Requirement of cyclin-dependent kinase function for hepatitis B virus cccDNA synthesis as measured by digital PCR

array:23 ["pii" => "S1665268119322951" "issn" => "16652681" "doi" => "10.1016/j.aohep.2019.12.005" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "173" "copyrightAnyo" => "2019" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2020;19:280-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 24 "formatos" => array:3 [ "EPUB" => 4 "HTML" => 9 "PDF" => 11 ] ] "itemSiguiente" => array:19 [ "pii" => "S1665268120300053" "issn" => "16652681" "doi" => "10.1016/j.aohep.2019.12.007" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "178" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2020;19:287-94" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3 "formatos" => array:2 [ "EPUB" => 1 "PDF" => 2 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "New model predicting gastroesophageal varices and variceal hemorrhage in patients with chronic liver disease" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "287" "paginaFinal" => "294" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 3303 "Ancho" => 2508 "Tamanyo" => 353048 ] ] "descripcion" => array:1 [ "en" => "The predictive performance of the new algorithm for GOV. (A) The model score was different between GOV positive group and GOV negative group in CHB training cohort. (B) ROC curve of the model score for diagnosing GOV in CHB training cohort. (C) The model score was different between GOV positive and GOV negative in CHB validation cohort. (D) ROC curve of the model score for diagnosing GOV in CHB validation cohort. (E) The model score was different between GOV positive and GOV negative in non-CHB validation cohort. (F) The model score was different between GOV positive and GOV negative in non-CHB validation cohort." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Jia-li Ma, Ling-ling He, Yu Jiang, Jun-ru Yang, Ping Li, Yao Zang, Hong-shan Wei" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Jia-li" "apellidos" => "Ma" ] 1 => array:2 [ "nombre" => "Ling-ling" "apellidos" => "He" ] 2 => array:2 [ "nombre" => "Yu" "apellidos" => "Jiang" ] 3 => array:2 [ "nombre" => "Jun-ru" "apellidos" => "Yang" ] 4 => array:2 [ "nombre" => "Ping" "apellidos" => "Li" ] 5 => array:2 [ "nombre" => "Yao" "apellidos" => "Zang" ] 6 => array:2 [ "nombre" => "Hong-shan" "apellidos" => "Wei" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120300053?idApp=UINPBA00004N" "url" => "/16652681/0000001900000003/v4_202006250909/S1665268120300053/v4_202006250909/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268120300065" "issn" => "16652681" "doi" => "10.1016/j.aohep.2020.01.002" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "179" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2020;19:269-79" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Circ-PRMT5 enhances the proliferation, migration and glycolysis of hepatoma cells by targeting miR-188-5p/HK2 axis" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "269" "paginaFinal" => "279" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0030" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 3026 "Ancho" => 3175 "Tamanyo" => 558033 ] ] "descripcion" => array:1 [ "en" => "Repression of miR-188-5p abolished effects of HK2 silencing on proliferation, migration and glycolysis of hepatocellular carcinoma cells. (A) The knockdown efficiency of sh-HK2 in SNU-387 and HCCLM3 cells was checked by RT-qPCR assay. (B–F) SNU-387 and HCCLM3 cells were transfected with sh-NC, sh-HK2, sh-HK2+anti-NC, or sh-HK2+anti-miR-188-5p. (B) MTT assay was performed for examining the cell viability of SNU-387 and HCCLM3 cells. (C) Cell migration assay was conducted in transfected SNU-387 and HCCLM3 cells. (D-F) Glucose consumption, lactate production and ATP level of transfected SNU-387 and HCCLM3 cells were calculated. *P<0.05." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Zhenghua Ding, Li Guo, Zhongming Deng, Peng Li" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Zhenghua" "apellidos" => "Ding" ] 1 => array:2 [ "nombre" => "Li" "apellidos" => "Guo" ] 2 => array:2 [ "nombre" => "Zhongming" "apellidos" => "Deng" ] 3 => array:2 [ "nombre" => "Peng" "apellidos" => "Li" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120300065?idApp=UINPBA00004N" "url" => "/16652681/0000001900000003/v4_202006250909/S1665268120300065/v4_202006250909/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Requirement of cyclin-dependent kinase function for hepatitis B virus cccDNA synthesis as measured by digital PCR" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "280" "paginaFinal" => "286" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Ching-Yu Bao, Hsu-Chin Hung, Yi-Wen Chen, Chiao-Yuan Fan, Chien-Jung Huang, Wenya Huang" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Ching-Yu" "apellidos" => "Bao" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Hsu-Chin" "apellidos" => "Hung" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Yi-Wen" "apellidos" => "Chen" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Chiao-Yuan" "apellidos" => "Fan" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "Chien-Jung" "apellidos" => "Huang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 5 => array:4 [ "nombre" => "Wenya" "apellidos" => "Huang" "email" => array:1 [ 0 => "whuang@mail.ncku.edu.tw" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] 2 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] 3 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan, Taiwan" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Cold Spring Biotech Corp, New Taipei City, Taiwan" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Department of Internal Medicine, Taipei City Hospital, Taipei, Taiwan" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Institute of Basic Medicine, National Cheng Kung University, Tainan, Taiwan" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Department of Pathology, National Cheng Kung University Hospital, Tainan, Taiwan" "etiqueta" => "e" "identificador" => "aff0025" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author at: Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, 1 University Road, Tainan 70101, Taiwan." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 3017 "Ancho" => 3333 "Tamanyo" => 360116 ] ] "descripcion" => array:1 [ "en" => "Inhibition of intracellular cccDNA synthesis by CDK inhibitors. (A) Virus protein production in HBV-producing HepAD38 cells. Viral core and surface proteins were greatly induced with removal of doxycycline from the growth medium. Left panel, representative image of Western blotting for HBV surface (HBs) and core (HBc) proteins. Right panel, summary of the results of at least 3 independent experiments. (B) MTT assays to detect the cell viabilities after UCN-01 treatments. UCN-01 concentrations of 0.5 and 1μM (arrows) were chosen for further studies of cccDNA. (C) Inhibition of the cccDNA levels after treatments with UCN-01, as measured by digital PCR and real-time PCR. (D–F) The intracellular HBV pgRNA (D) and the core and surface proteins (E) and the HBeAg and viral DNA levels in the growth medium (F) after UCN-01 treatments were analyzed. UCN-01 inhibited cccDNA synthesis as well as viral gene expression and virion production. (G) Intracellular cccDNA levels after treatments with the PKC inhibitor Go 6983 (50 and 100nM) and the CDK inhibitor AZD-5438 (500 and 750nM). AZD-5438 dramatically blocked cccDNA synthesis, whereas Go 6983 did not show a significant effect on cccDNA. *, **, and ***: p value<0.05, <0.01, and <0.001, respectively. ns: not significant." ] ] ] "textoCompleto" => "1IntroductionChronic hepatitis B (CHB) virus infection is the most important cause of hepatocellular carcinoma (HCC) worldwide <a class="elsevierStyleCrossRefs" href="#bib0200">[1,2]</a>. Currently, more than 2 billion people have been infected with HBV, and 350 million among them suffer from CHB, which often results in cirrhosis and HCC, diseases that are among the top leading causes of death worldwide <a class="elsevierStyleCrossRefs" href="#bib0210">[3–7]</a>. In some countries, HBV vaccination for newborns has been launched to reduce infection rates <a class="elsevierStyleCrossRef" href="#bib0235">[8]</a>. Additionally, antiviral therapies using nucleotide/nucleoside analogs have achieved effective “functional” cure of the virus infection. Despite this valuable progress in vaccines and treatments, so far there are still no reliable strategies for “complete” or “virological” cure due to the difficulty of eradicating the HBV residual replication intermediate covalently closed circular (ccc) DNA in hepatocytes <a class="elsevierStyleCrossRef" href="#bib0240">[9]</a>. Therefore, developing high-risk biomarkers for viral reactivation after nucleotide/nucleoside (NA) therapies in CHB patients is a very important issue.HBV enters the cell by binding to the sodium taurocholate cotransporting polypeptide (NTCP) receptor on the surface of hepatocytes <a class="elsevierStyleCrossRefs" href="#bib0245">[10,11]</a>. After entry, the viral nucleocapsid is released into the cytoplasm and then translocated into the nucleus <a class="elsevierStyleCrossRef" href="#bib0245">[10]</a>. Within the nucleus, relaxed circular (rc) DNA is converted into cccDNA, which then serves as a template for transcription <a class="elsevierStyleCrossRef" href="#bib0255">[12]</a>. The cccDNA functions as the template for transcription of the four viral RNAs (0.7, 2.1, 2.4, and 3.5kb), which are exported to the cytoplasm and used as mRNAs for translation of the HBV proteins. The longest (i.e., pregenomic, pg) RNA functions as the template for replication mediated by the viral polymerase, which executes the action of reverse transcription. Among all the steps in the HBV life cycle, reverse transcription is currently the main target for antiviral therapies. Nucleotide/nucleoside analogs, such as adefovir and entecavir, which block the process of viral reverse transcription, have been widely used as treatments for CHB patients. The drugs in this category are generally well tolerated, and potent drugs, such as entecavir and tenofovir, can often reduce viremia to below the detection limits of standard viral DNA measurement methods. However, viral reactivation after therapy discontinuation often occurs (∼60% within 2 years post treatment cessation), suggesting that lifelong treatment is necessary <a class="elsevierStyleCrossRef" href="#bib0260">[13]</a>.Because nucleotide/nucleoside drugs inhibit viral replication in the relative “late” phase of the viral life cycle and do not block the replication products generated in earlier phases, recent efforts to develop new strategies in HBV therapy target various critical steps involving in HBV replication and propagation, including viral entry, encapsidation, gene expression, and virion assembly. These novel antiviral drugs provide unprecedented opportunities to destroy HBV cccDNA and other replication intermediates and completely eradicate the virus, but the main challenge yet unresolved is the reliable quantification of cccDNA in the liver in the course of drug treatments <a class="elsevierStyleCrossRef" href="#bib0265">[14]</a>. Monitoring the ability of these treatments to reduce the cccDNA level, which is the key replication reservoir, is an essential task to demonstrate their potential to reach virological cure.The molecular mechanism of HBV cccDNA synthesis remains obscure despite of recent identification of the HBV receptor, NTCP, which has made de novo infection experiments in cultured hepatocytes much more applicable <a class="elsevierStyleCrossRef" href="#bib0270">[15]</a>. rcDNA, which is reverse transcribed from pgRNA, contains the phosphotyrosyl-bonded polymerase (P) protein and a single-stranded flap, which is believed to be removed by host endonucleases. Conversion of partially double-stranded and nick-containing rcDNA to fully double-stranded cccDNA predictably requires the actions of a DNA polymerase, a kinase, endonucleases, a ligase, a topoisomerase, and DNA repair factors. Additionally, it was reported that the phosphotyrosyl-linked P protein can be resolved by specific tyrosyl-DNA-phosphodiesterases (TDPs). However, many important players involved in the process of cccDNA synthesis remain to be characterized <a class="elsevierStyleCrossRef" href="#bib0275">[16]</a>.Some recent studies have reported the potential role of the host cell cycle machinery in HBV replication and propagation. The cyclin E2-cyclin-dependent kinase (CDK) 2 complex has been reported to be involved in regulating viral replication through mediating phosphorylation of the SAM domain- and HD domain-containing protein 1 (SAMHD1) <a class="elsevierStyleCrossRef" href="#bib0280">[17]</a>. Additionally, HBx, a protein important for HBV cccDNA synthesis and carcinogenic processes, has been found to activate protein kinase C (PKC), a family of protein kinases that are involved in controlling the function of some CDK proteins through phosphorylating serine and threonine amino acid residues on these proteins, leading to cell cycle progression <a class="elsevierStyleCrossRef" href="#bib0285">[18]</a>. PKC has also been shown to facilitate pgRNA encapsidation and virion production <a class="elsevierStyleCrossRef" href="#bib0290">[19]</a>. In light of these previous findings, we hypothesized that manipulation of the host cell cycle progression pathway represents a good candidate to control cccDNA synthesis.As the main viral replication reservoir, HBV cccDNA plays a key role in HBV persistence <a class="elsevierStyleCrossRef" href="#bib0275">[16]</a>. Therefore, cccDNA is believed to be an important predictive biomarker for the risk of adverse CHB outcomes. However, reliable detection of cccDNA with high sensitivity and specificity has been challenging because the cccDNA level is very low in the cell (2–30copies/cell), and it co-exists with a large excess amount of rcDNA <a class="elsevierStyleCrossRef" href="#bib0295">[20]</a>. The recent revolutionary digital PCR technology provides quantification of target nucleic acids with high sensitivity and specificity. We therefore hypothesized that digital PCR is a promising approach for cccDNA detection in antiviral drug development <a class="elsevierStyleCrossRef" href="#bib0300">[21]</a>. In this study, we established a convenient and cost-effective platform for the sensitive detection of cccDNA and explored the host molecular pathways controlling cccDNA synthesis.2Materials and methods2.1Cell lineHepAD38 cells, which contain the HBV genome under the tet-off transcription control, were used to examine the intracellular amplification of the virus genome and propagation <a class="elsevierStyleCrossRef" href="#bib0305">[22]</a>. The cells were maintained at 37°C in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 200mM L-glutamine (Gibco, Life Technologies, Carlsbad, CA, USA), 10U/μl penicillin-streptomycin (Lonza, Basel, Switzerland), and 400μg/ml G418 (MDBio) with 5% carbon dioxide. The cells were also maintained in medium supplemented with 0.3μg/ml doxycycline to keep viral gene transcription shut off until the time for viral gene expression.2.2Propagation of HBVTo induce viral gene expression and propagation, HepAD38 cells were grown in doxycycline-free medium. Virions were harvested every 5 days from the growth medium of the cultured cells and then filtered through a 0.45-μm filter. Viruses in the filtrate were concentrated using 10% polyethylene glycol (PEG) 8000 with gentle rotation at 4°C overnight, followed by centrifugation at 7000g for 0.5h. The supernatant was discarded, and the precipitated viruses were re-suspended in 2ml of serum-free DMEM/F-12 medium and then stored at −80°C. The harvested viral DNA was quantified by real-time PCR (Roche).2.3HBV DNA extractionHBV DNA was extracted from HepAD38 cells that were grown in medium containing no doxycycline to propagate HBV. After harvest, the cells were treated with 0.05g/L RNase A at 37°C for 30min, followed by cell lysis buffer (0.1% SDS, 150mM NaCl, 20mM EDTA, 20mM Tris-HCl [pH 7.5], and 0.8g/L proteinase K) at 55°C overnight. DNA in the cell lysate was then extracted with equal volumes of phenol and chloroform twice and chloroform once. DNA in the aqueous phase was mixed with 2 volumes of isopropanol and then centrifuged for precipitation.2.4HBV cccDNA extractionHBV cccDNA was isolated from HepAD38 cells that were grown in medium containing no doxycycline. The cells were lysed with the modified Hirt solution (1% SDS, 50mM Tris–HCl [pH 8.0]), 10mM EDTA [pH 8.0], and 150mM NaCl) <a class="elsevierStyleCrossRef" href="#bib0310">[23]</a>. After 30min of incubation at room temperature, 1/5 volume of 5M NaCl was added to the cell lysate and incubated at 4°C overnight. After centrifugation, the supernatant was supplemented with proteinase K (50μg/ml) and incubated at 37°C to digest protein for 2h. cccDNA was purified by phenol and chloroform extraction and ethanol precipitation. After centrifugation, the pellet was allowed to air dry and was dissolved in ddH2O. The purified cccDNA was treated with T5 and T7 exonucleases (New England Biolab) to digest contaminating rcDNA.2.5HBV rcDNA extraction from cell culture mediumHBV DNA in the cell culture medium was extracted using a QIAamp MinElute Virus Spin Kit (Qiagen). Briefly, doxycycline (-) culture medium of virus-producing HepAD38 cells was incubated with proteinase K and Buffer AL, which contained carrier RNA to facilitate extraction, then incubated at 56°C for 15min. The treated DNA was mixed with ethanol, incubated at room temperature for 5min and then precipitated by centrifugation. DNA was resuspended then loaded into a QIAamp MinElute column, and washed with Buffer AW1 and AW2 by gravity. DNA in the column was eluted with RNase-free ddH2O.2.6Cell survival assayHepAD38 cells were treated with various doses of the chemical UCN-01 (Sigma-Aldrich) or the solvent DMSO for 48h. The cell survival rates were detected by the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium (MTT) assay. Briefly, the cells were incubated in serum-free DMEM containing 0.5mg/ml MTT (Sigma–Aldrich) at 37°C for 3h. After the reaction, the MTT solution was transferred to a 96-well ELISA plate, and the absorbance was measured at 570nm.2.7HBV cccDNA quantitative PCRVirus-producing HepAD38 cells were treated with various concentrations of UCN-01 (Sigma-Aldrich), the PKC inhibitor Go 6983 (Sigma-Aldrich), or the CDK inhibitor AZD-5438 (Sigma-Aldrich) for 48h before harvest. The cccDNA extracted with the Hirt solution was treated with the T5 and T7 exonucleases to remove rcDNA. One microgram of cccDNA was treated with 5U each of the T5 and T7 exonucleases at 30°C for 90min, followed by incubation at 99°C for 5min to stop the enzymatic reactions. After digestion, cccDNA quantitative PCR was performed following a previously described protocol <a class="elsevierStyleCrossRef" href="#bib0315">[24]</a>. Briefly, the cccDNA template was mixed with TaqMan Universal Master Mix II and TaqMan® Probe (Thermo) for cccDNA detection and then subjected to the real-time PCR reactions. The PCR program was 50°C for 2min, 95°C for 10min, and then 40 cycles of 95°C for 30s and 60°C for 30s. The nucleotide positions and sequences of the PCR primers and the TaqMan® probe were forward primer: 5′-(1562) TTCTCATCTGCCGGACCG (1579)-3′, reverse primer: 5′-(1883) CACAGCTTGGAGGCTTGAAC (1864)-3′, and probe: 5′-FAM-(1836) CCTAATCATCTCTTGTTCAT (1855)-MGB-3′. The cccDNA-specific PCR primers span the gap region (1611–1838) on rcDNA.2.8HBV cccDNA digital PCRThe cccDNA was quantified by digital PCR using the Clarity™ Digital PCR System (JN Medsys) following the manufacturer's instructions. The PCR primers and TaqMan® Probe were the same as those used in the cccDNA quantitative PCR described in the previous section. The cccDNA template was partitioned into a multi-well PCR chip, where the PCR was divided into thousands or more of nanoliter sub-reactions such that each had at most a single copy of DNA. The PCR program for digital PCR was 95°C for 5min and then for 40 cycles of 95°C for 50s, 55°C for 100s and 70°C for 5min. After the PCR reactions, the images of the PCR chip results were scanned and converted into scatterplots of signals of the HEX dye conjugated to the hybridization probe in the PCR, and the cccDNA copies present in the sample were calculated.2.9HBV pgRNA quantification by real-time RT-PCRRNA of the HepAD38 cells was extracted using REzol™ C&T buffer (Protech) and then reverse transcribed into cDNA, following previously described protocols <a class="elsevierStyleCrossRef" href="#bib0320">[25]</a>. HBV pgRNA was detected by quantitative RT-PCR. Briefly, the cDNA was mixed with Fast SYBR® Green Master Mix (Thermo) and the pgRNA-specific PCR primers, and the reaction was then amplified by real-time PCR (Roche). The sequences of the RT-PCR primers were forward: 5′-TGTGGAGTTACTCTCGTTTTTGC-3′ and reverse: 5′-AAGGCTTCCCGATACAGAGC-3′ <a class="elsevierStyleCrossRef" href="#bib0325">[26]</a>.2.10Detection of HBV core and surface proteins by Western blottingHBV core and surface proteins were detected in the virus-producing HepAD38 cells by Western blotting, following a previously described protocol <a class="elsevierStyleCrossRef" href="#bib0320">[25]</a>. The antibodies used were an anti-HBsAg antibody (7H11-HRP, generously provided by Prof. Jun Zhang, Xiamen University, China) and an anti-HBcAg antibody (Novocastra).3Results3.1Development of HBV cccDNA analysis by digital PCRWe aimed to establish a digital PCR method to precisely quantify HBV cccDNA. The plasmid pHBV1.3x-BclI, which contains the whole HBV genome in double-stranded closed circular conformation, was used as the positive control for cccDNA and first subjected to the analysis <a class="elsevierStyleCrossRef" href="#bib0330">[27]</a>. The results showed that for the pHBV1.3X-BclI plasmid at various concentrations, the DNA copy numbers revealed in the digital PCR analysis were highly consistent with the input of the target HBV plasmid (R2=0.9993) but not rcDNA, showing a high specificity of cccDNA quantification by the ClarityTM dPCR platform (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>B). Based on multiple independent experimental results, the limit of detection (LOD) and limit of quantitation (LOQ) were 1.05copy/μl, and the limit of linearity (LOL) was 1.02×104copies/μl, indicating that the linear range of detection was 1.05 to 1.02×104copies/μl, reaching a dynamic detection range of 104-fold (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A).<elsevierMultimedia ident="fig0005"></elsevierMultimedia>HBV rcDNA, which co-exists with cccDNA in the cell, often interferes with cccDNA detection. To examine the specific detection of cccDNA in the presence of excess rcDNA, we used rcDNA as the matrix for cccDNA detection. The two types of DNA molecules were mixed in various molecular ratios and then subjected to cccDNA digital PCR with the Clarity™ platform. HBV rcDNA was isolated from virions in the growth medium of cultured HBV-producing HepAD38 cells. Samples in the cccDNA to rcDNA ratios of 1–1, 1–9, and 1–49 were prepared then measured by digital PCR. The analysis results revealed accurate copy numbers regardless of excess rcDNA in the reaction (R2=0.9913) (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>C). This finding indicated that the digital PCR method to quantify cccDNA is suitable for specific examination of cccDNA in clinical serum and liver specimens, in which rcDNA is in great excess. In addition, intrahepatic cccDNA was extracted from HepAD38 cells, where the whole HBV genome was integrated into the chromosome, and the virus genes were transcribed under control of the tet-off inducible promoter. The results of digital PCR analysis showed that the cccDNA copy numbers corresponded highly to the input amounts (R2=0.9931) (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A). The cccDNA levels measured by digital PCR were highly correlated with those measured by real-time quantitative PCR (R2=0.9947), indicating that the digital PCR method was compatible with quantitative PCR but had higher sensitivity and was readily applicable to cccDNA analysis in clinical specimens (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B).<elsevierMultimedia ident="fig0010"></elsevierMultimedia>3.2Blockage of intracellular cccDNA synthesis by CDK inhibitorsRecent studies have suggested that the host cell cycle machinery controls HBV replication <a class="elsevierStyleCrossRef" href="#bib0335">[28]</a>. Therefore, we examined whether HBV cccDNA synthesis is modulated by cell cycle progression. Virus-producing HepAD38 cells were first treated with UCN-01, an inhibitor with a broad-spectrum activity for PKC & CDK proteins, and then the intracellular cccDNA was purified and quantified by digital PCR (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A). The results showed that treatments with UCN-01 greatly decreased cccDNA levels even in the concentrations (0.5 and 1μM) where the cell viabilities were not greatly compromised, as analyzed by MTT assays (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>B and C), excluding the possibility that UCN-01-induced cccDNA blockage is caused by global DNA degradation attributed to cell apoptosis. Consistently with cccDNA blockage, the intracellular viral pgRNA and HBV core and surface proteins and the HBeAg and viral DNA in virions secreted in the cell growth medium also decreased after treatment with UCN-01 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>D–F).<elsevierMultimedia ident="fig0015"></elsevierMultimedia>The main groups of molecules whose kinase activities are inhibited by UCN-01 are PKC and CDK factors, suggesting that PKC and CDK are potentially important players in cccDNA synthesis <a class="elsevierStyleCrossRef" href="#bib0340">[29]</a>. To test this hypothesis, virus-producing HepAD38 cells were treated with (1) Go 6938, an inhibitor for a wide spectrum of PKCs, including PKCα, PKCβ, PKCγ, PKCδ, and PKCζ, that have been shown to involve in cell growth and differentiation <a class="elsevierStyleCrossRef" href="#bib0345">[30]</a>; and (2) AZD-5438, a potent inhibitor of CDK1, CDK2, and CDK9, which exhibited antiproliferative activity in human tumor cell lines <a class="elsevierStyleCrossRef" href="#bib0350">[31]</a>. The cccDNA levels in the cells treated with these drugs were measured by quantitative PCR. While the PKC inhibitor Go 6938 did not show a significant inhibitory effect on cccDNA synthesis, the CDK inhibitor AZD-5438 dramatically decreased cccDNA levels in a dose-dependent manner (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>G). These findings clearly demonstrated that CDK activity is required for HBV cccDNA synthesis.4DiscussionChronic HBV infection is the major etiological factor of HCC. Viral replication activity has been documented to stimulate carcinogenic pathways in the liver <a class="elsevierStyleCrossRef" href="#bib0355">[32]</a>. As the main viral replication reservoir, HBV cccDNA plays a key role in HBV persistence <a class="elsevierStyleCrossRef" href="#bib0275">[16]</a>. Understanding the molecular mechanism of cccDNA synthesis is a very important task for paving the way to develop new-generation antivirals complementing NA drugs, which are highly effective but present with high rates of relapse after treatment discontinuation. The molecular mechanism of cccDNA synthesis remains obscure because reliable detection of cccDNA with high sensitivity and specificity has been challenging <a class="elsevierStyleCrossRef" href="#bib0295">[20]</a>. Here, by utilizing the new approach of digital PCR, we developed a quick and cost-effective method for precise quantification of cccDNA. With this technique, studies of the stepwise molecular mechanisms regulating cccDNA synthesis can be greatly improved in the near future.HBV cccDNA is hypothesized to be an important predictive biomarker for the risk of adverse CHB outcomes. HBV cccDNA in the liver has also been shown to be highly correlated with serum ALT levels and liver inflammation, which ultimately leads to fibrosis, cirrhosis, and HCC <a class="elsevierStyleCrossRef" href="#bib0360">[33]</a>. cccDNA in hepatocytes also promotes the production of the viral oncoproteins HBx and LHBs, triggering oncogenic processes <a class="elsevierStyleCrossRefs" href="#bib0365">[34–37]</a>. The traditional gold standard method for cccDNA detection is Southern blotting, which separates rcDNA and cccDNA by electrophoresis based on the different conformations of the two molecules and allows cccDNA visualization <a class="elsevierStyleCrossRef" href="#bib0385">[38]</a>. However, the experimental procedures for Southern blotting are time consuming and tedious and require a large amount of specimen, which make it impossible for clinical practice. Later, development of a gene amplification approach using cccDNA-specific PCR primers and probes combined with exonucleases specifically cleaving rcDNA, which contains some single-stranded regions, has greatly improved the sensitivity and specificity of cccDNA detection <a class="elsevierStyleCrossRef" href="#bib0390">[39]</a>. Furthermore, the recent revolutionary digital PCR technology provides absolute quantification of target nucleic acids without the need for an external calibrator and is therefore a robust approach for cccDNA detection <a class="elsevierStyleCrossRef" href="#bib0300">[21]</a>.Hepatitis B virus has been reported to dysregulate the cell cycle to promote viral replication and a premalignant phenotype <a class="elsevierStyleCrossRef" href="#bib0335">[28]</a>. In this study, we found that the broad spectrum PKC and CDK inhibitor UCN-01 dramatically decreased cccDNA synthesis. Further investigation also identified that CDK but not PKC was required for cccDNA synthesis. A previous study found that HBV-infected primary human hepatocytes (PHHs) were enriched in the G2/M phase, rather than G0/G1 phase, where cultured PHHs predominantly reside in, indicating that host cell cycle progression is likely interrupted by HBV infection <a class="elsevierStyleCrossRef" href="#bib0335">[28]</a>. cccDNA, the template of HBV transcription, plays a key role in the viral life cycle and permits infection persistence. Nuclear cccDNA accumulates in the hepatocyte nucleus as a stable minichromosome organized by histones and other chromosome-modulating cellular proteins <a class="elsevierStyleCrossRef" href="#bib0255">[12]</a>. These proteins are differentially expressed in various cell cycle phases, indicating that cell cycle machinery is functionally linked with cccDNA synthesis. Our data indicated that the CDK1, 2 and 9 inhibitor AZD-5438, an effective anticancer drug for solid malignancies, greatly diminished cccDNA synthesis in hepatocytes stably propagating virions. The stepwise molecular mechanism for how host cell cycle control participates in cccDNA synthesis remains to be deciphered; thus, the current finding has suggested that disrupting host cell cycle progression is a promising strategy to eradicate the HBV cccDNA pool in hepatocytes, leading to a virological cure.In conclusion, this study developed a high-sensitivity and high-specificity method to precisely quantify HBV cccDNA in hepatocytes stably propagating viruses. The new digital PCR approach allows detection of cccDNA with a 1000-fold lower limit of detection than quantitative PCR. We also identified that host CDK activities are required for cccDNA synthesis. Future applications of digital PCR in clinical specimens in HBV carriers can be applied to drug screening for effective cccDNA inhibitors.AbbreviationsCCCcovalently closed circularCDKcyclin dependent kinaseCHBchronic hepatitis BdPCRdigital PCRHCChepatocellular carcinomaLODlimit of detectionLOQlimit of quantitationLOLlimit of linearityMTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazoliumNAnucleotide/nucleoside analogsNTCPsodium taurocholate cotransporting polypeptidePEGpolyethylene glycolPHHprimary human hepatocytePKCprotein kinase CrcDNArelaxed circular DNART-PCRreverse transcription-polymerase chain reactionSAMHD1SAM domain and HD domain-containing protein 1TDPtyrosyl-DNA-phosphodiesterasesAuthors’ contributionsCYB and CJH developed digital PCR and performed molecular and cellular experiments and drafted the manuscript; YWC and CYF performed digital PCR experiments; CJH performed statistical analyses of the experimental data; and WH designed the study. All authors read and approved the final manuscript.FundingThis study was supported by the Taiwan Ministry of Science and Technology (grant nos. 107-2622-B-006-003-CC2, 106-2320-B-006-048-MY3 and 107-2320-B-006-032-MY3 to WH), the Taiwan Ministry of Health and Welfare (grant no. MOHW108-TDU-B-211-113003 to WH), and the National Cheng Kung University Center of Infectious Disease and Signaling Research (grant no. D105-22004 to WH)." "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:3 [ "identificador" => "xres1354753" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Patients or materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1245687" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:10 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Cell line" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Propagation of HBV" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "HBV DNA extraction" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "HBV cccDNA extraction" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "HBV rcDNA extraction from cell culture medium" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Cell survival assay" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "HBV cccDNA quantitative PCR" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "HBV cccDNA digital PCR" ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "HBV pgRNA quantification by real-time RT-PCR" ] 9 => array:2 [ "identificador" => "sec0060" "titulo" => "Detection of HBV core and surface proteins by Western blotting" ] ] ] 4 => array:3 [ "identificador" => "sec0065" "titulo" => "Results" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0070" "titulo" => "Development of HBV cccDNA analysis by digital PCR" ] 1 => array:2 [ "identificador" => "sec0075" "titulo" => "Blockage of intracellular cccDNA synthesis by CDK inhibitors" ] ] ] 5 => array:2 [ "identificador" => "sec0080" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "sec0085" "titulo" => "Authors’ contributions" ] 7 => array:2 [ "identificador" => "sec0090" "titulo" => "Funding" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2019-10-24" "fechaAceptado" => "2019-12-20" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1245687" "palabras" => array:5 [ 0 => "Hepatitis B virus" 1 => "cccDNA" 2 => "Digital PCR" 3 => "Cyclin-dependent kinase" 4 => "Protein kinase C" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "Introduction and objectivesHBV covalently closed circular (ccc) DNA is the key player in viral persistence and an important predictive biomarker for hepatitis relapse. Precise quantification of intracellular cccDNA is challenging because cccDNA is present in very low levels in hepatocytes, where it also co-exists with a large excess amount of relaxed circular (rc) DNA. We aimed to develop a highly sensitive cccDNA detection method for cccDNA quantification by digital PCR (dPCR). Patients or materials and methodsA standard plasmid containing the whole HBV genome in the closed circular conformation was employed to characterize the performance of dPCR. rcDNA in the growth medium of HBV-producing HepAD38 cells was used as a matrix for cccDNA detection. Intrahepatic cccDNA measurement by dPCR and qPCR was performed to determine the correlation of the analysis results for the two methods. ResultsThe limit of detection (LOD) of the cccDNA dPCR was 1.05copy/μl, and the linear range of detection was 1.02×104copies/μl, achieving a dynamic detection range of 104-fold. cccDNA measurement using excess rcDNA as the matrix did not reveal false-positive detection, indicating that dPCR was highly specific. In the HepAD38 cells, the cccDNA levels measured by dPCR were highly correlated with those measured by qPCR but had a higher sensitivity. The CDK inhibitor AZD-5438 was found to block intracellular cccDNA synthesis. ConclusionsDpcr greatly improved the sensitivity and specificity of cccDNA detection. Host CDK activities are likely required for cccDNA synthesis. dPCR can potentially be applied for drug screening for effective cccDNA inhibitors." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Patients or materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] ] "multimedia" => array:3 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2081 "Ancho" => 2508 "Tamanyo" => 218144 ] ] "descripcion" => array:1 [ "en" => "Development of digital PCR for HBV cccDNA quantification. (A) LOD, LOQ, LOL, and linearity range of cccDNA quantification using the HBV plasmid pHBV1.3x-BclI as a standard. Based on at least 3 independent experiments, the LOD and LOQ for HBV cccDNA digital PCR were 1.05copy/μl, and the LOL was 1.02×104copies/μl. The linear range of detection was 1.02×104copies/μl. (B) Quantification of cccDNA in the pHBV1.3-BclI plasmid and rcDNA in virions in the growth medium of virus-producing HepAD38 cells. For the pHBV1.3X-BclI plasmid, the cccDNA copy numbers measured by digital PCR were consistent with the input numbers (R2=0.9993). However, the rcDNA in the same amounts was not detected by cccDNA digital PCR, indicating that digital PCR by the Clarity™ dPCR platform was highly sensitive and specific for cccDNA detection. (C) Quantification of cccDNA in reactions with various amounts of rcDNA. The relative ratios of cccDNA to rcDNA were 1–1, 1–9, or 1–49 in the digital PCRs. The dotted lines indicate the amounts of cccDNA template in the digital PCR reactions. In various ratios of cccDNA to rcDNA, the cccDNA copy numbers can be accurately quantified (R2=0.9913)." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2213 "Ancho" => 1441 "Tamanyo" => 132372 ] ] "descripcion" => array:1 [ "en" => "Detection of intracellular cccDNA in HepAD38 cells. (A) Various amounts of HBV cccDNA extracted from HepAD38 cells were quantified by digital PCR. The cccDNA copy numbers revealed by digital PCR were highly consistent with the input numbers (R2=0.9931). (B) Correlation of the cccDNA levels measured by digital PCR and real-time PCR. The results produced by the two methods were highly correlated (R2=0.9947)." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 3017 "Ancho" => 3333 "Tamanyo" => 360116 ] ] "descripcion" => array:1 [ "en" => "Inhibition of intracellular cccDNA synthesis by CDK inhibitors. (A) Virus protein production in HBV-producing HepAD38 cells. Viral core and surface proteins were greatly induced with removal of doxycycline from the growth medium. Left panel, representative image of Western blotting for HBV surface (HBs) and core (HBc) proteins. Right panel, summary of the results of at least 3 independent experiments. (B) MTT assays to detect the cell viabilities after UCN-01 treatments. UCN-01 concentrations of 0.5 and 1μM (arrows) were chosen for further studies of cccDNA. (C) Inhibition of the cccDNA levels after treatments with UCN-01, as measured by digital PCR and real-time PCR. (D–F) The intracellular HBV pgRNA (D) and the core and surface proteins (E) and the HBeAg and viral DNA levels in the growth medium (F) after UCN-01 treatments were analyzed. UCN-01 inhibited cccDNA synthesis as well as viral gene expression and virion production. (G) Intracellular cccDNA levels after treatments with the PKC inhibitor Go 6983 (50 and 100nM) and the CDK inhibitor AZD-5438 (500 and 750nM). AZD-5438 dramatically blocked cccDNA synthesis, whereas Go 6983 did not show a significant effect on cccDNA. *, **, and ***: p value<0.05, <0.01, and <0.001, respectively. ns: not significant." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0200" "etiqueta" => "[1]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B: The hunt for a killer virus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "B.S. Blumberg" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "fecha" => "2001" "editorial" => "Princeton University Press" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0205" "etiqueta" => "[2]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Estimates of the worldwide incidence of the 18 major cancers in 1985" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D.M. Parkin" 1 => "P. Pisani" 2 => "J. Ferlay" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/ijc.2910540102" "Revista" => array:6 [ "tituloSerie" => "Int J Cancer" "fecha" => "1993" "volumen" => "54" "paginaInicial" => "1" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8478135" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0210" "etiqueta" => "[3]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B virus and hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "P. Arbuthnot" 1 => "M. Kew" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2613.2001.iep0082-0077-x" "Revista" => array:6 [ "tituloSerie" => "Int J Exp Pathol" "fecha" => "2001" "volumen" => "82" "paginaInicial" => "77" "paginaFinal" => "100" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11454100" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0215" "etiqueta" => "[4]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular bases for the development of hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Bréchot" 1 => "D. Gozuacik" 2 => "Y. Murakami" 3 => "P. Paterlini-Bréchot" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Sem Cancer Biol" "fecha" => "2000" "volumen" => "10" "paginaInicial" => "211" "paginaFinal" => "231" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0220" "etiqueta" => "[5]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Global epidemiology of hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F. Bosch" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:3 [ "editores" => "K.Okuda, E.Tabor" "titulo" => "Liver Cancer" "serieFecha" => "1997" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0225" "etiqueta" => "[6]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatocellular carcinoma and HBV. A prospective study of 22,707 men in Taiwan" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Beasley" 1 => "L.Y. Hwang" 2 => "C.C. Lin" 3 => "C.S. Chien" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0140-6736(87)91555-8" "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "1981" "volumen" => "2" "paginaInicial" => "1129" "paginaFinal" => "1133" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2890028" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0230" "etiqueta" => "[7]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prediction models of long-term cirrhosis and hepatocellular carcinoma risk in chronic hepatitis B patients: risk scores integrating host and virus profiles" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.H. Lee" 1 => "H.I. Yang" 2 => "J. Liu" 3 => "R. Batrla-Utermann" 4 => "C.L. Jen" 5 => "U.H. Iloeje" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.26385" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2013" "volumen" => "58" "paginaInicial" => "546" "paginaFinal" => "554" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23504622" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0235" "etiqueta" => "[8]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nationwide hepatitis B vaccination program in Taiwan: effectiveness in the 20 years after it was launched" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y.C. Chien" 1 => "C.F. Jan" 2 => "H.S. Kuo" 3 => "C.J. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/epirev/mxj010" "Revista" => array:6 [ "tituloSerie" => "Epidemiol Rev" "fecha" => "2006" "volumen" => "28" "paginaInicial" => "126" "paginaFinal" => "135" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16782778" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0240" "etiqueta" => "[9]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Virological basis for the cure of chronic hepatitis B" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Hu" 1 => "J. Cheng" 2 => "L. Tang" 3 => "Z. Hu" 4 => "Y. Luo" 5 => "Y. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/acsinfecdis.8b00081" "Revista" => array:6 [ "tituloSerie" => "ACS Infect Dis" "fecha" => "2019" "volumen" => "5" "paginaInicial" => "659" "paginaFinal" => "674" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29893548" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0245" "etiqueta" => "[10]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Early events in hepatitis B virus infection: from the cell surface to the nucleus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:5 [ 0 => "C.N. Hayes" 1 => "Y. Zhang" 2 => "G.N. Makokha" 3 => "M.Z. Hasan" 4 => "M.D. Omokoko" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/jgh.13175" "Revista" => array:6 [ "tituloSerie" => "J Gastroenterol Hepatol" "fecha" => "2016" "volumen" => "31" "paginaInicial" => "302" "paginaFinal" => "309" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26414381" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0250" "etiqueta" => "[11]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The hepatitis B virus receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "W. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1146/annurev-cellbio-100814-125241" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Cell Dev Biol" "fecha" => "2015" "volumen" => "31" "paginaInicial" => "125" "paginaFinal" => "147" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26436705" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0255" "etiqueta" => "[12]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nuclear HBv binds the HBV minichromosome and modifies the epigenetic regulation of cccDNA function" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Belloni" 1 => "T. Pollicino" 2 => "F. De Nicola" 3 => "F. Guerrieri" 4 => "G. Raffa" 5 => "M. Fanciulli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.0908365106" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2009" "volumen" => "106" "paginaInicial" => "19975" "paginaFinal" => "19979" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19906987" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0260" "etiqueta" => "[13]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biomarker for HBV therapy discontinuation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "I. Dickson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Nat Rev Gastro Hepat" "fecha" => "2018" "volumen" => "15" "paginaInicial" => "132" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0265" "etiqueta" => "[14]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Treatment of hepatitis B: a concise review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R. Rajbhandari" 1 => "R.T. Chung" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ctg.2016.46" "Revista" => array:5 [ "tituloSerie" => "Clin Transl Gastroenterol" "fecha" => "2016" "volumen" => "7" "paginaInicial" => "e190" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27628420" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0270" "etiqueta" => "[15]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "NTCP-resconstituted in vitro HBV infection system" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Sun" 1 => "Y. Qi" 2 => "B. Peng" 3 => "W. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-4939-6700-1_1" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol" "fecha" => "2017" "volumen" => "1540" "paginaInicial" => "1" "paginaFinal" => "14" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27975303" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0275" "etiqueta" => "[16]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HBV cccDNA: viral persistence reservoir and key obstacle for a cure of chronic hepatitis B" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Nassal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/gutjnl-2015-309809" "Revista" => array:7 [ "tituloSerie" => "Gut" "fecha" => "2015" "volumen" => "64" "paginaInicial" => "1972" "paginaFinal" => "1984" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26048673" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022534711043369" "estado" => "S300" "issn" => "00225347" ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0280" "etiqueta" => "[17]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cyclin E2-CDK2 mediates SAMHD1 phosphorylation to abrogate its restriction of HBV replication in hepatoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Hu" 1 => "M. Qiao" 2 => "Y. Chen" 3 => "H. Tang" 4 => "W. Zhang" 5 => "D. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/1873-3468.13105" "Revista" => array:6 [ "tituloSerie" => "FEBS Lett" "fecha" => "2018" "volumen" => "592" "paginaInicial" => "1893" "paginaFinal" => "1904" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29782647" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0285" "etiqueta" => "[18]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The hepatitis B virus transactivator HBx causes elevation of diacylglycerol and activation of protein kinase C" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B. Luber" 1 => "U. Lauer" 2 => "L. Weiss" 3 => "M. Höhne" 4 => "P.H. Hofschneider" 5 => "A.S. Kekulé" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0923-2516(06)80047-6" "Revista" => array:6 [ "tituloSerie" => "Res Virol" "fecha" => "1993" "volumen" => "144" "paginaInicial" => "311" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8210715" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0290" "etiqueta" => "[19]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phosphorylation of hepatitis B virus core C-terminally truncated protein (Cp149) by PKC increases capsid assembly and stability" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Kang" 1 => "J. Yu" 2 => "G. Jung" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BJ20080724" "Revista" => array:6 [ "tituloSerie" => "Biochem J" "fecha" => "2008" "volumen" => "416" "paginaInicial" => "47" "paginaFinal" => "54" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18605987" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0295" "etiqueta" => "[20]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Single-cell analysis of covalently closed circular DNA copy numbers in a hepadnavirus-infected liver" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y.Y. Zhang" 1 => "B.H. Zhang" 2 => "D. Theele" 3 => "S. Litwin" 4 => "E. Toll" 5 => "J. Summers" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.2033898100" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2003" "volumen" => "100" "paginaInicial" => "12372" "paginaFinal" => "12377" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14528003" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0300" "etiqueta" => "[21]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Digital polymerase chain reaction assay for the genetic variation in a sporadic familial adenomatous polyposis patient using the chip-in-a-tube format" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "T. Kahyo" 1 => "H. Sugimura" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Vis Exp" "fecha" => "2018" "volumen" => "138" "paginaInicial" => "58199" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0305" "etiqueta" => "[22]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inducible expression of human hepatitis B virus (HBV) in stably transfected hepatoblastoma cells: a novel system for screening potential inhibitors of HBV replication" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.K. Ladner" 1 => "M.J. Otto" 2 => "C.S. Barker" 3 => "K. Zaifert" 4 => "G.H. Wang" 5 => "J.T. Guo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/1535-7163.MCT-08-0836" "Revista" => array:6 [ "tituloSerie" => "Mol Cancer Ther" "fecha" => "2009" "volumen" => "8" "paginaInicial" => "1856" "paginaFinal" => "1866" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19509270" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0310" "etiqueta" => "[23]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A southern blot assay for detection of hepatitis B virus covalently closed circular DNA from cell cultures" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "D. Cai" 1 => "H. Nie" 2 => "R. Yan" 3 => "J.T. Guo" 4 => "T.M. Block" 5 => "H. Guo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-62703-484-5_13" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol" "fecha" => "2013" "volumen" => "1030" "paginaInicial" => "151" "paginaFinal" => "161" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23821267" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0315" "etiqueta" => "[24]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of oxymatrine on the replication cycle of hepatitis B virus in vitro" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W.S. Xu" 1 => "K.K. Zhao" 2 => "X.H. Miao" 3 => "W. Ni" 4 => "X. Cai" 5 => "R.Q. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3748/wjg.v16.i16.2028" "Revista" => array:6 [ "tituloSerie" => "World J Gastroenterol" "fecha" => "2010" "volumen" => "16" "paginaInicial" => "2028" "paginaFinal" => "2037" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20419842" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0320" "etiqueta" => "[25]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B virus pre-S2 mutant surface protein inhibits DNA double strand break repair and leads to genome instability in hepatitis B virus hepatocarcinogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.H. Hsieh" 1 => "I.J. Su" 2 => "C.J. Yen" 3 => "Y.R. Liu" 4 => "R.J. Liu" 5 => "W.C. Hsieh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/path.4531" "Revista" => array:6 [ "tituloSerie" => "J Pathol" "fecha" => "2015" "volumen" => "236" "paginaInicial" => "337" "paginaFinal" => "347" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25775999" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0325" "etiqueta" => "[26]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantification of pregenomic RNA and covalently closed circular DNA in hepatitis B virus-related hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Bai" 1 => "Y. Yano" 2 => "T. Fukumoto" 3 => "A. Takebe" 4 => "M. Tanaka" 5 => "K. Kuramitsu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Int J Hepat" "fecha" => "2013" "paginaInicial" => "849290" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0330" "etiqueta" => "[27]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular components of hepatitis B virus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Feitelson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "fecha" => "1985" "editorial" => "Nijhoff Publications" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0335" "etiqueta" => "[28]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B virus deregulates the cell cycle to promote viral replication and a premalignant phenotype" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Xia" 1 => "X. Cheng" 2 => "Y. Li" 3 => "K. Valdez" 4 => "W. Chen" 5 => "T.J. Liang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JVI.00722-18" "Revista" => array:5 [ "tituloSerie" => "J Virol" "fecha" => "2018" "volumen" => "92" "paginaInicial" => "e00722" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30021897" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0340" "etiqueta" => "[29]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "UCN-01 (7-hydroxystaurosporine) inhibits the growth of human breast cancer xenografts through disruption of signal transduction" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Koh" 1 => "T. Kubota" 2 => "T. Migita" 3 => "S. Abe" 4 => "M. Hashimoto" 5 => "Y. Hosoda" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/BF02967547" "Revista" => array:6 [ "tituloSerie" => "Breast Cancer" "fecha" => "2002" "volumen" => "9" "paginaInicial" => "50" "paginaFinal" => "54" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12196722" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0345" "etiqueta" => "[30]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Overexpressed PKCδ downregulates the expression of PKCα in B16F10 melanoma: induction of apoptosis by PKCδ via ceramide generation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "K. Halder" 1 => "S. Banerjee" 2 => "A. Bose" 3 => "S. Majumder" 4 => "S. Majumdar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0091656" "Revista" => array:5 [ "tituloSerie" => "PLoS ONE" "fecha" => "2014" "volumen" => "9" "paginaInicial" => "e91656" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24632809" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0350" "etiqueta" => "[31]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "AZD5438, a potent oral inhibitor of cyclin-dependent kinases 1, 2, and 9, leads to pharmacodynamic changes and potent antitumor effects in human tumor xenografts" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Byth" 1 => "A. Thomas" 2 => "G. Hughes" 3 => "C. Forder" 4 => "A. McGregor" 5 => "C. Geh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "1997" "volumen" => "41" "paginaInicial" => "1715" "paginaFinal" => "1720" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9257747" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0355" "etiqueta" => "[32]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Viral hepatitis and hepatocellular carcinoma: etiology and management" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "P.J. Zamor" 1 => "A.S. deLemos" 2 => "M.W. Russo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.21037/jgo.2017.03.14" "Revista" => array:6 [ "tituloSerie" => "J Gastrointest Oncol" "fecha" => "2017" "volumen" => "8" "paginaInicial" => "229" "paginaFinal" => "242" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28480063" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0360" "etiqueta" => "[33]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Quantitative intrahepatic HBV cccDNA correlates with histological liver inflammation in chronic hepatitis B virus infection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L.B. Liang" 1 => "X. Zhu" 2 => "L.B. Yan" 3 => "L.Y. Du" 4 => "C. Liu" 5 => "J. Liao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ijid.2016.09.022" "Revista" => array:6 [ "tituloSerie" => "Int J Infect Dis" "fecha" => "2016" "volumen" => "52" "paginaInicial" => "77" "paginaFinal" => "82" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27686728" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0365" "etiqueta" => "[34]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B virus transcriptional activators: mechanisms and possible role in oncogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F.F. Henkler" 1 => "R. Koshy" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2893.1996.tb00001.x" "Revista" => array:6 [ "tituloSerie" => "J Viral Hepat" "fecha" => "1996" "volumen" => "3" "paginaInicial" => "109" "paginaFinal" => "121" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8871869" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0370" "etiqueta" => "[35]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Induction of the DNA-binding activity of c-jun/c-fos heterodimers by the hepatitis B virus transactivator pX" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Natoli" 1 => "M.L. Avantaggiati" 2 => "P. Chirllo" 3 => "A. Costanzo" 4 => "M. Artini" 5 => "C. Balsano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/mcb.14.2.989" "Revista" => array:6 [ "tituloSerie" => "Mol Cell Biol" "fecha" => "1994" "volumen" => "14" "paginaInicial" => "989" "paginaFinal" => "998" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7507209" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0375" "etiqueta" => "[36]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ras and Raf-dependent activation of c-jun transcriptional activity by the hepatitis B virus transactivator pX" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Natoli" 1 => "M.L. Avantaggiati" 2 => "P. Chirillo" 3 => "P.L. Puri" 4 => "A. Ianni" 5 => "C. Balsano" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "1994" "volumen" => "9" "paginaInicial" => "2837" "paginaFinal" => "2843" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8084589" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0380" "etiqueta" => "[37]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis B virus pre-S mutants, endoplasmic reticulum stress and hepatocarcinogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H.C. Wang" 1 => "W. Huang" 2 => "M.D. Lai" 3 => "I.J. Su" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1349-7006.2006.00235.x" "Revista" => array:6 [ "tituloSerie" => "Cancer Sci" "fecha" => "2006" "volumen" => "97" "paginaInicial" => "683" "paginaFinal" => "688" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16863502" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0385" "etiqueta" => "[38]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of HBV covalently closed circular DNA" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "X. Li" 1 => "J. Zhao" 2 => "Q. Yuan" 3 => "N. Xia" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Viruses" "fecha" => "2017" "volumen" => "9" "paginaInicial" => "139" ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0390" "etiqueta" => "[39]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Validation of a sensitive and specific real-time PCR for detection and quantitation of hepatitis B virus covalently closed circular DNA in plasma of chronic hepatitis B patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R.B. Takkenberg" 1 => "S. Menting" 2 => "M.G. Beld" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-61779-937-2_7" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol" "fecha" => "2012" "volumen" => "903" "paginaInicial" => "113" "paginaFinal" => "128" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22782814" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/0000001900000003/v4_202006250909/S1665268119322951/v4_202006250909/en/main.assets" "Apartado" => array:4 [ "identificador" => "78265" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/0000001900000003/v4_202006250909/S1665268119322951/v4_202006250909/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119322951?idApp=UINPBA00004N"]

Statistics

Original article

Ching-Yu Baoa, Hsu-Chin Hunga, Yi-Wen Chenb, Chiao-Yuan Fanb, Chien-Jung Huangc, Wenya Huanga,d,e,

Corresponding author

whuang@mail.ncku.edu.tw

Corresponding author at: Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, 1 University Road, Tainan 70101, Taiwan.

a Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan, Taiwan

b Cold Spring Biotech Corp, New Taipei City, Taiwan

c Department of Internal Medicine, Taipei City Hospital, Taipei, Taiwan

d Institute of Basic Medicine, National Cheng Kung University, Tainan, Taiwan

e Department of Pathology, National Cheng Kung University Hospital, Tainan, Taiwan

Read

2831

Times
was read the article

895

Total PDF

1936

Total HTML

Share statistics

 array:23 [
  "pii" => "S1665268119322951"
  "issn" => "16652681"
  "doi" => "10.1016/j.aohep.2019.12.005"
  "estado" => "S300"
  "fechaPublicacion" => "2020-05-01"
  "aid" => "173"
  "copyrightAnyo" => "2019"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Ann Hepatol. 2020;19:280-6"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 24
    "formatos" => array:3 [
      "EPUB" => 4
      "HTML" => 9
      "PDF" => 11
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1665268120300053"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2019.12.007"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "178"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2020;19:287-94"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 3
      "formatos" => array:2 [
        "EPUB" => 1
        "PDF" => 2
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "New model predicting gastroesophageal varices and variceal hemorrhage in patients with chronic liver disease"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "287"
          "paginaFinal" => "294"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Fig&#46; 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 3303
              "Ancho" => 2508
              "Tamanyo" => 353048
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">The predictive performance of the new algorithm for GOV&#46; &#40;A&#41; The model score was different between GOV positive group and GOV negative group in CHB training cohort&#46; &#40;B&#41; ROC curve of the model score for diagnosing GOV in CHB training cohort&#46; &#40;C&#41; The model score was different between GOV positive and GOV negative in CHB validation cohort&#46; &#40;D&#41; ROC curve of the model score for diagnosing GOV in CHB validation cohort&#46; &#40;E&#41; The model score was different between GOV positive and GOV negative in non-CHB validation cohort&#46; &#40;F&#41; The model score was different between GOV positive and GOV negative in non-CHB validation cohort&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Jia-li Ma, Ling-ling He, Yu Jiang, Jun-ru Yang, Ping Li, Yao Zang, Hong-shan Wei"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Jia-li"
              "apellidos" => "Ma"
            ]
            1 => array:2 [
              "nombre" => "Ling-ling"
              "apellidos" => "He"
            ]
            2 => array:2 [
              "nombre" => "Yu"
              "apellidos" => "Jiang"
            ]
            3 => array:2 [
              "nombre" => "Jun-ru"
              "apellidos" => "Yang"
            ]
            4 => array:2 [
              "nombre" => "Ping"
              "apellidos" => "Li"
            ]
            5 => array:2 [
              "nombre" => "Yao"
              "apellidos" => "Zang"
            ]
            6 => array:2 [
              "nombre" => "Hong-shan"
              "apellidos" => "Wei"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120300053?idApp=UINPBA00004N"
    "url" => "/16652681/0000001900000003/v4_202006250909/S1665268120300053/v4_202006250909/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1665268120300065"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2020.01.002"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "179"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2020;19:269-79"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Circ-PRMT5 enhances the proliferation&#44; migration and glycolysis of hepatoma cells by targeting miR-188-5p&#47;HK2 axis"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "269"
          "paginaFinal" => "279"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0030"
          "etiqueta" => "Fig&#46; 6"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr6.jpeg"
              "Alto" => 3026
              "Ancho" => 3175
              "Tamanyo" => 558033
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Repression of miR-188-5p abolished effects of HK2 silencing on proliferation&#44; migration and glycolysis of hepatocellular carcinoma cells&#46; &#40;A&#41; The knockdown efficiency of sh-HK2 in SNU-387 and HCCLM3 cells was checked by RT-qPCR assay&#46; &#40;B&#8211;F&#41; SNU-387 and HCCLM3 cells were transfected with sh-NC&#44; sh-HK2&#44; sh-HK2<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>anti-NC&#44; or sh-HK2<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>anti-miR-188-5p&#46; &#40;B&#41; MTT assay was performed for examining the cell viability of SNU-387 and HCCLM3 cells&#46; &#40;C&#41; Cell migration assay was conducted in transfected SNU-387 and HCCLM3 cells&#46; &#40;D-F&#41; Glucose consumption&#44; lactate production and ATP level of transfected SNU-387 and HCCLM3 cells were calculated&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Zhenghua Ding, Li Guo, Zhongming Deng, Peng Li"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Zhenghua"
              "apellidos" => "Ding"
            ]
            1 => array:2 [
              "nombre" => "Li"
              "apellidos" => "Guo"
            ]
            2 => array:2 [
              "nombre" => "Zhongming"
              "apellidos" => "Deng"
            ]
            3 => array:2 [
              "nombre" => "Peng"
              "apellidos" => "Li"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120300065?idApp=UINPBA00004N"
    "url" => "/16652681/0000001900000003/v4_202006250909/S1665268120300065/v4_202006250909/en/main.assets"
  ]
  "en" => array:18 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Requirement of cyclin-dependent kinase function for hepatitis B virus cccDNA synthesis as measured by digital PCR"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "280"
        "paginaFinal" => "286"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Ching-Yu Bao, Hsu-Chin Hung, Yi-Wen Chen, Chiao-Yuan Fan, Chien-Jung Huang, Wenya Huang"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Ching-Yu"
            "apellidos" => "Bao"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Hsu-Chin"
            "apellidos" => "Hung"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Yi-Wen"
            "apellidos" => "Chen"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Chiao-Yuan"
            "apellidos" => "Fan"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Chien-Jung"
            "apellidos" => "Huang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Wenya"
            "apellidos" => "Huang"
            "email" => array:1 [
              0 => "whuang@mail.ncku.edu.tw"
            ]
            "referencia" => array:4 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
              3 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:5 [
          0 => array:3 [
            "entidad" => "Department of Medical Laboratory Science and Biotechnology&#44; College of Medicine&#44; National Cheng Kung University&#44; Tainan&#44; Taiwan"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Cold Spring Biotech Corp&#44; New Taipei City&#44; Taiwan"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Internal Medicine&#44; Taipei City Hospital&#44; Taipei&#44; Taiwan"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Institute of Basic Medicine&#44; National Cheng Kung University&#44; Tainan&#44; Taiwan"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Department of Pathology&#44; National Cheng Kung University Hospital&#44; Tainan&#44; Taiwan"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author at&#58; Department of Medical Laboratory Science and Biotechnology&#44; College of Medicine&#44; National Cheng Kung University&#44; 1 University Road&#44; Tainan 70101&#44; Taiwan&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 3017
            "Ancho" => 3333
            "Tamanyo" => 360116
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Inhibition of intracellular cccDNA synthesis by CDK inhibitors&#46; &#40;A&#41; Virus protein production in HBV-producing HepAD38 cells&#46; Viral core and surface proteins were greatly induced with removal of doxycycline from the growth medium&#46; Left panel&#44; representative image of Western blotting for HBV surface &#40;HBs&#41; and core &#40;HBc&#41; proteins&#46; Right panel&#44; summary of the results of at least 3 independent experiments&#46; &#40;B&#41; MTT assays to detect the cell viabilities after UCN-01 treatments&#46; UCN-01 concentrations of 0&#46;5 and 1<span class="elsevierStyleHsp" style=""></span>&#956;M &#40;arrows&#41; were chosen for further studies of cccDNA&#46; &#40;C&#41; Inhibition of the cccDNA levels after treatments with UCN-01&#44; as measured by digital PCR and real-time PCR&#46; &#40;D&#8211;F&#41; The intracellular HBV pgRNA &#40;D&#41; and the core and surface proteins &#40;E&#41; and the HBeAg and viral DNA levels in the growth medium &#40;F&#41; after UCN-01 treatments were analyzed&#46; UCN-01 inhibited cccDNA synthesis as well as viral gene expression and virion production&#46; &#40;G&#41; Intracellular cccDNA levels after treatments with the PKC inhibitor Go 6983 &#40;50 and 100<span class="elsevierStyleHsp" style=""></span>nM&#41; and the CDK inhibitor AZD-5438 &#40;500 and 750<span class="elsevierStyleHsp" style=""></span>nM&#41;&#46; AZD-5438 dramatically blocked cccDNA synthesis&#44; whereas Go 6983 did not show a significant effect on cccDNA&#46; &#42;&#44; &#42;&#42;&#44; and &#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span> value<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#60;0&#46;01&#44; and &#60;0&#46;001&#44; respectively&#46; ns&#58; not significant&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1</span><span class="elsevierStyleSectionTitle" id="sect0035">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Chronic hepatitis B &#40;CHB&#41; virus infection is the most important cause of hepatocellular carcinoma &#40;HCC&#41; worldwide <a class="elsevierStyleCrossRefs" href="#bib0200">&#91;1&#44;2&#93;</a>&#46; Currently&#44; more than 2 billion people have been infected with HBV&#44; and 350 million among them suffer from CHB&#44; which often results in cirrhosis and HCC&#44; diseases that are among the top leading causes of death worldwide <a class="elsevierStyleCrossRefs" href="#bib0210">&#91;3&#8211;7&#93;</a>&#46; In some countries&#44; HBV vaccination for newborns has been launched to reduce infection rates <a class="elsevierStyleCrossRef" href="#bib0235">&#91;8&#93;</a>&#46; Additionally&#44; antiviral therapies using nucleotide&#47;nucleoside analogs have achieved effective &#8220;functional&#8221; cure of the virus infection&#46; Despite this valuable progress in vaccines and treatments&#44; so far there are still no reliable strategies for &#8220;complete&#8221; or &#8220;virological&#8221; cure due to the difficulty of eradicating the HBV residual replication intermediate covalently closed circular &#40;ccc&#41; DNA in hepatocytes <a class="elsevierStyleCrossRef" href="#bib0240">&#91;9&#93;</a>&#46; Therefore&#44; developing high-risk biomarkers for viral reactivation after nucleotide&#47;nucleoside &#40;NA&#41; therapies in CHB patients is a very important issue&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">HBV enters the cell by binding to the sodium taurocholate cotransporting polypeptide &#40;NTCP&#41; receptor on the surface of hepatocytes <a class="elsevierStyleCrossRefs" href="#bib0245">&#91;10&#44;11&#93;</a>&#46; After entry&#44; the viral nucleocapsid is released into the cytoplasm and then translocated into the nucleus <a class="elsevierStyleCrossRef" href="#bib0245">&#91;10&#93;</a>&#46; Within the nucleus&#44; relaxed circular &#40;rc&#41; DNA is converted into cccDNA&#44; which then serves as a template for transcription <a class="elsevierStyleCrossRef" href="#bib0255">&#91;12&#93;</a>&#46; The cccDNA functions as the template for transcription of the four viral RNAs &#40;0&#46;7&#44; 2&#46;1&#44; 2&#46;4&#44; and 3&#46;5<span class="elsevierStyleHsp" style=""></span>kb&#41;&#44; which are exported to the cytoplasm and used as mRNAs for translation of the HBV proteins&#46; The longest &#40;i&#46;e&#46;&#44; pregenomic&#44; pg&#41; RNA functions as the template for replication mediated by the viral polymerase&#44; which executes the action of reverse transcription&#46; Among all the steps in the HBV life cycle&#44; reverse transcription is currently the main target for antiviral therapies&#46; Nucleotide&#47;nucleoside analogs&#44; such as adefovir and entecavir&#44; which block the process of viral reverse transcription&#44; have been widely used as treatments for CHB patients&#46; The drugs in this category are generally well tolerated&#44; and potent drugs&#44; such as entecavir and tenofovir&#44; can often reduce viremia to below the detection limits of standard viral DNA measurement methods&#46; However&#44; viral reactivation after therapy discontinuation often occurs &#40;&#8764;60&#37; within 2 years post treatment cessation&#41;&#44; suggesting that lifelong treatment is necessary <a class="elsevierStyleCrossRef" href="#bib0260">&#91;13&#93;</a>&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">Because nucleotide&#47;nucleoside drugs inhibit viral replication in the relative &#8220;late&#8221; phase of the viral life cycle and do not block the replication products generated in earlier phases&#44; recent efforts to develop new strategies in HBV therapy target various critical steps involving in HBV replication and propagation&#44; including viral entry&#44; encapsidation&#44; gene expression&#44; and virion assembly&#46; These novel antiviral drugs provide unprecedented opportunities to destroy HBV cccDNA and other replication intermediates and completely eradicate the virus&#44; but the main challenge yet unresolved is the reliable quantification of cccDNA in the liver in the course of drug treatments <a class="elsevierStyleCrossRef" href="#bib0265">&#91;14&#93;</a>&#46; Monitoring the ability of these treatments to reduce the cccDNA level&#44; which is the key replication reservoir&#44; is an essential task to demonstrate their potential to reach virological cure&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">The molecular mechanism of HBV cccDNA synthesis remains obscure despite of recent identification of the HBV receptor&#44; NTCP&#44; which has made <span class="elsevierStyleItalic">de novo</span> infection experiments in cultured hepatocytes much more applicable <a class="elsevierStyleCrossRef" href="#bib0270">&#91;15&#93;</a>&#46; rcDNA&#44; which is reverse transcribed from pgRNA&#44; contains the phosphotyrosyl-bonded polymerase &#40;P&#41; protein and a single-stranded flap&#44; which is believed to be removed by host endonucleases&#46; Conversion of partially double-stranded and nick-containing rcDNA to fully double-stranded cccDNA predictably requires the actions of a DNA polymerase&#44; a kinase&#44; endonucleases&#44; a ligase&#44; a topoisomerase&#44; and DNA repair factors&#46; Additionally&#44; it was reported that the phosphotyrosyl-linked P protein can be resolved by specific tyrosyl-DNA-phosphodiesterases &#40;TDPs&#41;&#46; However&#44; many important players involved in the process of cccDNA synthesis remain to be characterized <a class="elsevierStyleCrossRef" href="#bib0275">&#91;16&#93;</a>&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">Some recent studies have reported the potential role of the host cell cycle machinery in HBV replication and propagation&#46; The cyclin E2-cyclin-dependent kinase &#40;CDK&#41; 2 complex has been reported to be involved in regulating viral replication through mediating phosphorylation of the SAM domain- and HD domain-containing protein 1 &#40;SAMHD1&#41; <a class="elsevierStyleCrossRef" href="#bib0280">&#91;17&#93;</a>&#46; Additionally&#44; HBx&#44; a protein important for HBV cccDNA synthesis and carcinogenic processes&#44; has been found to activate protein kinase C &#40;PKC&#41;&#44; a family of protein kinases that are involved in controlling the function of some CDK proteins through phosphorylating serine and threonine amino acid residues on these proteins&#44; leading to cell cycle progression <a class="elsevierStyleCrossRef" href="#bib0285">&#91;18&#93;</a>&#46; PKC has also been shown to facilitate pgRNA encapsidation and virion production <a class="elsevierStyleCrossRef" href="#bib0290">&#91;19&#93;</a>&#46; In light of these previous findings&#44; we hypothesized that manipulation of the host cell cycle progression pathway represents a good candidate to control cccDNA synthesis&#46;</p><p id="par0030" class="elsevierStylePara elsevierViewall">As the main viral replication reservoir&#44; HBV cccDNA plays a key role in HBV persistence <a class="elsevierStyleCrossRef" href="#bib0275">&#91;16&#93;</a>&#46; Therefore&#44; cccDNA is believed to be an important predictive biomarker for the risk of adverse CHB outcomes&#46; However&#44; reliable detection of cccDNA with high sensitivity and specificity has been challenging because the cccDNA level is very low in the cell &#40;2&#8211;30<span class="elsevierStyleHsp" style=""></span>copies&#47;cell&#41;&#44; and it co-exists with a large excess amount of rcDNA <a class="elsevierStyleCrossRef" href="#bib0295">&#91;20&#93;</a>&#46; The recent revolutionary digital PCR technology provides quantification of target nucleic acids with high sensitivity and specificity&#46; We therefore hypothesized that digital PCR is a promising approach for cccDNA detection in antiviral drug development <a class="elsevierStyleCrossRef" href="#bib0300">&#91;21&#93;</a>&#46; In this study&#44; we established a convenient and cost-effective platform for the sensitive detection of cccDNA and explored the host molecular pathways controlling cccDNA synthesis&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2</span><span class="elsevierStyleSectionTitle" id="sect0040">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;1</span><span class="elsevierStyleSectionTitle" id="sect0045">Cell line</span><p id="par0035" class="elsevierStylePara elsevierViewall">HepAD38 cells&#44; which contain the HBV genome under the <span class="elsevierStyleItalic">tet-off</span> transcription control&#44; were used to examine the intracellular amplification of the virus genome and propagation <a class="elsevierStyleCrossRef" href="#bib0305">&#91;22&#93;</a>&#46; The cells were maintained at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in Dulbecco&#39;s modified Eagle&#39;s medium supplemented with 10&#37; fetal bovine serum &#40;FBS&#41;&#44; 200<span class="elsevierStyleHsp" style=""></span>mM L-glutamine &#40;Gibco&#44; Life Technologies&#44; Carlsbad&#44; CA&#44; USA&#41;&#44; 10<span class="elsevierStyleHsp" style=""></span>U&#47;&#956;l penicillin-streptomycin &#40;Lonza&#44; Basel&#44; Switzerland&#41;&#44; and 400<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml G418 &#40;MDBio&#41; with 5&#37; carbon dioxide&#46; The cells were also maintained in medium supplemented with 0&#46;3<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml doxycycline to keep viral gene transcription shut off until the time for viral gene expression&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;2</span><span class="elsevierStyleSectionTitle" id="sect0050">Propagation of HBV</span><p id="par0040" class="elsevierStylePara elsevierViewall">To induce viral gene expression and propagation&#44; HepAD38 cells were grown in doxycycline-free medium&#46; Virions were harvested every 5 days from the growth medium of the cultured cells and then filtered through a 0&#46;45-&#956;m filter&#46; Viruses in the filtrate were concentrated using 10&#37; polyethylene glycol &#40;PEG&#41; 8000 with gentle rotation at 4<span class="elsevierStyleHsp" style=""></span>&#176;C overnight&#44; followed by centrifugation at 7000<span class="elsevierStyleHsp" style=""></span>g for 0&#46;5<span class="elsevierStyleHsp" style=""></span>h&#46; The supernatant was discarded&#44; and the precipitated viruses were re-suspended in 2<span class="elsevierStyleHsp" style=""></span>ml of serum-free DMEM&#47;F-12 medium and then stored at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The harvested viral DNA was quantified by real-time PCR &#40;Roche&#41;&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;3</span><span class="elsevierStyleSectionTitle" id="sect0055">HBV DNA extraction</span><p id="par0045" class="elsevierStylePara elsevierViewall">HBV DNA was extracted from HepAD38 cells that were grown in medium containing no doxycycline to propagate HBV&#46; After harvest&#44; the cells were treated with 0&#46;05<span class="elsevierStyleHsp" style=""></span>g&#47;L RNase A at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>min&#44; followed by cell lysis buffer &#40;0&#46;1&#37; SDS&#44; 150<span class="elsevierStyleHsp" style=""></span>mM NaCl&#44; 20<span class="elsevierStyleHsp" style=""></span>mM EDTA&#44; 20<span class="elsevierStyleHsp" style=""></span>mM Tris-HCl &#91;pH 7&#46;5&#93;&#44; and 0&#46;8<span class="elsevierStyleHsp" style=""></span>g&#47;L proteinase K&#41; at 55<span class="elsevierStyleHsp" style=""></span>&#176;C overnight&#46; DNA in the cell lysate was then extracted with equal volumes of phenol and chloroform twice and chloroform once&#46; DNA in the aqueous phase was mixed with 2 volumes of isopropanol and then centrifuged for precipitation&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;4</span><span class="elsevierStyleSectionTitle" id="sect0060">HBV cccDNA extraction</span><p id="par0050" class="elsevierStylePara elsevierViewall">HBV cccDNA was isolated from HepAD38 cells that were grown in medium containing no doxycycline&#46; The cells were lysed with the modified Hirt solution &#40;1&#37; SDS&#44; 50<span class="elsevierStyleHsp" style=""></span>mM Tris&#8211;HCl &#91;pH 8&#46;0&#93;&#41;&#44; 10<span class="elsevierStyleHsp" style=""></span>mM EDTA &#91;pH 8&#46;0&#93;&#44; and 150<span class="elsevierStyleHsp" style=""></span>mM NaCl&#41; <a class="elsevierStyleCrossRef" href="#bib0310">&#91;23&#93;</a>&#46; After 30<span class="elsevierStyleHsp" style=""></span>min of incubation at room temperature&#44; 1&#47;5 volume of 5<span class="elsevierStyleHsp" style=""></span>M NaCl was added to the cell lysate and incubated at 4<span class="elsevierStyleHsp" style=""></span>&#176;C overnight&#46; After centrifugation&#44; the supernatant was supplemented with proteinase K &#40;50<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41; and incubated at 37<span class="elsevierStyleHsp" style=""></span>&#176;C to digest protein for 2<span class="elsevierStyleHsp" style=""></span>h&#46; cccDNA was purified by phenol and chloroform extraction and ethanol precipitation&#46; After centrifugation&#44; the pellet was allowed to air dry and was dissolved in ddH<span class="elsevierStyleInf">2</span>O&#46; The purified cccDNA was treated with T5 and T7 exonucleases &#40;New England Biolab&#41; to digest contaminating rcDNA&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;5</span><span class="elsevierStyleSectionTitle" id="sect0065">HBV rcDNA extraction from cell culture medium</span><p id="par0055" class="elsevierStylePara elsevierViewall">HBV DNA in the cell culture medium was extracted using a QIAamp MinElute Virus Spin Kit &#40;Qiagen&#41;&#46; Briefly&#44; doxycycline &#40;-&#41; culture medium of virus-producing HepAD38 cells was incubated with proteinase K and Buffer AL&#44; which contained carrier RNA to facilitate extraction&#44; then incubated at 56<span class="elsevierStyleHsp" style=""></span>&#176;C for 15<span class="elsevierStyleHsp" style=""></span>min&#46; The treated DNA was mixed with ethanol&#44; incubated at room temperature for 5<span class="elsevierStyleHsp" style=""></span>min and then precipitated by centrifugation&#46; DNA was resuspended then loaded into a QIAamp MinElute column&#44; and washed with Buffer AW1 and AW2 by gravity&#46; DNA in the column was eluted with RNase-free ddH<span class="elsevierStyleInf">2</span>O&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;6</span><span class="elsevierStyleSectionTitle" id="sect0070">Cell survival assay</span><p id="par0060" class="elsevierStylePara elsevierViewall">HepAD38 cells were treated with various doses of the chemical UCN-01 &#40;Sigma-Aldrich&#41; or the solvent DMSO for 48<span class="elsevierStyleHsp" style=""></span>h&#46; The cell survival rates were detected by the &#40;3-&#40;4&#44;5-dimethylthiazol-2-yl&#41;-2&#44;5-diphenyltetrazolium bromide&#41; tetrazolium &#40;MTT&#41; assay&#46; Briefly&#44; the cells were incubated in serum-free DMEM containing 0&#46;5<span class="elsevierStyleHsp" style=""></span>mg&#47;ml MTT &#40;Sigma&#8211;Aldrich&#41; at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 3<span class="elsevierStyleHsp" style=""></span>h&#46; After the reaction&#44; the MTT solution was transferred to a 96-well ELISA plate&#44; and the absorbance was measured at 570<span class="elsevierStyleHsp" style=""></span>nm&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;7</span><span class="elsevierStyleSectionTitle" id="sect0075">HBV cccDNA quantitative PCR</span><p id="par0065" class="elsevierStylePara elsevierViewall">Virus-producing HepAD38 cells were treated with various concentrations of UCN-01 &#40;Sigma-Aldrich&#41;&#44; the PKC inhibitor Go 6983 &#40;Sigma-Aldrich&#41;&#44; or the CDK inhibitor AZD-5438 &#40;Sigma-Aldrich&#41; for 48<span class="elsevierStyleHsp" style=""></span>h before harvest&#46; The cccDNA extracted with the Hirt solution was treated with the T5 and T7 exonucleases to remove rcDNA&#46; One microgram of cccDNA was treated with 5<span class="elsevierStyleHsp" style=""></span>U each of the T5 and T7 exonucleases at 30<span class="elsevierStyleHsp" style=""></span>&#176;C for 90<span class="elsevierStyleHsp" style=""></span>min&#44; followed by incubation at 99<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min to stop the enzymatic reactions&#46; After digestion&#44; cccDNA quantitative PCR was performed following a previously described protocol <a class="elsevierStyleCrossRef" href="#bib0315">&#91;24&#93;</a>&#46; Briefly&#44; the cccDNA template was mixed with TaqMan Universal Master Mix II and TaqMan&#174; Probe &#40;Thermo&#41; for cccDNA detection and then subjected to the real-time PCR reactions&#46; The PCR program was 50<span class="elsevierStyleHsp" style=""></span>&#176;C for 2<span class="elsevierStyleHsp" style=""></span>min&#44; 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#44; and then 40 cycles of 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s and 60<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#46; The nucleotide positions and sequences of the PCR primers and the TaqMan&#174; probe were forward primer&#58; 5&#8242;-&#40;1562&#41; TTCTCATCTGCCGGACCG &#40;1579&#41;-3&#8242;&#44; reverse primer&#58; 5&#8242;-&#40;1883&#41; CACAGCTTGGAGGCTTGAAC &#40;1864&#41;-3&#8242;&#44; and probe&#58; 5&#8242;-FAM-&#40;1836&#41; CCTAATCATCTCTTGTTCAT &#40;1855&#41;-MGB-3&#8242;&#46; The cccDNA-specific PCR primers span the gap region &#40;1611&#8211;1838&#41; on rcDNA&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;8</span><span class="elsevierStyleSectionTitle" id="sect0080">HBV cccDNA digital PCR</span><p id="par0070" class="elsevierStylePara elsevierViewall">The cccDNA was quantified by digital PCR using the Clarity&#8482; Digital PCR System &#40;JN Medsys&#41; following the manufacturer&#39;s instructions&#46; The PCR primers and TaqMan&#174; Probe were the same as those used in the cccDNA quantitative PCR described in the previous section&#46; The cccDNA template was partitioned into a multi-well PCR chip&#44; where the PCR was divided into thousands or more of nanoliter sub-reactions such that each had at most a single copy of DNA&#46; The PCR program for digital PCR was 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min and then for 40 cycles of 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 50<span class="elsevierStyleHsp" style=""></span>s&#44; 55<span class="elsevierStyleHsp" style=""></span>&#176;C for 100<span class="elsevierStyleHsp" style=""></span>s and 70<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#46; After the PCR reactions&#44; the images of the PCR chip results were scanned and converted into scatterplots of signals of the HEX dye conjugated to the hybridization probe in the PCR&#44; and the cccDNA copies present in the sample were calculated&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;9</span><span class="elsevierStyleSectionTitle" id="sect0085">HBV pgRNA quantification by real-time RT-PCR</span><p id="par0075" class="elsevierStylePara elsevierViewall">RNA of the HepAD38 cells was extracted using REzol&#8482; C&#38;T buffer &#40;Protech&#41; and then reverse transcribed into cDNA&#44; following previously described protocols <a class="elsevierStyleCrossRef" href="#bib0320">&#91;25&#93;</a>&#46; HBV pgRNA was detected by quantitative RT-PCR&#46; Briefly&#44; the cDNA was mixed with Fast SYBR&#174; Green Master Mix &#40;Thermo&#41; and the pgRNA-specific PCR primers&#44; and the reaction was then amplified by real-time PCR &#40;Roche&#41;&#46; The sequences of the RT-PCR primers were forward&#58; 5&#8242;-TGTGGAGTTACTCTCGTTTTTGC-3&#8242; and reverse&#58; 5&#8242;-AAGGCTTCCCGATACAGAGC-3&#8242; <a class="elsevierStyleCrossRef" href="#bib0325">&#91;26&#93;</a>&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;10</span><span class="elsevierStyleSectionTitle" id="sect0090">Detection of HBV core and surface proteins by Western blotting</span><p id="par0080" class="elsevierStylePara elsevierViewall">HBV core and surface proteins were detected in the virus-producing HepAD38 cells by Western blotting&#44; following a previously described protocol <a class="elsevierStyleCrossRef" href="#bib0320">&#91;25&#93;</a>&#46; The antibodies used were an anti-HBsAg antibody &#40;7H11-HRP&#44; generously provided by Prof&#46; Jun Zhang&#44; Xiamen University&#44; China&#41; and an anti-HBcAg antibody &#40;Novocastra&#41;&#46;</p></span></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3</span><span class="elsevierStyleSectionTitle" id="sect0095">Results</span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;1</span><span class="elsevierStyleSectionTitle" id="sect0100">Development of HBV cccDNA analysis by digital PCR</span><p id="par0085" class="elsevierStylePara elsevierViewall">We aimed to establish a digital PCR method to precisely quantify HBV cccDNA&#46; The plasmid pHBV1&#46;3x-BclI&#44; which contains the whole HBV genome in double-stranded closed circular conformation&#44; was used as the positive control for cccDNA and first subjected to the analysis <a class="elsevierStyleCrossRef" href="#bib0330">&#91;27&#93;</a>&#46; The results showed that for the pHBV1&#46;3X-BclI plasmid at various concentrations&#44; the DNA copy numbers revealed in the digital PCR analysis were highly consistent with the input of the target HBV plasmid &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9993&#41; but not rcDNA&#44; showing a high specificity of cccDNA quantification by the Clarity<span class="elsevierStyleSup">TM</span> dPCR platform &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>B&#41;&#46; Based on multiple independent experimental results&#44; the limit of detection &#40;LOD&#41; and limit of quantitation &#40;LOQ&#41; were 1&#46;05<span class="elsevierStyleHsp" style=""></span>copy&#47;&#956;l&#44; and the limit of linearity &#40;LOL&#41; was 1&#46;02<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">4</span><span class="elsevierStyleHsp" style=""></span>copies&#47;&#956;l&#44; indicating that the linear range of detection was 1&#46;05 to 1&#46;02<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">4</span><span class="elsevierStyleHsp" style=""></span>copies&#47;&#956;l&#44; reaching a dynamic detection range of 10<span class="elsevierStyleSup">4</span>-fold &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0090" class="elsevierStylePara elsevierViewall">HBV rcDNA&#44; which co-exists with cccDNA in the cell&#44; often interferes with cccDNA detection&#46; To examine the specific detection of cccDNA in the presence of excess rcDNA&#44; we used rcDNA as the matrix for cccDNA detection&#46; The two types of DNA molecules were mixed in various molecular ratios and then subjected to cccDNA digital PCR with the Clarity&#8482; platform&#46; HBV rcDNA was isolated from virions in the growth medium of cultured HBV-producing HepAD38 cells&#46; Samples in the cccDNA to rcDNA ratios of 1&#8211;1&#44; 1&#8211;9&#44; and 1&#8211;49 were prepared then measured by digital PCR&#46; The analysis results revealed accurate copy numbers regardless of excess rcDNA in the reaction &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9913&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>C&#41;&#46; This finding indicated that the digital PCR method to quantify cccDNA is suitable for specific examination of cccDNA in clinical serum and liver specimens&#44; in which rcDNA is in great excess&#46; In addition&#44; intrahepatic cccDNA was extracted from HepAD38 cells&#44; where the whole HBV genome was integrated into the chromosome&#44; and the virus genes were transcribed under control of the <span class="elsevierStyleItalic">tet-off</span> inducible promoter&#46; The results of digital PCR analysis showed that the cccDNA copy numbers corresponded highly to the input amounts &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9931&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A&#41;&#46; The cccDNA levels measured by digital PCR were highly correlated with those measured by real-time quantitative PCR &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9947&#41;&#44; indicating that the digital PCR method was compatible with quantitative PCR but had higher sensitivity and was readily applicable to cccDNA analysis in clinical specimens &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;2</span><span class="elsevierStyleSectionTitle" id="sect0105">Blockage of intracellular cccDNA synthesis by CDK inhibitors</span><p id="par0095" class="elsevierStylePara elsevierViewall">Recent studies have suggested that the host cell cycle machinery controls HBV replication <a class="elsevierStyleCrossRef" href="#bib0335">&#91;28&#93;</a>&#46; Therefore&#44; we examined whether HBV cccDNA synthesis is modulated by cell cycle progression&#46; Virus-producing HepAD38 cells were first treated with UCN-01&#44; an inhibitor with a broad-spectrum activity for PKC &#38; CDK proteins&#44; and then the intracellular cccDNA was purified and quantified by digital PCR &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#41;&#46; The results showed that treatments with UCN-01 greatly decreased cccDNA levels even in the concentrations &#40;0&#46;5 and 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; where the cell viabilities were not greatly compromised&#44; as analyzed by MTT assays &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>B and C&#41;&#44; excluding the possibility that UCN-01-induced cccDNA blockage is caused by global DNA degradation attributed to cell apoptosis&#46; Consistently with cccDNA blockage&#44; the intracellular viral pgRNA and HBV core and surface proteins and the HBeAg and viral DNA in virions secreted in the cell growth medium also decreased after treatment with UCN-01 &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>D&#8211;F&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0100" class="elsevierStylePara elsevierViewall">The main groups of molecules whose kinase activities are inhibited by UCN-01 are PKC and CDK factors&#44; suggesting that PKC and CDK are potentially important players in cccDNA synthesis <a class="elsevierStyleCrossRef" href="#bib0340">&#91;29&#93;</a>&#46; To test this hypothesis&#44; virus-producing HepAD38 cells were treated with &#40;1&#41; Go 6938&#44; an inhibitor for a wide spectrum of PKCs&#44; including PKC&#945;&#44; PKC&#946;&#44; PKC&#947;&#44; PKC&#948;&#44; and PKC&#950;&#44; that have been shown to involve in cell growth and differentiation <a class="elsevierStyleCrossRef" href="#bib0345">&#91;30&#93;</a>&#59; and &#40;2&#41; AZD-5438&#44; a potent inhibitor of CDK1&#44; CDK2&#44; and CDK9&#44; which exhibited antiproliferative activity in human tumor cell lines <a class="elsevierStyleCrossRef" href="#bib0350">&#91;31&#93;</a>&#46; The cccDNA levels in the cells treated with these drugs were measured by quantitative PCR&#46; While the PKC inhibitor Go 6938 did not show a significant inhibitory effect on cccDNA synthesis&#44; the CDK inhibitor AZD-5438 dramatically decreased cccDNA levels in a dose-dependent manner &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>G&#41;&#46; These findings clearly demonstrated that CDK activity is required for HBV cccDNA synthesis&#46;</p></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">4</span><span class="elsevierStyleSectionTitle" id="sect0110">Discussion</span><p id="par0105" class="elsevierStylePara elsevierViewall">Chronic HBV infection is the major etiological factor of HCC&#46; Viral replication activity has been documented to stimulate carcinogenic pathways in the liver <a class="elsevierStyleCrossRef" href="#bib0355">&#91;32&#93;</a>&#46; As the main viral replication reservoir&#44; HBV cccDNA plays a key role in HBV persistence <a class="elsevierStyleCrossRef" href="#bib0275">&#91;16&#93;</a>&#46; Understanding the molecular mechanism of cccDNA synthesis is a very important task for paving the way to develop new-generation antivirals complementing NA drugs&#44; which are highly effective but present with high rates of relapse after treatment discontinuation&#46; The molecular mechanism of cccDNA synthesis remains obscure because reliable detection of cccDNA with high sensitivity and specificity has been challenging <a class="elsevierStyleCrossRef" href="#bib0295">&#91;20&#93;</a>&#46; Here&#44; by utilizing the new approach of digital PCR&#44; we developed a quick and cost-effective method for precise quantification of cccDNA&#46; With this technique&#44; studies of the stepwise molecular mechanisms regulating cccDNA synthesis can be greatly improved in the near future&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">HBV cccDNA is hypothesized to be an important predictive biomarker for the risk of adverse CHB outcomes&#46; HBV cccDNA in the liver has also been shown to be highly correlated with serum ALT levels and liver inflammation&#44; which ultimately leads to fibrosis&#44; cirrhosis&#44; and HCC <a class="elsevierStyleCrossRef" href="#bib0360">&#91;33&#93;</a>&#46; cccDNA in hepatocytes also promotes the production of the viral oncoproteins HBx and LHBs&#44; triggering oncogenic processes <a class="elsevierStyleCrossRefs" href="#bib0365">&#91;34&#8211;37&#93;</a>&#46; The traditional gold standard method for cccDNA detection is Southern blotting&#44; which separates rcDNA and cccDNA by electrophoresis based on the different conformations of the two molecules and allows cccDNA visualization <a class="elsevierStyleCrossRef" href="#bib0385">&#91;38&#93;</a>&#46; However&#44; the experimental procedures for Southern blotting are time consuming and tedious and require a large amount of specimen&#44; which make it impossible for clinical practice&#46; Later&#44; development of a gene amplification approach using cccDNA-specific PCR primers and probes combined with exonucleases specifically cleaving rcDNA&#44; which contains some single-stranded regions&#44; has greatly improved the sensitivity and specificity of cccDNA detection <a class="elsevierStyleCrossRef" href="#bib0390">&#91;39&#93;</a>&#46; Furthermore&#44; the recent revolutionary digital PCR technology provides absolute quantification of target nucleic acids without the need for an external calibrator and is therefore a robust approach for cccDNA detection <a class="elsevierStyleCrossRef" href="#bib0300">&#91;21&#93;</a>&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">Hepatitis B virus has been reported to dysregulate the cell cycle to promote viral replication and a premalignant phenotype <a class="elsevierStyleCrossRef" href="#bib0335">&#91;28&#93;</a>&#46; In this study&#44; we found that the broad spectrum PKC and CDK inhibitor UCN-01 dramatically decreased cccDNA synthesis&#46; Further investigation also identified that CDK but not PKC was required for cccDNA synthesis&#46; A previous study found that HBV-infected primary human hepatocytes &#40;PHHs&#41; were enriched in the G2&#47;M phase&#44; rather than G0&#47;G1 phase&#44; where cultured PHHs predominantly reside in&#44; indicating that host cell cycle progression is likely interrupted by HBV infection <a class="elsevierStyleCrossRef" href="#bib0335">&#91;28&#93;</a>&#46; cccDNA&#44; the template of HBV transcription&#44; plays a key role in the viral life cycle and permits infection persistence&#46; Nuclear cccDNA accumulates in the hepatocyte nucleus as a stable minichromosome organized by histones and other chromosome-modulating cellular proteins <a class="elsevierStyleCrossRef" href="#bib0255">&#91;12&#93;</a>&#46; These proteins are differentially expressed in various cell cycle phases&#44; indicating that cell cycle machinery is functionally linked with cccDNA synthesis&#46; Our data indicated that the CDK1&#44; 2 and 9 inhibitor AZD-5438&#44; an effective anticancer drug for solid malignancies&#44; greatly diminished cccDNA synthesis in hepatocytes stably propagating virions&#46; The stepwise molecular mechanism for how host cell cycle control participates in cccDNA synthesis remains to be deciphered&#59; thus&#44; the current finding has suggested that disrupting host cell cycle progression is a promising strategy to eradicate the HBV cccDNA pool in hepatocytes&#44; leading to a virological cure&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">In conclusion&#44; this study developed a high-sensitivity and high-specificity method to precisely quantify HBV cccDNA in hepatocytes stably propagating viruses&#46; The new digital PCR approach allows detection of cccDNA with a 1000-fold lower limit of detection than quantitative PCR&#46; We also identified that host CDK activities are required for cccDNA synthesis&#46; Future applications of digital PCR in clinical specimens in HBV carriers can be applied to drug screening for effective cccDNA inhibitors&#46;<span class="elsevierStyleDefList"><span class="elsevierStyleSectionTitle" id="sect0115">Abbreviations</span><span class="elsevierStyleDefTerm">CCC</span><span class="elsevierStyleDefDescription"><p id="par0125" class="elsevierStylePara elsevierViewall">covalently closed circular</p></span><span class="elsevierStyleDefTerm">CDK</span><span class="elsevierStyleDefDescription"><p id="par0130" class="elsevierStylePara elsevierViewall">cyclin dependent kinase</p></span><span class="elsevierStyleDefTerm">CHB</span><span class="elsevierStyleDefDescription"><p id="par0135" class="elsevierStylePara elsevierViewall">chronic hepatitis B</p></span><span class="elsevierStyleDefTerm">dPCR</span><span class="elsevierStyleDefDescription"><p id="par0140" class="elsevierStylePara elsevierViewall">digital PCR</p></span><span class="elsevierStyleDefTerm">HCC</span><span class="elsevierStyleDefDescription"><p id="par0145" class="elsevierStylePara elsevierViewall">hepatocellular carcinoma</p></span><span class="elsevierStyleDefTerm">LOD</span><span class="elsevierStyleDefDescription"><p id="par0150" class="elsevierStylePara elsevierViewall">limit of detection</p></span><span class="elsevierStyleDefTerm">LOQ</span><span class="elsevierStyleDefDescription"><p id="par0155" class="elsevierStylePara elsevierViewall">limit of quantitation</p></span><span class="elsevierStyleDefTerm">LOL</span><span class="elsevierStyleDefDescription"><p id="par0160" class="elsevierStylePara elsevierViewall">limit of linearity</p></span><span class="elsevierStyleDefTerm">MTT</span><span class="elsevierStyleDefDescription"><p id="par0165" class="elsevierStylePara elsevierViewall">&#40;3-&#40;4&#44;5-dimethylthiazol-2-yl&#41;-2&#44;5-diphenyltetrazolium bromide&#41; tetrazolium</p></span><span class="elsevierStyleDefTerm">NA</span><span class="elsevierStyleDefDescription"><p id="par0170" class="elsevierStylePara elsevierViewall">nucleotide&#47;nucleoside analogs</p></span><span class="elsevierStyleDefTerm">NTCP</span><span class="elsevierStyleDefDescription"><p id="par0175" class="elsevierStylePara elsevierViewall">sodium taurocholate cotransporting polypeptide</p></span><span class="elsevierStyleDefTerm">PEG</span><span class="elsevierStyleDefDescription"><p id="par0180" class="elsevierStylePara elsevierViewall">polyethylene glycol</p></span><span class="elsevierStyleDefTerm">PHH</span><span class="elsevierStyleDefDescription"><p id="par0185" class="elsevierStylePara elsevierViewall">primary human hepatocyte</p></span><span class="elsevierStyleDefTerm">PKC</span><span class="elsevierStyleDefDescription"><p id="par0190" class="elsevierStylePara elsevierViewall">protein kinase C</p></span><span class="elsevierStyleDefTerm">rcDNA</span><span class="elsevierStyleDefDescription"><p id="par0195" class="elsevierStylePara elsevierViewall">relaxed circular DNA</p></span><span class="elsevierStyleDefTerm">RT-PCR</span><span class="elsevierStyleDefDescription"><p id="par0200" class="elsevierStylePara elsevierViewall">reverse transcription-polymerase chain reaction</p></span><span class="elsevierStyleDefTerm">SAMHD1</span><span class="elsevierStyleDefDescription"><p id="par0205" class="elsevierStylePara elsevierViewall">SAM domain and HD domain-containing protein 1</p></span><span class="elsevierStyleDefTerm">TDP</span><span class="elsevierStyleDefDescription"><p id="par0210" class="elsevierStylePara elsevierViewall">tyrosyl-DNA-phosphodiesterases</p></span></span></p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Authors&#8217; contributions</span><p id="par0215" class="elsevierStylePara elsevierViewall">CYB and CJH developed digital PCR and performed molecular and cellular experiments and drafted the manuscript&#59; YWC and CYF performed digital PCR experiments&#59; CJH performed statistical analyses of the experimental data&#59; and WH designed the study&#46; All authors read and approved the final manuscript&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Funding</span><p id="par0220" class="elsevierStylePara elsevierViewall">This study was supported by the <span class="elsevierStyleGrantSponsor" id="gs1">Taiwan Ministry of Science and Technology</span> &#40;grant nos&#46; <span class="elsevierStyleGrantNumber" refid="gs1">107-2622-B-006-003-CC2</span>&#44; <span class="elsevierStyleGrantNumber" refid="gs1">106-2320-B-006-048-MY3</span> and <span class="elsevierStyleGrantNumber" refid="gs1">107-2320-B-006-032-MY3</span> to WH&#41;&#44; the <span class="elsevierStyleGrantSponsor" id="gs2">Taiwan Ministry of Health and Welfare</span> &#40;grant no&#46; <span class="elsevierStyleGrantNumber" refid="gs2">MOHW108-TDU-B-211-113003</span> to WH&#41;&#44; and the <span class="elsevierStyleGrantSponsor" id="gs3">National Cheng Kung University Center of Infectious Disease and Signaling Research</span> &#40;grant no&#46; <span class="elsevierStyleGrantNumber" refid="gs3">D105-22004</span> to WH&#41;&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:3 [
          "identificador" => "xres1354753"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction and objectives"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Patients or materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1245687"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:10 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Cell line"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Propagation of HBV"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "HBV DNA extraction"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "HBV cccDNA extraction"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "HBV rcDNA extraction from cell culture medium"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Cell survival assay"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "HBV cccDNA quantitative PCR"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "HBV cccDNA digital PCR"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "HBV pgRNA quantification by real-time RT-PCR"
            ]
            9 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Detection of HBV core and surface proteins by Western blotting"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0065"
          "titulo" => "Results"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Development of HBV cccDNA analysis by digital PCR"
            ]
            1 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "Blockage of intracellular cccDNA synthesis by CDK inhibitors"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Authors&#8217; contributions"
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Funding"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2019-10-24"
    "fechaAceptado" => "2019-12-20"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1245687"
          "palabras" => array:5 [
            0 => "Hepatitis B virus"
            1 => "cccDNA"
            2 => "Digital PCR"
            3 => "Cyclin-dependent kinase"
            4 => "Protein kinase C"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction and objectives</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">HBV covalently closed circular &#40;ccc&#41; DNA is the key player in viral persistence and an important predictive biomarker for hepatitis relapse&#46; Precise quantification of intracellular cccDNA is challenging because cccDNA is present in very low levels in hepatocytes&#44; where it also co-exists with a large excess amount of relaxed circular &#40;rc&#41; DNA&#46; We aimed to develop a highly sensitive cccDNA detection method for cccDNA quantification by digital PCR &#40;dPCR&#41;&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Patients or materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">A standard plasmid containing the whole HBV genome in the closed circular conformation was employed to characterize the performance of dPCR&#46; rcDNA in the growth medium of HBV-producing HepAD38 cells was used as a matrix for cccDNA detection&#46; Intrahepatic cccDNA measurement by dPCR and qPCR was performed to determine the correlation of the analysis results for the two methods&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The limit of detection &#40;LOD&#41; of the cccDNA dPCR was 1&#46;05<span class="elsevierStyleHsp" style=""></span>copy&#47;&#956;l&#44; and the linear range of detection was 1&#46;02<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">4</span><span class="elsevierStyleHsp" style=""></span>copies&#47;&#956;l&#44; achieving a dynamic detection range of 10<span class="elsevierStyleSup">4</span>-fold&#46; cccDNA measurement using excess rcDNA as the matrix did not reveal false-positive detection&#44; indicating that dPCR was highly specific&#46; In the HepAD38 cells&#44; the cccDNA levels measured by dPCR were highly correlated with those measured by qPCR but had a higher sensitivity&#46; The CDK inhibitor AZD-5438 was found to block intracellular cccDNA synthesis&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Dpcr greatly improved the sensitivity and specificity of cccDNA detection&#46; Host CDK activities are likely required for cccDNA synthesis&#46; dPCR can potentially be applied for drug screening for effective cccDNA inhibitors&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction and objectives"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Patients or materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusions"
          ]
        ]
      ]
    ]
    "multimedia" => array:3 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2081
            "Ancho" => 2508
            "Tamanyo" => 218144
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Development of digital PCR for HBV cccDNA quantification&#46; &#40;A&#41; LOD&#44; LOQ&#44; LOL&#44; and linearity range of cccDNA quantification using the HBV plasmid pHBV1&#46;3x-BclI as a standard&#46; Based on at least 3 independent experiments&#44; the LOD and LOQ for HBV cccDNA digital PCR were 1&#46;05<span class="elsevierStyleHsp" style=""></span>copy&#47;&#956;l&#44; and the LOL was 1&#46;02<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">4</span><span class="elsevierStyleHsp" style=""></span>copies&#47;&#956;l&#46; The linear range of detection was 1&#46;02<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">4</span><span class="elsevierStyleHsp" style=""></span>copies&#47;&#956;l&#46; &#40;B&#41; Quantification of cccDNA in the pHBV1&#46;3-BclI plasmid and rcDNA in virions in the growth medium of virus-producing HepAD38 cells&#46; For the pHBV1&#46;3X-BclI plasmid&#44; the cccDNA copy numbers measured by digital PCR were consistent with the input numbers &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9993&#41;&#46; However&#44; the rcDNA in the same amounts was not detected by cccDNA digital PCR&#44; indicating that digital PCR by the Clarity&#8482; dPCR platform was highly sensitive and specific for cccDNA detection&#46; &#40;C&#41; Quantification of cccDNA in reactions with various amounts of rcDNA&#46; The relative ratios of cccDNA to rcDNA were 1&#8211;1&#44; 1&#8211;9&#44; or 1&#8211;49 in the digital PCRs&#46; The dotted lines indicate the amounts of cccDNA template in the digital PCR reactions&#46; In various ratios of cccDNA to rcDNA&#44; the cccDNA copy numbers can be accurately quantified &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9913&#41;&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2213
            "Ancho" => 1441
            "Tamanyo" => 132372
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Detection of intracellular cccDNA in HepAD38 cells&#46; &#40;A&#41; Various amounts of HBV cccDNA extracted from HepAD38 cells were quantified by digital PCR&#46; The cccDNA copy numbers revealed by digital PCR were highly consistent with the input numbers &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9931&#41;&#46; &#40;B&#41; Correlation of the cccDNA levels measured by digital PCR and real-time PCR&#46; The results produced by the two methods were highly correlated &#40;<span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;9947&#41;&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 3017
            "Ancho" => 3333
            "Tamanyo" => 360116
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Inhibition of intracellular cccDNA synthesis by CDK inhibitors&#46; &#40;A&#41; Virus protein production in HBV-producing HepAD38 cells&#46; Viral core and surface proteins were greatly induced with removal of doxycycline from the growth medium&#46; Left panel&#44; representative image of Western blotting for HBV surface &#40;HBs&#41; and core &#40;HBc&#41; proteins&#46; Right panel&#44; summary of the results of at least 3 independent experiments&#46; &#40;B&#41; MTT assays to detect the cell viabilities after UCN-01 treatments&#46; UCN-01 concentrations of 0&#46;5 and 1<span class="elsevierStyleHsp" style=""></span>&#956;M &#40;arrows&#41; were chosen for further studies of cccDNA&#46; &#40;C&#41; Inhibition of the cccDNA levels after treatments with UCN-01&#44; as measured by digital PCR and real-time PCR&#46; &#40;D&#8211;F&#41; The intracellular HBV pgRNA &#40;D&#41; and the core and surface proteins &#40;E&#41; and the HBeAg and viral DNA levels in the growth medium &#40;F&#41; after UCN-01 treatments were analyzed&#46; UCN-01 inhibited cccDNA synthesis as well as viral gene expression and virion production&#46; &#40;G&#41; Intracellular cccDNA levels after treatments with the PKC inhibitor Go 6983 &#40;50 and 100<span class="elsevierStyleHsp" style=""></span>nM&#41; and the CDK inhibitor AZD-5438 &#40;500 and 750<span class="elsevierStyleHsp" style=""></span>nM&#41;&#46; AZD-5438 dramatically blocked cccDNA synthesis&#44; whereas Go 6983 did not show a significant effect on cccDNA&#46; &#42;&#44; &#42;&#42;&#44; and &#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span> value<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#60;0&#46;01&#44; and &#60;0&#46;001&#44; respectively&#46; ns&#58; not significant&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "&#91;1&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B&#58; The hunt for a killer virus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "B&#46;S&#46; Blumberg"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:2 [
                        "fecha" => "2001"
                        "editorial" => "Princeton University Press"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "&#91;2&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Estimates of the worldwide incidence of the 18 major cancers in 1985"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46;M&#46; Parkin"
                            1 => "P&#46; Pisani"
                            2 => "J&#46; Ferlay"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/ijc.2910540102"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Cancer"
                        "fecha" => "1993"
                        "volumen" => "54"
                        "paginaInicial" => "1"
                        "paginaFinal" => "13"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8478135"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "&#91;3&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B virus and hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "P&#46; Arbuthnot"
                            1 => "M&#46; Kew"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2613.2001.iep0082-0077-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Exp Pathol"
                        "fecha" => "2001"
                        "volumen" => "82"
                        "paginaInicial" => "77"
                        "paginaFinal" => "100"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11454100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "&#91;4&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular bases for the development of hepatitis B virus &#40;HBV&#41;-related hepatocellular carcinoma &#40;HCC&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Br&#233;chot"
                            1 => "D&#46; Gozuacik"
                            2 => "Y&#46; Murakami"
                            3 => "P&#46; Paterlini-Br&#233;chot"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Sem Cancer Biol"
                        "fecha" => "2000"
                        "volumen" => "10"
                        "paginaInicial" => "211"
                        "paginaFinal" => "231"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "&#91;5&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Global epidemiology of hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "F&#46; Bosch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:3 [
                        "editores" => "K&#46;Okuda, E&#46;Tabor"
                        "titulo" => "Liver Cancer"
                        "serieFecha" => "1997"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "&#91;6&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatocellular carcinoma and HBV&#46; A prospective study of 22&#44;707 men in Taiwan"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Beasley"
                            1 => "L&#46;Y&#46; Hwang"
                            2 => "C&#46;C&#46; Lin"
                            3 => "C&#46;S&#46; Chien"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0140-6736(87)91555-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "1981"
                        "volumen" => "2"
                        "paginaInicial" => "1129"
                        "paginaFinal" => "1133"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2890028"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "&#91;7&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prediction models of long-term cirrhosis and hepatocellular carcinoma risk in chronic hepatitis B patients&#58; risk scores integrating host and virus profiles"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;H&#46; Lee"
                            1 => "H&#46;I&#46; Yang"
                            2 => "J&#46; Liu"
                            3 => "R&#46; Batrla-Utermann"
                            4 => "C&#46;L&#46; Jen"
                            5 => "U&#46;H&#46; Iloeje"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/hep.26385"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hepatology"
                        "fecha" => "2013"
                        "volumen" => "58"
                        "paginaInicial" => "546"
                        "paginaFinal" => "554"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23504622"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "&#91;8&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nationwide hepatitis B vaccination program in Taiwan&#58; effectiveness in the 20 years after it was launched"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46;C&#46; Chien"
                            1 => "C&#46;F&#46; Jan"
                            2 => "H&#46;S&#46; Kuo"
                            3 => "C&#46;J&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/epirev/mxj010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Epidemiol Rev"
                        "fecha" => "2006"
                        "volumen" => "28"
                        "paginaInicial" => "126"
                        "paginaFinal" => "135"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16782778"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "&#91;9&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Virological basis for the cure of chronic hepatitis B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Hu"
                            1 => "J&#46; Cheng"
                            2 => "L&#46; Tang"
                            3 => "Z&#46; Hu"
                            4 => "Y&#46; Luo"
                            5 => "Y&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/acsinfecdis.8b00081"
                      "Revista" => array:6 [
                        "tituloSerie" => "ACS Infect Dis"
                        "fecha" => "2019"
                        "volumen" => "5"
                        "paginaInicial" => "659"
                        "paginaFinal" => "674"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29893548"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "&#91;10&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Early events in hepatitis B virus infection&#58; from the cell surface to the nucleus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:5 [
                            0 => "C&#46;N&#46; Hayes"
                            1 => "Y&#46; Zhang"
                            2 => "G&#46;N&#46; Makokha"
                            3 => "M&#46;Z&#46; Hasan"
                            4 => "M&#46;D&#46; Omokoko"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jgh.13175"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Gastroenterol Hepatol"
                        "fecha" => "2016"
                        "volumen" => "31"
                        "paginaInicial" => "302"
                        "paginaFinal" => "309"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26414381"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "&#91;11&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The hepatitis B virus receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "W&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1146/annurev-cellbio-100814-125241"
                      "Revista" => array:6 [
                        "tituloSerie" => "Annu Rev Cell Dev Biol"
                        "fecha" => "2015"
                        "volumen" => "31"
                        "paginaInicial" => "125"
                        "paginaFinal" => "147"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26436705"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "&#91;12&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nuclear HBv binds the HBV minichromosome and modifies the epigenetic regulation of cccDNA function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Belloni"
                            1 => "T&#46; Pollicino"
                            2 => "F&#46; De Nicola"
                            3 => "F&#46; Guerrieri"
                            4 => "G&#46; Raffa"
                            5 => "M&#46; Fanciulli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.0908365106"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2009"
                        "volumen" => "106"
                        "paginaInicial" => "19975"
                        "paginaFinal" => "19979"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19906987"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "&#91;13&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biomarker for HBV therapy discontinuation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "I&#46; Dickson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Nat Rev Gastro Hepat"
                        "fecha" => "2018"
                        "volumen" => "15"
                        "paginaInicial" => "132"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "&#91;14&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Treatment of hepatitis B&#58; a concise review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46; Rajbhandari"
                            1 => "R&#46;T&#46; Chung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ctg.2016.46"
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Transl Gastroenterol"
                        "fecha" => "2016"
                        "volumen" => "7"
                        "paginaInicial" => "e190"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27628420"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "&#91;15&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "NTCP-resconstituted in vitro HBV infection system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Sun"
                            1 => "Y&#46; Qi"
                            2 => "B&#46; Peng"
                            3 => "W&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-4939-6700-1_1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2017"
                        "volumen" => "1540"
                        "paginaInicial" => "1"
                        "paginaFinal" => "14"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27975303"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "&#91;16&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HBV cccDNA&#58; viral persistence reservoir and key obstacle for a cure of chronic hepatitis B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Nassal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/gutjnl-2015-309809"
                      "Revista" => array:7 [
                        "tituloSerie" => "Gut"
                        "fecha" => "2015"
                        "volumen" => "64"
                        "paginaInicial" => "1972"
                        "paginaFinal" => "1984"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26048673"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0022534711043369"
                          "estado" => "S300"
                          "issn" => "00225347"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "&#91;17&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cyclin E2-CDK2 mediates SAMHD1 phosphorylation to abrogate its restriction of HBV replication in hepatoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Hu"
                            1 => "M&#46; Qiao"
                            2 => "Y&#46; Chen"
                            3 => "H&#46; Tang"
                            4 => "W&#46; Zhang"
                            5 => "D&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/1873-3468.13105"
                      "Revista" => array:6 [
                        "tituloSerie" => "FEBS Lett"
                        "fecha" => "2018"
                        "volumen" => "592"
                        "paginaInicial" => "1893"
                        "paginaFinal" => "1904"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29782647"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "&#91;18&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The hepatitis B virus transactivator HBx causes elevation of diacylglycerol and activation of protein kinase C"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "B&#46; Luber"
                            1 => "U&#46; Lauer"
                            2 => "L&#46; Weiss"
                            3 => "M&#46; H&#246;hne"
                            4 => "P&#46;H&#46; Hofschneider"
                            5 => "A&#46;S&#46; Kekul&#233;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0923-2516(06)80047-6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Res Virol"
                        "fecha" => "1993"
                        "volumen" => "144"
                        "paginaInicial" => "311"
                        "paginaFinal" => "321"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8210715"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "&#91;19&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Phosphorylation of hepatitis B virus core C-terminally truncated protein &#40;Cp149&#41; by PKC increases capsid assembly and stability"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "H&#46; Kang"
                            1 => "J&#46; Yu"
                            2 => "G&#46; Jung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BJ20080724"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "2008"
                        "volumen" => "416"
                        "paginaInicial" => "47"
                        "paginaFinal" => "54"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18605987"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "&#91;20&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Single-cell analysis of covalently closed circular DNA copy numbers in a hepadnavirus-infected liver"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46;Y&#46; Zhang"
                            1 => "B&#46;H&#46; Zhang"
                            2 => "D&#46; Theele"
                            3 => "S&#46; Litwin"
                            4 => "E&#46; Toll"
                            5 => "J&#46; Summers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.2033898100"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2003"
                        "volumen" => "100"
                        "paginaInicial" => "12372"
                        "paginaFinal" => "12377"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14528003"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "&#91;21&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Digital polymerase chain reaction assay for the genetic variation in a sporadic familial adenomatous polyposis patient using the chip-in-a-tube format"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T&#46; Kahyo"
                            1 => "H&#46; Sugimura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "J Vis Exp"
                        "fecha" => "2018"
                        "volumen" => "138"
                        "paginaInicial" => "58199"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "&#91;22&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inducible expression of human hepatitis B virus &#40;HBV&#41; in stably transfected hepatoblastoma cells&#58; a novel system for screening potential inhibitors of HBV replication"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;K&#46; Ladner"
                            1 => "M&#46;J&#46; Otto"
                            2 => "C&#46;S&#46; Barker"
                            3 => "K&#46; Zaifert"
                            4 => "G&#46;H&#46; Wang"
                            5 => "J&#46;T&#46; Guo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1158/1535-7163.MCT-08-0836"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cancer Ther"
                        "fecha" => "2009"
                        "volumen" => "8"
                        "paginaInicial" => "1856"
                        "paginaFinal" => "1866"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19509270"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "&#91;23&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A southern blot assay for detection of hepatitis B virus covalently closed circular DNA from cell cultures"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "D&#46; Cai"
                            1 => "H&#46; Nie"
                            2 => "R&#46; Yan"
                            3 => "J&#46;T&#46; Guo"
                            4 => "T&#46;M&#46; Block"
                            5 => "H&#46; Guo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-62703-484-5_13"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2013"
                        "volumen" => "1030"
                        "paginaInicial" => "151"
                        "paginaFinal" => "161"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23821267"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "&#91;24&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effect of oxymatrine on the replication cycle of hepatitis B virus <span class="elsevierStyleItalic">in vitro</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46;S&#46; Xu"
                            1 => "K&#46;K&#46; Zhao"
                            2 => "X&#46;H&#46; Miao"
                            3 => "W&#46; Ni"
                            4 => "X&#46; Cai"
                            5 => "R&#46;Q&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v16.i16.2028"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2010"
                        "volumen" => "16"
                        "paginaInicial" => "2028"
                        "paginaFinal" => "2037"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20419842"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "&#91;25&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B virus pre-S<span class="elsevierStyleInf">2</span> mutant surface protein inhibits DNA double strand break repair and leads to genome instability in hepatitis B virus hepatocarcinogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;H&#46; Hsieh"
                            1 => "I&#46;J&#46; Su"
                            2 => "C&#46;J&#46; Yen"
                            3 => "Y&#46;R&#46; Liu"
                            4 => "R&#46;J&#46; Liu"
                            5 => "W&#46;C&#46; Hsieh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/path.4531"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Pathol"
                        "fecha" => "2015"
                        "volumen" => "236"
                        "paginaInicial" => "337"
                        "paginaFinal" => "347"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25775999"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "&#91;26&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantification of pregenomic RNA and covalently closed circular DNA in hepatitis B virus-related hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Bai"
                            1 => "Y&#46; Yano"
                            2 => "T&#46; Fukumoto"
                            3 => "A&#46; Takebe"
                            4 => "M&#46; Tanaka"
                            5 => "K&#46; Kuramitsu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Int J Hepat"
                        "fecha" => "2013"
                        "paginaInicial" => "849290"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "&#91;27&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular components of hepatitis B virus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Feitelson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:2 [
                        "fecha" => "1985"
                        "editorial" => "Nijhoff Publications"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "&#91;28&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B virus deregulates the cell cycle to promote viral replication and a premalignant phenotype"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46; Xia"
                            1 => "X&#46; Cheng"
                            2 => "Y&#46; Li"
                            3 => "K&#46; Valdez"
                            4 => "W&#46; Chen"
                            5 => "T&#46;J&#46; Liang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JVI.00722-18"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Virol"
                        "fecha" => "2018"
                        "volumen" => "92"
                        "paginaInicial" => "e00722"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30021897"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "&#91;29&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "UCN-01 &#40;7-hydroxystaurosporine&#41; inhibits the growth of human breast cancer xenografts through disruption of signal transduction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Koh"
                            1 => "T&#46; Kubota"
                            2 => "T&#46; Migita"
                            3 => "S&#46; Abe"
                            4 => "M&#46; Hashimoto"
                            5 => "Y&#46; Hosoda"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/BF02967547"
                      "Revista" => array:6 [
                        "tituloSerie" => "Breast Cancer"
                        "fecha" => "2002"
                        "volumen" => "9"
                        "paginaInicial" => "50"
                        "paginaFinal" => "54"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12196722"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "&#91;30&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Overexpressed PKC&#948; downregulates the expression of PKC&#945; in B16F10 melanoma&#58; induction of apoptosis by PKC&#948; via ceramide generation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "K&#46; Halder"
                            1 => "S&#46; Banerjee"
                            2 => "A&#46; Bose"
                            3 => "S&#46; Majumder"
                            4 => "S&#46; Majumdar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0091656"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS ONE"
                        "fecha" => "2014"
                        "volumen" => "9"
                        "paginaInicial" => "e91656"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24632809"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "&#91;31&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "AZD5438&#44; a potent oral inhibitor of cyclin-dependent kinases 1&#44; 2&#44; and 9&#44; leads to pharmacodynamic changes and potent antitumor effects in human tumor xenografts"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Byth"
                            1 => "A&#46; Thomas"
                            2 => "G&#46; Hughes"
                            3 => "C&#46; Forder"
                            4 => "A&#46; McGregor"
                            5 => "C&#46; Geh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Antimicrob Agents Chemother"
                        "fecha" => "1997"
                        "volumen" => "41"
                        "paginaInicial" => "1715"
                        "paginaFinal" => "1720"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9257747"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "&#91;32&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Viral hepatitis and hepatocellular carcinoma&#58; etiology and management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "P&#46;J&#46; Zamor"
                            1 => "A&#46;S&#46; deLemos"
                            2 => "M&#46;W&#46; Russo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.21037/jgo.2017.03.14"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Gastrointest Oncol"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "paginaInicial" => "229"
                        "paginaFinal" => "242"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28480063"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "&#91;33&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Quantitative intrahepatic HBV cccDNA correlates with histological liver inflammation in chronic hepatitis B virus infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;B&#46; Liang"
                            1 => "X&#46; Zhu"
                            2 => "L&#46;B&#46; Yan"
                            3 => "L&#46;Y&#46; Du"
                            4 => "C&#46; Liu"
                            5 => "J&#46; Liao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ijid.2016.09.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Infect Dis"
                        "fecha" => "2016"
                        "volumen" => "52"
                        "paginaInicial" => "77"
                        "paginaFinal" => "82"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27686728"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "&#91;34&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B virus transcriptional activators&#58; mechanisms and possible role in oncogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "F&#46;F&#46; Henkler"
                            1 => "R&#46; Koshy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2893.1996.tb00001.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Viral Hepat"
                        "fecha" => "1996"
                        "volumen" => "3"
                        "paginaInicial" => "109"
                        "paginaFinal" => "121"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8871869"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "&#91;35&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Induction of the DNA-binding activity of c-jun&#47;c-fos heterodimers by the hepatitis B virus transactivator pX"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Natoli"
                            1 => "M&#46;L&#46; Avantaggiati"
                            2 => "P&#46; Chirllo"
                            3 => "A&#46; Costanzo"
                            4 => "M&#46; Artini"
                            5 => "C&#46; Balsano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/mcb.14.2.989"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cell Biol"
                        "fecha" => "1994"
                        "volumen" => "14"
                        "paginaInicial" => "989"
                        "paginaFinal" => "998"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7507209"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "&#91;36&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ras and Raf-dependent activation of c-jun transcriptional activity by the hepatitis B virus transactivator pX"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Natoli"
                            1 => "M&#46;L&#46; Avantaggiati"
                            2 => "P&#46; Chirillo"
                            3 => "P&#46;L&#46; Puri"
                            4 => "A&#46; Ianni"
                            5 => "C&#46; Balsano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "1994"
                        "volumen" => "9"
                        "paginaInicial" => "2837"
                        "paginaFinal" => "2843"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8084589"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "&#91;37&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis B virus pre-S mutants&#44; endoplasmic reticulum stress and hepatocarcinogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H&#46;C&#46; Wang"
                            1 => "W&#46; Huang"
                            2 => "M&#46;D&#46; Lai"
                            3 => "I&#46;J&#46; Su"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1349-7006.2006.00235.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Sci"
                        "fecha" => "2006"
                        "volumen" => "97"
                        "paginaInicial" => "683"
                        "paginaFinal" => "688"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16863502"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "&#91;38&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of HBV covalently closed circular DNA"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46; Li"
                            1 => "J&#46; Zhao"
                            2 => "Q&#46; Yuan"
                            3 => "N&#46; Xia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Viruses"
                        "fecha" => "2017"
                        "volumen" => "9"
                        "paginaInicial" => "139"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "&#91;39&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Validation of a sensitive and specific real-time PCR for detection and quantitation of hepatitis B virus covalently closed circular DNA in plasma of chronic hepatitis B patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46;B&#46; Takkenberg"
                            1 => "S&#46; Menting"
                            2 => "M&#46;G&#46; Beld"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-61779-937-2_7"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2012"
                        "volumen" => "903"
                        "paginaInicial" => "113"
                        "paginaFinal" => "128"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22782814"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/16652681/0000001900000003/v4_202006250909/S1665268119322951/v4_202006250909/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "78265"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/16652681/0000001900000003/v4_202006250909/S1665268119322951/v4_202006250909/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119322951?idApp=UINPBA00004N"
]

Article information

ISSN: 16652681
Original language: English

DOI:10.1016/j.aohep.2019.12.005

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	1	1	2
2024 October	15	18	33
2024 September	42	12	54
2024 August	33	8	41
2024 July	25	8	33
2024 June	21	18	39
2024 May	27	17	44
2024 April	38	25	63
2024 March	40	21	61
2024 February	27	40	67
2024 January	18	6	24
2023 December	9	8	17
2023 November	19	5	24
2023 October	35	23	58
2023 September	14	2	16
2023 August	26	10	36
2023 July	32	5	37
2023 June	37	10	47
2023 May	53	7	60
2023 April	52	7	59
2023 March	31	5	36
2023 February	16	5	21
2023 January	35	5	40
2022 December	33	16	49
2022 November	29	9	38
2022 October	22	19	41
2022 September	28	15	43
2022 August	36	23	59
2022 July	23	15	38
2022 June	19	6	25
2022 May	27	12	39
2022 April	35	22	57
2022 March	25	28	53
2022 February	29	20	49
2022 January	67	29	96
2021 December	37	27	64
2021 November	38	31	69
2021 October	26	47	73
2021 September	36	31	67
2021 August	80	17	97
2021 July	25	13	38
2021 June	24	14	38
2021 May	30	8	38
2021 April	92	20	112
2021 March	40	22	62
2021 February	31	17	48
2021 January	58	17	75
2020 December	66	18	84
2020 November	53	15	68
2020 October	28	9	37
2020 September	44	14	58
2020 August	47	12	59
2020 July	28	8	36
2020 June	38	22	60
2020 May	52	21	73
2020 April	23	5	28
2020 March	10	8	18
2020 February	5	12	17
2020 January	6	7	13

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter