Original article
MicroRNA-494-3p prevents liver fibrosis and attenuates hepatic stellate cell activation by inhibiting proliferation and inducing apoptosis through targeting TRAF3
Hualong Li, Lei Zhang
, Nan Cai, Bing Zhang, Shaomei Sun
Corresponding author
zhlei_leizh@163.com
Corresponding author at: Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, 717 Jinyu Street, Muping District, Yantai, Shandong Province, 264100, China.
Corresponding author at: Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, 717 Jinyu Street, Muping District, Yantai, Shandong Province, 264100, China.
Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, Yantai, Shandong Province, 264100, China
Read
2285
Timeswas read the article
405
Total PDF
1880
Total HTML
Share statistics
array:24 [ "pii" => "S1665268121000041" "issn" => "16652681" "doi" => "10.1016/j.aohep.2021.100305" "estado" => "S300" "fechaPublicacion" => "2021-07-01" "aid" => "100305" "copyright" => "Fundación Clínica Médica Sur, A.C." "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2021;23C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S166526812100003X" "issn" => "16652681" "doi" => "10.1016/j.aohep.2021.100304" "estado" => "S300" "fechaPublicacion" => "2021-07-01" "aid" => "100304" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2021;23C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Waitlist mortality and transplant free survival in Hispanic patients listed for liver transplant using the UNOS database" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1491 "Ancho" => 1508 "Tamanyo" => 144133 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Post-Share 35: 1 year competing risk regression of non-Hispanic whites and Hispanics demonstrating relative removal from waitlist for death or clinical deterioration.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Daniela Goyes, Christopher J. Danford, John Paul Nsubuga, Alan Bonder" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Daniela" "apellidos" => "Goyes" ] 1 => array:2 [ "nombre" => "Christopher J." "apellidos" => "Danford" ] 2 => array:2 [ "nombre" => "John Paul" "apellidos" => "Nsubuga" ] 3 => array:2 [ "nombre" => "Alan" "apellidos" => "Bonder" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S166526812100003X?idApp=UINPBA00004N" "url" => "/16652681/000000230000000C/v3_202212060650/S166526812100003X/v3_202212060650/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268120301708" "issn" => "16652681" "doi" => "10.1016/j.aohep.2020.08.072" "estado" => "S300" "fechaPublicacion" => "2021-07-01" "aid" => "255" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "rev" "cita" => "Ann Hepatol. 2021;23C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Concise reviews</span>" "titulo" => "Silymarin is an ally against insulin resistance: A review" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3624 "Ancho" => 3175 "Tamanyo" => 1550186 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0050" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Therapeutic targets of silymarin in IR.</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">A) Insulin is released by pancreatic beta cells <elsevierMultimedia ident="202212060651026571"></elsevierMultimedia> in response to elevated blood glucose levels to maintain homeostatic blood glucose. Insulin binds to its receptor INSR <elsevierMultimedia ident="202212060651026572"></elsevierMultimedia> and undergoes Tyr phosphorylation which activates multiple signaling pathways, mainly PI3K and MAPK pathways. However, insulin regulates carbohydrate and lipid metabolism principally through activation of the PI3K pathway, initiated by interaction between the active, self-phosphorylated INSR with IRS1 <elsevierMultimedia ident="202212060651026573"></elsevierMultimedia>. Insulin promotes the translocation of GLUT4 from intracellular compartments to the plasma membrane by a pathway dependent on PI3K and Akt activation <elsevierMultimedia ident="202212060651026574"></elsevierMultimedia> promoting the uptake and storage of glucose in muscle and adipose tissues <elsevierMultimedia ident="202212060651026575"></elsevierMultimedia> [<a class="elsevierStyleCrossRef" href="#bib0025">5</a>,<a class="elsevierStyleCrossRef" href="#bib0030">6</a>,<a class="elsevierStyleCrossRef" href="#bib0165">33</a>,<a class="elsevierStyleCrossRef" href="#bib0250">50</a>,<a class="elsevierStyleCrossRef" href="#bib0285">57</a>].</p> <p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">B) In an insulin-resistant state, target cells (myocytes and adipocytes) have a decreased response to insulin action and hyperinsulinemia ensues. Poor insulin signaling is attributable to defects in insulin binding with its receptor and/or post-insulin binding modifications that alter the functionality of downstream proteins, such as phosphorylation at Ser/Thr residues of INSR and IRS1. This in turn decreases PI3K and Akt activity, and GLUT4 transporter expression, function, and translocation, resulting in decreased glucose uptake of the skeletal muscle and impaired glycogen, lipid, and protein synthesis. In adipocytes, increased lipolysis increases FFA release into the liver. Silymarin aids in pancreatic function recovery through increased insulin and glucagon expression <elsevierMultimedia ident="202212060651026576"></elsevierMultimedia>, normoglycemia, and recovery of insulin serum levels. Silymarin also inhibits JNK and IKK phosphorylation <elsevierMultimedia ident="202212060651026577"></elsevierMultimedia> and NfkB expression <elsevierMultimedia ident="202212060651026578"></elsevierMultimedia>, resulting in a decreased production of pro-inflammatory cytokines (TNFα, IL6) <elsevierMultimedia ident="202212060651026579"></elsevierMultimedia>. As inflammation is decreased, IRS-1/PI3K/Akt pathway signaling is favored <elsevierMultimedia ident="2022120606510265710"></elsevierMultimedia>, increasing GLUT4 expression <elsevierMultimedia ident="2022120606510265711"></elsevierMultimedia>, glucose uptake <elsevierMultimedia ident="2022120606510265712"></elsevierMultimedia>, and PTEN expression <elsevierMultimedia ident="2022120606510265713"></elsevierMultimedia> in muscleskeletal cells [<a class="elsevierStyleCrossRef" href="#bib0025">5</a>,<a class="elsevierStyleCrossRef" href="#bib0030">6</a>,<a class="elsevierStyleCrossRef" href="#bib0165">33</a>,<a class="elsevierStyleCrossRef" href="#bib0190">38</a>,<a class="elsevierStyleCrossRef" href="#bib0250">50</a>,<a class="elsevierStyleCrossRef" href="#bib0285">57</a>,<a class="elsevierStyleCrossRef" href="#bib0305">61</a>].</p> <p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">C) In an insulin-sensitive state, binding of insulin to INSR <elsevierMultimedia ident="2022120606510265714"></elsevierMultimedia> and phosphorylation or tyrosine residues <elsevierMultimedia ident="2022120606510265715"></elsevierMultimedia> leads to activation of the PI3K-Akt pathway <elsevierMultimedia ident="2022120606510265716"></elsevierMultimedia>, contributes to glycogen synthesis, decreased gluconeogenesis, protection against apoptosis, stimulation of mRNA translation, lipid and protein synthesis through the GSK3, mTOR and FoxO pathways [<a class="elsevierStyleCrossRef" href="#bib0025">5</a>,<a class="elsevierStyleCrossRef" href="#bib0030">6</a>,<a class="elsevierStyleCrossRef" href="#bib0165">33</a>,<a class="elsevierStyleCrossRef" href="#bib0250">50</a>,<a class="elsevierStyleCrossRef" href="#bib0285">57</a>].</p> <p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">D) In an insulin-resistant state, hyperinsulinemia leads to increased gluconeogenesis, uptake of FFAs, accumulation of lipids inside the cell, and decreased glycogen synthesis. This generates ROS in the mitochondrial chain which act on the fatty acids in the cell membrane causing lipid peroxidation. ROS induces pro-inflammatory cytokine synthesis including TNF-α, TGF-β1, and IL-6. Silymarin restores IRS-1/PI3K/Akt pathway signaling <elsevierMultimedia ident="2022120606510265717"></elsevierMultimedia>, increases PTEN expression <elsevierMultimedia ident="2022120606510265718"></elsevierMultimedia>, activates CFLAR expression and inhibits JNK and IKK phosphorylation <elsevierMultimedia ident="2022120606510265719"></elsevierMultimedia>, NfkB expression <elsevierMultimedia ident="2022120606510265720"></elsevierMultimedia>, and proinflammatory cytokine expression (TNFα, IL6) <elsevierMultimedia ident="2022120606510265721"></elsevierMultimedia>, eliminates free radicals resulting from lipid peroxidation <elsevierMultimedia ident="2022120606510265722"></elsevierMultimedia> and increases GSH cell content <elsevierMultimedia ident="2022120606510265723"></elsevierMultimedia> [<a class="elsevierStyleCrossRef" href="#bib0025">5</a>,<a class="elsevierStyleCrossRef" href="#bib0030">6</a>,<a class="elsevierStyleCrossRef" href="#bib0165">33</a>,<a class="elsevierStyleCrossRef" href="#bib0190">38</a>,<a class="elsevierStyleCrossRef" href="#bib0220">44</a>,<a class="elsevierStyleCrossRef" href="#bib0250">50</a>,<a class="elsevierStyleCrossRef" href="#bib0285">57</a>,<a class="elsevierStyleCrossRef" href="#bib0305">61</a>].</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Akt, Protein kinase B; CASP8, Caspase 8; CFLAR, CASP8 and FADD like apoptosis regulator; FADD, Fas associated via death; FFA, free fatty acids; FoxO, Forkhead box O; GLUT4, Glucose transporter 4; GSH, glutathione; GSK3, Glycogen synthase kinase 3; IKK, I kappa B kinase complex; IL-6, Interleukin-6; INSR, Insulin receptor; IRS1, Insulin receptor substrate 1; JNK, c-Jun N-terminal kinase; MAPK, Mitogen-activated kinases; mTOR, Mammalian target of rapamycin; NfkB, nuclear factor kappa-light-chain-enhancer of activated B cells; PI3K, phosphatidylinositol 3-kinase; PTEN, phosphatase and tensin homolog; ROS, reactive oxygen species; Ser, serine; TGF-β1, transforming growth factor beta-1; Thr, threonine; TNFα, Tumor necrosis factor α; Tyr, tyrosine.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Karla MacDonald-Ramos, Layla Michán, Alejandra Martínez-Ibarra, Marco Cerbón" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Karla" "apellidos" => "MacDonald-Ramos" ] 1 => array:2 [ "nombre" => "Layla" "apellidos" => "Michán" ] 2 => array:2 [ "nombre" => "Alejandra" "apellidos" => "Martínez-Ibarra" ] 3 => array:2 [ "nombre" => "Marco" "apellidos" => "Cerbón" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268120301708?idApp=UINPBA00004N" "url" => "/16652681/000000230000000C/v3_202212060650/S1665268120301708/v3_202212060650/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "MicroRNA-494-3p prevents liver fibrosis and attenuates hepatic stellate cell activation by inhibiting proliferation and inducing apoptosis through targeting TRAF3" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Hualong Li, Lei Zhang, Nan Cai, Bing Zhang, Shaomei Sun" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Hualong" "apellidos" => "Li" ] 1 => array:4 [ "nombre" => "Lei" "apellidos" => "Zhang" "email" => array:1 [ 0 => "zhlei_leizh@163.com" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 2 => array:2 [ "nombre" => "Nan" "apellidos" => "Cai" ] 3 => array:2 [ "nombre" => "Bing" "apellidos" => "Zhang" ] 4 => array:2 [ "nombre" => "Shaomei" "apellidos" => "Sun" ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, Yantai, Shandong Province, 264100, China" "identificador" => "aff0005" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author at: Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, 717 Jinyu Street, Muping District, Yantai, Shandong Province, 264100, China." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1471 "Ancho" => 3175 "Tamanyo" => 669853 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Liver damage and miRNA expression were observed in AH mice, and AST and ALT levels were increased in serum of AH mice.</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> Inflammatory cell infiltration in AH mice was observed by HE staining (magnification × 200 and × 100, scale bars = 100 μm). <span class="elsevierStyleBold">B-C.</span> Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels in AH mice were analyzed by enzyme linked immunosorbent (ELISA) assay. <span class="elsevierStyleBold">D.</span> Expressions of miRNAs in AH mice were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Expression levels were normalized to U6. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Control group.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Alcoholic hepatitis (AH) is a serious liver disease with high morbidity and mortality [<a class="elsevierStyleCrossRef" href="#bib0005">1</a>], and can progress into cirrhosis and hepatocellular carcinoma [<a class="elsevierStyleCrossRef" href="#bib0010">2</a>]. According to statistics, 10-20% of AH patients developed into cirrhosis annually [<a class="elsevierStyleCrossRef" href="#bib0010">2</a>]. Acetaldehyde, reactive oxygen species, endotoxins and cytokines promote liver fibrosis, induce or inhibit liver regeneration, which has been well acknowledged to be the pathogenic mechanisms of AH [<a class="elsevierStyleCrossRefs" href="#bib0015">3–6</a>]. Long-term heavy drinking can cause alcoholic liver disease, resulting in the gradual development of initial alcoholic fatty liver towards alcoholic liver fibrosis [<a class="elsevierStyleCrossRef" href="#bib0035">7</a>]. Hepatic stellate cells (HSCs) play a critical role in liver fibrosis [<a class="elsevierStyleCrossRef" href="#bib0040">8</a>]. They are in the quiescent state in normal liver, but are activated after liver damage [<a class="elsevierStyleCrossRef" href="#bib0045">9</a>]. Activated HSCs either resume the quiescent state or undergo apoptosis [<a class="elsevierStyleCrossRef" href="#bib0050">10</a>]. Therefore, controlling the activation of HSCs is a promising therapy to antagonize liver fibrosis.</p><p id="par0010" class="elsevierStylePara elsevierViewall">MicroRNA (miRNA) is widely studied in molecular biology research. It can participate in epithelial-mesenchymal transition, HSC activation and myofibroblast apoptosis through transcriptional regulation of transforming growth factor beta (TGFβ) and other cytokines. MiRNA also plays a key role in the occurrence of fibrosis [<a class="elsevierStyleCrossRef" href="#bib0055">11</a>]. The role of miRNAs in chronic liver diseases that lead to liver fibrosis, such as nonalcoholic fatty liver disease, viral hepatitis and alcoholic liver disease, has received increasing attention [<a class="elsevierStyleCrossRefs" href="#bib0060">12–14</a>]. As a class of endogenous targeting molecule, miRNAs can target HSCs to overcome the shortcomings of drugs, such as non-specificity and toxicity, and thus are conducive to developing new treating strategies for liver fibrosis.</p><p id="par0015" class="elsevierStylePara elsevierViewall">MiR-494, which is encoded by a gene located on chromosome 14q32.31, is considered to have a tumor-suppressive function and can be detected in various cancer tissues, such as gastric cancer, cholangiocarcinoma and lung cancer tissues [<a class="elsevierStyleCrossRefs" href="#bib0075">15–17</a>]. In hepatocellular carcinoma, overexpression of miR-494 enhanced sorafenib resistance via mTOR pathway activation [<a class="elsevierStyleCrossRef" href="#bib0090">18</a>]. Studies have found that miR-494-3p could be used as a potential biomarker for hepatocellular carcinoma [<a class="elsevierStyleCrossRef" href="#bib0095">19</a>], and high level of miR-494-3p in hepatocellular carcinoma was correlated with aggressive clinicopathological characteristics and was predictive of poor prognosis of HCC patients [<a class="elsevierStyleCrossRef" href="#bib0100">20</a>]. However, there is no study on the role of miR-494-3p in AH-induced liver fibrosis.</p><p id="par0020" class="elsevierStylePara elsevierViewall">Tumor Necrosis Factor Receptor (TNFR) Related Factor 3 (TRAF3) is a new protein related to the intracellular cytoplasmic domain of CD40 and its viral mimics-Epstein-Barr virus latent membrane protein 1 (LMP1) [<a class="elsevierStyleCrossRef" href="#bib0105">21</a>,<a class="elsevierStyleCrossRef" href="#bib0110">22</a>]. TRAF3 is a one of the most versatile members in the TRAF family [<a class="elsevierStyleCrossRef" href="#bib0115">23</a>,<a class="elsevierStyleCrossRef" href="#bib0120">24</a>]. For example, TRAF3 limits osteoclast formation induced by TNF, which mediates inflammation and joint destruction in inflammatory diseases, including rheumatoid arthritis [<a class="elsevierStyleCrossRef" href="#bib0125">25</a>]; TRAF3 impact B cell metabolism and exerts powerful restraint upon B cell survival and activation [<a class="elsevierStyleCrossRef" href="#bib0130">26</a>]; hepatocyte TRAF3 promotes HFD-induced or genetic hepatic steatosis in a TAK1-dependent manner [<a class="elsevierStyleCrossRef" href="#bib0135">27</a>].</p><p id="par0025" class="elsevierStylePara elsevierViewall">In the current study, we explored the potentially role of miR-494-3p in the development of AH with liver fibrosis. The findings provide a novel diagnostic and therapeutic target for treating liver fibrosis caused by AH.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Ethics statement</span><p id="par0030" class="elsevierStylePara elsevierViewall">From March 2017 to March 2019, 30 paired samples of AH liver tissues and normal liver tissues were collected from Yantai Affiliated Hospital of Binzhou Medical University. All patients had signed informed consent before the surgery. The study was approved by the Ethics Committee of Yantai Affiliated Hospital of Binzhou Medical University (No.YT2016070053), and the animal protocol was approved by the Institutional Review Board of Yantai Affiliated Hospital of Binzhou Medical University (2018031046-52).</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Preparation of human tissue specimens</span><p id="par0035" class="elsevierStylePara elsevierViewall">In this study, we obtained 30 paired samples of AH liver tissues and normal liver tissues from patients who were diagnosed with AH by pathological examination and healthy volunteers, respectively. All tissues were cut into about 1 cm<span class="elsevierStyleSup">3</span> [<a class="elsevierStyleCrossRef" href="#bib0015">3</a>] blocks with a sterile knife and washed twice with normal saline. Then, all tissues were immediately frozen in liquid nitrogen and transferred to a -80℃ refrigerator for preservation.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Establishment of a mice model of alcoholic hepatitis</span><p id="par0040" class="elsevierStylePara elsevierViewall">A total of 36 male C57BL/6 J mice, aged 7–8 weeks and weighing 20∼22 g, were obtained from Shilek Lab Animal (Shanghai, China). Animal license number: SYXK (Shanghai): 2019−0102. The animals were housed in normal pellets for 1 week at 22℃ under a 12 h/12 h light/dark cycle. In order to detect liver pathological changes and miRNA expression in AH mice, 12 of the mice were divided into Control group (n = 6, mice were fed with a control diet) and AH group (n = 6, mice were fed with a 4% alcohol Lieber-De Carli liquid diet (Hebei Hengshui Laobai Dry Wine Co., Ltd.) for 8 weeks). In order to further observe the effect of miR-494-3p mimic on AH mice, the remaining 24 mice were randomly divided into 4 groups, namely, Control group (n = 6), AH group (n = 6), AH + miR-494-3p mock (Mock) group (n = 6, mice were fed with a 4% alcohol Lieber-De Carli liquid diet for 8 weeks, and treated with tain vein injection of miR-494-3p mock since the 4th week), and AH + miR-494-3p mimic (Mimic) group (n = 6, mice were fed with a 4% alcohol Lieber-De Carli liquid diet for 8 weeks, and treated with tail vein injection of miR-494-3p mimic since the 4th week). Lieber-De Carli Alcohol liquid feeding consisted of 36% alcohol, 18% protein, 35% fat and 11% carbohydrate, which was modified from a previous report [<a class="elsevierStyleCrossRef" href="#bib0140">28</a>]. After 8 weeks, all mice were sacrificed by neck dislocation after being anesthetized with 0.2 mL of 1% pentobarbital sodium (P3761, Sigma-Aldrich, USA).</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Preparation of serum samples</span><p id="par0045" class="elsevierStylePara elsevierViewall">All mice were fasted for 12 h after the last feeding, weighed, and anesthetized by intraperitoneal injection of 1% pentobarbital sodium. 3∼5 mL of blood was taken from the abdominal aorta of each mice and placed into a biochemical blood collection tube, and then centrifuged at 4 ℃, 1,006.2 ×g for 10 min (min). Serum was collected and stored at -80℃.</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Enzyme linked immunosorbent (ELISA) assay</span><p id="par0050" class="elsevierStylePara elsevierViewall">Aspartate aminotransferase (AST, EM0857) and alanine aminotransferase (ALT, EM0829) were purchased from FineTest (Wuhan, China). Following the instructions of the ELISA kit, the absorbance at 450 nm was determined by a microplate reader (MD SpectraMax M5, Molecular Devices, USA), and the expressions of ALT and AST in serum were analyzed according to the standard curve drawn by OD value.</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Hematoxylin and eosin staining assay</span><p id="par0055" class="elsevierStylePara elsevierViewall">The Haematoxylin-Eosin (HE) staining kit (XY0516 N) was obtained from Xinxu (Shanghai, China). The liver tissues were cut into 0.2∼0.3 cm thickness. After removing the surrounding adipose tissues, the liver tissues were fixed with 10% neutral formaldehyde solution (M004, G fan, Shanghai, Beijing), dehydrated with gradient alcohol, embedded in wax and dewaxed. Hepatic steatosis and inflammation in the liver sections were visualized by HE staining and observed under a dark field fluorescence microscope (DM2000, Olympus, Tokyo, Japan) under 100 × and 200 × magnifications.</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">ɑ-SMA immunohistochemical assay</span><p id="par0060" class="elsevierStylePara elsevierViewall">The liver tissue sections were deparaffinized, hydrated and incubated in 3% hydrogen peroxide. The sections were then placed in 10 mM sodium citrate buffer (pH 6.0, Biomart, Beijing, China) and warmed in a microwave for 10 min for antigen retrieval. After 30 min of blocking in 0.1% Triton X-100 (DXT-11332481001, Roche, USA) at room temperature, the sections were incubated with primary antibody (Rabbit α-SMA antibody, 1:500, K10018, Biomart, Beijing, China) overnight at 4℃, followed by incubation with the secondary antibody Polymer-horseradish peroxidase anti-rabbit (Dako). After visualizing the proteins with 3,3’- diaminobenzidine, the sections were observed under a fluorescence microscope (DM2000, Olympus, Tokyo, Japan) under 100× and 200 × magnifications.</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Isolation, culture and identification of primary hepatic stellate cells</span><p id="par0065" class="elsevierStylePara elsevierViewall">C57BL/6 J mice were perfused <span class="elsevierStyleItalic">in situ</span> with EGTA and collagenase (Roche, Indianapolis, IN, USA) to obtain total liver cell suspension, and primary hepatocytes were obtained by Percoll density gradient centrifugation [<a class="elsevierStyleCrossRef" href="#bib0095">19</a>]. The cells were adjusted to a density of 3 × 10<span class="elsevierStyleSup">6</span> cells/mL and seeded in a 25 cm<span class="elsevierStyleSup">2</span> plastic culture flask that contained 5 mL DMEM complete medium (10% FBS, Gibco, Life Technologies) and 1% penicillin/streptomycin (Gibco, Life Technologies) at 37℃. After activating hepatic stellate cells (HSCs), ɑ-SMA was substantially expressed and detected by immunofluorescence. HSCs were incubated with primary antibody (anti-α-SMA) at 4℃ overnight and subsequently stained with secondary antibody (Polymer-horseradish peroxidase anti-rabbit). Fluorescence positive expression changes of cells were measured under a fluorescence microscope (DM2000, Olympus, Tokyo, Japan) under 400 × magnification and images were collected. Next, quantitative real-time polymerase chain reaction (qRT-PCR) was used to identify the expressions of miR-494-3p and activation-related proteins in activated HSCs.</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Cell grouping</span><p id="par0070" class="elsevierStylePara elsevierViewall">Firstly, to observe the effect of miR-494-3p on HSCs, the cells were divided into Blank group (untransfected), Mock group (transfected with mock) and Mimic group (transfected with mimic). Then, to further observe the effect of miR-494-3p and TNF receptor-associated factor 3 (TRAF3) on HSCs, the cells were divided into Mock + negative control (NC) group (transfected with mock + NC), Mock + TRAF3 group (transfected with mock + TRAF3), Mimic + NC group (transfected with mimic + NC) and Mimic + TRAF3 group (transfected with mimic + TRAF3).</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Cell transfection</span><p id="par0075" class="elsevierStylePara elsevierViewall">MiR-494-3p mimic (5′-UGAAACAUACACGGGAAACCUC-3′) and Mock (5′-ACAUCUGCGUAAGAUUCGAGUCUA-3′) were obtained from RiboBio (Guangzhou, China). The full length TRAF3 sequence synthesized by YouBia (Chongqing, China) was inserted into pcDNA3.1 vector (VT9221, YouBia, China) to obtained TRAF3 overexpression plasmid, and pcDNA3.1 empty vector was used as negative control (NC). HSCs were seeded into 6-well plates (5 × 10<span class="elsevierStyleSup">4</span> cells/mL) and transfected with miR-494-3p mimic/Mock alone (50 nM) or in combination with TRAF3 overexpression plasmid/pcDNA3.1 empty vector (1 µg) using Lipofectamine 2000 reagent (11668027, Invitrogen, USA) according to the instructions. After 48 h (h) of transfection, the transfection rate was detected by qRT-PCR.</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">qRT-PCR</span><p id="par0080" class="elsevierStylePara elsevierViewall">One ml of Trizol lysate was added to lyse the HSCs and liver tissues for total RNA extraction. The supernatant was collected and added with 200 μL of chloroform for 5 min at room temperature, followed by centrifugation at 12,000 ×<span class="elsevierStyleItalic">g</span> for 15 min at 4℃. The supernatant was collected and transferred to a new centrifugation tube. After being added with 500 μL of isopropanol and kept at room temperature for 10 min, the supernatant was centrifuged at 12,000 ×<span class="elsevierStyleItalic">g</span> for 10 min at 4℃. The resulting supernatant was discarded and the precipitate was washed by 1 mL of 75% ethanol (anhydrous ethanol and DEPC treated water) once, and centrifuged at 7500 ×<span class="elsevierStyleItalic">g</span> at 4℃ for 5 min. After discarding the ethanol, the precipitate was properly dried and then dissolved in 25 μL of DEPC water, and subsequently the total RNA concentration was measured by Nandrop. The total RNA was extracted from Trizol for reverse transcription reaction. The reaction conditions were set as: at 42℃ for 10 min, at 95℃ for 15 min, and storage at 4℃. The qPCR experiment was conducted with SYBR Green PCR Master Mix (Roche, Basle, Switzerland) on a RT-PCR detection system (ABI 7500, Life Technology, USA) under the conditions as follows: pretreatment at 95℃ for 10 min, followed by 40 cycles of 94℃ for 15 s (s) and 60℃ for 1 min, finally at 60℃ for 1 min and preservation at 4℃. Referring to existing research, related miRNAs (miR-494-3p, miR-30e, miR-182, miR-378a-3p and miR-202-3p) were screened for analysis. miRNA was isolated from HSCs and liver tissues using a miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. cDNA was generated with the miScript II RT Kit (QIAGEN) and amplified by qPCR using the miScript SYBR Green PCR Kit (QIAGEN). The gene copy number of each sample was expressed by the Cq value, and the relative expression of the genes was determined by the 2<span class="elsevierStyleSup">ΔΔCq</span> method [<a class="elsevierStyleCrossRef" href="#bib0145">29</a>]. Primers are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. miRNA expression levels were normalized to U6, and gene expression was normalized to GAPDH.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Cell counting kit (CCK)-8 assay</span><p id="par0085" class="elsevierStylePara elsevierViewall">HSCs at 5 × 10<span class="elsevierStyleSup">4</span> cells/mL were added into 96-well plates and incubated for 24 h. After 24, 48, 72 and 96 h of transfection treatment, CCK8 solution (Beyotime Institute of Biotechnology, Beijing, China) was added into the cells. After 2 h, the absorbance at 450 nm was measured using a microplate reader (MD SpectraMax M5, Molecular Devices, USA).</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Cell clone formation experiment</span><p id="par0090" class="elsevierStylePara elsevierViewall">HSCs (5 × 10<span class="elsevierStyleSup">4</span> cells/mL) were seeded into 6-well plates containing 37℃ pre-warmed medium and placed in a 37℃ incubator for culture. The medium was changed every two days and allowed to stand for 14 days. HSCs were fixed by 1:3 acetic acid/methanol for 30 min, and stained by a Giemsa stain (48900, Sigma-Aldrich, USA) for 20 min. The clone numbers of the cells were counted by naked eyes, and the colony formation rate was calculated using the equation: Clonal formation rate = (number of clones formed/number of cells seeded) × 100%.</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Apoptosis analysis</span><p id="par0095" class="elsevierStylePara elsevierViewall">An Annexin V-FITC/PI kit (CC2210, G-CLONE, Beijing, China) was used to evaluate the apoptosis of HSCs. HSC suspension at a final concentration of 1 × 10<span class="elsevierStyleSup">6</span> cells/mL was prepared using 500 μL of 1× Annexin V Binding Solution, and then it was added to a 6-well plate. The cell suspension was added with 5 μL of Annexin V-FITC and 5 μL of propidium iodide and cultured in the dark for 15 min at room temperature. Then cell apoptosis was detected by Flow cytometry (version 10.0, FlowJo, FACS CaliburTM, BD, Franklin Lakes, NJ, USA). The necrotic cells were located in the upper left area (Annexin V<span class="elsevierStyleSup">−</span>, PI<span class="elsevierStyleSup">+</span>), and the late apoptotic cells were located in the upper right area (Annexin V<span class="elsevierStyleSup">+</span>, PI<span class="elsevierStyleSup">+</span>), while the living cells were located in the lower left area (Annexin V<span class="elsevierStyleSup">−</span>, PI<span class="elsevierStyleSup">−</span>), and the early apoptotic cells were located in the upper right area (Annexin V<span class="elsevierStyleSup">+</span>, PI<span class="elsevierStyleSup">−</span>).</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Bioinformatics prediction and dual-luciferase reporter assay</span><p id="par0100" class="elsevierStylePara elsevierViewall">The target gene of miR-494-3p was predicted using the internationally recognized prediction site TargetScan7.2 (<a href="http://www.targetscan.org/vert_72/">http://www.targetscan.org/vert_72/</a>). The mutant (Mut) and wild-type (WT) TRAF3 were amplified by PCR and cloned into pmirGLO reporter vector (E1330, Promega, USA) to generate TRAF3-WT and TRAF3-Mut report plasmids. Subsequently, cells were transfected with TRAF3-3'-UTR plasmid (TRAF3-WT and TRAF3-Mut) alone or in combination with miR-494-3p mimic using Lipofectamine 2000 reagent (11668019, Invitrogen, USA). After 48 h of transfection, the luciferase activity was measured using a luciferase reporter assay system (Promega Corporation) in Lmax II luminescence meter (Molecular Devices, LLC, Sunnyvale, CA, USA).</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Western blot assay</span><p id="par0105" class="elsevierStylePara elsevierViewall">According to the literature [<a class="elsevierStyleCrossRef" href="#bib0150">30</a>], total proteins were extracted by RIPA lysate (PC901, Biomiga, USA). Total protein content was determined by a BCA Kit (93-K812-1000, Biovision, USA). The protein samples were separated by electrophoresis and then transferred to a membrane (PVDF, 2215, Millipore, CA, USA). The PVDF membrane was sealed with 5% skim milk at 37℃ for 1 h, and then separately incubated with Coll (1:2000 dilution, ab6308, Abcam, UK), matrix metalloproteinase 9 (MMP-9, 1:1000 dilution, ab38898, Abcam, UK), tissue inhibitor of metalloproteinase-1 (TIMP-1, 1:1000 dilution, ab61224, Abcam, UK), Vimentin (1:5000 dilution, ab92547, Abcam, UK) and GAPDH (1:10000 dilution, ab181602, Abcam, UK) at 4℃ overnight. Then goat anti-rabbit (1:5000 dilution, ab150077, Abcam, UK) or goat anti-mouse (1:5000 dilution, ab190475, Abcam, UK) was used to incubate the membrane at 37℃ for 1 h. Finally, immunoreactivity was detected with chemiluminescence reagent (PN3300, G-CLONE, Beijing, China), and color was developed in a gel imager (12003151, Bio-Rad, USA). GAPDH was used as a control.</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Statistical analysis</span><p id="par0110" class="elsevierStylePara elsevierViewall">The results were shown as the mean ± standard deviation (SD). Statistical significance was determined by analysis of variance (ANOVA) between groups followed by Bonferroni’s post hoc test using GraphPad Prism 7.0 (Graph-Pad Software Inc). Differences between two groups were compared by paired <span class="elsevierStyleItalic">t</span> test. <span class="elsevierStyleItalic">P</span> < 0.05 was considered as statistically significant.</p></span></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Results</span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Liver damage and miRNA expression were observed in AH mice, and AST and ALT levels were increased in serum of AH mice</span><p id="par0115" class="elsevierStylePara elsevierViewall">AH mice model was successfully established, which was supported by pathological changes. <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A showed that hepatic lipid accumulation (predominantly macrovesicular) increased in AH mice. Moreover, chronic inflammatory cell infiltration was observed in AH mice compared with the control group (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A). ELISA assay showed that AST and ALT levels were greatly enhanced in AH mice (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>B and 1C). The results from qRT-PCR exhibited that the expression of miR-182 was greatly elevated in AH mice, while the expressions of miR-494-3p, miR-30e, miR-378a-3p and miR-202-3p were extremely reduced (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>D), and therefore, miR-494-3p was selected for follow-up experiments.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">MiR-494-3p was down-regulated in human and mouse AH liver tissues, and it reduced α-SMA expression and prevented liver fibrosis</span><p id="par0120" class="elsevierStylePara elsevierViewall">The mRNA level of miR-494-3p was visibly lower in human and mice AH liver tissues than in healthy volunteers’ liver tissues (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A and 2B), while miR-494-3p mimic obviously enhanced miR-494-3p level in AH mice (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B). Also, the expression of α-SMA was largely reduced in the AH + mimic group in comparison with the AH + Mock group (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>C). Moreover, the data from qRT-PCR showed that miR-494-3p mimic inhibited the mRNA levels of α-SMA, COL-1, MMP-9 and TIMP-1 in AH mice compared with the AH + Mock group (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>D).</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0115" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">HSCs were successfully isolated, and activating HSCs or upregulating miR-494-3p had a regulatory effect on the levels of miR-494-3p, HSC activation-related proteins and fibrosis-related proteins</span><p id="par0125" class="elsevierStylePara elsevierViewall">The positive expression of ɑ-SMA showed that HSCs were successfully isolated from the mice (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A). We discovered that miR-494-3p was abundant in quiescent HSCs but decreased obviously in activated HSCs (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>B). Furthermore, the levels of HSC activation-related proteins ɑ-SMA, DDR2, FN1 and ITGB1 were up-regulated, while GFAP expression was down-regulated in activated HSCs (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C). To determine the role of miR-494-3p in activated HSCs, miR-494-3p mimic was transfected into the cells to up-regulate the level of miR-494-3p, and the resulting changes were confirmed by qRT-PCR (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>D). The mRNA levels of molecular markers ɑ-SMA, DDR2, FN1 and ITGB1 were down-regulated after transfection of miR-494-3p mimic, while GFAP expression was increased (<span class="elsevierStyleItalic">P</span> < 0.01, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>E). In addition, miR-494-3p mimic inhibited the mRNA levels of COL-1, MMP-9, TIMP-1 and Vimentin as compared with the Mock group (<span class="elsevierStyleItalic">P</span> < 0.01, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>F).</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">MiR-494-3p mimic inhibited viability and proliferation and induced apoptosis in HSCs</span><p id="par0130" class="elsevierStylePara elsevierViewall">HSC viability was markedly inhibited after miR-494-3p mimic treatment for 72 h and 96 h (<span class="elsevierStyleItalic">P</span> < 0.01, <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A). Meanwhile, colony formation of HSCs was inhibited by miR-494-3p mimic (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>B). We also found that HSC apoptosis was induced by miR-494-3p mimic (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>C).</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0125" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">MiR-494-3p targeted TRAF3 and inhibited TRAF3 expression, while overexpressed TRAF3 promoted TRAF3 expression</span><p id="par0135" class="elsevierStylePara elsevierViewall">The target genes of miR-494-3p were predicted by TargetScan, and we found that the 3’-UTR of TRAF3 contained putative binding sites for miR-494-3p both in human and mice (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A). Moreover, dual luciferase reporter assay showed that the luciferase activity of TRAF3-WT was inhibited by miR-494-3p mimic (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>B). In addition, the effect of miR-494-3p on TRAF3 expression was detected, and the mRNA level of TRAF3 was decreased in the miR-494-3p mimic group compared with the mock group (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>C). We found that TRAF3 level was increased in the TRAF3 group compared with the NC group (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>D), which indicated that TRAF3 overexpression plasmid was successfully transfected.</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span><span id="sec0130" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Overexpressed TRAF3 rescued the regulatory effect of miR-494-3p mimic on the levels of HSC activation- and fibrosis-related proteins</span><p id="par0140" class="elsevierStylePara elsevierViewall">As depicted in <a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A, the regulatory effect of miR-494-3p mimic on ɑ-SMA, DDR2, FN1, ITGB1 and GFAP expressions were reversed by overexpression of TRAF3 (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A). Furthermore, overexpressed TRAF3 partially offset the inhibitory effect of miR-494-3p mimic on the levels of fibrosis-related proteins, as evidenced by the enhanced mRNA and protein levels of COL-1, MMP-9, TIMP-1 and Vimentin (<span class="elsevierStyleItalic">P</span> < 0.05, <a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>B-C).</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span><span id="sec0135" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Overexpressed TRAF3 partially reversed the regulatory effect of miR-494-3p mimic on cell viability, proliferation and apoptosis</span><p id="par0145" class="elsevierStylePara elsevierViewall">The CCK-8 data demonstrated that HSC viability was significantly enhanced after treatment with overexpressed TRAF3 for 72 h and 96 h (<span class="elsevierStyleItalic">P</span> < 0.05, <a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>A). Meanwhile, the inhibitory effect of miR-494-3p mimic on cell viability was reversed after treatment with overexpressed TRAF3 for 72 h and 96 h (<span class="elsevierStyleItalic">P</span> < 0.05, <a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>A). Moreover, introduction of TRAF3 notably increased colony numbers compared with transfection of miR-494-3p mimic alone (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>B). In addition, Flow cytometry results revealed that overexpressed TRAF3 rescued the promoting effect of miR-494-3p mimic on the apoptosis of HSCs (<span class="elsevierStyleItalic">P</span> < 0.001, <a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>C).</p><elsevierMultimedia ident="fig0035"></elsevierMultimedia></span></span><span id="sec0140" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Discussion</span><p id="par0150" class="elsevierStylePara elsevierViewall">In the current study, our findings suggested that miR-494-3p mRNA level was down-regulated in AH liver tissues, and miR-494-3p mimic significantly reduced the expression of α-SMA and prevented liver fibrosis was prevented. In addition, we found that the expression and biological functions of miR-494-3p were regulated by TRAF3. Studies reported that miR-494-3p has low expression in various diseases, and moreover, it was reported as a novel noninvasive biomarker for hepatocellular carcinoma [<a class="elsevierStyleCrossRef" href="#bib0100">20</a>,<a class="elsevierStyleCrossRef" href="#bib0155">31</a>]. However, it is unclear whether miR-494-3p expression is associated with AH. In the present study, miR-494-3p level was down-regulated in liver tissues from AH patients and activated HSCs, thus suggesting that miR-494-3p was involved in AH development.</p><p id="par0155" class="elsevierStylePara elsevierViewall">Many studies have shown that miRNAs play key roles in alcoholic hepatitis and fibrosis. For example, miR-378 limits liver fibrosis and HSC activation [<a class="elsevierStyleCrossRef" href="#bib0160">32</a>]. MiR-29b attenuates hepatic stellate cell activation and induces apoptosis against liver fibrosis [<a class="elsevierStyleCrossRef" href="#bib0165">33</a>], and miR-26b-5p suppresses angiogenesis and liver fibrogenesis in mice [<a class="elsevierStyleCrossRef" href="#bib0170">34</a>]. Additionally, miR-126 inhibits the activation and migration of HSCs through targeting CRK [<a class="elsevierStyleCrossRef" href="#bib0175">35</a>]. To better understand the biological function of miR-494-3p in AH, we transfected overexpressed miR-494-3p into AH mice, and the results from in vivo functional experiments showed that miR-494-3p mimic alleviated collagen deposition and fibrosis, suggesting that miR-494-3p may inhibit AH development in mice. Liver fibrosis is characterized by excessive deposition of extracellular matrix (ECM) components, particularly type I collagen [<a class="elsevierStyleCrossRef" href="#bib0180">36</a>]. After liver injury, HSCs change from a resting phenotype to an activated phenotype, migrate to the injured area, and produce ECM [<a class="elsevierStyleCrossRef" href="#bib0185">37</a>]. MMP-9 is one of the most relevant MMPs that degrades normal liver matrix, and it could promote the development of liver fibrosis [<a class="elsevierStyleCrossRef" href="#bib0190">38</a>]. TIMP1, which has been demonstrated to reduce MMP activity, plays an important role in the progress of liver fibrosis and is an important target for the treatment of liver fibrosis [<a class="elsevierStyleCrossRef" href="#bib0195">39</a>]. The α-SMA, COL-1, MMP-9 and TIMP-1 genes are mainly produced by HSCs during fibrogenesis [<a class="elsevierStyleCrossRef" href="#bib0165">33</a>]. In this study, miR-494-3p overexpression inhibited the expressions of these fibrosis-related proteins in AH mice, indicating that miR-494-3p could inhibit liver fibrosis.</p><p id="par0160" class="elsevierStylePara elsevierViewall">When liver fibrosis is prevented, activated HSCs either keep a quiescent state or undergo apoptosis, and the latter leads to a decreased number of activated HSCs [<a class="elsevierStyleCrossRef" href="#bib0050">10</a>,<a class="elsevierStyleCrossRef" href="#bib0200">40</a>]. Down-regulation of miR-140-3p suppresses fibrogenesis and cell proliferation in HSCs [<a class="elsevierStyleCrossRef" href="#bib0205">41</a>]. MiR-193a/b-3p limits proliferation, relieves hepatic fibrosis and activates HSCs [<a class="elsevierStyleCrossRef" href="#bib0210">42</a>]. MiR-29b induced apoptosis of HSCs by regulating PARP and casepase-9 [<a class="elsevierStyleCrossRef" href="#bib0165">33</a>]. We found that miR-494-3p mimic inhibited the activation, proliferation and fibrosis of HSCs, indicating that up-regulation of miR-494-3p could inhibit liver fibrosis by inhibiting the proliferation of HSCs.</p><p id="par0165" class="elsevierStylePara elsevierViewall">Our data confirmed that miR-494-3p targeted TRAF3. Studies have shown that TRAF3 regulates the homeostasis of various cell types through different mechanisms [<a class="elsevierStyleCrossRef" href="#bib0215">43</a>,<a class="elsevierStyleCrossRef" href="#bib0220">44</a>]. MiR-107 modulates the apoptosis and autophagy of osteoarthritis chondrocytes by regulating TRAF3 [<a class="elsevierStyleCrossRef" href="#bib0225">45</a>]. MiR-155-5p is negatively correlated with acute pancreatitis and inversely adjusts the development of pancreatic acinar cells by modulating TRAF3 [<a class="elsevierStyleCrossRef" href="#bib0230">46</a>]. This study found that TRAF3 is a target gene of miR-494-3p, and the protective effect of overexpressed miR-494-3p on HSCs could be offset by TRAF3. These findings indicated that miR-494-3p may inhibit HSC proliferation and fibrosis via regulating TRAF3.</p><p id="par0170" class="elsevierStylePara elsevierViewall">To conclude, we proved that miR-494-3p suppressed HSC proliferation and fibrosis in AH by blocking TRAF3. Thus, our findings provide new treatment strategies for AH.</p></span><span id="sec0145" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0180">Funding</span><p id="par0175" class="elsevierStylePara elsevierViewall">This work was supported by the <span class="elsevierStyleGrantSponsor" id="gs0005">Research on Non-invasive Diagnosis Method of OBI</span> based on PBMC.</p></span><span id="sec0150" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0185">Ethics statement</span><p id="par0180" class="elsevierStylePara elsevierViewall">From March 2017 to March 2019, 30 AH liver tissues and normal liver tissues were collected from Yantai Affiliated Hospital of Binzhou Medical University. All patients had signed informed consent before the surgery. The study was approved by the Yantai Affiliated Hospital of Binzhou Medical University Ethics Committee (No.YT2016070053), and the protocol on animal was approved by the Institutional Review Board of the Yantai Affiliated Hospital of Binzhou Medical University (2018031046-52).</p></span><span id="sec0155" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0190">Declarations of interest</span><p id="par0185" class="elsevierStylePara elsevierViewall">None.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1814966" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1584618" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xpalclavsec1584617" "titulo" => "Abbreviations" ] 3 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 4 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:17 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Ethics statement" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Preparation of human tissue specimens" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Establishment of a mice model of alcoholic hepatitis" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Preparation of serum samples" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Enzyme linked immunosorbent (ELISA) assay" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Hematoxylin and eosin staining assay" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "ɑ-SMA immunohistochemical assay" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "Isolation, culture and identification of primary hepatic stellate cells" ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "Cell grouping" ] 9 => array:2 [ "identificador" => "sec0060" "titulo" => "Cell transfection" ] 10 => array:2 [ "identificador" => "sec0065" "titulo" => "qRT-PCR" ] 11 => array:2 [ "identificador" => "sec0070" "titulo" => "Cell counting kit (CCK)-8 assay" ] 12 => array:2 [ "identificador" => "sec0075" "titulo" => "Cell clone formation experiment" ] 13 => array:2 [ "identificador" => "sec0080" "titulo" => "Apoptosis analysis" ] 14 => array:2 [ "identificador" => "sec0085" "titulo" => "Bioinformatics prediction and dual-luciferase reporter assay" ] 15 => array:2 [ "identificador" => "sec0090" "titulo" => "Western blot assay" ] 16 => array:2 [ "identificador" => "sec0095" "titulo" => "Statistical analysis" ] ] ] 5 => array:3 [ "identificador" => "sec0100" "titulo" => "Results" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0105" "titulo" => "Liver damage and miRNA expression were observed in AH mice, and AST and ALT levels were increased in serum of AH mice" ] 1 => array:2 [ "identificador" => "sec0110" "titulo" => "MiR-494-3p was down-regulated in human and mouse AH liver tissues, and it reduced α-SMA expression and prevented liver fibrosis" ] 2 => array:2 [ "identificador" => "sec0115" "titulo" => "HSCs were successfully isolated, and activating HSCs or upregulating miR-494-3p had a regulatory effect on the levels of miR-494-3p, HSC activation-related proteins and fibrosis-related proteins" ] 3 => array:2 [ "identificador" => "sec0120" "titulo" => "MiR-494-3p mimic inhibited viability and proliferation and induced apoptosis in HSCs" ] 4 => array:2 [ "identificador" => "sec0125" "titulo" => "MiR-494-3p targeted TRAF3 and inhibited TRAF3 expression, while overexpressed TRAF3 promoted TRAF3 expression" ] 5 => array:2 [ "identificador" => "sec0130" "titulo" => "Overexpressed TRAF3 rescued the regulatory effect of miR-494-3p mimic on the levels of HSC activation- and fibrosis-related proteins" ] 6 => array:2 [ "identificador" => "sec0135" "titulo" => "Overexpressed TRAF3 partially reversed the regulatory effect of miR-494-3p mimic on cell viability, proliferation and apoptosis" ] ] ] 6 => array:2 [ "identificador" => "sec0140" "titulo" => "Discussion" ] 7 => array:2 [ "identificador" => "sec0145" "titulo" => "Funding" ] 8 => array:2 [ "identificador" => "sec0150" "titulo" => "Ethics statement" ] 9 => array:2 [ "identificador" => "sec0155" "titulo" => "Declarations of interest" ] 10 => array:2 [ "identificador" => "xack640369" "titulo" => "Acknowledgements" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-10-08" "fechaAceptado" => "2020-12-03" "PalabrasClave" => array:1 [ "en" => array:2 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1584618" "palabras" => array:4 [ 0 => "Alcoholic hepatitis" 1 => "Hepatic stellate cell" 2 => "miR-494-3p" 3 => "TNF receptor-associated factor 3" ] ] 1 => array:4 [ "clase" => "abr" "titulo" => "Abbreviations" "identificador" => "xpalclavsec1584617" "palabras" => array:9 [ 0 => "AH" 1 => "HSCs" 2 => "AST" 3 => "ALT" 4 => "ELISA" 5 => "qRT-PCR" 6 => "α-SMA" 7 => "(CCK)-8" 8 => "TRAF3" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction and objectives</span><p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Alcoholic hepatitis (AH) is characterized by high morbidity and mortality. MicroRNA-494-3p is possibly involved in the regulation of cancers, but its role in AH has been rarely studied.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">AH mice model and primarily cultured mice hepatic stellate cells (HSCs) model were constructed. Levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were analyzed by ELISA. Expressions of miRNAs, HSC activation-related proteins and fibrosis-related protein were analyzed by qRT-PCR and Western blot. Cell counting kit, colony formation and flow cytometry assays were used to detect cell viability, proliferation and apoptosis, respectively. The relationship between TNF receptor-associated factor 3 (TRAF3) and miR-494-3p was predicted and verified by TargetScan and dual-luciferase assay, respectively. Results of the above experiments were verified by rescue experiments using TRAF3.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Liver damage and miRNA expression were observed in AH mice, and AST and ALT levels were increased in serum of AH mice. MiR-494-3p was reduced in AH liver tissues, and it decreased the levels of α-SMA and fibrosis-related proteins. HSCs were isolated, and activating HSCs or upregulating miR-494-3p had a regulatory effect on the levels of miR-494-3p, HSC activation-related proteins and fibrosis-related proteins as well as cell viability, proliferation and apoptosis. In addition, miR-494-3p targeted TRAF3 and inhibited TRAF3 expression, while overexpressed TRAF3 promoted TRAF3 expression and rescued the regulatory effect of miR-494-3p on the levels of related proteins as well as cell viability, proliferation and apoptosis.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0095" class="elsevierStyleSimplePara elsevierViewall">This study provided a novel mechanistic comprehension of the anti-fibrotic effect of miR-494-3p.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] ] "multimedia" => array:8 [ 0 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1471 "Ancho" => 3175 "Tamanyo" => 669853 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Liver damage and miRNA expression were observed in AH mice, and AST and ALT levels were increased in serum of AH mice.</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> Inflammatory cell infiltration in AH mice was observed by HE staining (magnification × 200 and × 100, scale bars = 100 μm). <span class="elsevierStyleBold">B-C.</span> Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels in AH mice were analyzed by enzyme linked immunosorbent (ELISA) assay. <span class="elsevierStyleBold">D.</span> Expressions of miRNAs in AH mice were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Expression levels were normalized to U6. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Control group.</p>" ] ] 1 => array:8 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3100 "Ancho" => 3175 "Tamanyo" => 1114676 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">MiR-494-3p was down-regulated in human and mice AH liver tissues, and it reduced collagen area and prevented fibrosis in AH mice.</p> <p id="spar0020" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> The expression of miR-494-3p in liver tissues from alcoholic hepatitis (AH) patients and healthy volunteers was detected by quantitative real-time polymerase chain reaction (qRT-PCR). Expression levels were normalized to U6. <span class="elsevierStyleBold">B.</span> Transfection efficiency of miR-494-3p mimic in AH mice was determined by qRT-PCR. Expression levels were normalized to U6. <span class="elsevierStyleBold">C.</span> Immunohistochemical analysis of α-SMA expression in AH mice (magnification × 200 and × 100, scale bars = 100 μm). <span class="elsevierStyleBold">D.</span> Eectopic expression of miR-494-3p suppressed the levels of fibrosis-related proteins in AH mice, as detected by qRT-PCR assay. Expression levels were normalized to U6. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Control group; <span class="elsevierStyleSup">###</span><span class="elsevierStyleItalic">P</span> < 0.001 vs AH + miR-494-3p mock (Mock) group.</p>" ] ] 2 => array:8 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2570 "Ancho" => 3175 "Tamanyo" => 360379 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0015" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">HSCs were successfully isolated, and activating HSCs or upregulating miR-494-3p had a regulatory effect the levels of miR-494-3p and HSC activation-related proteins and fibrosis-related proteins.</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> Localization and expression of ɑ-SMA in cells were determined by immunofluorescence (magnification × 400, scale bars = 20 μm). <span class="elsevierStyleBold">B.</span> MiR-494-3p level was down-regulated in activated HSCs, as detected by qRT-qPCR assay. <span class="elsevierStyleBold">C.</span> Expression levels of activation-related proteins in HSCs were detected by qRT-qPCR assay. Expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). <span class="elsevierStyleBold">D.</span> Transfection efficiency of miR-494-3p was up-regulated by miR-494-3p mimic, as detected by qRT-PCR assay. Expression levels were normalized to U6. <span class="elsevierStyleBold">E-F.</span> The effect of miR-494-3p on the levels of HSC activation- and fibrosis-related protein was detected by qRT-PCR assay. Expression levels were normalized to GAPDH. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). **<span class="elsevierStyleItalic">P</span> < 0.01, ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Mock group; <span class="elsevierStyleSup">^^^</span><span class="elsevierStyleItalic">P</span> < 0.001 vs Quiescent group.</p>" ] ] 3 => array:8 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 2913 "Ancho" => 3175 "Tamanyo" => 614881 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0020" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">MiR-494-3p mimic inhibited viability and proliferation and induced apoptosis in HSCs.</p> <p id="spar0040" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> Cell Counting Kit (CCK)-8 assay showed that miR-494-3p inhibited HSC viability. <span class="elsevierStyleBold">B.</span> Colony formation assay showed that miR-494-3p inhibited HSC proliferation. <span class="elsevierStyleBold">C.</span> Flow cytometry assay showed that miR-494-3p induced HSC apoptosis. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). **<span class="elsevierStyleItalic">P</span> < 0.01, ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Mock group.</p>" ] ] 4 => array:8 [ "identificador" => "fig0025" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2496 "Ancho" => 3000 "Tamanyo" => 279133 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0025" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">MiR-494-3p targeted TRAF3 and inhibited TRAF3 expression, while overexpressed TRAF3 promoted TRAF3 expression.</p> <p id="spar0050" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> The binding sites of miR-494-3p and TNF receptor-associated factor 3 (TRAF3) were predicted by TargetScan v7.2 (<span class="elsevierStyleInterRef" id="intr0005" href="https://www.targetscan.org/">https://www.targetscan.org/</span>). <span class="elsevierStyleBold">B.</span> The direct interaction of miR-494-3p and TRAF3 was confirmed by dual-luciferase reporter assay. <span class="elsevierStyleBold">C.</span> The effect of miR-494-3p on TRAF3 expression was determined by qRT-PCR assay. <span class="elsevierStyleBold">D</span>. The transfection efficiency of TRAF3 was detected by qRT-PCR assay. Expression levels were normalized to GAPDH. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Mock group; <span class="elsevierStyleSup">###</span><span class="elsevierStyleItalic">P</span> < 0.001 vs Blank group; <span class="elsevierStyleSup">^^^</span><span class="elsevierStyleItalic">P</span> < 0.001 vs negative control (NC) group.</p>" ] ] 5 => array:8 [ "identificador" => "fig0030" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 3542 "Ancho" => 3175 "Tamanyo" => 497801 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0030" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Overexpressed TRAF3 rescued the regulatory effect of miR-494-3p mimic on the levels of HSC activation- and fibrosis-related protein.</p> <p id="spar0060" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> The effects of miR-494-3p and TRAF3 on the levels of HSC activation-related protein were determined by qRT-PCR assay. Expression levels were normalized to GAPDH. <span class="elsevierStyleBold">B.</span> The effects of miR-494-3p and TRAF3 on the levels of fibrosis-related proteins were determined by Western blot assay. Expression levels were normalized to GAPDH. <span class="elsevierStyleBold">C.</span> The effects of miR-494-3p and TRAF3 on the levels of fibrosis-related proteins were determined by qRT-PCR assay. Expression levels were normalized to GAPDH. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). *<span class="elsevierStyleItalic">P</span> < 0.05, **<span class="elsevierStyleItalic">P</span> < 0.01, ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Mock + NC group; <span class="elsevierStyleSup">#</span><span class="elsevierStyleItalic">P</span> < 0.05, <span class="elsevierStyleSup">##</span><span class="elsevierStyleItalic">P</span> < 0.01, <span class="elsevierStyleSup">###</span><span class="elsevierStyleItalic">P</span> < 0.001 vs Mock + TRAF3 group; <span class="elsevierStyleSup">^^</span><span class="elsevierStyleItalic">P</span> < 0.01, <span class="elsevierStyleSup">^^^</span><span class="elsevierStyleItalic">P</span> < 0.001 vs miR-494-3p mimic (Mimic) + NC group.</p>" ] ] 6 => array:8 [ "identificador" => "fig0035" "etiqueta" => "Fig. 7" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr7.jpeg" "Alto" => 2369 "Ancho" => 3175 "Tamanyo" => 515070 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0035" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Overexpressed TRAF3 partially reversed the regulatory effect of miR-494-3p mimic on cell viability, proliferation and apoptosis.</p> <p id="spar0070" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A.</span> The effects of miR-494-3p and TRAF3 on cell viability were determined by CCK-8 assay. <span class="elsevierStyleBold">B.</span> The effects of miR-494-3p and TRAF3 on proliferation were determined by colony formation assay. <span class="elsevierStyleBold">C.</span> The effects of miR-494-3p and TRAF3 on apoptosis were detected by flow cytometry assay. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). *<span class="elsevierStyleItalic">P</span> < 0.05, ***<span class="elsevierStyleItalic">P</span> < 0.001 vs Mock + NC group; <span class="elsevierStyleSup">##</span><span class="elsevierStyleItalic">P</span> < 0.01, <span class="elsevierStyleSup">###</span><span class="elsevierStyleItalic">P</span> < 0.001 vs Mock + TRAF3 group; <span class="elsevierStyleSup">^</span><span class="elsevierStyleItalic">P</span> < 0.05, <span class="elsevierStyleSup">^^^</span><span class="elsevierStyleItalic">P</span> < 0.001 vs Mimic + NC group.</p>" ] ] 7 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0040" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward (5′-3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse (5′-3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">miR-494−3p \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATTGGAACGATACAGAGAAGATT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGAACGCTTCACGAATTTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">COL-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATGTCTGGTTTGGAGAGAGCA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAGGAGCAGGGACTTCTTGAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TRAF3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAAGTGCAGCGTTCAGACTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCAGCCATAGCGCTTAAAAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TIMP-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGCTGTGAGGAATGCACA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGGAAGCCCTTTTCAGAGC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ɑ-SMA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTCCTTCGTGACTACTGCTGAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAAT GAAAGATGGCTGGAAGAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MMP-9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTCAAGGACGGTTGGTACTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGAAGATGTCGTGTGAGTTCC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">DDR2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTCTCAGGCTACGTTCAGATG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGAATCAAGCCACTCACACAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">FN1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGGCAGTGGTCATTTCAGATGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTCCCATCGTCATAGCACGTTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ITGB1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCGCGCGGAAAAGATGAAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATGTCATCTGGAGGGCAACC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Vimentin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AAGAACACCCGCACCAAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTAGTTGGCAAAGCGGTCA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GFAP \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGTGGCCACCAGTAACATGCAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCGATAGTCGTTAGCTTCGTGCTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAPDH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACAGCAACA GGGTGGTGGAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTTGAGGGTGCAGCGAACTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGACCTGAAACATACACGGGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TATCGTTGTACTCCACTCCTTGAC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Primers for qRT-PCR.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:46 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "[1]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mouse model of chronic and binge ethanol feeding (the NIAAA model)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Bertola" 1 => "S. Mathews" 2 => "S.H. Ki" 3 => "H. Wang" 4 => "B. Gao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nprot.2013.032" "Revista" => array:6 [ "tituloSerie" => "Nat Protoc" "fecha" => "2013" "volumen" => "8" "paginaInicial" => "627" "paginaFinal" => "637" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23449255" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "[2]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expression of proteins upregulated in hepatocellular carcinoma in patients with alcoholic hepatitis (AH) compared to non-alcoholic steatohepatitis (NASH): an immunohistochemical analysis of candidate proteins" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.G. Lu" 1 => "L. Nguyen" 2 => "S. Samadzadeh" 3 => "M. Masouminia" 4 => "A. Mendoza" 5 => "O. Sweeney" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.yexmp.2018.02.001" "Revista" => array:6 [ "tituloSerie" => "Exp Mol Pathol" "fecha" => "2018" "volumen" => "104" "paginaInicial" => "125" "paginaFinal" => "129" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29425759" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "[3]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA methylation-based prognosis and epidrivers in hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Villanueva" 1 => "A. Portela" 2 => "S. Sayols" 3 => "C. Battiston" 4 => "Y. Hoshida" 5 => "J. Méndez-González" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.27732" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2015" "volumen" => "61" "paginaInicial" => "1945" "paginaFinal" => "1956" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25645722" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "[4]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TLR2 and TLR9 contribute to alcohol-mediated liver injury through induction of CXCL1 and neutrophil infiltration" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y.S. Roh" 1 => "B. Zhang" 2 => "R. Loomba" 3 => "E. Seki" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpgi.00031.2015" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Gastrointest Liver Physiol" "fecha" => "2015" "volumen" => "309" "paginaInicial" => "G30" "paginaFinal" => "41" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25930080" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "[5]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Liver fibrosis: common mechanisms and antifibrotic therapies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D. Schuppan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.clinre.2015.05.005" "Revista" => array:7 [ "tituloSerie" => "Clin Res Hepatol Gastroenterol" "fecha" => "2015" "volumen" => "39" "numero" => "Suppl 1" "paginaInicial" => "S51" "paginaFinal" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26189980" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "[6]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatic cell proliferation plays a pivotal role in the prognosis of alcoholic hepatitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Lanthier" 1 => "L. Rubbia-Brandt" 2 => "N. Lin-Marq" 3 => "S. Clément" 4 => "J.L. Frossard" 5 => "N. Goossens" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2015.04.003" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2015" "volumen" => "63" "paginaInicial" => "609" "paginaFinal" => "621" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25872168" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "[7]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The critical dimension of ethnicity in liver cirrhosis mortality statistics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F.S. Stinson" 1 => "B.F. Grant" 2 => "M.C. Dufour" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Alcohol Clin Exp Res" "fecha" => "2001" "volumen" => "25" "paginaInicial" => "1181" "paginaFinal" => "1187" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11505049" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "[8]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatic stellate cells and liver fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "R.K. Moreira" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1043/1543-2165(2007)131[1728:hscalf]2.0.co;2" "Revista" => array:6 [ "tituloSerie" => "Arch Pathol Lab Med" "fecha" => "2007" "volumen" => "131" "paginaInicial" => "1728" "paginaFinal" => "1734" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17979495" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "[9]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Activation of hepatic stellate cells--a key issue in liver fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "H.L. Reeves" 1 => "S.L. Friedman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2741/reeves" "Revista" => array:6 [ "tituloSerie" => "Front Biosci" "fecha" => "2002" "volumen" => "7" "paginaInicial" => "d808" "paginaFinal" => "26" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11897564" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "[10]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reversal of hepatic fibrosis -- fact or fantasy?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.L. Friedman" 1 => "M.B. Bansal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.20974" "Revista" => array:7 [ "tituloSerie" => "Hepatology" "fecha" => "2006" "volumen" => "43" "paginaInicial" => "S82" "paginaFinal" => "8" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16447275" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0091674916002967" "estado" => "S300" "issn" => "00916749" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "[11]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNAs, transforming growth factor beta-1, and tissue fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Bowen" 1 => "R.H. Jenkins" 2 => "D.J. Fraser" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/path.4119" "Revista" => array:6 [ "tituloSerie" => "J Pathol" "fecha" => "2013" "volumen" => "229" "paginaInicial" => "274" "paginaFinal" => "285" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23042530" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "[12]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNAs in liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "X.W. Wang" 1 => "N.H. Heegaard" 2 => "H. Orum" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2012.04.007" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2012" "volumen" => "142" "paginaInicial" => "1431" "paginaFinal" => "1443" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22504185" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "[13]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNAs in the pathogenesis and treatment of progressive liver injury in NAFLD and liver fibrosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Q. Su" 1 => "V. Kumar" 2 => "N. Sud" 3 => "R.I. Mahato" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.addr.2018.01.009" "Revista" => array:7 [ "tituloSerie" => "Adv Drug Deliv Rev" "fecha" => "2018" "volumen" => "129" "paginaInicial" => "54" "paginaFinal" => "63" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29391222" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1885585719303706" "estado" => "S300" "issn" => "18855857" ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "[14]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-223 ameliorates alcoholic liver injury by inhibiting the IL-6-p47(phox)-oxidative stress pathway in neutrophils" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Li" 1 => "Y. He" 2 => "Z. Zhou" 3 => "T. Ramirez" 4 => "Y. Gao" 5 => "Y. Gao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/gutjnl-2016-311861" "Revista" => array:6 [ "tituloSerie" => "Gut" "fecha" => "2017" "volumen" => "66" "paginaInicial" => "705" "paginaFinal" => "715" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27679493" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "[15]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-494 sensitizes gastric Cancer cells to TRAIL treatment through downregulation of Survivin" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Xu" 1 => "D. Li" 2 => "T. Li" 3 => "L. Qiao" 4 => "K. Li" 5 => "L. Guo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000495867" "Revista" => array:6 [ "tituloSerie" => "Cell Physiol Biochem" "fecha" => "2018" "volumen" => "51" "paginaInicial" => "2212" "paginaFinal" => "2223" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30537730" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "[16]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Coordinated effects of microRNA-494 induce G₂/M arrest in human cholangiocarcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Yamanaka" 1 => "N.R. Campbell" 2 => "F. An" 3 => "S.C. Kuo" 4 => "J.J. Potter" 5 => "E. Mezey" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4161/cc.21105" "Revista" => array:6 [ "tituloSerie" => "Cell Cycle" "fecha" => "2012" "volumen" => "11" "paginaInicial" => "2729" "paginaFinal" => "2738" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22785131" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "[17]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-494 acts as a tumor promoter by targeting CASP2 in non-small cell lung cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q. Zhang" 1 => "Y. Li" 2 => "M. Zhao" 3 => "H. Lin" 4 => "W. Wang" 5 => "D. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41598-019-39453-2" "Revista" => array:5 [ "tituloSerie" => "Sci Rep" "fecha" => "2019" "volumen" => "9" "paginaInicial" => "3008" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30816202" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "[18]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The epigenetically regulated miR-494 associates with stem-cell phenotype and induces sorafenib resistance in hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Pollutri" 1 => "C. Patrizi" 2 => "S. Marinelli" 3 => "C. Giovannini" 4 => "E. Trombetta" 5 => "F.A. Giannone" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41419-017-0076-6" "Revista" => array:5 [ "tituloSerie" => "Cell Death Dis" "fecha" => "2018" "volumen" => "9" "paginaInicial" => "4" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29305580" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "[19]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serum microRNA expression profiling identifies serum biomarkers for HCV-related hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Li" 1 => "B. Jin" 2 => "T. Wang" 3 => "W. Li" 4 => "Z. Wang" 5 => "H. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3233/cbm-181970" "Revista" => array:6 [ "tituloSerie" => "Cancer Biomark" "fecha" => "2019" "volumen" => "26" "paginaInicial" => "501" "paginaFinal" => "512" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31658041" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "[20]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-494-3p promotes PI3K/AKT pathway hyperactivation and human hepatocellular carcinoma progression by targeting PTEN" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Lin" 1 => "Z.P. Huang" 2 => "J. Liu" 3 => "Y. Qiu" 4 => "Y.P. Tao" 5 => "M.C. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41598-018-28519-2" "Revista" => array:5 [ "tituloSerie" => "Sci Rep" "fecha" => "2018" "volumen" => "8" "paginaInicial" => "10461" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29992971" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "[21]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A novel member of the TRAF family of putative signal transducing proteins binds to the cytosolic domain of CD40" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Sato" 1 => "S. Irie" 2 => "J.C. Reed" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/0014-5793(94)01406-q" "Revista" => array:6 [ "tituloSerie" => "FEBS Lett" "fecha" => "1995" "volumen" => "358" "paginaInicial" => "113" "paginaFinal" => "118" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7530216" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "[22]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "G. Mosialos" 1 => "M. Birkenbach" 2 => "R. Yalamanchili" 3 => "T. VanArsdale" 4 => "C. Ware" 5 => "E. Kieff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/0092-8674(95)90489-1" "Revista" => array:6 [ "tituloSerie" => "Cell" "fecha" => "1995" "volumen" => "80" "paginaInicial" => "389" "paginaFinal" => "399" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7859281" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "[23]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Roles of TRAF3 in T cells: many surprises" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Z. Yi" 1 => "A.M. Wallis" 2 => "G.A. Bishop" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/15384101.2015.1021524" "Revista" => array:6 [ "tituloSerie" => "Cell Cycle" "fecha" => "2015" "volumen" => "14" "paginaInicial" => "1156" "paginaFinal" => "1163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25723057" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "[24]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expanding TRAF function: TRAF3 as a tri-faced immune regulator" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Häcker" 1 => "P.H. Tseng" 2 => "M. Karin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nri2998" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Immunol" "fecha" => "2011" "volumen" => "11" "paginaInicial" => "457" "paginaFinal" => "468" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21660053" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "[25]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "RANKL cytokine enhances TNF-induced osteoclastogenesis independently of TNF receptor associated factor (TRAF) 6 by degrading TRAF3 in osteoclast precursors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Z. Yao" 1 => "W. Lei" 2 => "R. Duan" 3 => "Y. Li" 4 => "L. Luo" 5 => "B.F. Boyce" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M116.771816" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2017" "volumen" => "292" "paginaInicial" => "10169" "paginaFinal" => "10179" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28438834" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "[26]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TRAF3 as a multifaceted regulator of B lymphocyte survival and activation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G.A. Bishop" 1 => "L.L. Stunz" 2 => "B.S. Hostager" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fimmu.2018.02161" "Revista" => array:5 [ "tituloSerie" => "Front Immunol" "fecha" => "2018" "volumen" => "9" "paginaInicial" => "2161" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30319624" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "[27]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatocyte TRAF3 promotes liver steatosis and systemic insulin resistance through targeting TAK1-dependent signalling" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.X. Wang" 1 => "X.J. Zhang" 2 => "P. Luo" 3 => "X. Jiang" 4 => "P. Zhang" 5 => "J. Guo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ncomms10592" "Revista" => array:5 [ "tituloSerie" => "Nat Commun" "fecha" => "2016" "volumen" => "7" "paginaInicial" => "10592" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26882989" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "[28]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-30e-UCP2 pathway regulates alcoholic hepatitis progress by influencing ATP and hydrogen peroxide expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "X. Jin" 1 => "M.S. Yu" 2 => "Y. Huang" 3 => "Z. Xiang" 4 => "Y.P. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.18632/oncotarget.19729" "Revista" => array:6 [ "tituloSerie" => "Oncotarget" "fecha" => "2017" "volumen" => "8" "paginaInicial" => "64294" "paginaFinal" => "64302" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28969071" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "[29]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of Zhenxin Xingshui Yizhi Fang on Aβ(25-35) induced expression of related transporters in HBMEC cell model" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Wu" 1 => "Q. Zheng" 2 => "Y.Y. Guo" 3 => "K.N. Zhang" 4 => "J. Luo" 5 => "S. Xiao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jep.2020.112783" "Revista" => array:3 [ "tituloSerie" => "J Ethnopharmacol" "fecha" => "2020" "volumen" => "260" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "[30]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Jujuboside A promotes Aβ clearance and ameliorates cognitive deficiency in Alzheimer’s disease through activating Axl/HSP90/PPARγ pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Zhang" 1 => "C. Qian" 2 => "Z.G. Zheng" 3 => "F. Qian" 4 => "Y. Wang" 5 => "P.M. Thu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7150/thno.26164" "Revista" => array:6 [ "tituloSerie" => "Theranostics" "fecha" => "2018" "volumen" => "8" "paginaInicial" => "4262" "paginaFinal" => "4278" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30128052" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "[31]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of invasion-metastasis-associated microRNAs in hepatocellular carcinoma based on bioinformatic analysis and experimental validation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W. Lou" 1 => "J. Chen" 2 => "B. Ding" 3 => "D. Chen" 4 => "H. Zheng" 5 => "D. Jiang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12967-018-1639-8" "Revista" => array:5 [ "tituloSerie" => "J Transl Med" "fecha" => "2018" "volumen" => "16" "paginaInicial" => "266" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30268144" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "[32]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Hyun" 1 => "S. Wang" 2 => "J. Kim" 3 => "K.M. Rao" 4 => "S.Y. Park" 5 => "I. Chung" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ncomms10993" "Revista" => array:5 [ "tituloSerie" => "Nat Commun" "fecha" => "2016" "volumen" => "7" "paginaInicial" => "10993" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27001906" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "[33]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "microRNA-29b prevents liver fibrosis by attenuating hepatic stellate cell activation and inducing apoptosis through targeting PI3K/AKT pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Wang" 1 => "E.S. Chu" 2 => "H.Y. Chen" 3 => "K. Man" 4 => "M.Y. Go" 5 => "X.R. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.18632/oncotarget.2621" "Revista" => array:6 [ "tituloSerie" => "Oncotarget" "fecha" => "2015" "volumen" => "6" "paginaInicial" => "7325" "paginaFinal" => "7338" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25356754" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "[34]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-26b-5p inhibits mouse liver fibrogenesis and angiogenesis by targeting PDGF receptor-beta" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Yang" 1 => "C. Dong" 2 => "J. Yang" 3 => "L. Yang" 4 => "N. Chang" 5 => "C. Qi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.omtn.2019.02.014" "Revista" => array:6 [ "tituloSerie" => "Mol Ther Nucleic Acids" "fecha" => "2019" "volumen" => "16" "paginaInicial" => "206" "paginaFinal" => "217" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30901579" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "[35]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Overexpression of miR-126 inhibits the activation and migration of HSCs through targeting CRK" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X.H. Gong" 1 => "C. Chen" 2 => "P. Hou" 3 => "S.C. Zhu" 4 => "C.Q. Wu" 5 => "C.L. Song" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000356653" "Revista" => array:6 [ "tituloSerie" => "Cell Physiol Biochem" "fecha" => "2014" "volumen" => "33" "paginaInicial" => "97" "paginaFinal" => "106" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24480980" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0180" "etiqueta" => "[36]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biodistribution and hepatic uptake of triplex-forming oligonucleotides against type alpha1(I) collagen gene promoter in normal and fibrotic rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Cheng" 1 => "Z. Ye" 2 => "R.V. Guntaka" 3 => "R.I. Mahato" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/mp050012x" "Revista" => array:6 [ "tituloSerie" => "Mol Pharm" "fecha" => "2005" "volumen" => "2" "paginaInicial" => "206" "paginaFinal" => "217" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15934781" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0185" "etiqueta" => "[37]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evolution of hepatic fibrosis research" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "N. Kawada" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1872-034X.2011.00776.x" "Revista" => array:5 [ "tituloSerie" => "Hepatol Res" "fecha" => "2011" "volumen" => "41" "paginaInicial" => "199" "paginaFinal" => "208" ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0190" "etiqueta" => "[38]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inhibition of hepatic fibrogenesis by matrix metalloproteinase-9 mutants in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Roderfeld" 1 => "R. Weiskirchen" 2 => "S. Wagner" 3 => "M.L. Berres" 4 => "C. Henkel" 5 => "J. Grötzinger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.05-4828com" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2006" "volumen" => "20" "paginaInicial" => "444" "paginaFinal" => "454" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16507762" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0195" "etiqueta" => "[39]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chlorogenic acid inhibits liver fibrosis by blocking the miR-21-Regulated TGF-β1/Smad7 signaling pathway in vitro and in vivo" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Yang" 1 => "L. Luo" 2 => "Z.D. Zhu" 3 => "X. Zhou" 4 => "Y. Wang" 5 => "J. Xue" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fphar.2017.00929" "Revista" => array:5 [ "tituloSerie" => "Front Pharmacol" "fecha" => "2017" "volumen" => "8" "paginaInicial" => "929" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29311932" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0200" "etiqueta" => "[40]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gliotoxin stimulates the apoptosis of human and rat hepatic stellate cells and enhances the resolution of liver fibrosis in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.C. Wright" 1 => "R. Issa" 2 => "D.E. Smart" 3 => "N. Trim" 4 => "G.I. Murray" 5 => "J.N. Primrose" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/gast.2001.27188" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2001" "volumen" => "121" "paginaInicial" => "685" "paginaFinal" => "698" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11522753" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0205" "etiqueta" => "[41]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Zhang KH. miR-140-3p knockdown suppresses cell proliferation and fibrogenesis in hepatic stellate cells via PTEN-Mediated AKT/mTOR signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.M. Wu" 1 => "T.H. Li" 2 => "H. Yun" 3 => "H.W. Ai" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3349/ymj.2019.60.6.561" "Revista" => array:6 [ "tituloSerie" => "Yonsei Med J" "fecha" => "2019" "volumen" => "60" "paginaInicial" => "561" "paginaFinal" => "569" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31124340" "web" => "Medline" ] ] ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0210" "etiqueta" => "[42]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-193a/b-3p relieves hepatic fibrosis and restrains proliferation and activation of hepatic stellate cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Ju" 1 => "Y. Nie" 2 => "X. Yang" 3 => "X. Wang" 4 => "F. Li" 5 => "M. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/jcmm.14210" "Revista" => array:6 [ "tituloSerie" => "J Cell Mol Med" "fecha" => "2019" "volumen" => "23" "paginaInicial" => "3824" "paginaFinal" => "3832" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30945448" "web" => "Medline" ] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0215" "etiqueta" => "[43]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The machinery of Nod-like receptors: refining the paths to immunity and cell death" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Saleh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1600-065X.2011.01045.x" "Revista" => array:6 [ "tituloSerie" => "Immunol Rev" "fecha" => "2011" "volumen" => "243" "paginaInicial" => "235" "paginaFinal" => "246" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21884180" "web" => "Medline" ] ] ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0220" "etiqueta" => "[44]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TRAF3 negatively regulates platelet activation and thrombosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Zhang" 1 => "G. Zhang" 2 => "B. Xiang" 3 => "X. Chen" 4 => "L. Tang" 5 => "S. Shi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41598-017-17189-1" "Revista" => array:6 [ "tituloSerie" => "Sci Rep" "fecha" => "2017" "volumen" => "7" "paginaInicial" => "17112" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29215030" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0735109719376788" "estado" => "S300" "issn" => "07351097" ] ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib0225" "etiqueta" => "[45]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-107 regulates autophagy and apoptosis of osteoarthritis chondrocytes by targeting TRAF3" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "X. Zhao" 1 => "H. Li" 2 => "L. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.intimp.2019.03.005" "Revista" => array:7 [ "tituloSerie" => "Int Immunopharmacol" "fecha" => "2019" "volumen" => "71" "paginaInicial" => "181" "paginaFinal" => "187" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30909133" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0091674914008938" "estado" => "S300" "issn" => "00916749" ] ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib0230" "etiqueta" => "[46]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-155-5p is Negatively Associated with Acute Pancreatitis and Inversely Regulates Pancreatic Acinar Cell Progression by Targeting Rela and Traf3" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Liu" 1 => "H. Zou" 2 => "Y. Wang" 3 => "X. Duan" 4 => "C. Chen" 5 => "W. Cheng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000495648" "Revista" => array:6 [ "tituloSerie" => "Cell Physiol Biochem" "fecha" => "2018" "volumen" => "51" "paginaInicial" => "1584" "paginaFinal" => "1599" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30497068" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack640369" "titulo" => "Acknowledgements" "texto" => "<p id="par0190" class="elsevierStylePara elsevierViewall">Not applicable.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/000000230000000C/v3_202212060650/S1665268121000041/v3_202212060650/en/main.assets" "Apartado" => array:4 [ "identificador" => "78265" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/000000230000000C/v3_202212060650/S1665268121000041/v3_202212060650/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121000041?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 10 | 0 | 10 |
| 2024 October | 65 | 2 | 67 |
| 2024 September | 56 | 4 | 60 |
| 2024 August | 56 | 6 | 62 |
| 2024 July | 55 | 12 | 67 |
| 2024 June | 38 | 6 | 44 |
| 2024 May | 57 | 5 | 62 |
| 2024 April | 50 | 15 | 65 |
| 2024 March | 69 | 10 | 79 |
| 2024 February | 75 | 8 | 83 |
| 2024 January | 61 | 2 | 63 |
| 2023 December | 75 | 14 | 89 |
| 2023 November | 107 | 15 | 122 |
| 2023 October | 99 | 21 | 120 |
| 2023 September | 51 | 2 | 53 |
| 2023 August | 44 | 10 | 54 |
| 2023 July | 55 | 7 | 62 |
| 2023 June | 51 | 19 | 70 |
| 2023 May | 94 | 5 | 99 |
| 2023 April | 50 | 2 | 52 |
| 2023 March | 28 | 7 | 35 |
| 2023 February | 25 | 12 | 37 |
| 2023 January | 19 | 6 | 25 |
| 2022 December | 40 | 4 | 44 |
| 2022 November | 29 | 12 | 41 |
| 2022 October | 36 | 8 | 44 |
| 2022 September | 34 | 16 | 50 |
| 2022 August | 17 | 14 | 31 |
| 2022 July | 15 | 11 | 26 |
| 2022 June | 15 | 11 | 26 |
| 2022 May | 26 | 11 | 37 |
| 2022 April | 23 | 9 | 32 |
| 2022 March | 27 | 7 | 34 |
| 2022 February | 18 | 5 | 23 |
| 2022 January | 55 | 18 | 73 |
| 2021 December | 19 | 11 | 30 |
| 2021 November | 17 | 10 | 27 |
| 2021 October | 24 | 13 | 37 |
| 2021 September | 15 | 11 | 26 |
| 2021 August | 22 | 8 | 30 |
| 2021 July | 128 | 20 | 148 |
| 2021 June | 5 | 1 | 6 |
| 2021 May | 9 | 2 | 11 |
| 2021 April | 3 | 4 | 7 |
| 2021 March | 4 | 5 | 9 |
| 2021 February | 4 | 4 | 8 |
| 2021 January | 5 | 0 | 5 |
Show all
