090">Abbreviations</span><p id="p0125" class="elsevierStylePara elsevierViewall"><ul class="elsevierStyleList" id="l0010"><li class="elsevierStyleListItem" id="u0005"><span class="elsevierStyleLabel">•</span><p id="p0130" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ALT:</span> alanine transaminase.</p></li><li class="elsevierStyleListItem" id="u0010"><span class="elsevierStyleLabel">•</span><p id="p0135" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">AST:</span> aspartate transaminase.</p></li><li class="elsevierStyleListItem" id="u0015"><span class="elsevierStyleLabel">•</span><p id="p0140" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">BMI:</span> body mass index.</p></li><li class="elsevierStyleListItem" id="u0020"><span class="elsevierStyleLabel">•</span><p id="p0145" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">BMP:</span> bone morphogenetic protein.</p></li><li class="elsevierStyleListItem" id="u0025"><span class="elsevierStyleLabel">•</span><p id="p0150" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">CREBH:</span> cAMP responsive element-binding protein, hepatocyte specific.</p></li><li class="elsevierStyleListItem" id="u0030"><span class="elsevierStyleLabel">•</span><p id="p0155" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ER:</span> endoplasmic reticulum.</p></li><li class="elsevierStyleListItem" id="u0035"><span class="elsevierStyleLabel">•</span><p id="p0160" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">FPN:</span> ferroportin.</p></li><li class="elsevierStyleListItem" id="u0040"><span class="elsevierStyleLabel">•</span><p id="p0165" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">GAPDH:</span> glyceraldehyde phosphate dehydrogenase.</p></li><li class="elsevierStyleListItem" id="u0045"><span class="elsevierStyleLabel">•</span><p id="p0170" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HAMP:</span> hepatic antimicrobial peptide.</p></li><li class="elsevierStyleListItem" id="u0050"><span class="elsevierStyleLabel">•</span><p id="p0175" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HIF1α:</span> hypoxia inducible factor 1α.</p></li><li class="elsevierStyleListItem" id="u0055"><span class="elsevierStyleLabel">•</span><p id="p0180" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HJV:</span> hemojuvelin.</p></li><li class="elsevierStyleListItem" id="u0060"><span class="elsevierStyleLabel">•</span><p id="p0185" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HNE:</span> 4-hydroxy-2-nonenal.</p></li><li class="elsevierStyleListItem" id="u0065"><span class="elsevierStyleLabel">•</span><p id="p0190" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HO-1:</span> hemeoxygenase 1.</p></li><li class="elsevierStyleListItem" id="u0070"><span class="elsevierStyleLabel">•</span><p id="p0195" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">JAK:</span> Janus kinase.</p></li><li class="elsevierStyleListItem" id="u0075"><span class="elsevierStyleLabel">•</span><p id="p0200" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">MDA:</span> malondialdehyde.</p></li><li class="elsevierStyleListItem" id="u0080"><span class="elsevierStyleLabel">•</span><p id="p0205" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NAFL:</span> nonalcoholic fatty liver.</p></li><li class="elsevierStyleListItem" id="u0085"><span class="elsevierStyleLabel">•</span><p id="p0210" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NAFLD:</span> nonalcoholic fatty liver disease.</p></li><li class="elsevierStyleListItem" id="u0090"><span class="elsevierStyleLabel">•</span><p id="p0215" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NAS:</span> NAFLD activity score.</p></li><li class="elsevierStyleListItem" id="u0095"><span class="elsevierStyleLabel">•</span><p id="p0220" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NASH:</span> nonalcoholic steatohepatitis.</p></li><li class="elsevierStyleListItem" id="u0100"><span class="elsevierStyleLabel">•</span><p id="p0225" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">PUFAs:</span> polyunsaturated fatty acids.</p></li><li class="elsevierStyleListItem" id="u0105"><span class="elsevierStyleLabel">•</span><p id="p0230" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">RES:</span> Reticuloendothelial system.</p></li><li class="elsevierStyleListItem" id="u0110"><span class="elsevierStyleLabel">•</span><p id="p0235" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">SMAD:</span> Sma and Mad related proteins.</p></li><li class="elsevierStyleListItem" id="u0115"><span class="elsevierStyleLabel">•</span><p id="p0240" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">SOCS3:</span> suppressor of cytokine signaling 3.</p></li><li class="elsevierStyleListItem" id="u0120"><span class="elsevierStyleLabel">•</span><p id="p0245" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">STAT3:</span> signal transducer and activator of transcription 3.</p></li><li class="elsevierStyleListItem" id="u0125"><span class="elsevierStyleLabel">•</span><p id="p0250" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">TIBC:</span> total iron binding capacity.</p></li><li class="elsevierStyleListItem" id="u0130"><span class="elsevierStyleLabel">•</span><p id="p0255" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">TMPRSS6:</span> transmembrane serine protease 6.</p></li></ul></p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:8 [ 0 => array:3 [ "identificador" => "xres1198050" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abs0010" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1116694" "titulo" => "Key words" ] 2 => array:2 [ "identificador" => "s0005" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "s0010" "titulo" => "Material and Methods" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "s0015" "titulo" => "Subjects" ] 1 => array:2 [ "identificador" => "s0020" "titulo" => "Baseline laboratory studies" ] 2 => array:2 [ "identificador" => "s0025" "titulo" => "RNA preparation and cDNA synthesis" ] 3 => array:2 [ "identificador" => "s0030" "titulo" => "Serum cytokine analysis" ] 4 => array:2 [ "identificador" => "s0035" "titulo" => "Statistical analysis" ] ] ] 4 => array:3 [ "identificador" => "s0040" "titulo" => "Results" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "s0045" "titulo" => "Clinical & laboratory characteristics" ] 1 => array:2 [ "identificador" => "s0050" "titulo" => "Increased hepatic gene expression of proinflammatory cytokines in patients with NASH relative to patients with NAFL" ] 2 => array:2 [ "identificador" => "s0055" "titulo" => "Hepcidin and TMPRSS6 expression is increased in patients with NASH" ] 3 => array:2 [ "identificador" => "s0060" "titulo" => "Excess hepatic iron is associated with increased hepcidin and reduced inflammatory cytokine expression in NAFLD patients with stainable iron deposition" ] 4 => array:2 [ "identificador" => "s0065" "titulo" => "HAMP expression strongly correlates with HJV expression" ] 5 => array:2 [ "identificador" => "s0070" "titulo" => "Serum cytokine analysis in patients with NASH relative to NAFL" ] ] ] 5 => array:2 [ "identificador" => "s0075" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "s0080" "titulo" => "Abbreviations" ] 7 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2016-06-18" "fechaAceptado" => "2016-07-05" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Key words" "identificador" => "xpalclavsec1116694" "palabras" => array:6 [ 0 => "Nonalcoholic fatty liver disease" 1 => "Nonalcoholic steatohepatitis" 2 => "Hepcidin" 3 => "Iron" 4 => "Inflammation" 5 => "TMPRSS6" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abs0010" class="elsevierStyleSection elsevierViewall"><p id="sp0035" class="elsevierStyleSimplePara elsevierViewall">Nonalcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease worldwide. We have previously shown that hepatic reticuloendothelial system (RES) iron deposition is associated with an advanced degree of nonalcoholic steatohepatitis (NASH) in humans. In this study, we aimed to determine differentially expressed genes related to iron overload, inflammation and oxidative stress pathways, with the goal of identifying factors associated with NASH progression. Seventy five patients with NAFLD were evaluated for their biochemical parameters and their liver tissue analyzed for NASH histological characteristics. Gene expression analysis of pathways related to iron homeostasis, inflammation and oxidative stress was performed using real-time PCR. Gene expression was compared between subjects based on disease status and presence of hepatic iron staining. We observed increased gene expression of hepcidin (HAMP) (2.3 fold, p = 0.027), transmembrane serine proteinase 6 (TMPRSS6) (8.4 fold, p = 0.003), signal transducer and activator of transcription 3 (STAT3) (5.5 fold, p = 0.004), proinflammatory cytokines; IL-1β (2.7 fold, p = 0.046) and TNF-α (3.8 fold, p = 0.001) in patients with NASH. TMPRSS6, a negative regulator of HAMP, is overexpressed in patients with NASH and HIF1α (hypoxia inducible factor-1) is downregulated. NAFLD patients with hepatic iron deposition exhibited higher hepci-din expression (3.1 fold, p = 0.04) but lower expression of cytokines. In conclusion, we observed elevated hepatic HAMP expression in patients with NASH and in NAFLD patients who had hepatic iron deposition, while proinflammatory cytokines displayed elevated expression only in patients with NASH, suggesting a regulatory role for hepcidin in NAFL to NASH transition and in mitigating inflammatory responses.</p></span>" ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "f0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2120 "Ancho" => 1000 "Tamanyo" => 224362 ] ] "descripcion" => array:1 [ "en" => "<p id="sp0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> Hepatic mRNA expression of IL-6, IL-1/3, TNF, NFkB, STAT3, IL-6R and SOCS3 in patients with NASH compared to patients with NAFL. p values: IL-6: 0.15, IL-1f): 0.046, TNFa: 0.001, NFkB: 0.203, STAT3: 0.004, IL-6R: 0.12, SOCS3: 0.012. <span class="elsevierStyleBold">B.</span> Hepatic mRNA expression of HAMP, HJV, FPN1, BMP6 and TMPRSS6in patients with NASH compared to patients with NAFLD. p values: HAMP: 0.02, HJV: 0.06, FPN: 0.22, BMP6: 0.28. TMPRSS6: 0.004. <span class="elsevierStyleBold">C.</span> Hepatic mRNA expression of HO-1, HIF-1 and CREBH in patients with NASH compared to patients with NAFL. p values: HO-1: 0.89, HIF-1: 0.004 and CREBH: 0.85. All values are shown as medians and statistical significance (p < 0.05) is marked* and p < 0.01 is marked.**</p>" ] ] 1 => array:7 [ "identificador" => "f0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2171 "Ancho" => 1003 "Tamanyo" => 212446 ] ] "descripcion" => array:1 [ "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Effects of excess iron in patients with NAFLD. Hepatic mRNA expression of: <span class="elsevierStyleBold">A.</span> Inflammatory markers IL-6, IL-1 p, TNFa, NFkB, STAT3, IL-6R and SOCS3 (p values; IL-6: 0.008, IL-1f): 0.06, TNFa: 0.13, NFkB: 0.02, STAT3: 0.97 IL-6R: 0.29, SOCS3: 0.07). <span class="elsevierStyleBold">B.</span> Iron regulatory genes HAMP, HJV, FPN1 BMP6 and TMPRSS6 (p values; HAMP: 0.04, HJV: 0.16, FPN1: 0.51, BMP6: 0.47 and TMPRSS6: 0.19), and <span class="elsevierStyleBold">C.</span> Stress-responsive genes CREBH, HO-1 and HIF-1 a (p values; CREBH: 0.007, HO-1: 0.66 and HIF-1 a: 0.35) in NAFLD + iron patients compared to NAFLD-iron patients. All values are shown as medians and statistical significance (p < 0.05) marked* and p < 0.01 is marked.**</p>" ] ] 2 => array:7 [ "identificador" => "f0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1210 "Ancho" => 2075 "Tamanyo" => 158833 ] ] "descripcion" => array:1 [ "en" => "<p id="sp0015" class="elsevierStyleSimplePara elsevierViewall">Linear regression in all NAFLD subjects (n = 75) are shown in (<span class="elsevierStyleBold">A</span>) and in NAFLD patients with hepatic iron overload (NAFLD + Fe) (n = 26) (<span class="elsevierStyleBold">B</span>). The regression line obtained with best fitted values and 95% confidence interval is shown. The table shows correlation coefficients between the log hepcidin mRNA and HJV mRNA in the various study groups. The r and p values are shown for each correlation and linear regression analysis. Since multiple analyses were performed, the cutoff was adjusted based on the Bon Ferroni equation to p < 0.01.</p>" ] ] 3 => array:7 [ "identificador" => "t0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sense Primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Antisense Primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCACATCGCTCAGACACCAT3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GGCAACAATATCCACTTTACCAGAGT3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HAMP \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CATCTGCATTTTCTGCTGCG3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GTCTTGCAGCACATCCCAC3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">FPN1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CTTCAGCCTGGCAAGTTACATG3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CTTCTCAAAGGCATTTGAAAGGG3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">’GGTACATCCTCGACGGCATCT3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GTGCCTCTTTGCTGCTTTCAC3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-6R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’ATCGGGCTGAACGGTCAAAG3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GGCGTCGTGGATGACACAG3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TNFα \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GACAAGCCTGTAGCCCATGT3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’TTATCTCTCAGCTCCACGCC3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-1β \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCTGTCCTGCGTGTTGAAAGA3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GGGAACTGGGCAGACTCAAA3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NFκB \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCCCACGAGCTTGTAGGAAAG3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCAGGTTCTGGAAACTGTGGAT3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CREBH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CTGGTCCTGAGGAATGCAACAG3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CTGGGAGCATAGTCCTGGCG3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BMP6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’TGTTGGACACCCGTGTAGTAT3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’AACCCACAGATTGCTAGTGGC3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TMPRSS6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCTACAGGGCCGAGTACGAA3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’TCAATGCAGCTATGTCTTTCACA3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SOCS3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CCTGCGCCTCAAGACCTTC3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’GTCACTGCGCTCCAGTAGAA3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">STAT3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’CAGCAGCTTGACACACGGTA3’ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5’AAACACCAAAGTGGCATGTGA3’ \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HO-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AAGACTGCGTTCCTGCTCAAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AAAGCCCTACAGCAACTGTCG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HIF-1α \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGAACAAAACACACAGCGAAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AATCAGCACCAAGCAGGTCATA \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2046067.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="sp0020" class="elsevierStyleSimplePara elsevierViewall">List of primers sequence used for the target genes.</p>" ] ] 4 => array:8 [ "identificador" => "t0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "fuente" => "Statistical significance (p < 0.05) was determined by Mann-Whitney U test." "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " rowspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"></th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Baseline characteristics</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " rowspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p = value</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">NAFL (n = 30) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">NASH (n = 45) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Physiological variables \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age (yrs) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">51.00 (44.00-58.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">47.00 (38.00-56.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.303 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11F/19M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26F/19M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.053 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BMI (kg/m<span class="elsevierStyleSup">2</span>) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32.11 (28.60-37.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34.75 (29.58-38.06) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.23 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Laboratory values \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CRP (mg/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.90 (1.50-5.10) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.60 (2.50-10.27) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.064 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ferritin (μg/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">131.00 (73.00-363.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">203.00 (78.25-316.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.58 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Serum iron (μg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">75.50 (60.00-93.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65.50 (50.00-93.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.38 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TIBC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">325.00 (298.00-387.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">356.00 (318.00-387.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.89 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Trans Sat (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20.40 (13.60-25.90) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19.43 (12.72-26.91) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bili (dir) (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.20 (0.20-0.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.20 (0.10-0.20) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.065 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Alk. Phos. (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">71.50 (63.00-89.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">78.00 (60.50-96.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.38 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AST (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33.00 (27.00-43.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46.00 (33.00-70.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.01 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALT (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61.50 (43.00-89.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">75.00 (52.00-132.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.055 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total Chol. (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">200.00 (168.00-215.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">196.50 (166.00-230.75) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.865 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TG (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">147.00 (108.00-247.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">152.00 (98.00-216.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.868 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HDL (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36.00 (33.00-45.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38.50 (35.25-46.75) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.315 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LDL (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">123.00 (109.00-143.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">110.00 (97.50-149.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.48 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tri/HDL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.93 (2.50-6.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.05 (2.45-5.83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.739 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Histological variables \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Steatosis (0-3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.00 (0.00-2.25) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.00 (2.00-3.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">< 0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fibrosis (0-6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.00 (1.00-2.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.00 (1.50-4.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Inflammation (0-3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.00 (0.00-0.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.00 (1.00-2.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ballooning (0-2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.00 (2.00-4.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.00 (1.00-2.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">< 0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NAS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.00 (0.00-0.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.00 (4.00-6.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">< 0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2046066.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="sp0025" class="elsevierStyleSimplePara elsevierViewall">Baseline characteristic, values are presented as the median (25th to 75th percentile) for physiologic variable, laboratory values and histological scores.</p>" ] ] 5 => array:8 [ "identificador" => "t0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "fuente" => "Statistical significance (p < 0.05) was determined by Wilcoxon Rank sum test, after adjusting for variables such as age, sex and BMI. NAFLD: nonalcoholic fatty liver disease." "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " rowspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"></th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Baseline characteristics</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " rowspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-value</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">NAFLD - Iron (n = 49) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">NAFLD + Iron (n = 26) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Physiologic variables \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age(yrs) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48.00 (38.00-56.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">51.50 (43.75-61.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.13 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29F/19M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7F/19M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.008 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BMI(kg/m<span class="elsevierStyleSup">2</span>) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34.70 (30.40-40.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30.3 (28.10-35.20) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.03 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Laboratory values \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CRP (mg/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.70 (2.60-3.60) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.30 (1.40-3.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0093 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ferritin (μg/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">98.90 (60.30-241.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">312.00 (204.00-472.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0009 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Serum Iron (μg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62.00 (45.30-86.80) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">83.50 (70.00-108.80) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0079 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TIBC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">371.00 (324.00-395.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">320.00 (299.00-363.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0498 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Trans Sat (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17.20 (12.10-24.60) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23.30 (21.30-37.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0005 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Alb. (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.10 (3.90-4.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.30 (4.10-4.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0052 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bili (dir) (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.20 (0.10-0.20) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.20 (0.20-0.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0385 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Alk. Phos. (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">74.50 (63.80-94.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">70.50 (59.30-86.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0128 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AST (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38.00 (27.00-52.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">51.00 (33.50-72.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0012 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALT (U/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62.50 (44.8-104.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">78.00 (57.50-127.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0045 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total Chol. (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">194.50 (163.00-222.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">203.50 (185.30-232.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0399 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TG (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">149.00 (99.50-220.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">150.50 (123.80-216.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0292 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HDL (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38.50 (35.00-47.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">37.00 (34.00-41.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0287 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LDL (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">111.00 (97.00-133.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">127.00 (109.50-152.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0503 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tri/HDL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.10 (2.30-6.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.10 (3.10-6.30) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0250 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2046068.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="sp0030" class="elsevierStyleSimplePara elsevierViewall">Baseline characteristic values of NAFLD patients with or without hepatic iron deposition are presented as medians (25th to 75th percentile) for physiologic variables and laboratory values.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bs0010" "bibliografiaReferencia" => array:31 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nonalcoholic fatty liver disease: a systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Rinella M.E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/jama.2015.5370" "Revista" => array:6 [ "tituloSerie" => "JAMA" "fecha" => "2015" "volumen" => "313" "paginaInicial" => "2263" "paginaFinal" => "2273" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26057287" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Iron metabolism in Nonalcoholic Fatty Liver Disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Nelson J.E." 1 => "Klintworth H." 2 => "Kowdley K.V." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11894-011-0234-4" "Revista" => array:6 [ "tituloSerie" => "Curr Gastroenterol Rep" "fecha" => "2012" "volumen" => "14" "paginaInicial" => "8" "paginaFinal" => "16" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22124850" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nonalcoholic Steatohepa-titis Clinical Research Network. Lower serum hepcidin and greater parenchymal iron in nonalcoholic fatty liver disease patients with C282Y HFE mutations" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Nelson J.E." 1 => "Brunt E.M." 2 => "Kowdley K.V." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.25856" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2012" "volumen" => "56" "paginaInicial" => "1730" "paginaFinal" => "1740" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22611049" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HFE C282Y mutations are associated with advanced hepatic fibrosis in Caucasians with nonalcoholic steatohepatitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Nelson J.E." 1 => "Bhattacharya R." 2 => "Lindor K.D." 3 => "Chalasani N." 4 => "Raaka S." 5 => "Heathcote E.J." 6 => "Miskovsky E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.21742" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2007" "volumen" => "46" "paginaInicial" => "723" "paginaFinal" => "729" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17680648" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Relationship between the pattern of hepatic iron deposition and histological severity in nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Nelson J.E." 1 => "Wilson L." 2 => "Brunt E.M." 3 => "Yeh M.M." 4 => "Kleiner D.E." 5 => "Unalp-Arida A." 6 => "Kowdley K.V." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.24038" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2011" "volumen" => "53" "paginaInicial" => "448" "paginaFinal" => "457" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21274866" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Nemeth E." 1 => "Tuttle M.S." 2 => "Powelson J." 3 => "Vaughn M.B." 4 => "Donovan A." 5 => "Ward D.M." 6 => "Ganz T." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1126/science.1104742" "Revista" => array:6 [ "tituloSerie" => "Science" "fecha" => "2004" "volumen" => "306" "paginaInicial" => "2090" "paginaFinal" => "2093" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15514116" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Babitt J.L." 1 => "Huang F.W." 2 => "Wrighting D.M." 3 => "Xia Y." 4 => "Sidis Y." 5 => "Samad T.A." 6 => "Campagna J.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ng1777" "Revista" => array:6 [ "tituloSerie" => "Nat Genet" "fecha" => "2006" "volumen" => "38" "paginaInicial" => "531" "paginaFinal" => "539" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16604073" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "STAT3 mediates hepatic hepcidin expression and its inflammatory stimulation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Verga Falzacappa M.V." 1 => "Vujic S.M." 2 => "Kessler R." 3 => "Stolte J." 4 => "Hentze M.W." 5 => "Muckenthaler M.U." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1182/blood-2006-07-033969" "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "2007" "volumen" => "109" "paginaInicial" => "353" "paginaFinal" => "358" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16946298" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The gene encoding the iron regulatory peptide hepcidin is regulated by anemia, hypoxia, and inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Nicolas G." 1 => "Chauvet C." 2 => "Viatte L." 3 => "Danan J.L." 4 => "Bigard X." 5 => "Devaux I." 6 => "Beaumont C." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI15686" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "2002" "volumen" => "110" "paginaInicial" => "1037" "paginaFinal" => "1044" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12370282" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alterations in lipid, carbohydrate and iron metabolism in patients with non-alcoholic steatohepatitis (NASH) and metabolic syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Zimmermann A." 1 => "Zimmermann T." 2 => "Schattenberg J." 3 => "Pottgen S." 4 => "Lotz J." 5 => "Rossmann H." 6 => "Roeddiger R." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejim.2011.01.011" "Revista" => array:6 [ "tituloSerie" => "Eur J Intern Med" "fecha" => "2011" "volumen" => "22" "paginaInicial" => "305" "paginaFinal" => "310" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21570653" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TMPRSS6 rs855791 modulates hepcidin transcription in vitro and serum hepcidin levels in normal individuals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Nai A." 1 => "Pagani A." 2 => "Silvestri L." 3 => "Campostrini N." 4 => "Corbella M." 5 => "Girelli D." 6 => "Traglia M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1182/blood-2011-06-364034" "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "2011" "volumen" => "118" "paginaInicial" => "4459" "paginaFinal" => "4462" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21873547" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ROS mediate the hypoxic repression of the hepcidin gene by inhibiting C/EBPalpha and STAT-3" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Choi S.O." 1 => "Cho Y.S." 2 => "Kim H.L." 3 => "Park J.W." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2007.02.137" "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2007" "volumen" => "356" "paginaInicial" => "312" "paginaFinal" => "317" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17349976" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Erythropoietin mediates hepcidin expression in hepatocytes through EPOR signaling and regulation of C/EB-Palpha" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Pinto J.P." 1 => "Ribeiro S." 2 => "Pontes H." 3 => "Thowfeequ S." 4 => "Tosh D." 5 => "Carval-ho F." 6 => "Porto G." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1182/blood-2007-08-106195" "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "2008" "volumen" => "111" "paginaInicial" => "5727" "paginaFinal" => "5733" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18326822" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alcohol metabolism-mediated oxidative stress down-regulates hepcidin transcription and leads to increased duodenal iron transporter expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Harrison-Findik D.D." 1 => "Schafer D." 2 => "Klein E." 3 => "Timchenko N.A." 4 => "Ku-laksiz H." 5 => "Clemens D." 6 => "Fein E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M602098200" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2006" "volumen" => "281" "paginaInicial" => "22974" "paginaFinal" => "22982" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16737972" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathways underlying iron accumulation in human nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Aigner E." 1 => "Theurl I." 2 => "Theurl M." 3 => "Lederer D." 4 => "Haufe H." 5 => "Dietze O." 6 => "Strass-er M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/ajcn/87.5.1374" "Revista" => array:6 [ "tituloSerie" => "Am J Clin Nutr" "fecha" => "2008" "volumen" => "87" "paginaInicial" => "1374" "paginaFinal" => "1383" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18469261" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepcidin and iron-related gene expression in subjects with Dysmetabolic Hepatic Iron Overload" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Barisani D." 1 => "Pelucchi S." 2 => "Mariani R." 3 => "Galimberti S." 4 => "Trombini P." 5 => "Fumagalli D." 6 => "Meneveri R." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2008.03.011" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2008" "volumen" => "49" "paginaInicial" => "123" "paginaFinal" => "133" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18462824" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased adipose tissue expression of hep-cidin in severe obesity is independent from diabetes and NASH" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Bekri S." 1 => "Gual P." 2 => "Anty R." 3 => "Luciani N." 4 => "Dahman M." 5 => "Ramesh B." 6 => "Iannelli A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2006.07.007" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2006" "volumen" => "131" "paginaInicial" => "788" "paginaFinal" => "796" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16952548" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serum hepcidin levels and iron metabolism in obese children with and without fatty liver: case-control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Demircioglu F." 1 => "Gorunmez G." 2 => "Dagistan E." 3 => "Goksugur S.B." 4 => "Bek-das M." 5 => "Tosun M." 6 => "Kizildag B." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00431-014-2268-8" "Revista" => array:6 [ "tituloSerie" => "Eur J Pediatr" "fecha" => "2014" "volumen" => "173" "paginaInicial" => "947" "paginaFinal" => "951" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24500395" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nonalcoholic fatty liver disease (NAFLD) activity score and the his-topathologic diagnosis in NAFLD: distinct clinicopathologic meanings" "autores" => array:1 [ 0 => array:3 [ "colaboracion" => "NASH Clinical Research Network (CRN)" "etal" => false "autores" => array:5 [ 0 => "Brunt E.M." 1 => "Kleiner D.E." 2 => "Wilson L.A." 3 => "Belt P." 4 => "Neuschwander-Tetri B.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.24127" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2011" "volumen" => "53" "paginaInicial" => "810" "paginaFinal" => "820" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21319198" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analysis of hepatic genes involved in the metabolism of fatty acids and iron in nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Mitsuyoshi H." 1 => "Yasui K." 2 => "Harano Y." 3 => "Endo M." 4 => "Tsuji K." 5 => "Minami M." 6 => "Itoh Y." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1872-034X.2008.00464.x" "Revista" => array:6 [ "tituloSerie" => "Hepatol Res" "fecha" => "2009" "volumen" => "39" "paginaInicial" => "366" "paginaFinal" => "373" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19054139" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serum levels of hepcidin in patients with biopsy-proven nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Senates E." 1 => "Yilmaz Y." 2 => "Colak Y." 3 => "Ozturk O." 4 => "Altunoz M.E." 5 => "Kurt R." 6 => "Ozkara S." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/met.2010.0121" "Revista" => array:6 [ "tituloSerie" => "Metab Syndr Relat Disord" "fecha" => "2011" "volumen" => "9" "paginaInicial" => "287" "paginaFinal" => "290" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21417913" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-6 induces hepcidin expression through STAT3" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Wrighting D.M." 1 => "Andrews N.C." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1182/blood-2006-06-027631" "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "2006" "volumen" => "108" "paginaInicial" => "3204" "paginaFinal" => "3209" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16835372" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "STAT3 is required for IL-6-gp130-de-pendent activation of hepcidin in vivo" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Pietrangelo A." 1 => "Dierssen U." 2 => "Valli L." 3 => "Garuti C." 4 => "Rump A." 5 => "Corradi-ni E." 6 => "Ernst M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2006.10.018" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2007" "volumen" => "132" "paginaInicial" => "294" "paginaFinal" => "300" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17241879" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Modulation of hepcidin to treat iron deregulation: potential clinical applications" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Blanchette N.L." 1 => "Manz D.H." 2 => "Torti F.M." 3 => "Tort S.V." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1586/17474086.2016.1124757" "Revista" => array:6 [ "tituloSerie" => "Expert Rev Hematol" "fecha" => "2016" "volumen" => "9" "paginaInicial" => "169" "paginaFinal" => "186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26669208" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Iron regulation by hepcidin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Zhao N." 1 => "Zhang A.S." 2 => "Enns C.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI67225" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "2013" "volumen" => "123" "paginaInicial" => "2337" "paginaFinal" => "2343" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23722909" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepcidin mediates transcriptional changes that modulate acute cytokine-induced inflammatory responses in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "De D.I." 1 => "Zhang T.Y." 2 => "Koening C.L." 3 => "Branch R.W." 4 => "London N." 5 => "Lo E." 6 => "Daynes R.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI42011" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "2010" "volumen" => "120" "paginaInicial" => "2395" "paginaFinal" => "2405" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20530874" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Cabrita M." 1 => "Pereira C.F." 2 => "Rodrigues P." 3 => "Cardoso E.M." 4 => "Arosa F.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1432-1033.2004.04387.x" "Revista" => array:6 [ "tituloSerie" => "FEBS J" "fecha" => "2005" "volumen" => "272" "paginaInicial" => "152" "paginaFinal" => "165" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15634340" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hemojuvelin is essential for dietary iron sensing, and its mutation leads to severe iron overload" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Niederkofler V." 1 => "Salie R." 2 => "Arber S." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI25683" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "2005" "volumen" => "115" "paginaInicial" => "2180" "paginaFinal" => "2186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16075058" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hemoju-velin-neogenin interaction is required for bone morphogenic protein-4-induced hepcidin expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Zhang A.S." 1 => "Yang F." 2 => "Wang J." 3 => "Tsukamoto H." 4 => "Enns C.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M109.027318" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2009" "volumen" => "284" "paginaInicial" => "22580" "paginaFinal" => "22589" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19564337" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Zhang A.S." 1 => "Gao J." 2 => "Koeberl D.D." 3 => "Enns C.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M110.109488" "Revista" => array:6 [ "tituloSerie" => "The role of hepato-cyte hemojuvelin in the regulation of bone morphogenic pro-tein-6 and hepcidin expression in vivo J Biol Chem" "fecha" => "2010" "volumen" => "285" "paginaInicial" => "16416" "paginaFinal" => "16423" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20363739" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HFE genotype, parenchy-mal iron accumulation, and liver fibrosis in patients with nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Valenti L." 1 => "Fracanzani A.L." 2 => "Bugianesi E." 3 => "Dongiovanni P." 4 => "Gal-mozzi E." 5 => "Vanni E." 6 => "Canavesi E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2009.11.013" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2010" "volumen" => "138" "paginaInicial" => "905" "paginaFinal" => "912" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19931264" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/0000001600000001/v1_201905311015/S1665268119303643/v1_201905311015/en/main.assets" "Apartado" => array:4 [ "identificador" => "77721" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Article" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/0000001600000001/v1_201905311015/S1665268119303643/v1_201905311015/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119303643?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 2 | 0 | 2 |
| 2024 October | 10 | 7 | 17 |
| 2024 September | 14 | 7 | 21 |
| 2024 August | 22 | 2 | 24 |
| 2024 July | 18 | 5 | 23 |
| 2024 June | 8 | 4 | 12 |
| 2024 May | 18 | 3 | 21 |
| 2024 April | 11 | 7 | 18 |
| 2024 March | 23 | 3 | 26 |
| 2024 February | 18 | 8 | 26 |
| 2024 January | 12 | 5 | 17 |
| 2023 December | 15 | 7 | 22 |
| 2023 November | 15 | 5 | 20 |
| 2023 October | 11 | 7 | 18 |
| 2023 September | 14 | 3 | 17 |
| 2023 August | 6 | 10 | 16 |
| 2023 July | 8 | 8 | 16 |
| 2023 June | 6 | 1 | 7 |
| 2023 May | 21 | 5 | 26 |
| 2023 April | 14 | 3 | 17 |
| 2023 March | 21 | 4 | 25 |
| 2023 February | 7 | 7 | 14 |
| 2023 January | 8 | 3 | 11 |
| 2022 December | 20 | 12 | 32 |
| 2022 November | 16 | 11 | 27 |
| 2022 October | 20 | 6 | 26 |
| 2022 September | 15 | 12 | 27 |
| 2022 August | 8 | 12 | 20 |
| 2022 July | 13 | 11 | 24 |
| 2022 June | 22 | 14 | 36 |
| 2022 May | 48 | 9 | 57 |
| 2022 April | 20 | 10 | 30 |
| 2022 March | 27 | 11 | 38 |
| 2022 February | 40 | 8 | 48 |
| 2022 January | 66 | 10 | 76 |
| 2021 December | 12 | 14 | 26 |
| 2021 November | 15 | 8 | 23 |
| 2021 October | 12 | 18 | 30 |
| 2021 September | 7 | 9 | 16 |
| 2021 August | 8 | 7 | 15 |
| 2021 July | 8 | 13 | 21 |
| 2021 June | 8 | 10 | 18 |
| 2021 May | 16 | 7 | 23 |
| 2021 April | 35 | 11 | 46 |
| 2021 March | 10 | 7 | 17 |
| 2021 February | 12 | 16 | 28 |
| 2021 January | 11 | 10 | 21 |
| 2020 December | 10 | 7 | 17 |
| 2020 November | 20 | 11 | 31 |
| 2020 October | 10 | 7 | 17 |
| 2020 September | 15 | 5 | 20 |
| 2020 August | 14 | 8 | 22 |
| 2020 July | 10 | 6 | 16 |
| 2020 June | 9 | 11 | 20 |
| 2020 May | 9 | 5 | 14 |
| 2020 April | 17 | 3 | 20 |
| 2020 March | 10 | 6 | 16 |
| 2020 February | 11 | 6 | 17 |
| 2020 January | 17 | 9 | 26 |
| 2019 December | 13 | 5 | 18 |
| 2019 November | 8 | 6 | 14 |
| 2019 October | 8 | 1 | 9 |
| 2019 September | 10 | 4 | 14 |
| 2019 August | 2 | 3 | 5 |
| 2019 July | 4 | 5 | 9 |
| 2019 June | 9 | 2 | 11 |
| 2019 May | 2 | 3 | 5 |
Show all
