Alterations in chemokine receptor CCR5 activity influence tumor cell biology in human cholangiocarcinoma cell lines

array:24 ["pii" => "S1665268120301800" "issn" => "16652681" "doi" => "10.1016/j.aohep.2020.09.009" "estado" => "S300" "fechaPublicacion" => "2021-03-01" "aid" => "265" "copyright" => "AEDV" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2021;21C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1665268120301769" "issn" => "16652681" "doi" => "10.1016/j.aohep.2020.09.005" "estado" => "S300" "fechaPublicacion" => "2021-03-01" "aid" => "261" "copyright" => "AEDV" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2021;21C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "The histone variant H3.3 regulates the transcription of the hepatitis B virus" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1758 "Ancho" => 2925 "Tamanyo" => 337828 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "The histone variant H3.3 histone is necessary to regulate HBV transcription. (A) Scheme illustrating the shH3.3 experiment and detection of the HBV viral intermediates. (B) Levels of mRNA on samples derived from shControl or shH3.3 treated Huh7 cells measured by real-time PCR. The graph shows mRNA levels expressed relative to the shControl. Each expression level was normalized to that of GAPDH. The standard deviation was obtained from three independent experiments. (C) Cell cycle profile of Huh7 cells treated with shH3.3. The standard deviation was obtained from three independent experiments. (D) Covalent post-translational modifications on histone H3 were determined by ChIP analysis using the specific antibodies: H3 (left) and H3K4me3 (right). Immunoprecipitated DNA was quantified by qPCR using specific primers for core promoter. The results are expressed as fold changes of % Input with respect to the control. The standard deviation was obtained from three PCR reactions and the graphs are representative of two independent experiments. (E) The HBV replicative intermediates cytoplasmic viral core particles (cytDNA, right) and cccDNA (left) were determined 72 h post-transfection of the shH3.3 construct. The value obtained in shControl and in shH3.3 was divided by the shControl value, thus the results are expressed relative to the Control. The standard deviation was obtained from three independent experiments. (F) The quantity of the viral antigen HBsAg in the supernatant of the transfected cells was determined by ELISA, using specific antibodies. The result is shown as fold changes with respect to the control. The standard deviation was obtained from three independent experiments. *: p < 0.05, **: p < 0.01, Student’s t-test." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Francisca Alvarez-Astudillo, Daniel Garrido, Manuel Varas-Godoy, José Leonardo Gutiérrez, Rodrigo A. Villanueva, Alejandra Loyola" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Francisca" "apellidos" => "Alvarez-Astudillo" ] 1 => array:2 [ "nombre" => "Daniel" "apellidos" => "Garrido" ] 2 => array:2 [ "nombre" => "Manuel" "apellidos" => "Varas-Godoy" ] 3 => array:2 [ "nombre" => "José Leonardo" "apellidos" => "Gutiérrez" ] 4 => array:2 [ "nombre" => "Rodrigo A." "apellidos" => "Villanueva" ] 5 => array:2 [ "nombre" => "Alejandra" "apellidos" => "Loyola" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301769?idApp=UINPBA00004N" "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301769/v1_202102250957/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268120301782" "issn" => "16652681" "doi" => "10.1016/j.aohep.2020.09.007" "estado" => "S300" "fechaPublicacion" => "2021-03-01" "aid" => "263" "copyright" => "AEDV" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2021;21C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Temporal histopathological changes in biliary atresia: A perspective for rapid fibrosis progression" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:3 [ 0 => "en" 1 => "en" 2 => "en" ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 1 "multimedia" => array:5 [ "identificador" => "fig0015" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => false "mostrarDisplay" => true "figura" => array:1 [ 0 => array:4 [ "imagen" => "fx1.jpeg" "Alto" => 539 "Ancho" => 1333 "Tamanyo" => 127463 ] ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Hanaa A El-Araby, Magdy A Saber, Noha M Radwan, Doha M Taie, Nermin M Adawy, Ahmad M Sira" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Hanaa A" "apellidos" => "El-Araby" ] 1 => array:2 [ "nombre" => "Magdy A" "apellidos" => "Saber" ] 2 => array:2 [ "nombre" => "Noha M" "apellidos" => "Radwan" ] 3 => array:2 [ "nombre" => "Doha M" "apellidos" => "Taie" ] 4 => array:2 [ "nombre" => "Nermin M" "apellidos" => "Adawy" ] 5 => array:2 [ "nombre" => "Ahmad M" "apellidos" => "Sira" ] ] ] ] "resumen" => array:2 [ 0 => array:3 [ "titulo" => "Graphical abstract" "clase" => "graphical" "resumen" => "<elsevierMultimedia ident="fig0015"></elsevierMultimedia>" ] 1 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<ul class="elsevierStyleList" id="lis0120"><li class="elsevierStyleListItem" id="lsti0120">•Liver fibrosis in biliary atresia (BA) progresses within a short time.</li><li class="elsevierStyleListItem" id="lsti0125">•A younger infant with BA could exhibit a higher grade of fibrosis.</li><li class="elsevierStyleListItem" id="lsti0130">•Pathological findings in BA are well studied, but there are very few studies regarding temporal changes.</li><li class="elsevierStyleListItem" id="lsti0135">•Bile ductular proliferation was the only independent feature showing temporal increase.</li></ul>" ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301782?idApp=UINPBA00004N" "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301782/v1_202102250957/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Alterations in chemokine receptor CCR5 activity influence tumor cell biology in human cholangiocarcinoma cell lines" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Jiaqi Yang, David Sontag, Yuewen Gong, Gerald Y. Minuk" "autores" => array:4 [ 0 => array:3 [ "nombre" => "Jiaqi" "apellidos" => "Yang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "David" "apellidos" => "Sontag" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Yuewen" "apellidos" => "Gong" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:4 [ "nombre" => "Gerald Y." "apellidos" => "Minuk" "email" => array:1 [ 0 => "gerald.minuk@umanitoba.ca" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Section of Hepatology, Department of Internal Medicine, Rudy Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "College of Pharmacy, University of Manitoba, Winnipeg, Manitoba, Canada" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 910 "Ancho" => 1508 "Tamanyo" => 94521 ] ] "descripcion" => array:1 [ "en" => "CCR subtype mRNA expression in HuCCT1 and KMBC cells as determined by real-time RT-PCR. Human activated peripheral blood mononuclear cells (PBMCs) served as positive controls. Data presented as mean±SD of three determinations." ] ] ] "textoCompleto" => "1IntroductionCholangiocarcinoma (CCA) is the most common primary malignancy of the biliary tract. Traditionally, CCAs are divided into intrahepatic and extrahepatic (including hilar and distal duct) tumors (I-CCA and E-CCA respectively). In addition to the anatomical distinction, I-CCA and E-CCA also differ with respect their growth patterns. Specifically, I-CCA tend to be mass forming and often metastasize whereas E-CCA tend to grow parallel to tissue planes and rarely develop distant metastases <a class="elsevierStyleCrossRefs" href="#bib0155">[1,2]</a>.Unfortunately, CCA treatment (both l-CCA and E-CCA) is often palliative. Surgical excision and liver transplantation are potentially curative but can only be offered to a small minority of CCA patients <a class="elsevierStyleCrossRefs" href="#bib0165">[3–6]</a>. Chemotherapy and radiation therapy are largely ineffective. Thus, it is not surprising that mean overall CCA patient survival times are less than two years <a class="elsevierStyleCrossRefs" href="#bib0185">[7,8]</a>.Chemokines are 8–14kDa proteins consisting of four main subclasses: C-, CC-, CXC- and CX3C- where C represents cysteine and X any amino acid residue. Beyond their traditional roles of modulating immune cell trafficking <a class="elsevierStyleCrossRef" href="#bib0195">[9]</a>, chemokine receptors (CRs: CC, CXC, XC or CX3C-R) and ligands (-L) also regulate non-immune cell growth and migration <a class="elsevierStyleCrossRefs" href="#bib0195">[9,10]</a>.In the setting of carcinoma, chemokine gradients within the tumor microenvironment influence tumor cell survival, growth and metastasis <a class="elsevierStyleCrossRef" href="#bib0205">[11]</a>. A well-studied example is the chemotaxis complex: chemokine receptor CXCR4 and its ligand CXCL12. This receptor-ligand interaction has been implicated in the development of tumor metastases for in excess of 20 distinct tumor types <a class="elsevierStyleCrossRef" href="#bib0210">[12]</a>. In addition, CR and chemokine interactions influence tumor angiogenesis and the induction of tumor promoting growth factors <a class="elsevierStyleCrossRefs" href="#bib0205">[11,13,14]</a>.Despite the high mortality associated with CCA and importance of chemotaxis in regulating tumor cell biology, there are a paucity of reports describing chemotaxis in CCA. In one of the few studies reported to date, CXCR4-CXCL12 interactions were described in both CCA tissues and cell lines <a class="elsevierStyleCrossRef" href="#bib0225">[15]</a>. In another, inhibition of CXCR4 expression reduced CCA tumor cell proliferation, metastasis and neural invasion whereas overexpression induced tumor cell invasion <a class="elsevierStyleCrossRefs" href="#bib0230">[16–20]</a>. Finally, CXCR2-CXCL5 interactions have been implicated in CCA tumor development and inhibition of CXCR2 expression has been reported to significantly inhibit tumor growth <a class="elsevierStyleCrossRef" href="#bib0255">[21]</a>. To date, there have been no reports describing the expression profile or influence of the CCR subclass on I-CCA and E-CCA tumor cell biology.In the present study, we documented the CCR subclass expression profiles (CCR1-10) in representative human I-CCA and E-CCA cell lines. We also documented the effects of a commercially available CCR5 antagonist (Maraviroc) and agonist (RANTES) on I-CCA and E-CCA proliferation, spheroid formation, migration and invasion.2Materials and methods2.1Cells and reagentsThe human I-CCA HuCCT1 cell line was purchased from Sekisui XenoTech (USA), and E-CCA KMBC cell line from ATCC (USA). Maraviroc, a commercially available CCR5 antagonist was purchased from Sigma-Aldrich, USA, and RANTES, a CCR5 agonist from Invitrogen, USA.2.2Cell cultureHuCCT1 and KMBC cells were cultured in RPMI 1640 medium supplemented with 110mg/L sodium pyruvate, 10% HI- fetal bovine serum (FBS), 100U/mL penicillin and 100μg/mL streptomycin (Invitrogen, USA). All cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air.2.3CCR expression profilesTotal RNA was extracted by TRIzol Plus RNA Purification (Invitrogen, USA). First strand cDNA was synthesized by the iScript™ cDNA synthesis kit Reverse Transcription Kit (Bio-Rad, USA) according to the manufacturer's instructions. Real-time polymerase chain reaction (qPCR) was performed using the Power SYBR® Green PCR Master Mix (Invitrogen, USA). The specific primers are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a> and were designed with the respective sequences from GenBank by Oligo 7 software. PCR amplification was initially held at 95°C for 10min, then carried out by applying 35 cycles comprised of denaturation at 95°C for 15s, annealing temperature at 58°C for 1min, followed by a final melting curve stage using a ViiA™ 7 Real-time PCR System (Applied Bio-systems, USA). Data were analyzed by QuantStudio™ Real-Time PCR Software (Applied Bio-systems, USA). The gene cycle threshold (CT) value of the target was normalized to beta-actin. Gene expressions were calculated by using the relative quantification method (2−ΔCT) <a class="elsevierStyleCrossRef" href="#bib0260">[22]</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>2.4Cell proliferationHuCCT-1 and KMBC cells were seeded onto 96-well plates at a density of 5000 cells per well in 100μL of RPMI 1640 medium with 10% FBS and incubated for 24h. The following day, cell culture media (CM) was replaced with 5% heat inactivated FBS (Invitrogen, USA). During concentration-dependent experiments, cells were exposed to CM alone or CM plus a range of Maravirocs (0.1–1000nM) and RANTES (1–50ng/mL) concentrations for three days. Time-dependent proliferative activity was tested from days 1 to 6 at CM alone or CM plus a constant Maraviroc concentration of 1000nM, RANTES 20ng/mL or a combination of Maraviroc/RANTES (1000nM/20ng/mL). At the end of treatments, cell proliferation was measured by adding premixed WST-1 reagent (Takara Bro, USA) and incubating at 37°C for 3h. Blank wells with CM alone were used to detect background activity.2.5Spheroid formationHuCCT1 and KMBC cell lines were suspended in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) medium (Invitrogen, USA), supplemented with 1×B-27 Serum-Free Supplement (Invitrogen, USA), 4μg/mL heparin (Stem cell Technologies, Canada), 100U/mL penicillin and 100μg/mL streptomycin, 10ng/mL epidermal growth factor (EGF) (Invitrogen, USA), and 10ng/mL basic fibroblast growth factor (bFGF) (Invitrogen, USA) <a class="elsevierStyleCrossRef" href="#bib0265">[23]</a>. Cells were subsequently seeded at densities of 200cells per well in ultra-low attachment 96-well plates (Corning, USA), and treated with either Maraviroc (1000nM), RANTES (20ng/mL), or Maraviroc/RANTES (1000nM/20ng/mL). After 0, 3 and 6 days of culture, spheroids were photographed using an inverted microscope (Optika, Italy). Cells treated with CM only served as the controls. Aggregation diameter was measured and analyzed using ImageJ software.2.6Cell migrationHuCCT1 and KMBC cell lines (0.5×106/mL, 2mL per well) were seeded in 6-well plates and cultured with RPMI 1640 medium supplemented with 10% FBS until confluent. Monolayers were then scratched with a 200μL pipette tip to generate a wound according to the method described previously <a class="elsevierStyleCrossRef" href="#bib0270">[24]</a>. To investigate the effects of Maraviroc, RANTES and Maraviroc/RANTES on wound healing, cells were exposed to Maraviroc (1000nM), RANTES (20ng/mL), and Maraviroc/RANTES (1000nM/20ng/mL). Phase contrast images were captured at 0, 12 and 24h. Images acquired for each cell group were analyzed quantitatively by using ImageJ software. By comparing images from each captured time point, the migration capacity of cells was measured as the extent of wound closure by calculating wound area.2.7Cell invasionTwenty-four well Transwell permeable supports with 8μm pores (Corning, USA) were used to measure cell invasion. HuCCT1 or KMBC cells (1×105) in 100μL serum-free medium were added to the upper chambers. The lower chambers contained 650μL RPMI 1640 medium with either 10% FBS, 5% heat inactivated FBS, Maraviroc (1000nM), RANTES (20ng/mL), or Maraviroc/RANTES (1000nM/20ng/mL). After 24h incubation, cells from the upper surface membrane were removed with a cotton swab. Penetrated cells in the lower chamber were dissociated and collected by a cell dissociation buffer (Invitrogen, USA). Collected cells were counted by a cell counter (Cellometer® Auto 2000, Nexcelom Bioscience, USA).2.8Statistical analysisAll experiments were performed in triplicate and repeated on a minimum of three occasions. Significant differences were determined by repeated measures of ANOVA and/or Tukey's multiple comparison post hoc test. A Student's t-test was used for comparisons of two groups. Data were analyzed by GraphPad Prism 6 statistical software (GraphPad Software, Inc., USA). Differences with p values below 0.05 were considered statistically significant.3ResultsThe CCR expression profiles of HuCCT1 and KMBC cells are provided in <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>. All 10 CCR motifs (CCR1-10) were expressed in HuCCT1 cells, while six (CCR4, CCR5, CCR6, CCR8, CCR9 and CCR10) were detected in KMBC cells. The CCR motifs most abundant in HuCCT1 cells were CCR5 followed by CCR7. In KMBC cells, CCR6 was most abundant followed by CCR5. Thus, as one of the higher CCR expressed subtypes, the effects of the CCR5 antagonist Maraviroc, agonist RANTES and Maraviroc/RANTES combination on I-CCA and E-CCA cell biology were further explored.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>As shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A and B, in HuCCT1 cells, there were no concentration-dependent alterations in cell proliferation with Maraviroc or RANTES. However, in KMBC cells (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>C and D), proliferation was inhibited at the highest concentration of Maraviroc (1000nM), and upregulated at RANTES concentrations of 5ng/mL and higher with maximum increased proliferation occurring at 20ng/mL. Based on these findings, all further experimentation was performed at a Maraviroc concentration of 1000nM, RANTES 20ng/mL and Maraviroc/RANTES (1000nM/20ng/mL). Of note, the increase in KMBC cell proliferation that occurred with RANTES was not observed following exposure to the combination of Maraviroc/RANTES (data not shown).<elsevierMultimedia ident="fig0010"></elsevierMultimedia>There were no time-dependent effects of Maraviroc or RANES on HuCCT1 cell proliferation over the six days exposure (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A). However, in KMBC cells, an inhibitory effect of Maraviroc on cell proliferation was evident on day 3 and more so on day 6 (p<0.05 and 0.0001 respectively) (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C). On exposure to RANTES, KMBC cell proliferation increased at all time periods (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>D). In the presence of both Maraviroc/RANTES, the inhibitory effects of Maraviroc and stimulatory effects of RANTES were no longer evident (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>E).<elsevierMultimedia ident="fig0015"></elsevierMultimedia><a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a> demonstrates the results of spheroid formation in HuCCT1 and KMBC cells following treatment with Maraviroc, RANTES, or Maraviroc/RANTES. Neither Maraviroc, RANTES nor Maraviroc/RANTES altered spheroid information in HuCCT1 cells (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A). On the other hand, spheroid formation was significantly inhibited in KMBC cells following exposure to Maraviroc (Day 3 dimensions for Maraviroc: 145±6nM versus control: 244.7±11.2nM, p<0.0001; Day 6: Maraviroc: 170.7±17.6nM versus control: 322.7±23.7nM, p<0.0001), while RANTES alone had no effect. In the presence of both Maraviroc/RANTES, the inhibitory effect of Maraviroc on KMBC cells was no longer evident.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>The effects of Maraviroc, RANTES and Maraviroc/RANTES on cell migration were documented by the scratch wound healing assay (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>). Here, Maraviroc inhibited HuCCT1 cell migration at 12h (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A and B), while RANTES had no significant effect. The inhibitory effect of Maraviroc was no longer evident in the presence of Maraviroc/RANTES. In KMBC cells the inhibition of Maraviroc at 12 and 24h was not significant but increases in cell migration occurred with RANTES at both time intervals. In the presence of Maraviroc/RANTES, the increases associated with RANTES alone were no longer evident (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>C and D).<elsevierMultimedia ident="fig0025"></elsevierMultimedia>Finally, regarding cell invasion, Maraviroc inhibited HuCCT1 cell invasion (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A), whereas RANTES had no effect. The inhibitory effect of Maraviroc was no longer evident in the presence of Maraviroc/RANTES. In KMBC cells, Maraviroc inhibited while RANTES increased cell invasion (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>B). Of note, the increase observed with RANTES persisted in the presence of Maraviroc/RANTES.<elsevierMultimedia ident="fig0030"></elsevierMultimedia>4DiscussionThe results of this study indicate that CCR expression profiles differed in these representative human I-CCA and E-CCA cell lines. The results also indicate that a specific CCR5 antagonist and agonist, can alter tumor cell biology in a cell-specific manner with the CCR5 antagonist being associated with attenuated and agonist, enhanced tumor cell activities. Together, these findings could help to explain the different tumor growth characteristics observed in I-CCA and E-CCA. They also raise the possibility that CCR5 antagonists may have therapeutic benefit in the treatment of CCA.Unfortunately there have been no previous reports documenting the complete CCR expression profile in human CCA tissues or cell lines. Thus, a comparative analysis with previous data could not be undertaken. However, the CCR expression profile detected in I-CCA was similar to that described for human hepatocellular carcinoma <a class="elsevierStyleCrossRef" href="#bib0275">[25]</a>, a finding that may reflect the common risk factors and/or origin of these tumors <a class="elsevierStyleCrossRef" href="#bib0280">[26]</a>. Moreover, significant expression of CCR5 is in keeping with the high expression observed in the livers of patients with chronic liver disease and its tumor promoting properties which include activation of mTOR and AKT pathways <a class="elsevierStyleCrossRef" href="#bib0285">[27]</a>.Overall, the CCR5 antagonist Maraviroc inhibited HuCCT1 growth promoting properties and to a lesser extent, in KMBC cells. Specifically, Maraviroc inhibited HuCCT1 proliferation, migration and invasion whereas in KMBC cells, spheroid formation and invasion were inhibited. Somewhat surprisingly, with the exception of KMBC cell invasion, RANTES alone did not have opposing effects. Presumably, this finding relates to constitutive CCR5 activation by an autocrine ligand <a class="elsevierStyleCrossRef" href="#bib0290">[28]</a>. That the addition of Maraviroc did not reverse the increase in cell invasion associated with RANTES, suggests the RANTES effect may be CCR5-independent. However, it is also possible the process is concentration-dependent and higher concentrations of Maraviroc may have been more effective.In terms of clinical relevance, the results of this study and those obtained with the commercially available CCR5 antagonist Maraviroc in particular, suggest that in CCA, therapeutic benefit might be derived from CCR5 inhibition. Such an approach has been applied to gastric cancers with some success <a class="elsevierStyleCrossRef" href="#bib0295">[29]</a>. The possibility is rendered feasible by the fact the inhibitory concentration of Maraviroc (1000nM) is well within the range reported in the blood of patients treated with this agent <a class="elsevierStyleCrossRef" href="#bib0300">[30]</a>. Also to be considered is whether the use of a CCR5 antagonist in the treatment of primary sclerosing cholangitis (PSC), a condition associated with a significantly increased risk of CCA, may help to prevent the development or course of these tumors in PSC patients.Having confirmed that at least in these two cell lines, I-CCA and E-CCA possess different CCR expression profiles and respond differently to a CCR5 antagonist and agonist, the question arises as to why such differences exist. Both I-CCA and E-CCA consist of malignant cholangiocytes. However, when analyzed for differences in the expression of cancer stem cell (CSC) markers, significant differences are evident. Specifically, CSC markers are expressed in greater than 90% of HuCCT1 cells but less than 5% of KMBCs cells (authors unpublished data). Given that the prevalence of CSCs influences tumor cell biology, this could explain the differences observed. Clearly, further research is required to test this hypothesis.There are a number of limitations to this study that warrant emphases. First, only one I-CCA and one E-CCA cell line were studied. Whether similar results would have been obtained with additional cell lines remains to be determined. Second, due to the lack of commercially available CCR antagonists other than Maraviroc, only the effects of CCR5 inhibition were documented. When available, results obtained with a CCR6 antagonist, the CCR subtype expressed to the greatest extent in KMBC cells, will be of interest. Third, because CCR5 receptor inhibition and activation with Maraviroc and RANTES respectively have been documented in all other cells studied to date, confirmation of the effects of these agents on receptor activity per se was not undertaken. Finally, the results described reflect preliminary findings of an in vitro cell based system. Additional studies in animal models of CCA are warranted.In conclusion, the results of this study support clinical observations that I-CCA and E-CCA have different tumor growth and invasive properties. They also raise the possibility that these differences reflect differences in CCR expression profiles. In general, exposure to a specific CCR5 antagonist inhibited while an agonist enhanced tumor cell properties. Additional studies are required to determine whether inhibition of CCR5 has benefit in the treatment of CCA in humans.Lay summaryActivation of chemokine receptors can alter the behavior of normal and cancerous cells. This study revealed that bile duct cancers which develop within the liver express different chemokine receptors than those that develop outside the liver. This finding may help to explain why the two types of bile duct cancer behave differently. Importantly, the results also indicate the behavior of bile duct cancer cells can be favorably altered by blocking certain chemokine receptors.Financial supportThis research was supported by a grant (315741) from the Canadian Liver Foundation and Kenroc Builders Inc.ContributionsConcept & design: JY, YG, GYM. Experiments and procedures: JY, DS. Data analysis: JY, YG, GYM. Writing of article: JY, YG, GYM.Conflict of interestThere are no conflicts of interest to report." "textoCompletoSecciones" => array:1 [ "secciones" => array:11 [ 0 => array:3 [ "identificador" => "xres1471590" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1340220" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:8 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Cells and reagents" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Cell culture" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "CCR expression profiles" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Cell proliferation" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Spheroid formation" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Cell migration" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Cell invasion" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "Statistical analysis" ] ] ] 4 => array:2 [ "identificador" => "sec0055" "titulo" => "Results" ] 5 => array:2 [ "identificador" => "sec0060" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "sec0065" "titulo" => "Lay summary" ] 7 => array:2 [ "identificador" => "sec0070" "titulo" => "Financial support" ] 8 => array:2 [ "identificador" => "sec0075" "titulo" => "Contributions" ] 9 => array:2 [ "identificador" => "sec0080" "titulo" => "Conflict of interest" ] 10 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-08-13" "fechaAceptado" => "2020-09-18" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1340220" "palabras" => array:10 [ 0 => "Chemotaxis" 1 => "Chemokines" 2 => "Chemokine receptors" 3 => "CCR5" 4 => "CCR6" 5 => "Maraviroc" 6 => "Cholangiocarcinoma" 7 => "Chemokine receptor antagonists" 8 => "Cell lines" 9 => "Rantes" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "Introduction and objectivesIntrahepatic (I-CCA) and extrahepatic (E-CCA) cholangiocarcinoma (CCA) have different growth patterns and risks for tumor metastasis. Inhibition and/or activation of the chemokine receptor CCR subclasses have been reported to alter tumor cell biology in non-CCA cancers. In this study we documented CCR expression profiles in representative human I-CCA and E-CCA cell lines and the in vitro effects of CCR antagonists and agonists on tumor cell biology. Materials and methodsCCR expression profiles were documented by real-time reverse transcription polymerase chain reaction; cell proliferation by WST-1; spheroid formation by sphere dimensions in anchorage-free medium; cell migration by wound healing and invasion by Transwell invasion chambers. ResultsAll 10 CCR motifs (CCR1-10) were expressed in the I-CCA, HuCCT1 cell line and six (CCR4, 5, 6, 8, 9 and 10) in the E-CCA, KMBC cell line. In HuCCT1 cells, CCR5 expression was most abundant whereas in KMBC cells, CCR6 followed by CCR5 were most abundant. The CCR5 antagonist Maraviroc significantly inhibited cell proliferation, migration and invasion in HuCCT1 cells, and spheroid formation and invasion in KMBC cells. The CCR5 agonist RANTES had no effect on HuCCT1 cells but increased cell proliferation, migration and invasion of KMBC cells. ConclusionThese results suggest that CCR expression profiles differ in I-CCA and E-CCA. They also indicate that CCR5 antagonists and agonists have cell-specific effects but in general, CCR5 inactivation inhibits CCA tumor cell aggressiveness. Additional research is required to determine whether CCR5 inactivation is of value in the treatment of CCA in humans." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] ] "nomenclatura" => array:1 [ 0 => array:3 [ "identificador" => "nom0005" "titulo" => "Abbreviations" "listaDefinicion" => array:1 [ 0 => array:1 [ "definicion" => array:8 [ 0 => array:2 [ "termino" => "CCR" "descripcion" => "chemokine receptors" ] 1 => array:2 [ "termino" => "I-CCA" "descripcion" => "intra-hepatic cholangiocarcinoma" ] 2 => array:2 [ "termino" => "E-CCA" "descripcion" => "extra-hepatic cholangiocarcinoma" ] 3 => array:2 [ "termino" => "WST-1" "descripcion" => "water-soluble tetrazolium salt-1" ] 4 => array:2 [ "termino" => "RANTES" "descripcion" => "regulated on activation, normal T cell expressed and secreted" ] 5 => array:2 [ "termino" => "FBS" "descripcion" => "fetal bovine serum" ] 6 => array:2 [ "termino" => "mTOR" "descripcion" => "mechanistic target of rapamycin" ] 7 => array:2 [ "termino" => "CSC" "descripcion" => "cancer stem cells" ] ] ] ] ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 910 "Ancho" => 1508 "Tamanyo" => 94521 ] ] "descripcion" => array:1 [ "en" => "CCR subtype mRNA expression in HuCCT1 and KMBC cells as determined by real-time RT-PCR. Human activated peripheral blood mononuclear cells (PBMCs) served as positive controls. Data presented as mean±SD of three determinations." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2691 "Ancho" => 3167 "Tamanyo" => 538565 ] ] "descripcion" => array:1 [ "en" => "Dose-dependent effects of the CCR5 antagonist (Maraviroc) and agonist (RANTES) on HuCCT1 and KMBC cell proliferation. HuCCT1 and KMBC cells were exposed to Maraviroc or RANTES for 3 days. Panels A and B: Dose-dependent effects of Maraviroc and RANTES on HuCCT1 cell and Panels C and D: KMBC cell proliferation. The stimulatory effects of RANTES on KMBC cell proliferation were no longer evident when KMBC cells were exposure to the combination of Maraviroc/RANTES (M+R). Data presented as mean±SD. *: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2062 "Ancho" => 3167 "Tamanyo" => 251039 ] ] "descripcion" => array:1 [ "en" => "Time-dependent effects of the CCR5 antagonist (Maraviroc) and agonist (RANTES) on HuCCT1 and KMBC cell proliferation. HuCCT1 and KMBC cells were exposed to Maraviroc, RANTES, or Maraviroc/RANTES for 1, 3, and 6 days. Panels A and B: Time-dependent effects of Maraviroc (1000nM) and RANTES (20ng/mL) on HuCCT1 cell proliferation. Panels C and D: Time-dependent effects of Maraviroc (1000nM) and RANTES (20ng/mL) on KMBC cells. The inhibitory effects of Maraviroc on days 3 and 6 and stimulatory effects of RANTES at all time points on KMBC cell proliferation were no longer evident when KMBC cells were exposure to the combination of Maraviroc/RANTES (Panel E). Data presented as mean±SD. *: p<0.05." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 2451 "Ancho" => 3167 "Tamanyo" => 367507 ] ] "descripcion" => array:1 [ "en" => "Spheroid formation by HuCCT1 and KMBC cells in the presence of the CCR5 antagonist Maraviroc (1000nM), agonist RANTES (20ng/mL), and a combination of Maraviroc/RANTES (1000nM/20ng/mL). Cells were seeded at densities of 200cells/well in ultra-low 96-well plates to generate spheroids. Panel A: Spheroid formation in HuCCT1 cells was not influenced by Maraviroc, RANTES, or Maraviroc/RANTES. Sale bar: 50 and 100μm. Panel B: Maraviroc inhibited KMBC spheroid formation on days 3 and 6 while RANTES had no effect. The inhibitory effect of Maraviroc was no longer evident when KMBC cells were exposed to the combination of Maraviroc/RANTES. Sale bar: 50 and 250μm. Panel C: The diameters of spheroid formation were measured by software ImageJ. Data presented as mean±SD. ****: p<0.0001." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2799 "Ancho" => 3167 "Tamanyo" => 519743 ] ] "descripcion" => array:1 [ "en" => "Migration of HuCCT1 and KMBC cells after exposure to the CCR5 antagonist Maraviroc (1000nM), agonist RANTES (20ng/mL) and combination of Maraviroc/RANTES (1000nM/20ng/mL). Panels A and B: Results in HuCCT1cells, and Panels C and D: in KMBC cells. Maraviroc delayed HuCCT1 wound closure at 12h while RANTES increased KMBC wound closure at 12 and 24h. Both the inhibitory effects of Maraviroc and stimulatory effects of RANTES were no longer evident when cells were exposed to the combination of Maraviroc/RANTES. Sale bar: 250μm. ImageJ analysis of cell migration was determined by measuring wound closure from phase-contrast images. Data presented as mean±SD. *: p<0.05; **: p<0.01; ****: p<0.0001." ] ] 5 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1545 "Ancho" => 1508 "Tamanyo" => 215135 ] ] "descripcion" => array:1 [ "en" => "Invasion of HuCCT1 and KMBC cells were documented with the use of Transwell invasion chambers, in the presence of Maraviroc (1000nM), RANTES (20ng/mL) and the combination of Maraviroc/RANTES combination (1000nM/20ng/mL). Panel A: Results in HuCCT1 cells and Panel B: in KMBC cells. Maraviroc inhibited HuCCT1 and KMBC cell invasion while RANTES increased KMBC cell invasion. The stimulatory effect of RANTES on KMBC cell persisted in the presence of Maraviroc/RANTES. Data presented as mean±SD. *: p<0.05." ] ] 6 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primers (5′–3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm (°C) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Size (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR1</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GACTATGACACGACCACAGAGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">117 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TACCAAGGAGTACAGAGGGGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR2</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGTTCAGAAGGTATCTCTCGGTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">115 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGCGTGTTTGTTGAAGTCACT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR3</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTCATCATGGCGGTGTTTTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">155 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAGTGGGAGTAGGCGATCAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR4</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGAAGGCATCAAGGCATTTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">137 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACACATCAGTCATGGACCTGAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR5</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTCTGGGCTCCCTACAACATT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">93 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTGGTCCAACCTGTTAGAGCTA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR6</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTCAGCGATGTTTTCGACTCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">134 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCAATCGGTACAAATAGCCTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR7</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGAGGTCACGGACGATTACAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">134 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTAGGCCCACGAAACAAATGAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR8</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTGTGACAACAGTGACCGACT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">173 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTCTTGCAGACCACAAGGAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR9</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATGTCAGGCAGTTTGCGAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">105 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGCAGTACCAGTAGACAAGGAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR10</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATTACTCTGGGGATGAAGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">117 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCACGGTCAGGGAGACACT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">β-actin</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCCTCTCCCAAGTCCACACAGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">131 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-sense \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGGCACGAAGGCTCATCATTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2532315.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Primers and conditions of real-time polymerase chain reaction." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:30 [ 0 => array:3 [ "identificador" => "bib0155" "etiqueta" => "[1]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cholangiocarcinoma. A spectrum of intrahepatic, perihilar, and distal tumors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Nakeeb" 1 => "H.A. Pitt" 2 => "T.A. Sohn" 3 => "J. Coleman" 4 => "R.A. Abrams" 5 => "S. Piantadosi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/00000658-199610000-00005" "Revista" => array:7 [ "tituloSerie" => "Ann Surg" "fecha" => "1996" "volumen" => "224" "numero" => "4" "paginaInicial" => "463" "paginaFinal" => "473" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8857851" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0160" "etiqueta" => "[2]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Perioperative and long-term outcome of intraheptic cholangiocarcinoma involving the hepatic hilus after curative-intent resection: comparison with peripheral intrahepatic cholangiocarcinoma and hilar cholangiocarcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X.F. Zhang" 1 => "F. Bagante" 2 => "Q. Chen" 3 => "E.W. Beal" 4 => "Y. Lv" 5 => "M. Weiss" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.surg.2018.01.001" "Revista" => array:7 [ "tituloSerie" => "Surgery" "fecha" => "2018" "volumen" => "163" "numero" => "5" "paginaInicial" => "1114" "paginaFinal" => "1120" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29398035" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0165" "etiqueta" => "[3]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cholangiocarcinoma: thirty-one-year experience with 564 patients at a single institution" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.L. DeOliveira" 1 => "S.C. Cunningham" 2 => "J.L. Cameron" 3 => "F. Kamangar" 4 => "J.M. Winter" 5 => "K.D. Lillemoe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/01.sla.0000251366.62632.d3" "Revista" => array:7 [ "tituloSerie" => "Ann Surg" "fecha" => "2007" "volumen" => "245" "numero" => "5" "paginaInicial" => "755" "paginaFinal" => "762" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17457168" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0170" "etiqueta" => "[4]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Two hundred forty consecutive portal vein embolizations before extended hepatectomy for biliary cancer: surgical outcome and long-term follow-up" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Nagino" 1 => "J. Kamiya" 2 => "H. Nishio" 3 => "T. Ebata" 4 => "T. Arai" 5 => "Y. Nimura" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/01.sla.0000201482.11876.14" "Revista" => array:7 [ "tituloSerie" => "Ann Surg" "fecha" => "2006" "volumen" => "243" "numero" => "3" "paginaInicial" => "364" "paginaFinal" => "372" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16495702" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0175" "etiqueta" => "[5]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Treatment and prognosis for patients with intrahepatic cholangiocarcinoma: systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M.N. Mavros" 1 => "K.P. Economopoulos" 2 => "V.G. Alexiou" 3 => "T.M. Pawlik" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/jamasurg.2013.5137" "Revista" => array:7 [ "tituloSerie" => "JAMA Surg" "fecha" => "2014" "volumen" => "149" "numero" => "6" "paginaInicial" => "565" "paginaFinal" => "574" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24718873" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0180" "etiqueta" => "[6]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Current surgical management of hilar and intrahepatic cholangiocarcinoma: the role of resection and orthotopic liver transplantation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "H. Petrowsky" 1 => "J.C. Hong" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Transpl Proc" "fecha" => "2009" "volumen" => "41" "numero" => "10" "paginaInicial" => "4023" "paginaFinal" => "4035" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0185" "etiqueta" => "[7]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Survival analysis of intrahepatic cholangiocarcinoma after resection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.Y. Cho" 1 => "S.J. Park" 2 => "S.H. Kim" 3 => "S.S. Han" 4 => "Y.K. Kim" 5 => "K.W. Lee" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1245/s10434-010-0938-y" "Revista" => array:7 [ "tituloSerie" => "Ann Surg Oncol" "fecha" => "2010" "volumen" => "17" "numero" => "7" "paginaInicial" => "1823" "paginaFinal" => "1830" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20165987" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0190" "etiqueta" => "[8]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical features and survival outcome of locally advanced extrahepatic cholangiocarcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.J. Lee" 1 => "W. Kwon" 2 => "M.J. Kang" 3 => "J.Y. Jang" 4 => "Y.R. Chang" 5 => "W. Jung" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Korean J Hepato-biliary-pancreatic Surg" "fecha" => "2014" "volumen" => "18" "numero" => "1" "paginaInicial" => "1" "paginaFinal" => "8" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0195" "etiqueta" => "[9]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The many roles of chemokines and chemokine receptors in inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "I.F. Charo" 1 => "R.M. Ransohoff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMra052723" "Revista" => array:7 [ "tituloSerie" => "N Engl J Med" "fecha" => "2006" "volumen" => "354" "numero" => "6" "paginaInicial" => "610" "paginaFinal" => "621" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16467548" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0200" "etiqueta" => "[10]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemokines, chemokine receptors and the gastrointestinal system" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Miyazaki" 1 => "K. Takabe" 2 => "W.A. Yeudall" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3748/wjg.v19.i19.2847" "Revista" => array:7 [ "tituloSerie" => "World J Gastroenterol" "fecha" => "2013" "volumen" => "19" "numero" => "19" "paginaInicial" => "2847" "paginaFinal" => "2863" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23704819" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0205" "etiqueta" => "[11]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cancer and the chemokine network" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F. Balkwill" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrc1388" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Cancer" "fecha" => "2004" "volumen" => "4" "numero" => "7" "paginaInicial" => "540" "paginaFinal" => "550" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15229479" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0210" "etiqueta" => "[12]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The significance of cancer cell expression of the chemokine receptor CXCR4" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F. Balkwill" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.semcancer.2003.10.003" "Revista" => array:7 [ "tituloSerie" => "Semin Cancer Biol" "fecha" => "2004" "volumen" => "14" "numero" => "3" "paginaInicial" => "171" "paginaFinal" => "179" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15246052" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0215" "etiqueta" => "[13]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemokines in cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.T. Chow" 1 => "A.D. Luster" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/2326-6066.CIR-14-0160" "Revista" => array:7 [ "tituloSerie" => "Cancer Immunol Res" "fecha" => "2014" "volumen" => "2" "numero" => "12" "paginaInicial" => "1125" "paginaFinal" => "1131" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25480554" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0220" "etiqueta" => "[14]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemokine receptor CXCR7 regulates the invasion, angiogenesis and tumor growth of human hepatocellular carcinoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Zheng" 1 => "H.Y. Li" 2 => "X.L. Su" 3 => "X.Y. Wang" 4 => "T. Tian" 5 => "F. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1756-9966-29-31" "Revista" => array:5 [ "tituloSerie" => "J Exp Clin Cancer Res" "fecha" => "2010" "volumen" => "29" "paginaInicial" => "31" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20380740" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0225" "etiqueta" => "[15]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Roles of the MEK1/2 and AKT pathways in CXCL12/CXCR4 induced cholangiocarcinoma cell invasion" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Leelawat" 1 => "S. Leelawat" 2 => "S. Narong" 3 => "S. Hongeng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3748/wjg.v13.i10.1561" "Revista" => array:7 [ "tituloSerie" => "World J Gastroenterol" "fecha" => "2007" "volumen" => "13" "numero" => "10" "paginaInicial" => "1561" "paginaFinal" => "1568" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17461449" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0230" "etiqueta" => "[16]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Possible regulation of migration of intrahepatic cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor necrosis factor-alpha and stromal-derived factor-1 released in stroma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Ohira" 1 => "M. Sasaki" 2 => "K. Harada" 3 => "Y. Sato" 4 => "Y. Zen" 5 => "K. Isse" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2353/ajpath.2006.050204" "Revista" => array:7 [ "tituloSerie" => "Am J Pathol" "fecha" => "2006" "volumen" => "168" "numero" => "4" "paginaInicial" => "1155" "paginaFinal" => "1168" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16565491" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0235" "etiqueta" => "[17]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "X.Y. Tan" 1 => "S. Chang" 2 => "W. Liu" 3 => "H.H. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.5009/gnl.2014.8.2.196" "Revista" => array:7 [ "tituloSerie" => "Gut Liver" "fecha" => "2014" "volumen" => "8" "numero" => "2" "paginaInicial" => "196" "paginaFinal" => "204" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24672662" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0240" "etiqueta" => "[18]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Delivery of miR-200c mimic with poly(amido amine) cxcr4 antagonists for combined inhibition of cholangiocarcinoma cell invasiveness" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Xie" 1 => "C.J. Wehrkamp" 2 => "J. Li" 3 => "Y. Wang" 4 => "Y. Wang" 5 => "J.L. Mott" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mol Pharmaceut" "fecha" => "2016" "volumen" => "13" "numero" => "3" "paginaInicial" => "1073" "paginaFinal" => "1080" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0245" "etiqueta" => "[19]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Blockade of CXCL12/CXCR4 signaling inhibits intrahepatic cholangiocarcinoma progression and metastasis via inactivation of canonical Wnt pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S. Zhao" 1 => "J. Wang" 2 => "C. Qin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s13046-014-0103-8" "Revista" => array:5 [ "tituloSerie" => "J Exp Clin Cancer Res" "fecha" => "2014" "volumen" => "33" "paginaInicial" => "103" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25471741" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0250" "etiqueta" => "[20]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CD24 induces the invasion of cholangiocarcinoma cells by upregulating CXCR4 and increasing the phosphorylation of ERK1/2" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Leelawat" 1 => "S. Keeratichamroen" 2 => "S. Leelawat" 3 => "R. Tohtong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/ol.2013.1587" "Revista" => array:7 [ "tituloSerie" => "Oncol Lett" "fecha" => "2013" "volumen" => "6" "numero" => "5" "paginaInicial" => "1439" "paginaFinal" => "1446" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24179538" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0255" "etiqueta" => "[21]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Blockage of CXCR2 suppresses tumor growth of intrahepatic cholangiocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Sueoka" 1 => "T. Hirano" 2 => "Y. Uda" 3 => "Y. Iimuro" 4 => "J. Yamanaka" 5 => "J. Fujimoto" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.surg.2013.12.037" "Revista" => array:8 [ "tituloSerie" => "Surgery" "fecha" => "2014" "volumen" => "155" "numero" => "4" "paginaInicial" => "640" "paginaFinal" => "649" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24582495" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0026049517301853" "estado" => "S300" "issn" => "00260495" ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0260" "etiqueta" => "[22]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K.J. Livak" 1 => "T.D. Schmittgen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1006/meth.2001.1262" "Revista" => array:7 [ "tituloSerie" => "Methods" "fecha" => "2001" "volumen" => "25" "numero" => "4" "paginaInicial" => "402" "paginaFinal" => "408" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0265" "etiqueta" => "[23]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effects of low-density lipoprotein docosahexaenoic acid nanoparticles on cancer stem cells isolated from human hepatoma cell lines" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J. Yang" 1 => "Y. Gong" 2 => "D.P. Sontag" 3 => "I. Corbin" 4 => "G.Y. Minuk" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11033-018-4252-2" "Revista" => array:7 [ "tituloSerie" => "Mol Biol Rep" "fecha" => "2018" "volumen" => "45" "numero" => "5" "paginaInicial" => "1023" "paginaFinal" => "1036" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30069818" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0270" "etiqueta" => "[24]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C.C. Liang" 1 => "A.Y. Park" 2 => "J.L. Guan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nprot.2007.30" "Revista" => array:7 [ "tituloSerie" => "Nat Protoc" "fecha" => "2007" "volumen" => "2" "numero" => "2" "paginaInicial" => "329" "paginaFinal" => "333" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17406593" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0275" "etiqueta" => "[25]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chemokines and their receptors play important roles in the development of hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.M. Liang" 1 => "L. Chen" 2 => "H. Hu" 3 => "H.Y. Ma" 4 => "L.L. Gao" 5 => "J. Qin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4254/wjh.v7.i10.1390" "Revista" => array:7 [ "tituloSerie" => "World J Hepatol" "fecha" => "2015" "volumen" => "7" "numero" => "10" "paginaInicial" => "1390" "paginaFinal" => "1402" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26052384" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0280" "etiqueta" => "[26]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification and characterization of tumorigenic liver cancer stem cells by CD133 and CD24" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "D.F. Feng" 1 => "P. Gong" 2 => "W. Li" 3 => "H. Xu" 4 => "T. Zhang" 5 => "N. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Biomater Tissue Eng" "fecha" => "2015" "volumen" => "5" "paginaInicial" => "635" "paginaFinal" => "646" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0285" "etiqueta" => "[27]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The chemokine system, and its CCR5 and CXCR4 receptors, as potential targets for personalized therapy in cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "P. Weitzenfeld" 1 => "A. Ben-Baruch" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.canlet.2013.10.006" "Revista" => array:7 [ "tituloSerie" => "Cancer Lett" "fecha" => "2014" "volumen" => "352" "numero" => "1" "paginaInicial" => "36" "paginaFinal" => "53" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24141062" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0290" "etiqueta" => "[28]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Autocrine CCL5 signaling promotes invasion and migration of CD133+ ovarian cancer stem-like cells via NF-kappaB-mediated MMP-9 upregulation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Long" 1 => "R. Xie" 2 => "T. Xiang" 3 => "Z. Zhao" 4 => "S. Lin" 5 => "Z. Liang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/stem.1194" "Revista" => array:7 [ "tituloSerie" => "Stem Cells" "fecha" => "2012" "volumen" => "30" "numero" => "10" "paginaInicial" => "2309" "paginaFinal" => "2319" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22887854" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0295" "etiqueta" => "[29]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CCR5 antagonism by maraviroc reduces the potential for gastric cancer cell dissemination" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Mencarelli" 1 => "L. Graziosi" 2 => "B. Renga" 3 => "S. Cipriani" 4 => "C. D’Amore" 5 => "D. Francisci" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1593/tlo.13499" "Revista" => array:7 [ "tituloSerie" => "Transl Oncol" "fecha" => "2013" "volumen" => "6" "numero" => "6" "paginaInicial" => "784" "paginaFinal" => "793" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24466382" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0300" "etiqueta" => "[30]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Population pharmacokinetic/pharmacodynamic analysis of CCR5 receptor occupancy by maraviroc in healthy subjects and HIV-positive patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.C. Rosario" 1 => "P. Jacqmin" 2 => "P. Dorr" 3 => "I. James" 4 => "T.M. Jenkins" 5 => "S. Abel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2125.2008.03140.x" "Revista" => array:7 [ "tituloSerie" => "Br J Clin Pharmacol" "fecha" => "2008" "volumen" => "65" "numero" => "Suppl. 1" "paginaInicial" => "86" "paginaFinal" => "94" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18333870" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301800/v1_202102250957/en/main.assets" "Apartado" => array:4 [ "identificador" => "78265" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/000000210000000C/v1_202102250957/S1665268120301800/v1_202102250957/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301800?idApp=UINPBA00004N"]

Statistics

Original article

Jiaqi Yanga, David Sontagb, Yuewen Gongb, Gerald Y. Minuka,b,

Corresponding author

gerald.minuk@umanitoba.ca

Corresponding author.

a Section of Hepatology, Department of Internal Medicine, Rudy Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada

b College of Pharmacy, University of Manitoba, Winnipeg, Manitoba, Canada

Read

1735

Times
was read the article

391

Total PDF

1344

Total HTML

Share statistics

 array:24 [
  "pii" => "S1665268120301800"
  "issn" => "16652681"
  "doi" => "10.1016/j.aohep.2020.09.009"
  "estado" => "S300"
  "fechaPublicacion" => "2021-03-01"
  "aid" => "265"
  "copyright" => "AEDV"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Ann Hepatol. 2021;21C:"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1665268120301769"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2020.09.005"
    "estado" => "S300"
    "fechaPublicacion" => "2021-03-01"
    "aid" => "261"
    "copyright" => "AEDV"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2021;21C:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "The histone variant H3&#46;3 regulates the transcription of the hepatitis B virus"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0010"
          "etiqueta" => "Fig&#46; 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1758
              "Ancho" => 2925
              "Tamanyo" => 337828
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0010"
              "detalle" => "Fig&#46; "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The histone variant H3&#46;3 histone is necessary to regulate HBV transcription&#46;</p> <p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Scheme illustrating the shH3&#46;3 experiment and detection of the HBV viral intermediates&#46; &#40;B&#41; Levels of mRNA on samples derived from shControl or shH3&#46;3 treated Huh7 cells measured by real-time PCR&#46; The graph shows mRNA levels expressed relative to the shControl&#46; Each expression level was normalized to that of GAPDH&#46; The standard deviation was obtained from three independent experiments&#46; &#40;C&#41; Cell cycle profile of Huh7 cells treated with shH3&#46;3&#46; The standard deviation was obtained from three independent experiments&#46; &#40;D&#41; Covalent post-translational modifications on histone H3 were determined by ChIP analysis using the specific antibodies&#58; H3 &#40;left&#41; and H3K4me3 &#40;right&#41;&#46; Immunoprecipitated DNA was quantified by qPCR using specific primers for core promoter&#46; The results are expressed as fold changes of &#37; Input with respect to the control&#46; The standard deviation was obtained from three PCR reactions and the graphs are representative of two independent experiments&#46; &#40;E&#41; The HBV replicative intermediates cytoplasmic viral core particles &#40;cytDNA&#44; right&#41; and cccDNA &#40;left&#41; were determined 72&#8239;h post-transfection of the shH3&#46;3 construct&#46; The value obtained in shControl and in shH3&#46;3 was divided by the shControl value&#44; thus the results are expressed relative to the Control&#46; The standard deviation was obtained from three independent experiments&#46; &#40;F&#41; The quantity of the viral antigen HBsAg in the supernatant of the transfected cells was determined by ELISA&#44; using specific antibodies&#46; The result is shown as fold changes with respect to the control&#46; The standard deviation was obtained from three independent experiments&#46; &#42;&#58; p&#8239;&#60;&#8239;0&#46;05&#44; &#42;&#42;&#58; p&#8239;&#60;&#8239;0&#46;01&#44; Student&#8217;s <span class="elsevierStyleItalic">t</span>-test&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Francisca Alvarez-Astudillo, Daniel Garrido, Manuel Varas-Godoy, Jos&#233; Leonardo Guti&#233;rrez, Rodrigo A&#46; Villanueva, Alejandra Loyola"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Francisca"
              "apellidos" => "Alvarez-Astudillo"
            ]
            1 => array:2 [
              "nombre" => "Daniel"
              "apellidos" => "Garrido"
            ]
            2 => array:2 [
              "nombre" => "Manuel"
              "apellidos" => "Varas-Godoy"
            ]
            3 => array:2 [
              "nombre" => "Jos&#233; Leonardo"
              "apellidos" => "Guti&#233;rrez"
            ]
            4 => array:2 [
              "nombre" => "Rodrigo A&#46;"
              "apellidos" => "Villanueva"
            ]
            5 => array:2 [
              "nombre" => "Alejandra"
              "apellidos" => "Loyola"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301769?idApp=UINPBA00004N"
    "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301769/v1_202102250957/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1665268120301782"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2020.09.007"
    "estado" => "S300"
    "fechaPublicacion" => "2021-03-01"
    "aid" => "263"
    "copyright" => "AEDV"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2021;21C:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Temporal histopathological changes in biliary atresia&#58; A perspective for rapid fibrosis progression"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:3 [
        0 => "en"
        1 => "en"
        2 => "en"
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 1
        "multimedia" => array:5 [
          "identificador" => "fig0015"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => false
          "mostrarDisplay" => true
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "fx1.jpeg"
              "Alto" => 539
              "Ancho" => 1333
              "Tamanyo" => 127463
            ]
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Hanaa A El-Araby, Magdy A Saber, Noha M Radwan, Doha M Taie, Nermin M Adawy, Ahmad M Sira"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Hanaa A"
              "apellidos" => "El-Araby"
            ]
            1 => array:2 [
              "nombre" => "Magdy A"
              "apellidos" => "Saber"
            ]
            2 => array:2 [
              "nombre" => "Noha M"
              "apellidos" => "Radwan"
            ]
            3 => array:2 [
              "nombre" => "Doha M"
              "apellidos" => "Taie"
            ]
            4 => array:2 [
              "nombre" => "Nermin M"
              "apellidos" => "Adawy"
            ]
            5 => array:2 [
              "nombre" => "Ahmad M"
              "apellidos" => "Sira"
            ]
          ]
        ]
      ]
      "resumen" => array:2 [
        0 => array:3 [
          "titulo" => "Graphical abstract"
          "clase" => "graphical"
          "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0090" class="elsevierStyleSimplePara elsevierViewall"><elsevierMultimedia ident="fig0015"></elsevierMultimedia></p></span>"
        ]
        1 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0095" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0120"><li class="elsevierStyleListItem" id="lsti0120"><span class="elsevierStyleLabel">&#8226;</span><p id="par0120" class="elsevierStylePara elsevierViewall">Liver fibrosis in biliary atresia &#40;BA&#41; progresses within a short time&#46;</p></li><li class="elsevierStyleListItem" id="lsti0125"><span class="elsevierStyleLabel">&#8226;</span><p id="par0125" class="elsevierStylePara elsevierViewall">A younger infant with BA could exhibit a higher grade of fibrosis&#46;</p></li><li class="elsevierStyleListItem" id="lsti0130"><span class="elsevierStyleLabel">&#8226;</span><p id="par0130" class="elsevierStylePara elsevierViewall">Pathological findings in BA are well studied&#44; but there are very few studies regarding temporal changes&#46;</p></li><li class="elsevierStyleListItem" id="lsti0135"><span class="elsevierStyleLabel">&#8226;</span><p id="par0135" class="elsevierStylePara elsevierViewall">Bile ductular proliferation was the only independent feature showing temporal increase&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301782?idApp=UINPBA00004N"
    "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301782/v1_202102250957/en/main.assets"
  ]
  "en" => array:18 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Alterations in chemokine receptor CCR5 activity influence tumor cell biology in human cholangiocarcinoma cell lines"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Jiaqi Yang, David Sontag, Yuewen Gong, Gerald Y&#46; Minuk"
        "autores" => array:4 [
          0 => array:3 [
            "nombre" => "Jiaqi"
            "apellidos" => "Yang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "David"
            "apellidos" => "Sontag"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Yuewen"
            "apellidos" => "Gong"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:4 [
            "nombre" => "Gerald Y&#46;"
            "apellidos" => "Minuk"
            "email" => array:1 [
              0 => "gerald.minuk@umanitoba.ca"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Section of Hepatology&#44; Department of Internal Medicine&#44; Rudy Faculty of Medicine&#44; University of Manitoba&#44; Winnipeg&#44; Manitoba&#44; Canada"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "College of Pharmacy&#44; University of Manitoba&#44; Winnipeg&#44; Manitoba&#44; Canada"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 910
            "Ancho" => 1508
            "Tamanyo" => 94521
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">CCR subtype mRNA expression in HuCCT1 and KMBC cells as determined by real-time RT-PCR&#46; Human activated peripheral blood mononuclear cells &#40;PBMCs&#41; served as positive controls&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three determinations&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1</span><span class="elsevierStyleSectionTitle" id="sect0040">Introduction</span><p id="par0045" class="elsevierStylePara elsevierViewall">Cholangiocarcinoma &#40;CCA&#41; is the most common primary malignancy of the biliary tract&#46; Traditionally&#44; CCAs are divided into intrahepatic and extrahepatic &#40;including hilar and distal duct&#41; tumors &#40;I-CCA and E-CCA respectively&#41;&#46; In addition to the anatomical distinction&#44; I-CCA and E-CCA also differ with respect their growth patterns&#46; Specifically&#44; I-CCA tend to be mass forming and often metastasize whereas E-CCA tend to grow parallel to tissue planes and rarely develop distant metastases <a class="elsevierStyleCrossRefs" href="#bib0155">&#91;1&#44;2&#93;</a>&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">Unfortunately&#44; CCA treatment &#40;both l-CCA and E-CCA&#41; is often palliative&#46; Surgical excision and liver transplantation are potentially curative but can only be offered to a small minority of CCA patients <a class="elsevierStyleCrossRefs" href="#bib0165">&#91;3&#8211;6&#93;</a>&#46; Chemotherapy and radiation therapy are largely ineffective&#46; Thus&#44; it is not surprising that mean overall CCA patient survival times are less than two years <a class="elsevierStyleCrossRefs" href="#bib0185">&#91;7&#44;8&#93;</a>&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">Chemokines are 8&#8211;14<span class="elsevierStyleHsp" style=""></span>kDa proteins consisting of four main subclasses&#58; C-&#44; CC-&#44; CXC- and CX<span class="elsevierStyleInf">3</span>C- where C represents cysteine and X any amino acid residue&#46; Beyond their traditional roles of modulating immune cell trafficking <a class="elsevierStyleCrossRef" href="#bib0195">&#91;9&#93;</a>&#44; chemokine receptors &#40;CRs&#58; CC&#44; CXC&#44; XC or CX<span class="elsevierStyleInf">3</span>C-R&#41; and ligands &#40;-L&#41; also regulate non-immune cell growth and migration <a class="elsevierStyleCrossRefs" href="#bib0195">&#91;9&#44;10&#93;</a>&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">In the setting of carcinoma&#44; chemokine gradients within the tumor microenvironment influence tumor cell survival&#44; growth and metastasis <a class="elsevierStyleCrossRef" href="#bib0205">&#91;11&#93;</a>&#46; A well-studied example is the chemotaxis complex&#58; chemokine receptor CXCR4 and its ligand CXCL12&#46; This receptor-ligand interaction has been implicated in the development of tumor metastases for in excess of 20 distinct tumor types <a class="elsevierStyleCrossRef" href="#bib0210">&#91;12&#93;</a>&#46; In addition&#44; CR and chemokine interactions influence tumor angiogenesis and the induction of tumor promoting growth factors <a class="elsevierStyleCrossRefs" href="#bib0205">&#91;11&#44;13&#44;14&#93;</a>&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">Despite the high mortality associated with CCA and importance of chemotaxis in regulating tumor cell biology&#44; there are a paucity of reports describing chemotaxis in CCA&#46; In one of the few studies reported to date&#44; CXCR4-CXCL12 interactions were described in both CCA tissues and cell lines <a class="elsevierStyleCrossRef" href="#bib0225">&#91;15&#93;</a>&#46; In another&#44; inhibition of CXCR4 expression reduced CCA tumor cell proliferation&#44; metastasis and neural invasion whereas overexpression induced tumor cell invasion <a class="elsevierStyleCrossRefs" href="#bib0230">&#91;16&#8211;20&#93;</a>&#46; Finally&#44; CXCR2-CXCL5 interactions have been implicated in CCA tumor development and inhibition of CXCR2 expression has been reported to significantly inhibit tumor growth <a class="elsevierStyleCrossRef" href="#bib0255">&#91;21&#93;</a>&#46; To date&#44; there have been no reports describing the expression profile or influence of the CCR subclass on I-CCA and E-CCA tumor cell biology&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">In the present study&#44; we documented the CCR subclass expression profiles &#40;CCR1-10&#41; in representative human I-CCA and E-CCA cell lines&#46; We also documented the effects of a commercially available CCR5 antagonist &#40;Maraviroc&#41; and agonist &#40;RANTES&#41; on I-CCA and E-CCA proliferation&#44; spheroid formation&#44; migration and invasion&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2</span><span class="elsevierStyleSectionTitle" id="sect0045">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;1</span><span class="elsevierStyleSectionTitle" id="sect0050">Cells and reagents</span><p id="par0075" class="elsevierStylePara elsevierViewall">The human I-CCA HuCCT1 cell line was purchased from Sekisui XenoTech &#40;USA&#41;&#44; and E-CCA KMBC cell line from ATCC &#40;USA&#41;&#46; Maraviroc&#44; a commercially available CCR5 antagonist was purchased from Sigma-Aldrich&#44; USA&#44; and RANTES&#44; a CCR5 agonist from Invitrogen&#44; USA&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;2</span><span class="elsevierStyleSectionTitle" id="sect0055">Cell culture</span><p id="par0080" class="elsevierStylePara elsevierViewall">HuCCT1 and KMBC cells were cultured in RPMI 1640 medium supplemented with 110<span class="elsevierStyleHsp" style=""></span>mg&#47;L sodium pyruvate&#44; 10&#37; HI- fetal bovine serum &#40;FBS&#41;&#44; 100<span class="elsevierStyleHsp" style=""></span>U&#47;mL penicillin and 100<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL streptomycin &#40;Invitrogen&#44; USA&#41;&#46; All cells were incubated at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in a humidified atmosphere of 5&#37; CO<span class="elsevierStyleInf">2</span> and 95&#37; air&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;3</span><span class="elsevierStyleSectionTitle" id="sect0060">CCR expression profiles</span><p id="par0085" class="elsevierStylePara elsevierViewall">Total RNA was extracted by TRIzol Plus RNA Purification &#40;Invitrogen&#44; USA&#41;&#46; First strand cDNA was synthesized by the iScript&#8482; cDNA synthesis kit Reverse Transcription Kit &#40;Bio-Rad&#44; USA&#41; according to the manufacturer&#39;s instructions&#46; Real-time polymerase chain reaction &#40;qPCR&#41; was performed using the Power SYBR&#174; Green PCR Master Mix &#40;Invitrogen&#44; USA&#41;&#46; The specific primers are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a> and were designed with the respective sequences from GenBank by Oligo 7 software&#46; PCR amplification was initially held at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#44; then carried out by applying 35 cycles comprised of denaturation at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 15<span class="elsevierStyleHsp" style=""></span>s&#44; annealing temperature at 58<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>min&#44; followed by a final melting curve stage using a ViiA&#8482; 7 Real-time PCR System &#40;Applied Bio-systems&#44; USA&#41;&#46; Data were analyzed by QuantStudio&#8482; Real-Time PCR Software &#40;Applied Bio-systems&#44; USA&#41;&#46; The gene cycle threshold &#40;CT&#41; value of the target was normalized to beta-actin&#46; Gene expressions were calculated by using the relative quantification method &#40;2<span class="elsevierStyleSup">&#8722;&#916;CT</span>&#41; <a class="elsevierStyleCrossRef" href="#bib0260">&#91;22&#93;</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;4</span><span class="elsevierStyleSectionTitle" id="sect0065">Cell proliferation</span><p id="par0090" class="elsevierStylePara elsevierViewall">HuCCT-1 and KMBC cells were seeded onto 96-well plates at a density of 5000 cells per well in 100<span class="elsevierStyleHsp" style=""></span>&#956;L of RPMI 1640 medium with 10&#37; FBS and incubated for 24<span class="elsevierStyleHsp" style=""></span>h&#46; The following day&#44; cell culture media &#40;CM&#41; was replaced with 5&#37; heat inactivated FBS &#40;Invitrogen&#44; USA&#41;&#46; During concentration-dependent experiments&#44; cells were exposed to CM alone or CM plus a range of Maravirocs &#40;0&#46;1&#8211;1000<span class="elsevierStyleHsp" style=""></span>nM&#41; and RANTES &#40;1&#8211;50<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41; concentrations for three days&#46; Time-dependent proliferative activity was tested from days 1 to 6 at CM alone or CM plus a constant Maraviroc concentration of 1000<span class="elsevierStyleHsp" style=""></span>nM&#44; RANTES 20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL or a combination of Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; At the end of treatments&#44; cell proliferation was measured by adding premixed WST-1 reagent &#40;Takara Bro&#44; USA&#41; and incubating at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 3<span class="elsevierStyleHsp" style=""></span>h&#46; Blank wells with CM alone were used to detect background activity&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;5</span><span class="elsevierStyleSectionTitle" id="sect0070">Spheroid formation</span><p id="par0095" class="elsevierStylePara elsevierViewall">HuCCT1 and KMBC cell lines were suspended in Dulbecco&#39;s Modified Eagle Medium&#47;Nutrient Mixture F-12 &#40;DMEM&#47;F12&#41; medium &#40;Invitrogen&#44; USA&#41;&#44; supplemented with 1<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>B-27 Serum-Free Supplement &#40;Invitrogen&#44; USA&#41;&#44; 4<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL heparin &#40;Stem cell Technologies&#44; Canada&#41;&#44; 100<span class="elsevierStyleHsp" style=""></span>U&#47;mL penicillin and 100<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL streptomycin&#44; 10<span class="elsevierStyleHsp" style=""></span>ng&#47;mL epidermal growth factor &#40;EGF&#41; &#40;Invitrogen&#44; USA&#41;&#44; and 10<span class="elsevierStyleHsp" style=""></span>ng&#47;mL basic fibroblast growth factor &#40;bFGF&#41; &#40;Invitrogen&#44; USA&#41; <a class="elsevierStyleCrossRef" href="#bib0265">&#91;23&#93;</a>&#46; Cells were subsequently seeded at densities of 200<span class="elsevierStyleHsp" style=""></span>cells per well in ultra-low attachment 96-well plates &#40;Corning&#44; USA&#41;&#44; and treated with either Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#44; or Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; After 0&#44; 3 and 6 days of culture&#44; spheroids were photographed using an inverted microscope &#40;Optika&#44; Italy&#41;&#46; Cells treated with CM only served as the controls&#46; Aggregation diameter was measured and analyzed using ImageJ software&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;6</span><span class="elsevierStyleSectionTitle" id="sect0075">Cell migration</span><p id="par0100" class="elsevierStylePara elsevierViewall">HuCCT1 and KMBC cell lines &#40;0&#46;5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">6</span>&#47;mL&#44; 2<span class="elsevierStyleHsp" style=""></span>mL per well&#41; were seeded in 6-well plates and cultured with RPMI 1640 medium supplemented with 10&#37; FBS until confluent&#46; Monolayers were then scratched with a 200<span class="elsevierStyleHsp" style=""></span>&#956;L pipette tip to generate a wound according to the method described previously <a class="elsevierStyleCrossRef" href="#bib0270">&#91;24&#93;</a>&#46; To investigate the effects of Maraviroc&#44; RANTES and Maraviroc&#47;RANTES on wound healing&#44; cells were exposed to Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#44; and Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; Phase contrast images were captured at 0&#44; 12 and 24<span class="elsevierStyleHsp" style=""></span>h&#46; Images acquired for each cell group were analyzed quantitatively by using ImageJ software&#46; By comparing images from each captured time point&#44; the migration capacity of cells was measured as the extent of wound closure by calculating wound area&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;7</span><span class="elsevierStyleSectionTitle" id="sect0080">Cell invasion</span><p id="par0105" class="elsevierStylePara elsevierViewall">Twenty-four well Transwell permeable supports with 8<span class="elsevierStyleHsp" style=""></span>&#956;m pores &#40;Corning&#44; USA&#41; were used to measure cell invasion&#46; HuCCT1 or KMBC cells &#40;1<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">5</span>&#41; in 100<span class="elsevierStyleHsp" style=""></span>&#956;L serum-free medium were added to the upper chambers&#46; The lower chambers contained 650<span class="elsevierStyleHsp" style=""></span>&#956;L RPMI 1640 medium with either 10&#37; FBS&#44; 5&#37; heat inactivated FBS&#44; Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#44; or Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; After 24<span class="elsevierStyleHsp" style=""></span>h incubation&#44; cells from the upper surface membrane were removed with a cotton swab&#46; Penetrated cells in the lower chamber were dissociated and collected by a cell dissociation buffer &#40;Invitrogen&#44; USA&#41;&#46; Collected cells were counted by a cell counter &#40;Cellometer&#174; Auto 2000&#44; Nexcelom Bioscience&#44; USA&#41;&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;8</span><span class="elsevierStyleSectionTitle" id="sect0085">Statistical analysis</span><p id="par0110" class="elsevierStylePara elsevierViewall">All experiments were performed in triplicate and repeated on a minimum of three occasions&#46; Significant differences were determined by repeated measures of ANOVA and&#47;or Tukey&#39;s multiple comparison post hoc test&#46; A Student&#39;s <span class="elsevierStyleItalic">t</span>-test was used for comparisons of two groups&#46; Data were analyzed by GraphPad Prism 6 statistical software &#40;GraphPad Software&#44; Inc&#46;&#44; USA&#41;&#46; Differences with p values below 0&#46;05 were considered statistically significant&#46;</p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3</span><span class="elsevierStyleSectionTitle" id="sect0090">Results</span><p id="par0115" class="elsevierStylePara elsevierViewall">The CCR expression profiles of HuCCT1 and KMBC cells are provided in <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#46; All 10 CCR motifs &#40;CCR1-10&#41; were expressed in HuCCT1 cells&#44; while six &#40;CCR4&#44; CCR5&#44; CCR6&#44; CCR8&#44; CCR9 and CCR10&#41; were detected in KMBC cells&#46; The CCR motifs most abundant in HuCCT1 cells were CCR5 followed by CCR7&#46; In KMBC cells&#44; CCR6 was most abundant followed by CCR5&#46; Thus&#44; as one of the higher CCR expressed subtypes&#44; the effects of the CCR5 antagonist Maraviroc&#44; agonist RANTES and Maraviroc&#47;RANTES combination on I-CCA and E-CCA cell biology were further explored&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0120" class="elsevierStylePara elsevierViewall">As shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A and B&#44; in HuCCT1 cells&#44; there were no concentration-dependent alterations in cell proliferation with Maraviroc or RANTES&#46; However&#44; in KMBC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C and D&#41;&#44; proliferation was inhibited at the highest concentration of Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; and upregulated at RANTES concentrations of 5<span class="elsevierStyleHsp" style=""></span>ng&#47;mL and higher with maximum increased proliferation occurring at 20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#46; Based on these findings&#44; all further experimentation was performed at a Maraviroc concentration of 1000<span class="elsevierStyleHsp" style=""></span>nM&#44; RANTES 20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL and Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; Of note&#44; the increase in KMBC cell proliferation that occurred with RANTES was not observed following exposure to the combination of Maraviroc&#47;RANTES &#40;data not shown&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0125" class="elsevierStylePara elsevierViewall">There were no time-dependent effects of Maraviroc or RANES on HuCCT1 cell proliferation over the six days exposure &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#41;&#46; However&#44; in KMBC cells&#44; an inhibitory effect of Maraviroc on cell proliferation was evident on day 3 and more so on day 6 &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 and 0&#46;0001 respectively&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>C&#41;&#46; On exposure to RANTES&#44; KMBC cell proliferation increased at all time periods &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>D&#41;&#46; In the presence of both Maraviroc&#47;RANTES&#44; the inhibitory effects of Maraviroc and stimulatory effects of RANTES were no longer evident &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>E&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0130" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a> demonstrates the results of spheroid formation in HuCCT1 and KMBC cells following treatment with Maraviroc&#44; RANTES&#44; or Maraviroc&#47;RANTES&#46; Neither Maraviroc&#44; RANTES nor Maraviroc&#47;RANTES altered spheroid information in HuCCT1 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>A&#41;&#46; On the other hand&#44; spheroid formation was significantly inhibited in KMBC cells following exposure to Maraviroc &#40;Day 3 dimensions for Maraviroc&#58; 145<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>6<span class="elsevierStyleHsp" style=""></span>nM versus control&#58; 244&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;2<span class="elsevierStyleHsp" style=""></span>nM&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#59; Day 6&#58; Maraviroc&#58; 170&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>17&#46;6<span class="elsevierStyleHsp" style=""></span>nM versus control&#58; 322&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>23&#46;7<span class="elsevierStyleHsp" style=""></span>nM&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#41;&#44; while RANTES alone had no effect&#46; In the presence of both Maraviroc&#47;RANTES&#44; the inhibitory effect of Maraviroc on KMBC cells was no longer evident&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><p id="par0135" class="elsevierStylePara elsevierViewall">The effects of Maraviroc&#44; RANTES and Maraviroc&#47;RANTES on cell migration were documented by the scratch wound healing assay &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>&#41;&#46; Here&#44; Maraviroc inhibited HuCCT1 cell migration at 12<span class="elsevierStyleHsp" style=""></span>h &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A and B&#41;&#44; while RANTES had no significant effect&#46; The inhibitory effect of Maraviroc was no longer evident in the presence of Maraviroc&#47;RANTES&#46; In KMBC cells the inhibition of Maraviroc at 12 and 24<span class="elsevierStyleHsp" style=""></span>h was not significant but increases in cell migration occurred with RANTES at both time intervals&#46; In the presence of Maraviroc&#47;RANTES&#44; the increases associated with RANTES alone were no longer evident &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>C and D&#41;&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia><p id="par0140" class="elsevierStylePara elsevierViewall">Finally&#44; regarding cell invasion&#44; Maraviroc inhibited HuCCT1 cell invasion &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>A&#41;&#44; whereas RANTES had no effect&#46; The inhibitory effect of Maraviroc was no longer evident in the presence of Maraviroc&#47;RANTES&#46; In KMBC cells&#44; Maraviroc inhibited while RANTES increased cell invasion &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>B&#41;&#46; Of note&#44; the increase observed with RANTES persisted in the presence of Maraviroc&#47;RANTES&#46;</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">4</span><span class="elsevierStyleSectionTitle" id="sect0095">Discussion</span><p id="par0145" class="elsevierStylePara elsevierViewall">The results of this study indicate that CCR expression profiles differed in these representative human I-CCA and E-CCA cell lines&#46; The results also indicate that a specific CCR5 antagonist and agonist&#44; can alter tumor cell biology in a cell-specific manner with the CCR5 antagonist being associated with attenuated and agonist&#44; enhanced tumor cell activities&#46; Together&#44; these findings could help to explain the different tumor growth characteristics observed in I-CCA and E-CCA&#46; They also raise the possibility that CCR5 antagonists may have therapeutic benefit in the treatment of CCA&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">Unfortunately there have been no previous reports documenting the complete CCR expression profile in human CCA tissues or cell lines&#46; Thus&#44; a comparative analysis with previous data could not be undertaken&#46; However&#44; the CCR expression profile detected in I-CCA was similar to that described for human hepatocellular carcinoma <a class="elsevierStyleCrossRef" href="#bib0275">&#91;25&#93;</a>&#44; a finding that may reflect the common risk factors and&#47;or origin of these tumors <a class="elsevierStyleCrossRef" href="#bib0280">&#91;26&#93;</a>&#46; Moreover&#44; significant expression of CCR5 is in keeping with the high expression observed in the livers of patients with chronic liver disease and its tumor promoting properties which include activation of mTOR and AKT pathways <a class="elsevierStyleCrossRef" href="#bib0285">&#91;27&#93;</a>&#46;</p><p id="par0155" class="elsevierStylePara elsevierViewall">Overall&#44; the CCR5 antagonist Maraviroc inhibited HuCCT1 growth promoting properties and to a lesser extent&#44; in KMBC cells&#46; Specifically&#44; Maraviroc inhibited HuCCT1 proliferation&#44; migration and invasion whereas in KMBC cells&#44; spheroid formation and invasion were inhibited&#46; Somewhat surprisingly&#44; with the exception of KMBC cell invasion&#44; RANTES alone did not have opposing effects&#46; Presumably&#44; this finding relates to constitutive CCR5 activation by an autocrine ligand <a class="elsevierStyleCrossRef" href="#bib0290">&#91;28&#93;</a>&#46; That the addition of Maraviroc did not reverse the increase in cell invasion associated with RANTES&#44; suggests the RANTES effect may be CCR5-independent&#46; However&#44; it is also possible the process is concentration-dependent and higher concentrations of Maraviroc may have been more effective&#46;</p><p id="par0160" class="elsevierStylePara elsevierViewall">In terms of clinical relevance&#44; the results of this study and those obtained with the commercially available CCR5 antagonist Maraviroc in particular&#44; suggest that in CCA&#44; therapeutic benefit might be derived from CCR5 inhibition&#46; Such an approach has been applied to gastric cancers with some success <a class="elsevierStyleCrossRef" href="#bib0295">&#91;29&#93;</a>&#46; The possibility is rendered feasible by the fact the inhibitory concentration of Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41; is well within the range reported in the blood of patients treated with this agent <a class="elsevierStyleCrossRef" href="#bib0300">&#91;30&#93;</a>&#46; Also to be considered is whether the use of a CCR5 antagonist in the treatment of primary sclerosing cholangitis &#40;PSC&#41;&#44; a condition associated with a significantly increased risk of CCA&#44; may help to prevent the development or course of these tumors in PSC patients&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">Having confirmed that at least in these two cell lines&#44; I-CCA and E-CCA possess different CCR expression profiles and respond differently to a CCR5 antagonist and agonist&#44; the question arises as to why such differences exist&#46; Both I-CCA and E-CCA consist of malignant cholangiocytes&#46; However&#44; when analyzed for differences in the expression of cancer stem cell &#40;CSC&#41; markers&#44; significant differences are evident&#46; Specifically&#44; CSC markers are expressed in greater than 90&#37; of HuCCT1 cells but less than 5&#37; of KMBCs cells &#40;authors unpublished data&#41;&#46; Given that the prevalence of CSCs influences tumor cell biology&#44; this could explain the differences observed&#46; Clearly&#44; further research is required to test this hypothesis&#46;</p><p id="par0170" class="elsevierStylePara elsevierViewall">There are a number of limitations to this study that warrant emphases&#46; First&#44; only one I-CCA and one E-CCA cell line were studied&#46; Whether similar results would have been obtained with additional cell lines remains to be determined&#46; Second&#44; due to the lack of commercially available CCR antagonists other than Maraviroc&#44; only the effects of CCR5 inhibition were documented&#46; When available&#44; results obtained with a CCR6 antagonist&#44; the CCR subtype expressed to the greatest extent in KMBC cells&#44; will be of interest&#46; Third&#44; because CCR5 receptor inhibition and activation with Maraviroc and RANTES respectively have been documented in all other cells studied to date&#44; confirmation of the effects of these agents on receptor activity per se was not undertaken&#46; Finally&#44; the results described reflect preliminary findings of an in vitro cell based system&#46; Additional studies in animal models of CCA are warranted&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">In conclusion&#44; the results of this study support clinical observations that I-CCA and E-CCA have different tumor growth and invasive properties&#46; They also raise the possibility that these differences reflect differences in CCR expression profiles&#46; In general&#44; exposure to a specific CCR5 antagonist inhibited while an agonist enhanced tumor cell properties&#46; Additional studies are required to determine whether inhibition of CCR5 has benefit in the treatment of CCA in humans&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Lay summary</span><p id="par0180" class="elsevierStylePara elsevierViewall">Activation of chemokine receptors can alter the behavior of normal and cancerous cells&#46; This study revealed that bile duct cancers which develop within the liver express different chemokine receptors than those that develop outside the liver&#46; This finding may help to explain why the two types of bile duct cancer behave differently&#46; Importantly&#44; the results also indicate the behavior of bile duct cancer cells can be favorably altered by blocking certain chemokine receptors&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Financial support</span><p id="par0185" class="elsevierStylePara elsevierViewall">This research was supported by a grant &#40;<span class="elsevierStyleGrantNumber" refid="gs1">315741</span>&#41; from the <span class="elsevierStyleGrantSponsor" id="gs1">Canadian Liver Foundation and Kenroc Builders Inc</span>&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Contributions</span><p id="par0190" class="elsevierStylePara elsevierViewall">Concept &#38; design&#58; JY&#44; YG&#44; GYM&#46; Experiments and procedures&#58; JY&#44; DS&#46; Data analysis&#58; JY&#44; YG&#44; GYM&#46; Writing of article&#58; JY&#44; YG&#44; GYM&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Conflict of interest</span><p id="par0195" class="elsevierStylePara elsevierViewall">There are no conflicts of interest to report&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1471590"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction and objectives"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1340220"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Cells and reagents"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Cell culture"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "CCR expression profiles"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Cell proliferation"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Spheroid formation"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Cell migration"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Cell invasion"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Results"
        ]
        5 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Lay summary"
        ]
        7 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Conflict of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-08-13"
    "fechaAceptado" => "2020-09-18"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1340220"
          "palabras" => array:10 [
            0 => "Chemotaxis"
            1 => "Chemokines"
            2 => "Chemokine receptors"
            3 => "CCR5"
            4 => "CCR6"
            5 => "Maraviroc"
            6 => "Cholangiocarcinoma"
            7 => "Chemokine receptor antagonists"
            8 => "Cell lines"
            9 => "Rantes"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction and objectives</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Intrahepatic &#40;I-CCA&#41; and extrahepatic &#40;E-CCA&#41; cholangiocarcinoma &#40;CCA&#41; have different growth patterns and risks for tumor metastasis&#46; Inhibition and&#47;or activation of the chemokine receptor CCR subclasses have been reported to alter tumor cell biology in non-CCA cancers&#46; In this study we documented CCR expression profiles in representative human I-CCA and E-CCA cell lines and the in vitro effects of CCR antagonists and agonists on tumor cell biology&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">CCR expression profiles were documented by real-time reverse transcription polymerase chain reaction&#59; cell proliferation by WST-1&#59; spheroid formation by sphere dimensions in anchorage-free medium&#59; cell migration by wound healing and invasion by Transwell invasion chambers&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">All 10 CCR motifs &#40;CCR1-10&#41; were expressed in the I-CCA&#44; HuCCT1 cell line and six &#40;CCR4&#44; 5&#44; 6&#44; 8&#44; 9 and 10&#41; in the E-CCA&#44; KMBC cell line&#46; In HuCCT1 cells&#44; CCR5 expression was most abundant whereas in KMBC cells&#44; CCR6 followed by CCR5 were most abundant&#46; The CCR5 antagonist Maraviroc significantly inhibited cell proliferation&#44; migration and invasion in HuCCT1 cells&#44; and spheroid formation and invasion in KMBC cells&#46; The CCR5 agonist RANTES had no effect on HuCCT1 cells but increased cell proliferation&#44; migration and invasion of KMBC cells&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">These results suggest that CCR expression profiles differ in I-CCA and E-CCA&#46; They also indicate that CCR5 antagonists and agonists have cell-specific effects but in general&#44; CCR5 inactivation inhibits CCA tumor cell aggressiveness&#46; Additional research is required to determine whether CCR5 inactivation is of value in the treatment of CCA in humans&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction and objectives"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "nomenclatura" => array:1 [
      0 => array:3 [
        "identificador" => "nom0005"
        "titulo" => "<span class="elsevierStyleSectionTitle" id="sect0035">Abbreviations</span>"
        "listaDefinicion" => array:1 [
          0 => array:1 [
            "definicion" => array:8 [
              0 => array:2 [
                "termino" => "CCR"
                "descripcion" => "<p id="par0005" class="elsevierStylePara elsevierViewall">chemokine receptors</p>"
              ]
              1 => array:2 [
                "termino" => "I-CCA"
                "descripcion" => "<p id="par0010" class="elsevierStylePara elsevierViewall">intra-hepatic cholangiocarcinoma</p>"
              ]
              2 => array:2 [
                "termino" => "E-CCA"
                "descripcion" => "<p id="par0015" class="elsevierStylePara elsevierViewall">extra-hepatic cholangiocarcinoma</p>"
              ]
              3 => array:2 [
                "termino" => "WST-1"
                "descripcion" => "<p id="par0020" class="elsevierStylePara elsevierViewall">water-soluble tetrazolium salt-1</p>"
              ]
              4 => array:2 [
                "termino" => "RANTES"
                "descripcion" => "<p id="par0025" class="elsevierStylePara elsevierViewall">regulated on activation&#44; normal T cell expressed and secreted</p>"
              ]
              5 => array:2 [
                "termino" => "FBS"
                "descripcion" => "<p id="par0030" class="elsevierStylePara elsevierViewall">fetal bovine serum</p>"
              ]
              6 => array:2 [
                "termino" => "mTOR"
                "descripcion" => "<p id="par0035" class="elsevierStylePara elsevierViewall">mechanistic target of rapamycin</p>"
              ]
              7 => array:2 [
                "termino" => "CSC"
                "descripcion" => "<p id="par0040" class="elsevierStylePara elsevierViewall">cancer stem cells</p>"
              ]
            ]
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 910
            "Ancho" => 1508
            "Tamanyo" => 94521
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">CCR subtype mRNA expression in HuCCT1 and KMBC cells as determined by real-time RT-PCR&#46; Human activated peripheral blood mononuclear cells &#40;PBMCs&#41; served as positive controls&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three determinations&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2691
            "Ancho" => 3167
            "Tamanyo" => 538565
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Dose-dependent effects of the CCR5 antagonist &#40;Maraviroc&#41; and agonist &#40;RANTES&#41; on HuCCT1 and KMBC cell proliferation&#46; HuCCT1 and KMBC cells were exposed to Maraviroc or RANTES for 3 days&#46; Panels A and B&#58; Dose-dependent effects of Maraviroc and RANTES on HuCCT1 cell and Panels C and D&#58; KMBC cell proliferation&#46; The stimulatory effects of RANTES on KMBC cell proliferation were no longer evident when KMBC cells were exposure to the combination of Maraviroc&#47;RANTES &#40;M<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>R&#41;&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; &#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#44; &#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#44; &#42;&#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2062
            "Ancho" => 3167
            "Tamanyo" => 251039
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Time-dependent effects of the CCR5 antagonist &#40;Maraviroc&#41; and agonist &#40;RANTES&#41; on HuCCT1 and KMBC cell proliferation&#46; HuCCT1 and KMBC cells were exposed to Maraviroc&#44; RANTES&#44; or Maraviroc&#47;RANTES for 1&#44; 3&#44; and 6 days&#46; Panels A and B&#58; Time-dependent effects of Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41; and RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41; on HuCCT1 cell proliferation&#46; Panels C and D&#58; Time-dependent effects of Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41; and RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41; on KMBC cells&#46; The inhibitory effects of Maraviroc on days 3 and 6 and stimulatory effects of RANTES at all time points on KMBC cell proliferation were no longer evident when KMBC cells were exposure to the combination of Maraviroc&#47;RANTES &#40;Panel E&#41;&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; &#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 2451
            "Ancho" => 3167
            "Tamanyo" => 367507
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Spheroid formation by HuCCT1 and KMBC cells in the presence of the CCR5 antagonist Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; agonist RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#44; and a combination of Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; Cells were seeded at densities of 200<span class="elsevierStyleHsp" style=""></span>cells&#47;well in ultra-low 96-well plates to generate spheroids&#46; Panel A&#58; Spheroid formation in HuCCT1 cells was not influenced by Maraviroc&#44; RANTES&#44; or Maraviroc&#47;RANTES&#46; Sale bar&#58; 50 and 100<span class="elsevierStyleHsp" style=""></span>&#956;m&#46; Panel B&#58; Maraviroc inhibited KMBC spheroid formation on days 3 and 6 while RANTES had no effect&#46; The inhibitory effect of Maraviroc was no longer evident when KMBC cells were exposed to the combination of Maraviroc&#47;RANTES&#46; Sale bar&#58; 50 and 250<span class="elsevierStyleHsp" style=""></span>&#956;m&#46; Panel C&#58; The diameters of spheroid formation were measured by software ImageJ&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; &#42;&#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 2799
            "Ancho" => 3167
            "Tamanyo" => 519743
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Migration of HuCCT1 and KMBC cells after exposure to the CCR5 antagonist Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; agonist RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41; and combination of Maraviroc&#47;RANTES &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; Panels A and B&#58; Results in HuCCT1cells&#44; and Panels C and D&#58; in KMBC cells&#46; Maraviroc delayed HuCCT1 wound closure at 12<span class="elsevierStyleHsp" style=""></span>h while RANTES increased KMBC wound closure at 12 and 24<span class="elsevierStyleHsp" style=""></span>h&#46; Both the inhibitory effects of Maraviroc and stimulatory effects of RANTES were no longer evident when cells were exposed to the combination of Maraviroc&#47;RANTES&#46; Sale bar&#58; 250<span class="elsevierStyleHsp" style=""></span>&#956;m&#46; ImageJ analysis of cell migration was determined by measuring wound closure from phase-contrast images&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; &#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;&#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "fig0030"
        "etiqueta" => "Fig&#46; 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1545
            "Ancho" => 1508
            "Tamanyo" => 215135
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Invasion of HuCCT1 and KMBC cells were documented with the use of Transwell invasion chambers&#44; in the presence of Maraviroc &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#41;&#44; RANTES &#40;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41; and the combination of Maraviroc&#47;RANTES combination &#40;1000<span class="elsevierStyleHsp" style=""></span>nM&#47;20<span class="elsevierStyleHsp" style=""></span>ng&#47;mL&#41;&#46; Panel A&#58; Results in HuCCT1 cells and Panel B&#58; in KMBC cells&#46; Maraviroc inhibited HuCCT1 and KMBC cell invasion while RANTES increased KMBC cell invasion&#46; The stimulatory effect of RANTES on KMBC cell persisted in the presence of Maraviroc&#47;RANTES&#46; Data presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; &#42;&#58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primers &#40;5&#8242;&#8211;3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm &#40;&#176;C&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Size &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR1</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GACTATGACACGACCACAGAGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">117&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TACCAAGGAGTACAGAGGGGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR2</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGTTCAGAAGGTATCTCTCGGTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">115&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCGTGTTTGTTGAAGTCACT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR3</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTCATCATGGCGGTGTTTTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">155&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAGTGGGAGTAGGCGATCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR4</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGAAGGCATCAAGGCATTTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">137&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACACATCAGTCATGGACCTGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR5</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTCTGGGCTCCCTACAACATT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTGGTCCAACCTGTTAGAGCTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR6</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTCAGCGATGTTTTCGACTCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">134&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCAATCGGTACAAATAGCCTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR7</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGAGGTCACGGACGATTACAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">134&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTAGGCCCACGAAACAAATGAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR8</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTGTGACAACAGTGACCGACT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">173&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTCTTGCAGACCACAAGGAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR9</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATGTCAGGCAGTTTGCGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">105&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCAGTACCAGTAGACAAGGAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">CCR10</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATTACTCTGGGGATGAAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">117&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCACGGTCAGGGAGACACT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#946;-actin</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCCTCTCCCAAGTCCACACAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">131&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGGCACGAAGGCTCATCATTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2532315.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Primers and conditions of real-time polymerase chain reaction&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:30 [
            0 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "&#91;1&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cholangiocarcinoma&#46; A spectrum of intrahepatic&#44; perihilar&#44; and distal tumors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Nakeeb"
                            1 => "H&#46;A&#46; Pitt"
                            2 => "T&#46;A&#46; Sohn"
                            3 => "J&#46; Coleman"
                            4 => "R&#46;A&#46; Abrams"
                            5 => "S&#46; Piantadosi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/00000658-199610000-00005"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Surg"
                        "fecha" => "1996"
                        "volumen" => "224"
                        "numero" => "4"
                        "paginaInicial" => "463"
                        "paginaFinal" => "473"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8857851"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "&#91;2&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Perioperative and long-term outcome of intraheptic cholangiocarcinoma involving the hepatic hilus after curative-intent resection&#58; comparison with peripheral intrahepatic cholangiocarcinoma and hilar cholangiocarcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46;F&#46; Zhang"
                            1 => "F&#46; Bagante"
                            2 => "Q&#46; Chen"
                            3 => "E&#46;W&#46; Beal"
                            4 => "Y&#46; Lv"
                            5 => "M&#46; Weiss"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.surg.2018.01.001"
                      "Revista" => array:7 [
                        "tituloSerie" => "Surgery"
                        "fecha" => "2018"
                        "volumen" => "163"
                        "numero" => "5"
                        "paginaInicial" => "1114"
                        "paginaFinal" => "1120"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29398035"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "&#91;3&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cholangiocarcinoma&#58; thirty-one-year experience with 564 patients at a single institution"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;L&#46; DeOliveira"
                            1 => "S&#46;C&#46; Cunningham"
                            2 => "J&#46;L&#46; Cameron"
                            3 => "F&#46; Kamangar"
                            4 => "J&#46;M&#46; Winter"
                            5 => "K&#46;D&#46; Lillemoe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/01.sla.0000251366.62632.d3"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Surg"
                        "fecha" => "2007"
                        "volumen" => "245"
                        "numero" => "5"
                        "paginaInicial" => "755"
                        "paginaFinal" => "762"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17457168"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "&#91;4&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Two hundred forty consecutive portal vein embolizations before extended hepatectomy for biliary cancer&#58; surgical outcome and long-term follow-up"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Nagino"
                            1 => "J&#46; Kamiya"
                            2 => "H&#46; Nishio"
                            3 => "T&#46; Ebata"
                            4 => "T&#46; Arai"
                            5 => "Y&#46; Nimura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/01.sla.0000201482.11876.14"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Surg"
                        "fecha" => "2006"
                        "volumen" => "243"
                        "numero" => "3"
                        "paginaInicial" => "364"
                        "paginaFinal" => "372"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16495702"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "&#91;5&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Treatment and prognosis for patients with intrahepatic cholangiocarcinoma&#58; systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46;N&#46; Mavros"
                            1 => "K&#46;P&#46; Economopoulos"
                            2 => "V&#46;G&#46; Alexiou"
                            3 => "T&#46;M&#46; Pawlik"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/jamasurg.2013.5137"
                      "Revista" => array:7 [
                        "tituloSerie" => "JAMA Surg"
                        "fecha" => "2014"
                        "volumen" => "149"
                        "numero" => "6"
                        "paginaInicial" => "565"
                        "paginaFinal" => "574"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24718873"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "&#91;6&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Current surgical management of hilar and intrahepatic cholangiocarcinoma&#58; the role of resection and orthotopic liver transplantation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "H&#46; Petrowsky"
                            1 => "J&#46;C&#46; Hong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Transpl Proc"
                        "fecha" => "2009"
                        "volumen" => "41"
                        "numero" => "10"
                        "paginaInicial" => "4023"
                        "paginaFinal" => "4035"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "&#91;7&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Survival analysis of intrahepatic cholangiocarcinoma after resection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;Y&#46; Cho"
                            1 => "S&#46;J&#46; Park"
                            2 => "S&#46;H&#46; Kim"
                            3 => "S&#46;S&#46; Han"
                            4 => "Y&#46;K&#46; Kim"
                            5 => "K&#46;W&#46; Lee"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1245/s10434-010-0938-y"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Surg Oncol"
                        "fecha" => "2010"
                        "volumen" => "17"
                        "numero" => "7"
                        "paginaInicial" => "1823"
                        "paginaFinal" => "1830"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20165987"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "&#91;8&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical features and survival outcome of locally advanced extrahepatic cholangiocarcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;J&#46; Lee"
                            1 => "W&#46; Kwon"
                            2 => "M&#46;J&#46; Kang"
                            3 => "J&#46;Y&#46; Jang"
                            4 => "Y&#46;R&#46; Chang"
                            5 => "W&#46; Jung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Korean J Hepato-biliary-pancreatic Surg"
                        "fecha" => "2014"
                        "volumen" => "18"
                        "numero" => "1"
                        "paginaInicial" => "1"
                        "paginaFinal" => "8"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "&#91;9&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The many roles of chemokines and chemokine receptors in inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "I&#46;F&#46; Charo"
                            1 => "R&#46;M&#46; Ransohoff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMra052723"
                      "Revista" => array:7 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2006"
                        "volumen" => "354"
                        "numero" => "6"
                        "paginaInicial" => "610"
                        "paginaFinal" => "621"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16467548"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "&#91;10&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chemokines&#44; chemokine receptors and the gastrointestinal system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "H&#46; Miyazaki"
                            1 => "K&#46; Takabe"
                            2 => "W&#46;A&#46; Yeudall"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v19.i19.2847"
                      "Revista" => array:7 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2013"
                        "volumen" => "19"
                        "numero" => "19"
                        "paginaInicial" => "2847"
                        "paginaFinal" => "2863"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23704819"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "&#91;11&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cancer and the chemokine network"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "F&#46; Balkwill"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrc1388"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Cancer"
                        "fecha" => "2004"
                        "volumen" => "4"
                        "numero" => "7"
                        "paginaInicial" => "540"
                        "paginaFinal" => "550"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15229479"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "&#91;12&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The significance of cancer cell expression of the chemokine receptor CXCR4"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "F&#46; Balkwill"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.semcancer.2003.10.003"
                      "Revista" => array:7 [
                        "tituloSerie" => "Semin Cancer Biol"
                        "fecha" => "2004"
                        "volumen" => "14"
                        "numero" => "3"
                        "paginaInicial" => "171"
                        "paginaFinal" => "179"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15246052"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "&#91;13&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chemokines in cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;T&#46; Chow"
                            1 => "A&#46;D&#46; Luster"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1158/2326-6066.CIR-14-0160"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cancer Immunol Res"
                        "fecha" => "2014"
                        "volumen" => "2"
                        "numero" => "12"
                        "paginaInicial" => "1125"
                        "paginaFinal" => "1131"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25480554"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "&#91;14&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chemokine receptor CXCR7 regulates the invasion&#44; angiogenesis and tumor growth of human hepatocellular carcinoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Zheng"
                            1 => "H&#46;Y&#46; Li"
                            2 => "X&#46;L&#46; Su"
                            3 => "X&#46;Y&#46; Wang"
                            4 => "T&#46; Tian"
                            5 => "F&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1756-9966-29-31"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Exp Clin Cancer Res"
                        "fecha" => "2010"
                        "volumen" => "29"
                        "paginaInicial" => "31"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20380740"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "&#91;15&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Roles of the MEK1&#47;2 and AKT pathways in CXCL12&#47;CXCR4 induced cholangiocarcinoma cell invasion"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K&#46; Leelawat"
                            1 => "S&#46; Leelawat"
                            2 => "S&#46; Narong"
                            3 => "S&#46; Hongeng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v13.i10.1561"
                      "Revista" => array:7 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2007"
                        "volumen" => "13"
                        "numero" => "10"
                        "paginaInicial" => "1561"
                        "paginaFinal" => "1568"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17461449"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "&#91;16&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Possible regulation of migration of intrahepatic cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor necrosis factor-alpha and stromal-derived factor-1 released in stroma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Ohira"
                            1 => "M&#46; Sasaki"
                            2 => "K&#46; Harada"
                            3 => "Y&#46; Sato"
                            4 => "Y&#46; Zen"
                            5 => "K&#46; Isse"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2353/ajpath.2006.050204"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Pathol"
                        "fecha" => "2006"
                        "volumen" => "168"
                        "numero" => "4"
                        "paginaInicial" => "1155"
                        "paginaFinal" => "1168"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16565491"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "&#91;17&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46;Y&#46; Tan"
                            1 => "S&#46; Chang"
                            2 => "W&#46; Liu"
                            3 => "H&#46;H&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5009/gnl.2014.8.2.196"
                      "Revista" => array:7 [
                        "tituloSerie" => "Gut Liver"
                        "fecha" => "2014"
                        "volumen" => "8"
                        "numero" => "2"
                        "paginaInicial" => "196"
                        "paginaFinal" => "204"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24672662"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "&#91;18&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Delivery of miR-200c mimic with poly&#40;amido amine&#41; cxcr4 antagonists for combined inhibition of cholangiocarcinoma cell invasiveness"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Xie"
                            1 => "C&#46;J&#46; Wehrkamp"
                            2 => "J&#46; Li"
                            3 => "Y&#46; Wang"
                            4 => "Y&#46; Wang"
                            5 => "J&#46;L&#46; Mott"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Pharmaceut"
                        "fecha" => "2016"
                        "volumen" => "13"
                        "numero" => "3"
                        "paginaInicial" => "1073"
                        "paginaFinal" => "1080"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "&#91;19&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Blockade of CXCL12&#47;CXCR4 signaling inhibits intrahepatic cholangiocarcinoma progression and metastasis via inactivation of canonical Wnt pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46; Zhao"
                            1 => "J&#46; Wang"
                            2 => "C&#46; Qin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13046-014-0103-8"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Exp Clin Cancer Res"
                        "fecha" => "2014"
                        "volumen" => "33"
                        "paginaInicial" => "103"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25471741"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "&#91;20&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CD24 induces the invasion of cholangiocarcinoma cells by upregulating CXCR4 and increasing the phosphorylation of ERK1&#47;2"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K&#46; Leelawat"
                            1 => "S&#46; Keeratichamroen"
                            2 => "S&#46; Leelawat"
                            3 => "R&#46; Tohtong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ol.2013.1587"
                      "Revista" => array:7 [
                        "tituloSerie" => "Oncol Lett"
                        "fecha" => "2013"
                        "volumen" => "6"
                        "numero" => "5"
                        "paginaInicial" => "1439"
                        "paginaFinal" => "1446"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24179538"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "&#91;21&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Blockage of CXCR2 suppresses tumor growth of intrahepatic cholangiocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Sueoka"
                            1 => "T&#46; Hirano"
                            2 => "Y&#46; Uda"
                            3 => "Y&#46; Iimuro"
                            4 => "J&#46; Yamanaka"
                            5 => "J&#46; Fujimoto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.surg.2013.12.037"
                      "Revista" => array:8 [
                        "tituloSerie" => "Surgery"
                        "fecha" => "2014"
                        "volumen" => "155"
                        "numero" => "4"
                        "paginaInicial" => "640"
                        "paginaFinal" => "649"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24582495"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0026049517301853"
                          "estado" => "S300"
                          "issn" => "00260495"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "&#91;22&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2&#40;-Delta Delta C&#40;T&#41;&#41; Method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46;J&#46; Livak"
                            1 => "T&#46;D&#46; Schmittgen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1006/meth.2001.1262"
                      "Revista" => array:7 [
                        "tituloSerie" => "Methods"
                        "fecha" => "2001"
                        "volumen" => "25"
                        "numero" => "4"
                        "paginaInicial" => "402"
                        "paginaFinal" => "408"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "&#91;23&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of low-density lipoprotein docosahexaenoic acid nanoparticles on cancer stem cells isolated from human hepatoma cell lines"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46; Yang"
                            1 => "Y&#46; Gong"
                            2 => "D&#46;P&#46; Sontag"
                            3 => "I&#46; Corbin"
                            4 => "G&#46;Y&#46; Minuk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11033-018-4252-2"
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Biol Rep"
                        "fecha" => "2018"
                        "volumen" => "45"
                        "numero" => "5"
                        "paginaInicial" => "1023"
                        "paginaFinal" => "1036"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30069818"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "&#91;24&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In vitro scratch assay&#58; a convenient and inexpensive method for analysis of cell migration in vitro"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46;C&#46; Liang"
                            1 => "A&#46;Y&#46; Park"
                            2 => "J&#46;L&#46; Guan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nprot.2007.30"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Protoc"
                        "fecha" => "2007"
                        "volumen" => "2"
                        "numero" => "2"
                        "paginaInicial" => "329"
                        "paginaFinal" => "333"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17406593"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "&#91;25&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chemokines and their receptors play important roles in the development of hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;M&#46; Liang"
                            1 => "L&#46; Chen"
                            2 => "H&#46; Hu"
                            3 => "H&#46;Y&#46; Ma"
                            4 => "L&#46;L&#46; Gao"
                            5 => "J&#46; Qin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4254/wjh.v7.i10.1390"
                      "Revista" => array:7 [
                        "tituloSerie" => "World J Hepatol"
                        "fecha" => "2015"
                        "volumen" => "7"
                        "numero" => "10"
                        "paginaInicial" => "1390"
                        "paginaFinal" => "1402"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26052384"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "&#91;26&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification and characterization of tumorigenic liver cancer stem cells by CD133 and CD24"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "D&#46;F&#46; Feng"
                            1 => "P&#46; Gong"
                            2 => "W&#46; Li"
                            3 => "H&#46; Xu"
                            4 => "T&#46; Zhang"
                            5 => "N&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biomater Tissue Eng"
                        "fecha" => "2015"
                        "volumen" => "5"
                        "paginaInicial" => "635"
                        "paginaFinal" => "646"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "&#91;27&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The chemokine system&#44; and its CCR5 and CXCR4 receptors&#44; as potential targets for personalized therapy in cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "P&#46; Weitzenfeld"
                            1 => "A&#46; Ben-Baruch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.canlet.2013.10.006"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cancer Lett"
                        "fecha" => "2014"
                        "volumen" => "352"
                        "numero" => "1"
                        "paginaInicial" => "36"
                        "paginaFinal" => "53"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24141062"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "&#91;28&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Autocrine CCL5 signaling promotes invasion and migration of CD133&#43; ovarian cancer stem-like cells via NF-kappaB-mediated MMP-9 upregulation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Long"
                            1 => "R&#46; Xie"
                            2 => "T&#46; Xiang"
                            3 => "Z&#46; Zhao"
                            4 => "S&#46; Lin"
                            5 => "Z&#46; Liang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/stem.1194"
                      "Revista" => array:7 [
                        "tituloSerie" => "Stem Cells"
                        "fecha" => "2012"
                        "volumen" => "30"
                        "numero" => "10"
                        "paginaInicial" => "2309"
                        "paginaFinal" => "2319"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22887854"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "&#91;29&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CCR5 antagonism by maraviroc reduces the potential for gastric cancer cell dissemination"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Mencarelli"
                            1 => "L&#46; Graziosi"
                            2 => "B&#46; Renga"
                            3 => "S&#46; Cipriani"
                            4 => "C&#46; D&#8217;Amore"
                            5 => "D&#46; Francisci"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1593/tlo.13499"
                      "Revista" => array:7 [
                        "tituloSerie" => "Transl Oncol"
                        "fecha" => "2013"
                        "volumen" => "6"
                        "numero" => "6"
                        "paginaInicial" => "784"
                        "paginaFinal" => "793"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24466382"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "&#91;30&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Population pharmacokinetic&#47;pharmacodynamic analysis of CCR5 receptor occupancy by maraviroc in healthy subjects and HIV-positive patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;C&#46; Rosario"
                            1 => "P&#46; Jacqmin"
                            2 => "P&#46; Dorr"
                            3 => "I&#46; James"
                            4 => "T&#46;M&#46; Jenkins"
                            5 => "S&#46; Abel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2125.2008.03140.x"
                      "Revista" => array:7 [
                        "tituloSerie" => "Br J Clin Pharmacol"
                        "fecha" => "2008"
                        "volumen" => "65"
                        "numero" => "Suppl&#46; 1"
                        "paginaInicial" => "86"
                        "paginaFinal" => "94"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18333870"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/16652681/000000210000000C/v1_202102250957/S1665268120301800/v1_202102250957/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "78265"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/16652681/000000210000000C/v1_202102250957/S1665268120301800/v1_202102250957/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301800?idApp=UINPBA00004N"
]

Article information

ISSN: 16652681
Original language: English

DOI:10.1016/j.aohep.2020.09.009

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	3	0	3
2024 October	18	7	25
2024 September	28	0	28
2024 August	30	7	37
2024 July	22	7	29
2024 June	20	4	24
2024 May	15	7	22
2024 April	29	15	44
2024 March	32	9	41
2024 February	22	15	37
2024 January	21	7	28
2023 December	25	4	29
2023 November	30	4	34
2023 October	40	9	49
2023 September	15	6	21
2023 August	20	7	27
2023 July	18	8	26
2023 June	26	8	34
2023 May	53	6	59
2023 April	47	8	55
2023 March	17	5	22
2023 February	8	7	15
2023 January	14	12	26
2022 December	21	3	24
2022 November	24	8	32
2022 October	22	17	39
2022 September	29	14	43
2022 August	27	12	39
2022 July	9	7	16
2022 June	14	6	20
2022 May	10	8	18
2022 April	12	7	19
2022 March	27	8	35
2022 February	24	7	31
2022 January	72	4	76
2021 December	70	14	84
2021 November	43	15	58
2021 October	64	12	76
2021 September	35	7	42
2021 August	33	7	40
2021 July	11	8	19
2021 June	12	8	20
2021 May	22	6	28
2021 April	105	14	119
2021 March	58	16	74
2021 February	22	6	28
2021 January	12	7	19
2020 December	9	5	14
2020 November	3	0	3
2020 October	1	3	4

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter