Immediate expression of c-fos and c-jun mRNA in a model of intestinal autotransplantation and ischemia-reperfusion in situ

array:24 ["pii" => "S1807593222013886" "issn" => "18075932" "doi" => "10.6061/clinics/2015(05)12" "estado" => "S300" "fechaPublicacion" => "2015-05-01" "aid" => "1388" "copyright" => "CLINICS" "copyrightAnyo" => "2015" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:373-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1807593222013898" "issn" => "18075932" "doi" => "10.6061/clinics/2015(05)13" "estado" => "S300" "fechaPublicacion" => "2015-05-01" "aid" => "1389" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:380-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "BASIC RESEARCH" "titulo" => "Lifespan extension and increased resistance to environmental stressors by N-Acetyl-L-Cysteine in Caenorhabditis elegans" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "380" "paginaFinal" => "386" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig3" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 388 "Ancho" => 750 "Tamanyo" => 22415 ] ] "descripcion" => array:1 [ "en" => "Response to environmental stressors with or without NAC treatment. (A) Survival after 10 h of heat stress was compared between untreated control and 5 mM NAC-treated worms. Data show the average of five independent experiments. (B) Time-course survival of worms after UV irradiation was monitored every hour. Values are means of three independent experiments. Asterisk indicates a significant difference (p<0.05 by Student's t test). Error bars indicate SEM." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Seung-Il Oh, Jin-Kook Park, Sang-Kyu Park" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Seung-Il" "apellidos" => "Oh" ] 1 => array:2 [ "nombre" => "Jin-Kook" "apellidos" => "Park" ] 2 => array:2 [ "nombre" => "Sang-Kyu" "apellidos" => "Park" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013898?idApp=UINPBA00004N" "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013898/v1_202212011403/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1807593222013874" "issn" => "18075932" "doi" => "10.6061/clinics/2015(05)11" "estado" => "S300" "fechaPublicacion" => "2015-05-01" "aid" => "1387" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:369-72" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "CLINICAL SCIENCE" "titulo" => "Accuracy of the Timed Up and Go test for predicting sarcopenia in elderly hospitalized patients" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "369" "paginaFinal" => "372" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 784 "Ancho" => 800 "Tamanyo" => 27240 ] ] "descripcion" => array:1 [ "en" => "Accuracy of the test Time Up and Go to predict sarcopenia in the sample of 68 elderly hospitalized patients." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Bruno Prata Martinez, Isabela Barboza Gomes, Carolina Santana de Oliveira, Isis Resende Ramos, Mônica Diniz Marques Rocha, Luiz Alberto Forgiarini Júnior, Fernanda Warken Rosa Camelier, Aquiles Assunção Camelier" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Bruno Prata" "apellidos" => "Martinez" ] 1 => array:2 [ "nombre" => "Isabela Barboza" "apellidos" => "Gomes" ] 2 => array:2 [ "nombre" => "Carolina Santana" "apellidos" => "de Oliveira" ] 3 => array:2 [ "nombre" => "Isis Resende" "apellidos" => "Ramos" ] 4 => array:2 [ "nombre" => "Mônica Diniz Marques" "apellidos" => "Rocha" ] 5 => array:2 [ "nombre" => "Luiz Alberto Forgiarini" "apellidos" => "Júnior" ] 6 => array:2 [ "nombre" => "Fernanda Warken Rosa" "apellidos" => "Camelier" ] 7 => array:2 [ "nombre" => "Aquiles Assunção" "apellidos" => "Camelier" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013874?idApp=UINPBA00004N" "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013874/v1_202212011403/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "BASIC RESEARCH" "titulo" => "Immediate expression of c-fos and c-jun mRNA in a model of intestinal autotransplantation and ischemia-reperfusion in situ" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "373" "paginaFinal" => "379" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Maria Mercês Santos, Ana Cristina Aoun Tannuri, Maria Cecilia Mendonça Coelho, Josiane de Oliveira Gonçalves, Suellen Serafini, Luiz Fernando Ferraz da Silva, Uenis Tannuri" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Maria Mercês" "apellidos" => "Santos" ] 1 => array:2 [ "nombre" => "Ana Cristina Aoun" "apellidos" => "Tannuri" ] 2 => array:2 [ "nombre" => "Maria Cecilia Mendonça" "apellidos" => "Coelho" ] 3 => array:2 [ "nombre" => "Josiane" "apellidos" => "de Oliveira Gonçalves" ] 4 => array:2 [ "nombre" => "Suellen" "apellidos" => "Serafini" ] 5 => array:2 [ "nombre" => "Luiz Fernando Ferraz" "apellidos" => "da Silva" ] 6 => array:4 [ "nombre" => "Uenis" "apellidos" => "Tannuri" "email" => array:1 [ 0 => "uenist@usp.br" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Pediatric Liver Transplantation Unit and Laboratory of Research in Pediatric Surgery (LIM 30), Faculdade de Medicina da Universidade de São Paulo, Pediatric Surgery Division, São Paulo/SP, Brazil" "identificador" => "aff1" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Corresponding author: Uenis Tannuri" ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig2" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 514 "Ancho" => 750 "Tamanyo" => 43488 ] ] "descripcion" => array:1 [ "en" => "The sequential expression patterns of c-fos and c-jun mRNA (semiquantitative method) and images of the respective bands. The numbers in the vertical axis correspond to the relative expression levels normalized to the internal control gene (β-actin)." ] ] ] "textoCompleto" => "INTRODUCTIONIntestinal ischemia-reperfusion (I/R) injury occurs in several clinical conditions and after intestinal transplantation. The hypoxia and tissue damage caused by I/R injury can, in turn, result in severe complications, and following intestinal transplantation, this type of injury plays a determining role in early graft dysfunction and long-term graft survival <a class="elsevierStyleCrossRefs" href="#bib1">1-4</a>. The number of cells present in adult tissue is determined based on the balance between destroyed and regenerated cells, and apoptosis plays an important role in this process of homeostasis under both physiological and pathological conditions <a class="elsevierStyleCrossRef" href="#bib5">5</a>. As a function of apoptosis, some gastrointestinal mucosal cells are periodically lost, leaving room for their physiological renewal, which occurs in association with the proliferation of local totipotent cells. Apoptosis and regeneration can also be triggered by I/R injury at the molecular level <a class="elsevierStyleCrossRef" href="#bib6">6</a>. In addition, apoptosis has been described as a marker of intestinal graft rejection <a class="elsevierStyleCrossRef" href="#bib7">7</a>. The process of intestinal regeneration after I/R injury involves increased DNA synthesis as well as the rapid and brief expression of immediate early response genes (IEGs) <a class="elsevierStyleCrossRef" href="#bib4">4</a>, including those which encode the transcription factors c-fos and c-jun. IEGs, which are expressed in a rapid and transient manner, can be induced by several factors, including I/R injury.The cellular genes c-fos and c-jun dimerize to form the activator protein-1 (AP-1) transcription factor complex. In addition, each forms several other stable homo- or heterodimeric complexes that bind to DNA regulatory, promoter, and potentiation regions thus controlling the transcription of numerous target genes. Both c-fos and c-jun contain leucine zippers that are responsible for their dimerization and for the regulation of cellular response genes following injury. Those genes can be expressed within minutes after the exposure of cells to a given stimulus, and the resulting products participate in several metabolic processes, such as the regulation of cell proliferation, differentiation, and apoptosis <a class="elsevierStyleCrossRef" href="#bib8">8</a>. The aim of the present study was to investigate the phenomena of apoptosis and cell proliferation in a previously described intestinal I/R injury autograft model involving cold preservation of the intestine. This model allows for the study of the physiological changes that occur following intestinal transplantation without the interference of immune aggression induced by the graft <a class="elsevierStyleCrossRef" href="#bib2">2</a>.In cold ischemic preservation of the intestine, hypothermia protects against I/R injury <a class="elsevierStyleCrossRefs" href="#bib9">9,10</a>. We quantified apoptosis and the cell proliferation index via histological examination and immunohistochemical analysis. We also investigated the molecular mechanisms involved in I/R injury repair by measuring the expression of the early activation genes c-fos and c-jun, which induce apoptosis and cell proliferation. A better understanding of the phenomena underlying I/R injury may allow for the identification of interventions to reduce its occurrence and, thus, to achieve better preservation of the intestinal graft.MATERIALS AND METHODSThirty adult male Wistar rats were subjected to surgery using the previously described I/R model involving perfusion through the cecal artery <a class="elsevierStyleCrossRef" href="#bib2">2</a>. Briefly, under an operating microscope (10X magnification), the mesocolon was sectioned from the cecum to the level of the middle colic artery. In the root of the mesentery, the mesenteric artery and vein were completely dissected and isolated by sectioning all of the nervous and lymphatic tissues to an extension of approximately 1 cm.All of the mesentery between the superior mesenteric artery and the jejunum (6-8 cm below the ligament of Treitz) was also sectioned. After these procedures, the distal branch of the superior mesenteric artery corresponding to the cecum was dissected (under a microscope at 40X magnification) in an extension that was sufficient for cannulation with a 1.9 French silicone catheter (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1A</a>). Close to the cecal valve, there was a consistently located lymph node that served as a reference point for the localization of the cecal artery. The jejunum and the ascending colon were clamped, and the superior mesenteric artery and vein were occluded using non-traumatic vascular clamps. The superior mesenteric artery was irrigated with lactated Ringer'´s solution at 4°C through a previously inserted cannula in the cecal artery, and perfusion was performed using an infusion pump at a rate of 40 ml of solution per hour, accompanied by the additional cooling of the peritoneal cavity with ice (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1B</a>). The effluent flowed out through a small leak in the superior mesenteric vein. The perfusion was considered adequate when the intestine and the mesentery were completely pale and the effluent was clear. Then, perfusion was interrupted (the total volume necessary for perfusion was 2.5 to 5.0 ml), the opening of the mesenteric vein was sutured with 10-0 prolene, and the catheter was removed. Next, the clamps were immediately removed from the mesenteric artery and vein, and reperfusion of the intestine (graft) was confirmed based on the return of pulsatile mesenteric blood flow. The average duration of ischemia was 18.37±5.06 min. Following reperfusion, the cecum was harvested at different time points as representative intestinal samples. The rats were allocated to the following four subgroups according to the reperfusion time: subgroup 1: 5 min (n=9); subgroup 2: 15 min (n=7); subgroup 3: 30 min (n=8); and subgroup 4: 60 min (n=6). Additionally, a control group (n=7) was subjected to the same procedures except for I/R injury.<elsevierMultimedia ident="fig1"></elsevierMultimedia>The harvested material was divided into two fragments One fragment was immersed in 10% formaldehyde for histological processing and immunohistochemical analysis, and the other fragment was immediately frozen in liquid nitrogen at -170°C for RNA extraction.Immunohistochemical methodsTUNEL assayThe TUNEL assay is a method used to detect DNA fragmentation that results from the activation of apoptotic cascades. In the present study, intestinal histological sections were fixed in 10% formalin, embedded in paraffin, sliced into 5-μm-thick sections, and then deparaffinized. Following hydration, the sections were subjected to TUNEL staining and enzymatic digestion with proteinase K, followed by the blocking of endogenous peroxidase activity. Finally, the sections were immersed in sodium citrate and Triton X-100 solution to induce cell permeabilization, incubated in TdT enzyme solution and a mixture of nucleotides, washed with phosphate-buffered saline (PBS), and incubated in Converter-POD. The sections were processed to detect apoptotic cells using the chromogenic substrate 3,3'-diaminobenzidine (DAB) (Sigma¯), followed by counterstaining with Harris hematoxylin, dehydration, and mounting. This assay was performed using intestinal samples from the control group, and the samples were harvested at 60 min after I/R to quantify apoptosis. This time point was selected because it exhibited the greatest expression of the c-fos and c-jun genes <a class="elsevierStyleCrossRef" href="#bib2">2</a>.Ki-67 stainingTo quantify intestinal cell proliferation, immunohistochemical staining for Ki-67 was performed on intestinal samples from the control group and the group of samples harvested at 60 min after I/R.The monoclonal anti-Ki-67 antibody used was a mouse IgG1 antibody against a nuclear fraction of the L428 Hodgkin's lymphoma cell line. The anti-Ki-67 antibody recognizes and reacts with Ki-67, which is a nuclear protein detected at all active stages of the cell cycle except for G0; therefore, it serves as a marker of cell proliferation.After fixation with 10% formaldehyde, the tissues were embedded in paraffin, sliced into 5-μm-thick sections, deparaffinized, and hydrated. The sections were then processed for antigen recovery, blocking of endogenous peroxidase activity, and the immunohistochemical detection of Ki-67. For this purpose, the sections were incubated in the mouse monoclonal anti-rat Ki-67 antibody (clone MIB-5; DAKO) diluted 1:400. Staining was performed using the chromogenic substrate DAB (Sigma¯), followed by counterstaining with Harris hematoxylin, dehydration, and mounting.Histomorphometric analysisHistological analysis was performed using a Nikon¯ eclipse 50i microscope (Nikon Corporation Tokyo, Japan). Images were acquired using 10x ocular and 40x objective lenses. The full surface of the intestinal mucosa of each section was photographed for all of the slides. NIS-Elements BR¯ software controlled by an IBM computer was used to acquire digital color microscopic images. Histomorphometric analyses were performed using slides from the control group and the group of samples harvested at 60 min after reperfusion. To quantify the cells labeled in the TUNEL assay and by Ki-67 immunostaining, the digital images were analyzed using Image-Pro Plus 4.5 software (Media Cybernetics, Silver Spring, USA). TUNEL-positive cells were quantified by counting individual apoptotic cells in a defined area of interest, the size of which was automatically calculated by a previously calibrated computer system. Thus, the number of apoptotic cells per mm3 was obtained. A total of 47 mucosal fragments from six animals in the control group and 80 mucosal fragments from six animals in the 60-min after reperfusion group were measured.A macro (computer routine) was developed for use with Image-Pro Plus software, for which the interval of positive labeling was predefined by an experienced pathologist to perform the automatic counting of Ki-67-positive areas that were dark brown in color, as well as to calculate the total villus/delimited crypt areas. These calculations allowed us to determine the proportions of Ki-67-positive areas in the villi and the crypts. A total of 390 Ki-67-positive villus areas were measured in six animals from the control group, and 652 were measured from six animals in the group of cecum samples harvested at 60 min after I/R.Molecular methodsExtraction of total RNA and reverse transcriptionThe intestinal fragments that were freshly collected and immediately frozen in liquid nitrogen were stored at -170°C until processing to study the expression of the c-fos and c-jun genes in association with cell proliferation and apoptosis. First, total RNA was extracted from intestinal samples using TRIZOL™ reagent (Invitrogen, Carlsbad, CA, USA). Approximately 100 mg of intestine was fragmented in a tissue mill (Mikro Dismembrator U, Sartorius AG, Goettingen, Germany) after the addition of liquid nitrogen and was then homogenized in 700 μl of TRIZOL solution according to the manufacturer's protocol.The total RNA concentration was measured using a spectrophotometer (BioPhotometer, Eppendorf AG, Germany) at 260 nm, and RNA quality was assessed by calculating the 260 nm/280 nm absorbance ratio. One microgram of RNA was subjected to agarose gel electrophoresis to assess its integrity by visualizing the fragments corresponding to 18S and 28S ribosomal RNAs.Complementary DNA (cDNA) was prepared from 2 μg of total RNA via reverse transcription using 200 U of SuperScript III RNase H-RT (Invitrogen) and oligo(dT)s as primers. The resulting cDNA solution was stored at -20°C.Gene expression was evaluated by two methods, conventional semiquantitative RT-polymerase chain reaction (PCR) and real-time RT-PCR analyses, and the results of these two methods were compared.PCR and semiquantitative analysis of PCR productsThe specific primers for c-fos and c-jun used in the present study were previously described by Shima et al. <a class="elsevierStyleCrossRef" href="#bib4">4</a>. The β-actin gene was amplified as an internal control of RNA transcription. The primer sequences and the amplification conditions are described in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>. Double-distilled water was used in place of cDNA as a negative control. The total PCR volume of 25 μl included the following reagents: 3 μl of cDNA, 2 pmol of each forward and reverse primer, 200 μM of each deoxynucleotide (dATP, dCTP, dGTP, and dTTP), 2.5 μl of enzyme buffer, and 2 U of Taq DNA polymerase. A separate reaction was prepared for each investigated gene and was amplified according to the optimal parameters for the given primers using the same thermocycler (MJ Research, CA, USA). After an initial denaturation step at 95°C for 5 min, cycles of denaturation at 95°C for 60 sec, annealing for 60 sec (<a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>), and extension at 72°C were performed, followed by a final extension step at 72°C for 10 min. Each PCR reaction was repeated three times to ensure data consistency. The amplified product (10 μl volume) was subjected to electrophoresis in a 2% agarose gel.<elsevierMultimedia ident="tbl1"></elsevierMultimedia>Semiquantitative analysis of PCR productsThe gel was viewed using a Kodak Gel Logic 100 Imaging System (Kodak, Rochester, NY, USA). The magnitude of the expression of each gene was assessed by band densitometry using Kodak Molecular Imaging Software. The amounts of the c-fos and c-jun PCR products were normalized to those of β-actin. The expression levels of the c-jun and c-fos genes were presented as the means ± standard deviation of the average relative band densities.Real-time PCR and quantitative analysis of PCR productsThe primers used to amplify the c-fos and β-actin genes were the same as those used in semiquantitative RT-PCR, but other primers were synthesized to amplify the c-jun gene because in real-time PCR, the reactions for the target gene and the housekeeping gene are performed together, and the same annealing temperature should be used for both reactions. In addition, a smaller amplicon is required. The primer sequences for the c-jun gene were as follows: 5' caggtggcacagcttaaaca 3' (forward); 5' cgcaaccagtcaagttctca 3' (reverse). The amplicon size was 162 base pairs.Quantitative real-time PCR was performed in a 15.0 µL reaction mixture consisting of 7.5 µL of Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, CA), 0.3 µL each of gene-specific forward and reverse primers (10 µM), 1.0 µL of cDNA, and 5.9 µL of nuclease-free water using a Rotor-Gene Q 5plex HRM thermal cycler (Qiagen, Germany).The cycling conditions were as follows: initial template denaturation at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 30 seconds, and extension at 72 °C for 30 seconds. Fluorescence detection was performed during each cycle at 72°C to identify the positive samples. Each sample was assessed in triplicate, and controls lacking the template were included in parallel for each reaction.Amplification was followed by melting curve analysis to assess PCR product specificity. The data were analyzed using the 2-ΔΔCT method of relative quantification <a class="elsevierStyleCrossRef" href="#bib11">11</a>.Statistical analysisTo compare the gene expression data obtained via semiquantitative RT-PCR, one-way analysis of variance (ANOVA) was performed, and the Bonferroni test was applied for comparisons between the groups. The gene expression data obtained via real-time PCR were analyzed using the Kruskal-Wallis test and the post hoc Tukey test because they had a non-parametric distribution. The TUNEL and Ki-67 immunofluorescence data were analyzed using PASW Statistics Base v.15.0 for Windows (SPSS Inc.©). The Mann-Whitney U test was used to compare pairs of groups. The data were expressed as the medians (interquartile ranges). Significance was established at p<0.05.RESULTSMolecular studiesSemiquantitative and quantitative analysis of PCR productsThe expression levels of the c-fos and c-jun genes as determined by semiquantitative and quantitative analyses are shown in <a class="elsevierStyleCrossRefs" href="#fig2">Figures 2 and 3</a>. The expression levels of these two genes coincided, with increases beginning at 5 min after reperfusion.<elsevierMultimedia ident="fig2"></elsevierMultimedia><elsevierMultimedia ident="fig3"></elsevierMultimedia>Immunohistochemical analysisObservation of the TUNEL-stained sections under a microscope revealed the presence of dark brown apoptotic bodies, predominantly in the mucosa. Counting of the apoptotic bodies revealed that the number of apoptotic cells in the group of cecum samples harvested at 60 min after I/R was greater than that in the control group (p=0.009). In addition, the proportion of Ki-67-positive area was significantly higher in this experimental group than in the control group (p<0.001) (<a class="elsevierStyleCrossRefs" href="#fig4">Figures 4 and 5</a>).<elsevierMultimedia ident="fig4"></elsevierMultimedia><elsevierMultimedia ident="fig5"></elsevierMultimedia>DISCUSSIONIn the present study, we investigated the expression of the IEGs c-fos and c-jun in a rat I/R model in which the intestine was perfused with lactated Ringer's solution at 4°C. The intestine was kept cool in situ during ischemia. In addition, markers of cell proliferation and apoptosis were investigated in intestinal samples harvested at the time point of maximal IEG expression. Two analysis methods, semiquantitative and quantitative PCR, were utilized in the current investigation to provide a better estimation of the results. The expression levels of both genes coincided, in agreement with previous results of investigations performed in our laboratory <a class="elsevierStyleCrossRef" href="#bib12">12</a>.A previous study of IEGs in a pig liver I/R model during the acute stage, i.e., 1-3 h after reperfusion, suggested that c-fos and c-jun participate in both tissue regeneration and apoptosis <a class="elsevierStyleCrossRef" href="#bib8">8</a>. The same study showed that the duration of cold ischemia for liver preservation and the levels of oxygen free radicals are associated with the expression of IEGs <a class="elsevierStyleCrossRef" href="#bib8">8</a>. Taguchi et al. investigated the expression of c-fos and c-jun in a rat model of intestinal transplantation. These authors reported a lack of gene activity during the first 30 min after transplantation. They found that at 4 h after transplantation, c-fos only began to be expressed and c-jun exhibited little activity. However, at 72 h after transplantation, the expression of both genes was not detectable. These authors concluded that c-fos and c-jun are associated with the adaptive process of intestinal transplantation <a class="elsevierStyleCrossRef" href="#bib13">13</a>. The results of our study are similar, showing that these two IEGs are expressed early. However, our measurements were performed earlier and at shorter intervals within the first hour after reperfusion. The c-fos and c-jun expression levels in our samples began to increase at 5 min, and this alteration was maintained at 60 min, in contrast to the observations of the aforementioned previous study.Shima et al. studied the expression of c-fos and c-jun in rat intestines after I/R <a class="elsevierStyleCrossRef" href="#bib4">4</a> and found that apoptosis and cell proliferation depend on their expression, similar to the conclusions of other studies <a class="elsevierStyleCrossRefs" href="#bib8">8,14</a>. The authors further suggested that the joint expression of these IEGs results in the induction of cell proliferation and apoptosis after I/R. Shima et al. proposed a more specific correlation between the roles of c-fos and c-jun after I/R in which c-fos induces cell proliferation and c-jun is a key factor involved in apoptosis <a class="elsevierStyleCrossRef" href="#bib4">4</a>. In the present study, the early expression of c-fos and c-jun indicated that these inducers of apoptosis and cell proliferation had been activated by I/R. We sought to understand and to establish the correlation between these genetic phenomena and the immunohistochemical markers of apoptosis (by TUNEL staining) and cell proliferation (by Ki-67 staining).Immunohistochemical analysis via the TUNEL assay revealed a statistically significant increase in the number of apoptotic cells at 60 min after I/R in the I/R-injured cecum compared with the control cecum, indicating that the induction of apoptosis, but not necrosis, occurred early <a class="elsevierStyleCrossRef" href="#bib15">15</a>. This finding is in agreement with reports in the literature showing that apoptotic cells appear several minutes after stimulation and that the full sequence of apoptosis is completed within 1-4 h <a class="elsevierStyleCrossRef" href="#bib16">16</a>. We also found a statistically significant difference in the number of proliferating cells at 60 min after reperfusion, as demonstrated by the increased expression of Ki-67. Thus, the IEGs c-fos and c-jun together may be responsible for cell proliferation and apoptosis. The major questions that remain to be answered concern the exact time at which these phenomena occur and whether it is possible to control apoptosis to improve the preservation of intestinal grafts. Our results showed that cold graft preservation was not sufficiently protective because the IEGs were induced quite early after reperfusion. Oxygen free radicals are likely an important trigger of the expression of IEGs, and these species may also play definitive roles in cold ischemic graft preservation; however, these possibilities require further study. In conclusion, the early activation of the c-fos and c-jun genes occurred after intestinal I/R injury, and these genes together can trigger cell proliferation and apoptosis.AUTHOR CONTRIBUTIONSSantos MM and Tannuri AC performed the experiments. Coelho MC, Gonçalves JO, Serafini S and Silva LF performed the laboratory analysis. Tannuri U revised the manuscript." "textoCompletoSecciones" => array:1 [ "secciones" => array:7 [ 0 => array:2 [ "identificador" => "xpalclavsec1582304" "titulo" => "KEYWORDS" ] 1 => array:2 [ "identificador" => "cesec10" "titulo" => "INTRODUCTION" ] 2 => array:3 [ "identificador" => "cesec20" "titulo" => "MATERIALS AND METHODS" "secciones" => array:4 [ 0 => array:3 [ "identificador" => "cesec30" "titulo" => "Immunohistochemical methods" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "cesec40" "titulo" => "TUNEL assay" ] 1 => array:2 [ "identificador" => "cesec50" "titulo" => "Ki-67 staining" ] ] ] 1 => array:2 [ "identificador" => "cesec60" "titulo" => "Histomorphometric analysis" ] 2 => array:3 [ "identificador" => "cesec70" "titulo" => "Molecular methods" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "cesec80" "titulo" => "Extraction of total RNA and reverse transcription" ] 1 => array:2 [ "identificador" => "cesec90" "titulo" => "PCR and semiquantitative analysis of PCR products" ] 2 => array:2 [ "identificador" => "cesec100" "titulo" => "Semiquantitative analysis of PCR products" ] 3 => array:2 [ "identificador" => "cesec110" "titulo" => "Real-time PCR and quantitative analysis of PCR products" ] ] ] 3 => array:2 [ "identificador" => "cesec120" "titulo" => "Statistical analysis" ] ] ] 3 => array:3 [ "identificador" => "cesec130" "titulo" => "RESULTS" "secciones" => array:2 [ 0 => array:3 [ "identificador" => "cesec140" "titulo" => "Molecular studies" "secciones" => array:1 [ 0 => array:2 [ "identificador" => "cesec150" "titulo" => "Semiquantitative and quantitative analysis of PCR products" ] ] ] 1 => array:2 [ "identificador" => "cesec160" "titulo" => "Immunohistochemical analysis" ] ] ] 4 => array:2 [ "identificador" => "cesec170" "titulo" => "DISCUSSION" ] 5 => array:2 [ "identificador" => "cesec180" "titulo" => "AUTHOR CONTRIBUTIONS" ] 6 => array:1 [ "titulo" => "REFERENCES" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2014-12-03" "fechaAceptado" => "2015-02-06" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "KEYWORDS" "identificador" => "xpalclavsec1582304" "palabras" => array:6 [ 0 => "Ischemia-reperfusion injury" 1 => "Immediate early genes" 2 => "Activator protein 1" 3 => "Small intestine" 4 => "C-fos" 5 => "C-jun gene" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "resumen" => "OBJECTIVE:Intestinal ischemia-reperfusion injury occurs in several clinical conditions and after intestinal transplantation. The aim of the present study was to investigate the phenomena of apoptosis and cell proliferation in a previously described intestinal ischemia-reperfusion injury autograft model using immunohistochemical markers. The molecular mechanisms involved in ischemia-reperfusion injury repair were also investigated by measuring the expression of the early activation genes c-fos and c-jun, which induce apoptosis and cell proliferation. MATERIALS AND METHODS:Thirty adult male Wistar rats were subjected to surgery for a previously described ischemia-reperfusion model that preserved the small intestine, the cecum and the ascending colon. Following reperfusion, the cecum was harvested at different time points as a representative segment of the intestine. The rats were allocated to the following four subgroups according to the reperfusion time: subgroup 1: 5 min; subgroup 2: 15 min; subgroup 3: 30 min; and subgroup 4: 60 min. A control group of cecum samples was also collected. The expression of c-fos, c-jun and immunohistochemical markers of cell proliferation and apoptosis (Ki67 and TUNEL, respectively) was studied. RESULTS:The expression of both c-fos and c-jun in the cecum was increased beginning at 5 min after ischemia-reperfusion compared with the control. The expression of c-fos began to increase at 5 min, peaked at 30 min, and exhibited a declining tendency at 60 min after reperfusion. A progressive increase in c-jun expression was observed. Immunohistochemical analyses confirmed these observations. CONCLUSION:The early activation of the c-fos and c-jun genes occurred after intestinal ischemia-reperfusion injury, and these genes can act together to trigger cell proliferation and apoptosis." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs10" "titulo" => "OBJECTIVE:" ] 1 => array:2 [ "identificador" => "ceabs20" "titulo" => "MATERIALS AND METHODS:" ] 2 => array:2 [ "identificador" => "ceabs30" "titulo" => "RESULTS:" ] 3 => array:2 [ "identificador" => "ceabs40" "titulo" => "CONCLUSION:" ] ] ] ] "NotaPie" => array:1 [ 0 => array:1 [ "nota" => "No potential conflict of interest was reported." ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1020 "Ancho" => 666 "Tamanyo" => 187869 ] ] "descripcion" => array:1 [ "en" => "A) Cannulation of the distal branch of the superior mesenteric artery using a silicone catheter. B) Aspect of the intestine after irrigation with lactated Ringer's solution at 4°C." ] ] 1 => array:7 [ "identificador" => "fig2" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 514 "Ancho" => 750 "Tamanyo" => 43488 ] ] "descripcion" => array:1 [ "en" => "The sequential expression patterns of c-fos and c-jun mRNA (semiquantitative method) and images of the respective bands. The numbers in the vertical axis correspond to the relative expression levels normalized to the internal control gene (β-actin)." ] ] 2 => array:7 [ "identificador" => "fig3" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 515 "Ancho" => 750 "Tamanyo" => 32171 ] ] "descripcion" => array:1 [ "en" => "The sequential expression patterns of c-fos and c-jun mRNA (quantitative method). Note that these results are similar to those obtained using the semiquantitative method." ] ] 3 => array:7 [ "identificador" => "fig4" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 462 "Ancho" => 744 "Tamanyo" => 23477 ] ] "descripcion" => array:1 [ "en" => "The numbers of apoptotic cells (left - TUNEL assay) and proliferating cells (right - Ki-67 staining) in the control and I/R-injured groups (60 min after reperfusion)." ] ] 4 => array:7 [ "identificador" => "fig5" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 259 "Ancho" => 691 "Tamanyo" => 64602 ] ] "descripcion" => array:1 [ "en" => "Immunohistochemical analyses of TUNEL (A) and Ki-67 (B) staining at 60 min after reperfusion. Note the increased numbers of positively stained cells at this time point compared to the control." ] ] 5 => array:7 [ "identificador" => "tbl1" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "Ta=annealing temperaturebp=base pair" "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Primer sequence \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Amplicon size (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Ta \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Number of cycles \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">β-actin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - gcc aga gcg gga gtg gtg aa - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">309 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">53°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - ggc ttg ggc tca ggg tca tt - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">c-fos \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - gcc tcg ttc ctc cag tcc ga - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">434 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">53°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - tgc gat gga aag gcc agc cc - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">c-jun \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - acc ttc aac acc cca gcc atg - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">554 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">55°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5‘ - ggc cat ctc ttg ctc gaa gtc - 3‘ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Primer sequences and amplification conditions." ] ] ] "bibliografia" => array:2 [ "titulo" => "REFERENCES" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec10" "bibliografiaReferencia" => array:16 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gut ischaemia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => """ U Haglund \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/gut.35.1_suppl.s73" "Revista" => array:7 [ "tituloSerie" => "Gut" "fecha" => "1994" "volumen" => "35" "numero" => "1 Suppl" "paginaInicial" => "S73" "paginaFinal" => "S76" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8125397" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Description of a new model of intestinal denervation and in?situ ischemia-reperfusion injury using the cecal artery for perfusion" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ MM Santos \n \t\t\t\t\t\t\t\t """ 1 => """ U Tannuri \n \t\t\t\t\t\t\t\t """ 2 => """ AC Tannuri \n \t\t\t\t\t\t\t\t """ 3 => """ MC Coelho \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.transproceed.2009.05.037" "Revista" => array:7 [ "tituloSerie" => "Transplant Proc" "fecha" => "2009" "volumen" => "41" "numero" => "9" "paginaInicial" => "3617" "paginaFinal" => "3621" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19917354" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.transproceed.2009.05.037" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.transproceed.2009.05.037" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apoptosis is a major mode of cell death caused by ischaemia and ischaemia/reperfusion injury to the rat intestinal epithelium" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ H Ikeda \n \t\t\t\t\t\t\t\t """ 1 => """ Y Suzuki \n \t\t\t\t\t\t\t\t """ 2 => """ M Suzuki \n \t\t\t\t\t\t\t\t """ 3 => """ M Koike \n \t\t\t\t\t\t\t\t """ 4 => """ J Tamura \n \t\t\t\t\t\t\t\t """ 5 => """ J Tong \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1136/gut.42.4.530" "Revista" => array:7 [ "tituloSerie" => "Gut" "fecha" => "1998" "volumen" => "42" "numero" => "4" "paginaInicial" => "530" "paginaFinal" => "537" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9616316" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1136/gut.42.4.530" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1136/gut.42.4.530" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased expression of c-fos and c-jun in the rat small intestinal epithelium after ischemia-reperfusion injury: a possible correlation with the proliferation or apoptosis of intestinal epithelial cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ Y Shima \n \t\t\t\t\t\t\t\t """ 1 => """ T Tajiri \n \t\t\t\t\t\t\t\t """ 2 => """ T Taguchi \n \t\t\t\t\t\t\t\t """ 3 => """ S Suita \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.jpedsurg.2005.12.025" "Revista" => array:8 [ "tituloSerie" => "J Pediatr Surg" "fecha" => "2006" "volumen" => "41" "numero" => "4" "paginaInicial" => "830" "paginaFinal" => "836" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16567203" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0967586815005895" "estado" => "S300" "issn" => "09675868" ] ] ] 1 => array:2 [ "doi" => "10.1016/j.jpedsurg.2005.12.025" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.jpedsurg.2005.12.025" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The apoptosis cascade–morphological and immunohistochemical methods for its visualization" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ B Huppertz \n \t\t\t\t\t\t\t\t """ 1 => """ HG Frank \n \t\t\t\t\t\t\t\t """ 2 => """ P Kaufmann \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s004290050254" "Revista" => array:8 [ "tituloSerie" => "Anat Embryol (Berl)" "fecha" => "1999" "volumen" => "200" "numero" => "1" "paginaInicial" => "1" "paginaFinal" => "18" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10395001" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1525505019303166" "estado" => "S300" "issn" => "15255050" ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of apoptosis in intestinal ischaemia-reperfusion injury–a light and electron microscopic study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ KA Shah \n \t\t\t\t\t\t\t\t """ 1 => """ S Shurey \n \t\t\t\t\t\t\t\t """ 2 => """ CJ Green \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1046/j.1365-2613.1997.420369.x" "Revista" => array:7 [ "tituloSerie" => "Int J Exp Pathol" "fecha" => "1997" "volumen" => "78" "numero" => "5" "paginaInicial" => "355" "paginaFinal" => "363" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9462233" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1046/j.1365-2613.1997.420369.x" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1046/j.1365-2613.1997.420369.x" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anatomic and histologic variability of epithelial apoptosis in small bowel transplants" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ BA Pasternak \n \t\t\t\t\t\t\t\t """ 1 => """ MH Collins \n \t\t\t\t\t\t\t\t """ 2 => """ GM Tiao \n \t\t\t\t\t\t\t\t """ 3 => """ JA Rudolph \n \t\t\t\t\t\t\t\t """ 4 => """ MH Alonso \n \t\t\t\t\t\t\t\t """ 5 => """ FC Ryckman \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1111/j.1399-3046.2008.01125.x" "Revista" => array:7 [ "tituloSerie" => "Pediatr Transplant" "fecha" => "2010" "volumen" => "14" "numero" => "1" "paginaInicial" => "72" "paginaFinal" => "76" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19207229" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1111/j.1399-3046.2008.01125.x" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1111/ptr.2009.14.issue-1" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "c-fos and c-jun mRNA expression in a pig liver model of ischemia/reperfusion: effect of extended cold storage and the antioxidant idebenone" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ E Wieland \n \t\t\t\t\t\t\t\t """ 1 => """ M Oellerich \n \t\t\t\t\t\t\t\t """ 2 => """ F Braun \n \t\t\t\t\t\t\t\t """ 3 => """ E Schtuz \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/s0009-9120(00)00070-9" "Revista" => array:7 [ "tituloSerie" => "Clin Biochem" "fecha" => "2000" "volumen" => "33" "numero" => "4" "paginaInicial" => "285" "paginaFinal" => "290" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10936587" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/s0009-9120(00)00070-9" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/S0009-9120(00)00070-9" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regional hypothermia reduces mucosal NFkappaB and PMN priming via gut lymph during canine mesenteric ischemia/reperfusion" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ HT Hassoun \n \t\t\t\t\t\t\t\t """ 1 => """ UM Fischer \n \t\t\t\t\t\t\t\t """ 2 => """ BO Attuwaybi \n \t\t\t\t\t\t\t\t """ 3 => """ FA Moore \n \t\t\t\t\t\t\t\t """ 4 => """ HJ Safi \n \t\t\t\t\t\t\t\t """ 5 => """ SJ Allen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/s0022-4804(03)00298-1" "Revista" => array:8 [ "tituloSerie" => "J Surg Res" "fecha" => "2003" "volumen" => "115" "numero" => "1" "paginaInicial" => "121" "paginaFinal" => "126" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14572782" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0920121116303035" "estado" => "S300" "issn" => "09201211" ] ] ] 1 => array:2 [ "doi" => "10.1016/s0022-4804(03)00298-1" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/S0022-4804(03)00298-1" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hypothermia protects against gut ischemia/reperfusion-induced impaired intestinal transit by inducing heme oxygenase-1" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ BO Attuwaybi \n \t\t\t\t\t\t\t\t """ 1 => """ HT Hassoun \n \t\t\t\t\t\t\t\t """ 2 => """ L Zou \n \t\t\t\t\t\t\t\t """ 3 => """ RA Kozar \n \t\t\t\t\t\t\t\t """ 4 => """ BC Kone \n \t\t\t\t\t\t\t\t """ 5 => """ NW Weisbrodt \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/s0022-4804(03)00313-5" "Revista" => array:8 [ "tituloSerie" => "J Surg Res" "fecha" => "2003" "volumen" => "115" "numero" => "1" "paginaInicial" => "48" "paginaFinal" => "55" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14572772" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0140673606690430" "estado" => "S300" "issn" => "01406736" ] ] ] 1 => array:2 [ "doi" => "10.1016/s0022-4804(03)00313-5" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/S0022-4804(03)00313-5" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ KJ Livak \n \t\t\t\t\t\t\t\t """ 1 => """ TD Schmittgen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1006/meth.2001.1262" "Revista" => array:7 [ "tituloSerie" => "Methods" "fecha" => "2001" "volumen" => "25" "numero" => "4" "paginaInicial" => "402" "paginaFinal" => "408" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1006/meth.2001.1262" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1006/meth.2001.1262" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dynamic expression of desmin, α-SMA and TGF-β1 during hepatic fibrogenesis induced by selective bile duct ligation in young rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ JO Gonçalves \n \t\t\t\t\t\t\t\t """ 1 => """ AC Tannuri \n \t\t\t\t\t\t\t\t """ 2 => """ MC Coelho \n \t\t\t\t\t\t\t\t """ 3 => """ I Bendit \n \t\t\t\t\t\t\t\t """ 4 => """ U Tannuri \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/1414-431x20143679" "Revista" => array:7 [ "tituloSerie" => "Braz J Med Biol Res" "fecha" => "2014" "volumen" => "47" "numero" => "10" "paginaInicial" => "850" "paginaFinal" => "857" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25140817" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expression of immediate-early genes c-fos and c-jun in small intestinal transplantation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ T Taguchi \n \t\t\t\t\t\t\t\t """ 1 => """ Y Fujii \n \t\t\t\t\t\t\t\t """ 2 => """ M Nakao \n \t\t\t\t\t\t\t\t """ 3 => """ K Ogita \n \t\t\t\t\t\t\t\t """ 4 => """ Y Shima \n \t\t\t\t\t\t\t\t """ 5 => """ S Suita \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Transplant Proc" "fecha" => "2000" "volumen" => "32" "numero" => "6" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/S0041-1345(00)01224-0" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "JNK activation and apoptosis during ischemia-reperfusion" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ I Onishi \n \t\t\t\t\t\t\t\t """ 1 => """ K Shimizu \n \t\t\t\t\t\t\t\t """ 2 => """ T Tani \n \t\t\t\t\t\t\t\t """ 3 => """ T Hashimoto \n \t\t\t\t\t\t\t\t """ 4 => """ K Miwa \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/s0041-1345(98)01912-5" "Revista" => array:8 [ "tituloSerie" => "Transplant Proc" "fecha" => "1999" "volumen" => "31" "numero" => "1-2" "paginaInicial" => "1077" "paginaFinal" => "1079" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10083482" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1059131119306016" "estado" => "S300" "issn" => "10591311" ] ] ] 1 => array:2 [ "doi" => "10.1016/s0041-1345(98)01912-5" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/S0041-1345(98)01912-5" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inhibition of c-jun N-terminal kinase pathway improves cell viability in response to oxidant injury" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ Y Li \n \t\t\t\t\t\t\t\t """ 1 => """ Y Arita \n \t\t\t\t\t\t\t\t """ 2 => """ HC Koo \n \t\t\t\t\t\t\t\t """ 3 => """ JM Davis \n \t\t\t\t\t\t\t\t """ 4 => """ JA Kazzaz \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1165/rcmb.2003-0087RC" "Revista" => array:7 [ "tituloSerie" => "Am J Respir Cell Mol Biol" "fecha" => "2003" "volumen" => "29" "numero" => "6" "paginaInicial" => "779" "paginaFinal" => "783" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12842852" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1165/rcmb.2003-0087RC" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1165/rcmb.2003-0087RC" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Programmed cell death induced by ischemia-reperfusion in rat intestinal mucosa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ T Noda \n \t\t\t\t\t\t\t\t """ 1 => """ R Iwakiri \n \t\t\t\t\t\t\t\t """ 2 => """ K Fujimoto \n \t\t\t\t\t\t\t\t """ 3 => """ S Matsuo \n \t\t\t\t\t\t\t\t """ 4 => """ TY Aw \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpgi.1998.274.2.G270" "Revista" => array:8 [ "tituloSerie" => "Am J Physiol" "fecha" => "1998" "volumen" => "274" "numero" => "2 Pt 1" "paginaInicial" => "G270" "paginaFinal" => "G276" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9486179" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0920121117302449" "estado" => "S300" "issn" => "09201211" ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013886/v1_202212011403/en/main.assets" "Apartado" => null "PDF" => "https://static.elsevier.es/multimedia/18075932/0000007000000005/v1_202212011403/S1807593222013886/v1_202212011403/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013886?idApp=UINPBA00004N"]

Statistics

BASIC RESEARCH

Maria Mercês Santos, Ana Cristina Aoun Tannuri, Maria Cecilia Mendonça Coelho, Josiane de Oliveira Gonçalves, Suellen Serafini, Luiz Fernando Ferraz da Silva, Uenis Tannuri

Corresponding author

uenist@usp.br

Corresponding author: Uenis Tannuri

Pediatric Liver Transplantation Unit and Laboratory of Research in Pediatric Surgery (LIM 30), Faculdade de Medicina da Universidade de São Paulo, Pediatric Surgery Division, São Paulo/SP, Brazil

Read

549

Times
was read the article

227

Total PDF

322

Total HTML

Share statistics

 array:24 [
  "pii" => "S1807593222013886"
  "issn" => "18075932"
  "doi" => "10.6061/clinics/2015(05)12"
  "estado" => "S300"
  "fechaPublicacion" => "2015-05-01"
  "aid" => "1388"
  "copyright" => "CLINICS"
  "copyrightAnyo" => "2015"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/"
  "subdocumento" => "fla"
  "cita" => "Clinics. 2015;70:373-9"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1807593222013898"
    "issn" => "18075932"
    "doi" => "10.6061/clinics/2015(05)13"
    "estado" => "S300"
    "fechaPublicacion" => "2015-05-01"
    "aid" => "1389"
    "copyright" => "CLINICS"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/"
    "subdocumento" => "fla"
    "cita" => "Clinics. 2015;70:380-6"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">BASIC RESEARCH</span>"
      "titulo" => "Lifespan extension and increased resistance to environmental stressors by N-Acetyl-L-Cysteine in <span class="elsevierStyleItalic">Caenorhabditis elegans</span>"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "380"
          "paginaFinal" => "386"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig3"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 388
              "Ancho" => 750
              "Tamanyo" => 22415
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara30" class="elsevierStyleSimplePara elsevierViewall">Response to environmental stressors with or without NAC treatment&#46; &#40;A&#41; Survival after 10 h of heat stress was compared between untreated control and 5 mM NAC-treated worms&#46; Data show the average of five independent experiments&#46; &#40;B&#41; Time-course survival of worms after UV irradiation was monitored every hour&#46; Values are means of three independent experiments&#46; Asterisk indicates a significant difference &#40;<span class="elsevierStyleItalic">p</span>&#60;0&#46;05 by Student&#39;s <span class="elsevierStyleItalic">t</span> test&#41;&#46; Error bars indicate SEM&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Seung-Il Oh, Jin-Kook Park, Sang-Kyu Park"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Seung-Il"
              "apellidos" => "Oh"
            ]
            1 => array:2 [
              "nombre" => "Jin-Kook"
              "apellidos" => "Park"
            ]
            2 => array:2 [
              "nombre" => "Sang-Kyu"
              "apellidos" => "Park"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013898?idApp=UINPBA00004N"
    "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013898/v1_202212011403/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1807593222013874"
    "issn" => "18075932"
    "doi" => "10.6061/clinics/2015(05)11"
    "estado" => "S300"
    "fechaPublicacion" => "2015-05-01"
    "aid" => "1387"
    "copyright" => "CLINICS"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/"
    "subdocumento" => "fla"
    "cita" => "Clinics. 2015;70:369-72"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">CLINICAL SCIENCE</span>"
      "titulo" => "Accuracy of the Timed Up and Go test for predicting sarcopenia in elderly hospitalized patients"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "369"
          "paginaFinal" => "372"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig1"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 784
              "Ancho" => 800
              "Tamanyo" => 27240
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">Accuracy of the test Time Up and Go to predict sarcopenia in the sample of 68 elderly hospitalized patients&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Bruno Prata Martinez, Isabela Barboza Gomes, Carolina Santana de Oliveira, Isis Resende Ramos, M&#244;nica Diniz Marques Rocha, Luiz Alberto Forgiarini J&#250;nior, Fernanda Warken Rosa Camelier, Aquiles Assun&#231;&#227;o Camelier"
          "autores" => array:8 [
            0 => array:2 [
              "nombre" => "Bruno Prata"
              "apellidos" => "Martinez"
            ]
            1 => array:2 [
              "nombre" => "Isabela Barboza"
              "apellidos" => "Gomes"
            ]
            2 => array:2 [
              "nombre" => "Carolina Santana"
              "apellidos" => "de Oliveira"
            ]
            3 => array:2 [
              "nombre" => "Isis Resende"
              "apellidos" => "Ramos"
            ]
            4 => array:2 [
              "nombre" => "M&#244;nica Diniz Marques"
              "apellidos" => "Rocha"
            ]
            5 => array:2 [
              "nombre" => "Luiz Alberto Forgiarini"
              "apellidos" => "J&#250;nior"
            ]
            6 => array:2 [
              "nombre" => "Fernanda Warken Rosa"
              "apellidos" => "Camelier"
            ]
            7 => array:2 [
              "nombre" => "Aquiles Assun&#231;&#227;o"
              "apellidos" => "Camelier"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013874?idApp=UINPBA00004N"
    "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013874/v1_202212011403/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">BASIC RESEARCH</span>"
    "titulo" => "Immediate expression of c-fos and c-jun mRNA in a model of intestinal autotransplantation and ischemia-reperfusion <span class="elsevierStyleItalic">in situ</span>"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "373"
        "paginaFinal" => "379"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Maria Merc&#234;s Santos, Ana Cristina Aoun Tannuri, Maria Cecilia Mendon&#231;a Coelho, Josiane de Oliveira Gon&#231;alves, Suellen Serafini, Luiz Fernando Ferraz da Silva, Uenis Tannuri"
        "autores" => array:7 [
          0 => array:2 [
            "nombre" => "Maria Merc&#234;s"
            "apellidos" => "Santos"
          ]
          1 => array:2 [
            "nombre" => "Ana Cristina Aoun"
            "apellidos" => "Tannuri"
          ]
          2 => array:2 [
            "nombre" => "Maria Cecilia Mendon&#231;a"
            "apellidos" => "Coelho"
          ]
          3 => array:2 [
            "nombre" => "Josiane"
            "apellidos" => "de Oliveira Gon&#231;alves"
          ]
          4 => array:2 [
            "nombre" => "Suellen"
            "apellidos" => "Serafini"
          ]
          5 => array:2 [
            "nombre" => "Luiz Fernando Ferraz"
            "apellidos" => "da Silva"
          ]
          6 => array:4 [
            "nombre" => "Uenis"
            "apellidos" => "Tannuri"
            "email" => array:1 [
              0 => "uenist@usp.br"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor1"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "Pediatric Liver Transplantation Unit and Laboratory of Research in Pediatric Surgery &#40;LIM 30&#41;&#44; Faculdade de Medicina da Universidade de S&#227;o Paulo&#44; Pediatric Surgery Division&#44; S&#227;o Paulo&#47;SP&#44; Brazil"
            "identificador" => "aff1"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor1"
            "etiqueta" => "&#42;"
            "correspondencia" => "Corresponding author&#58; Uenis Tannuri"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig2"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 514
            "Ancho" => 750
            "Tamanyo" => 43488
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara20" class="elsevierStyleSimplePara elsevierViewall">The sequential expression patterns of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> mRNA &#40;semiquantitative method&#41; and images of the respective bands&#46; The numbers in the vertical axis correspond to the relative expression levels normalized to the internal control gene &#40;<span class="elsevierStyleItalic">&#946;-actin</span>&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="cesec10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle60">INTRODUCTION</span><p id="para10" class="elsevierStylePara elsevierViewall">Intestinal ischemia-reperfusion &#40;I&#47;R&#41; injury occurs in several clinical conditions and after intestinal transplantation&#46; The hypoxia and tissue damage caused by I&#47;R injury can&#44; in turn&#44; result in severe complications&#44; and following intestinal transplantation&#44; this type of injury plays a determining role in early graft dysfunction and long-term graft survival <a class="elsevierStyleCrossRefs" href="#bib1">1-4</a>&#46; The number of cells present in adult tissue is determined based on the balance between destroyed and regenerated cells&#44; and apoptosis plays an important role in this process of homeostasis under both physiological and pathological conditions <a class="elsevierStyleCrossRef" href="#bib5">5</a>&#46; As a function of apoptosis&#44; some gastrointestinal mucosal cells are periodically lost&#44; leaving room for their physiological renewal&#44; which occurs in association with the proliferation of local totipotent cells&#46; Apoptosis and regeneration can also be triggered by I&#47;R injury at the molecular level <a class="elsevierStyleCrossRef" href="#bib6">6</a>&#46; In addition&#44; apoptosis has been described as a marker of intestinal graft rejection <a class="elsevierStyleCrossRef" href="#bib7">7</a>&#46; The process of intestinal regeneration after I&#47;R injury involves increased DNA synthesis as well as the rapid and brief expression of immediate early response genes &#40;IEGs&#41; <a class="elsevierStyleCrossRef" href="#bib4">4</a>&#44; including those which encode the transcription factors c-fos and c-jun&#46; IEGs&#44; which are expressed in a rapid and transient manner&#44; can be induced by several factors&#44; including I&#47;R injury&#46;</p><p id="para20" class="elsevierStylePara elsevierViewall">The cellular genes c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> dimerize to form the activator protein-1 &#40;AP-1&#41; transcription factor complex&#46; In addition&#44; each forms several other stable homo- or heterodimeric complexes that bind to DNA regulatory&#44; promoter&#44; and potentiation regions thus controlling the transcription of numerous target genes&#46; Both c-fos and c-jun contain leucine zippers that are responsible for their dimerization and for the regulation of cellular response genes following injury&#46; Those genes can be expressed within minutes after the exposure of cells to a given stimulus&#44; and the resulting products participate in several metabolic processes&#44; such as the regulation of cell proliferation&#44; differentiation&#44; and apoptosis <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; The aim of the present study was to investigate the phenomena of apoptosis and cell proliferation in a previously described intestinal I&#47;R injury autograft model involving cold preservation of the intestine&#46; This model allows for the study of the physiological changes that occur following intestinal transplantation without the interference of immune aggression induced by the graft <a class="elsevierStyleCrossRef" href="#bib2">2</a>&#46;</p><p id="para30" class="elsevierStylePara elsevierViewall">In cold ischemic preservation of the intestine&#44; hypothermia protects against I&#47;R injury <a class="elsevierStyleCrossRefs" href="#bib9">9&#44;10</a>&#46; We quantified apoptosis and the cell proliferation index via histological examination and immunohistochemical analysis&#46; We also investigated the molecular mechanisms involved in I&#47;R injury repair by measuring the expression of the early activation genes <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span>&#44; which induce apoptosis and cell proliferation&#46; A better understanding of the phenomena underlying I&#47;R injury may allow for the identification of interventions to reduce its occurrence and&#44; thus&#44; to achieve better preservation of the intestinal graft&#46;</p></span><span id="cesec20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle70">MATERIALS AND METHODS</span><p id="para40" class="elsevierStylePara elsevierViewall">Thirty adult male Wistar rats were subjected to surgery using the previously described I&#47;R model involving perfusion through the cecal artery <a class="elsevierStyleCrossRef" href="#bib2">2</a>&#46; Briefly&#44; under an operating microscope &#40;10X magnification&#41;&#44; the mesocolon was sectioned from the cecum to the level of the middle colic artery&#46; In the root of the mesentery&#44; the mesenteric artery and vein were completely dissected and isolated by sectioning all of the nervous and lymphatic tissues to an extension of approximately 1 cm&#46;</p><p id="para50" class="elsevierStylePara elsevierViewall">All of the mesentery between the superior mesenteric artery and the jejunum &#40;6-8 cm below the ligament of Treitz&#41; was also sectioned&#46; After these procedures&#44; the distal branch of the superior mesenteric artery corresponding to the cecum was dissected &#40;under a microscope at 40X magnification&#41; in an extension that was sufficient for cannulation with a 1&#46;9 French silicone catheter &#40;<a class="elsevierStyleCrossRef" href="#fig1">Figure 1A</a>&#41;&#46; Close to the cecal valve&#44; there was a consistently located lymph node that served as a reference point for the localization of the cecal artery&#46; The jejunum and the ascending colon were clamped&#44; and the superior mesenteric artery and vein were occluded using non-traumatic vascular clamps&#46; The superior mesenteric artery was irrigated with lactated Ringer&#39;&#180;s solution at 4&#176;C through a previously inserted cannula in the cecal artery&#44; and perfusion was performed using an infusion pump at a rate of 40 ml of solution per hour&#44; accompanied by the additional cooling of the peritoneal cavity with ice &#40;<a class="elsevierStyleCrossRef" href="#fig1">Figure 1B</a>&#41;&#46; The effluent flowed out through a small leak in the superior mesenteric vein&#46; The perfusion was considered adequate when the intestine and the mesentery were completely pale and the effluent was clear&#46; Then&#44; perfusion was interrupted &#40;the total volume necessary for perfusion was 2&#46;5 to 5&#46;0 ml&#41;&#44; the opening of the mesenteric vein was sutured with 10-0 prolene&#44; and the catheter was removed&#46; Next&#44; the clamps were immediately removed from the mesenteric artery and vein&#44; and reperfusion of the intestine &#40;graft&#41; was confirmed based on the return of pulsatile mesenteric blood flow&#46; The average duration of ischemia was 18&#46;37&#177;5&#46;06 min&#46; Following reperfusion&#44; the cecum was harvested at different time points as representative intestinal samples&#46; The rats were allocated to the following four subgroups according to the reperfusion time&#58; subgroup 1&#58; 5 min &#40;n&#61;9&#41;&#59; subgroup 2&#58; 15 min &#40;n&#61;7&#41;&#59; subgroup 3&#58; 30 min &#40;n&#61;8&#41;&#59; and subgroup 4&#58; 60 min &#40;n&#61;6&#41;&#46; Additionally&#44; a control group &#40;n&#61;7&#41; was subjected to the same procedures except for I&#47;R injury&#46;</p><elsevierMultimedia ident="fig1"></elsevierMultimedia><p id="para60" class="elsevierStylePara elsevierViewall">The harvested material was divided into two fragments One fragment was immersed in 10&#37; formaldehyde for histological processing and immunohistochemical analysis&#44; and the other fragment was immediately frozen in liquid nitrogen at -170&#176;C for RNA extraction&#46;</p><span id="cesec30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle80">Immunohistochemical methods</span><span id="cesec40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle90">TUNEL assay</span><p id="para70" class="elsevierStylePara elsevierViewall">The TUNEL assay is a method used to detect DNA fragmentation that results from the activation of apoptotic cascades&#46; In the present study&#44; intestinal histological sections were fixed in 10&#37; formalin&#44; embedded in paraffin&#44; sliced into 5-&#956;m-thick sections&#44; and then deparaffinized&#46; Following hydration&#44; the sections were subjected to TUNEL staining and enzymatic digestion with proteinase K&#44; followed by the blocking of endogenous peroxidase activity&#46; Finally&#44; the sections were immersed in sodium citrate and Triton X-100 solution to induce cell permeabilization&#44; incubated in TdT enzyme solution and a mixture of nucleotides&#44; washed with phosphate-buffered saline &#40;PBS&#41;&#44; and incubated in Converter-POD&#46; The sections were processed to detect apoptotic cells using the chromogenic substrate 3&#44;3&#39;-diaminobenzidine &#40;DAB&#41; &#40;Sigma&#175;&#41;&#44; followed by counterstaining with Harris hematoxylin&#44; dehydration&#44; and mounting&#46; This assay was performed using intestinal samples from the control group&#44; and the samples were harvested at 60 min after I&#47;R to quantify apoptosis&#46; This time point was selected because it exhibited the greatest expression of the c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> genes <a class="elsevierStyleCrossRef" href="#bib2">2</a>&#46;</p></span><span id="cesec50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle100">Ki-67 staining</span><p id="para80" class="elsevierStylePara elsevierViewall">To quantify intestinal cell proliferation&#44; immunohistochemical staining for Ki-67 was performed on intestinal samples from the control group and the group of samples harvested at 60 min after I&#47;R&#46;</p><p id="para90" class="elsevierStylePara elsevierViewall">The monoclonal anti-Ki-67 antibody used was a mouse IgG1 antibody against a nuclear fraction of the L428 Hodgkin&#39;s lymphoma cell line&#46; The anti-Ki-67 antibody recognizes and reacts with Ki-67&#44; which is a nuclear protein detected at all active stages of the cell cycle except for G0&#59; therefore&#44; it serves as a marker of cell proliferation&#46;</p><p id="para100" class="elsevierStylePara elsevierViewall">After fixation with 10&#37; formaldehyde&#44; the tissues were embedded in paraffin&#44; sliced into 5-&#956;m-thick sections&#44; deparaffinized&#44; and hydrated&#46; The sections were then processed for antigen recovery&#44; blocking of endogenous peroxidase activity&#44; and the immunohistochemical detection of Ki-67&#46; For this purpose&#44; the sections were incubated in the mouse monoclonal anti-rat Ki-67 antibody &#40;clone MIB-5&#59; DAKO&#41; diluted 1&#58;400&#46; Staining was performed using the chromogenic substrate DAB &#40;Sigma&#175;&#41;&#44; followed by counterstaining with Harris hematoxylin&#44; dehydration&#44; and mounting&#46;</p></span></span><span id="cesec60" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle110">Histomorphometric analysis</span><p id="para110" class="elsevierStylePara elsevierViewall">Histological analysis was performed using a Nikon&#175; eclipse 50i microscope &#40;Nikon Corporation Tokyo&#44; Japan&#41;&#46; Images were acquired using 10x ocular and 40x objective lenses&#46; The full surface of the intestinal mucosa of each section was photographed for all of the slides&#46; NIS-Elements BR&#175; software controlled by an IBM computer was used to acquire digital color microscopic images&#46; Histomorphometric analyses were performed using slides from the control group and the group of samples harvested at 60 min after reperfusion&#46; To quantify the cells labeled in the TUNEL assay and by Ki-67 immunostaining&#44; the digital images were analyzed using Image-Pro Plus 4&#46;5 software &#40;Media Cybernetics&#44; Silver Spring&#44; USA&#41;&#46; TUNEL-positive cells were quantified by counting individual apoptotic cells in a defined area of interest&#44; the size of which was automatically calculated by a previously calibrated computer system&#46; Thus&#44; the number of apoptotic cells per mm<span class="elsevierStyleSup">3</span> was obtained&#46; A total of 47 mucosal fragments from six animals in the control group and 80 mucosal fragments from six animals in the 60-min after reperfusion group were measured&#46;</p><p id="para120" class="elsevierStylePara elsevierViewall">A macro &#40;computer routine&#41; was developed for use with Image-Pro Plus software&#44; for which the interval of positive labeling was predefined by an experienced pathologist to perform the automatic counting of Ki-67-positive areas that were dark brown in color&#44; as well as to calculate the total villus&#47;delimited crypt areas&#46; These calculations allowed us to determine the proportions of Ki-67-positive areas in the villi and the crypts&#46; A total of 390 Ki-67-positive villus areas were measured in six animals from the control group&#44; and 652 were measured from six animals in the group of cecum samples harvested at 60 min after I&#47;R&#46;</p></span><span id="cesec70" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle120">Molecular methods</span><span id="cesec80" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle130">Extraction of total RNA and reverse transcription</span><p id="para130" class="elsevierStylePara elsevierViewall">The intestinal fragments that were freshly collected and immediately frozen in liquid nitrogen were stored at -170&#176;C until processing to study the expression of the c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> genes in association with cell proliferation and apoptosis&#46; First&#44; total RNA was extracted from intestinal samples using TRIZOL&#8482; reagent &#40;Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41;&#46; Approximately 100 mg of intestine was fragmented in a tissue mill &#40;Mikro Dismembrator U&#44; Sartorius AG&#44; Goettingen&#44; Germany&#41; after the addition of liquid nitrogen and was then homogenized in 700 &#956;l of TRIZOL solution according to the manufacturer&#39;s protocol&#46;</p><p id="para140" class="elsevierStylePara elsevierViewall">The total RNA concentration was measured using a spectrophotometer &#40;BioPhotometer&#44; Eppendorf AG&#44; Germany&#41; at 260 nm&#44; and RNA quality was assessed by calculating the 260 nm&#47;280 nm absorbance ratio&#46; One microgram of RNA was subjected to agarose gel electrophoresis to assess its integrity by visualizing the fragments corresponding to 18S and 28S ribosomal RNAs&#46;</p><p id="para150" class="elsevierStylePara elsevierViewall">Complementary DNA &#40;cDNA&#41; was prepared from 2 &#956;g of total RNA via reverse transcription using 200 U of SuperScript III RNase H-RT &#40;Invitrogen&#41; and oligo&#40;dT&#41;s as primers&#46; The resulting cDNA solution was stored at -20&#176;C&#46;</p><p id="para160" class="elsevierStylePara elsevierViewall">Gene expression was evaluated by two methods&#44; conventional semiquantitative RT-polymerase chain reaction &#40;PCR&#41; and real-time RT-PCR analyses&#44; and the results of these two methods were compared&#46;</p></span><span id="cesec90" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle140">PCR and semiquantitative analysis of PCR products</span><p id="para170" class="elsevierStylePara elsevierViewall">The specific primers for c-fos and c-jun used in the present study were previously described by Shima et al&#46; <a class="elsevierStyleCrossRef" href="#bib4">4</a>&#46; The <span class="elsevierStyleItalic">&#946;-actin</span> gene was amplified as an internal control of RNA transcription&#46; The primer sequences and the amplification conditions are described in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>&#46; Double-distilled water was used in place of cDNA as a negative control&#46; The total PCR volume of 25 &#956;l included the following reagents&#58; 3 &#956;l of cDNA&#44; 2 pmol of each forward and reverse primer&#44; 200 &#956;M of each deoxynucleotide &#40;dATP&#44; dCTP&#44; dGTP&#44; and dTTP&#41;&#44; 2&#46;5 &#956;l of enzyme buffer&#44; and 2 U of <span class="elsevierStyleItalic">Taq</span> DNA polymerase&#46; A separate reaction was prepared for each investigated gene and was amplified according to the optimal parameters for the given primers using the same thermocycler &#40;MJ Research&#44; CA&#44; USA&#41;&#46; After an initial denaturation step at 95&#176;C for 5 min&#44; cycles of denaturation at 95&#176;C for 60 sec&#44; annealing for 60 sec &#40;<a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>&#41;&#44; and extension at 72&#176;C were performed&#44; followed by a final extension step at 72&#176;C for 10 min&#46; Each PCR reaction was repeated three times to ensure data consistency&#46; The amplified product &#40;10 &#956;l volume&#41; was subjected to electrophoresis in a 2&#37; agarose gel&#46;</p><elsevierMultimedia ident="tbl1"></elsevierMultimedia></span><span id="cesec100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle150">Semiquantitative analysis of PCR products</span><p id="para180" class="elsevierStylePara elsevierViewall">The gel was viewed using a Kodak Gel Logic 100 Imaging System &#40;Kodak&#44; Rochester&#44; NY&#44; USA&#41;&#46; The magnitude of the expression of each gene was assessed by band densitometry using Kodak Molecular Imaging Software&#46; The amounts of the <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span> PCR products were normalized to those of <span class="elsevierStyleItalic">&#946;-actin</span>&#46; The expression levels of the c-<span class="elsevierStyleItalic">jun</span> and c-<span class="elsevierStyleItalic">fos</span> genes were presented as the means &#177; standard deviation of the average relative band densities&#46;</p></span><span id="cesec110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle160">Real-time PCR and quantitative analysis of PCR products</span><p id="para190" class="elsevierStylePara elsevierViewall">The primers used to amplify the <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">&#946;-actin</span> genes were the same as those used in semiquantitative RT-PCR&#44; but other primers were synthesized to amplify the <span class="elsevierStyleItalic">c-jun</span> gene because in real-time PCR&#44; the reactions for the target gene and the housekeeping gene are performed together&#44; and the same annealing temperature should be used for both reactions&#46; In addition&#44; a smaller amplicon is required&#46; The primer sequences for the <span class="elsevierStyleItalic">c-jun</span> gene were as follows&#58; 5&#39; caggtggcacagcttaaaca 3&#39; &#40;forward&#41;&#59; 5&#39; cgcaaccagtcaagttctca 3&#39; &#40;reverse&#41;&#46; The amplicon size was 162 base pairs&#46;</p><p id="para200" class="elsevierStylePara elsevierViewall">Quantitative real-time PCR was performed in a 15&#46;0 &#181;L reaction mixture consisting of 7&#46;5 &#181;L of Platinum SYBR Green qPCR SuperMix-UDG &#40;Invitrogen&#44; Carlsbad&#44; CA&#41;&#44; 0&#46;3 &#181;L each of gene-specific forward and reverse primers &#40;10 &#181;M&#41;&#44; 1&#46;0 &#181;L of cDNA&#44; and 5&#46;9 &#181;L of nuclease-free water using a Rotor-Gene Q 5plex HRM thermal cycler &#40;Qiagen&#44; Germany&#41;&#46;</p><p id="para210" class="elsevierStylePara elsevierViewall">The cycling conditions were as follows&#58; initial template denaturation at 95 &#176;C for 1 min&#44; followed by 40 cycles of denaturation at 95 &#176;C for 20 seconds&#44; annealing at 60 &#176;C for 30 seconds&#44; and extension at 72 &#176;C for 30 seconds&#46; Fluorescence detection was performed during each cycle at 72&#176;C to identify the positive samples&#46; Each sample was assessed in triplicate&#44; and controls lacking the template were included in parallel for each reaction&#46;</p><p id="para220" class="elsevierStylePara elsevierViewall">Amplification was followed by melting curve analysis to assess PCR product specificity&#46; The data were analyzed using the 2<span class="elsevierStyleSup">-&#916;&#916;CT</span> method of relative quantification <a class="elsevierStyleCrossRef" href="#bib11">11</a>&#46;</p></span></span><span id="cesec120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle170">Statistical analysis</span><p id="para230" class="elsevierStylePara elsevierViewall">To compare the gene expression data obtained via semiquantitative RT-PCR&#44; one-way analysis of variance &#40;ANOVA&#41; was performed&#44; and the Bonferroni test was applied for comparisons between the groups&#46; The gene expression data obtained via real-time PCR were analyzed using the Kruskal-Wallis test and the post hoc Tukey test because they had a non-parametric distribution&#46; The TUNEL and Ki-67 immunofluorescence data were analyzed using PASW Statistics Base v&#46;15&#46;0 for Windows &#40;SPSS Inc&#46;&#169;&#41;&#46; The Mann-Whitney U test was used to compare pairs of groups&#46; The data were expressed as the medians &#40;interquartile ranges&#41;&#46; Significance was established at <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#46;</p></span></span><span id="cesec130" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle180">RESULTS</span><span id="cesec140" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle190">Molecular studies</span><span id="cesec150" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle200">Semiquantitative and quantitative analysis of PCR products</span><p id="para240" class="elsevierStylePara elsevierViewall">The expression levels of the <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span> genes as determined by semiquantitative and quantitative analyses are shown in <a class="elsevierStyleCrossRefs" href="#fig2">Figures 2 and 3</a>&#46; The expression levels of these two genes coincided&#44; with increases beginning at 5 min after reperfusion&#46;</p><elsevierMultimedia ident="fig2"></elsevierMultimedia><elsevierMultimedia ident="fig3"></elsevierMultimedia></span></span><span id="cesec160" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle210">Immunohistochemical analysis</span><p id="para250" class="elsevierStylePara elsevierViewall">Observation of the TUNEL-stained sections under a microscope revealed the presence of dark brown apoptotic bodies&#44; predominantly in the mucosa&#46; Counting of the apoptotic bodies revealed that the number of apoptotic cells in the group of cecum samples harvested at 60 min after I&#47;R was greater than that in the control group &#40;p&#61;0&#46;009&#41;&#46; In addition&#44; the proportion of Ki-67-positive area was significantly higher in this experimental group than in the control group &#40;p&#60;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRefs" href="#fig4">Figures 4 and 5</a>&#41;&#46;</p><elsevierMultimedia ident="fig4"></elsevierMultimedia><elsevierMultimedia ident="fig5"></elsevierMultimedia></span></span><span id="cesec170" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle220">DISCUSSION</span><p id="para260" class="elsevierStylePara elsevierViewall">In the present study&#44; we investigated the expression of the IEGs <span class="elsevierStyleItalic">c-fos</span> and c-<span class="elsevierStyleItalic">jun</span> in a rat I&#47;R model in which the intestine was perfused with lactated Ringer&#39;s solution at 4&#176;C&#46; The intestine was kept cool <span class="elsevierStyleItalic">in situ</span> during ischemia&#46; In addition&#44; markers of cell proliferation and apoptosis were investigated in intestinal samples harvested at the time point of maximal IEG expression&#46; Two analysis methods&#44; semiquantitative and quantitative PCR&#44; were utilized in the current investigation to provide a better estimation of the results&#46; The expression levels of both genes coincided&#44; in agreement with previous results of investigations performed in our laboratory <a class="elsevierStyleCrossRef" href="#bib12">12</a>&#46;</p><p id="para270" class="elsevierStylePara elsevierViewall">A previous study of IEGs in a pig liver I&#47;R model during the acute stage&#44; i&#46;e&#46;&#44; 1-3 h after reperfusion&#44; suggested that c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> participate in both tissue regeneration and apoptosis <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; The same study showed that the duration of cold ischemia for liver preservation and the levels of oxygen free radicals are associated with the expression of IEGs <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; Taguchi et al&#46; investigated the expression of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> in a rat model of intestinal transplantation&#46; These authors reported a lack of gene activity during the first 30 min after transplantation&#46; They found that at 4 h after transplantation&#44; c-<span class="elsevierStyleItalic">fos</span> only began to be expressed and c-<span class="elsevierStyleItalic">jun</span> exhibited little activity&#46; However&#44; at 72 h after transplantation&#44; the expression of both genes was not detectable&#46; These authors concluded that c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> are associated with the adaptive process of intestinal transplantation <a class="elsevierStyleCrossRef" href="#bib13">13</a>&#46; The results of our study are similar&#44; showing that these two IEGs are expressed early&#46; However&#44; our measurements were performed earlier and at shorter intervals within the first hour after reperfusion&#46; The c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> expression levels in our samples began to increase at 5 min&#44; and this alteration was maintained at 60 min&#44; in contrast to the observations of the aforementioned previous study&#46;</p><p id="para280" class="elsevierStylePara elsevierViewall">Shima et al&#46; studied the expression of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> in rat intestines after I&#47;R <a class="elsevierStyleCrossRef" href="#bib4">4</a> and found that apoptosis and cell proliferation depend on their expression&#44; similar to the conclusions of other studies <a class="elsevierStyleCrossRefs" href="#bib8">8&#44;14</a>&#46; The authors further suggested that the joint expression of these IEGs results in the induction of cell proliferation and apoptosis after I&#47;R&#46; Shima et al&#46; proposed a more specific correlation between the roles of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> after I&#47;R in which c-<span class="elsevierStyleItalic">fos</span> induces cell proliferation and <span class="elsevierStyleItalic">c-jun</span> is a key factor involved in apoptosis <a class="elsevierStyleCrossRef" href="#bib4">4</a>&#46; In the present study&#44; the early expression of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> indicated that these inducers of apoptosis and cell proliferation had been activated by I&#47;R&#46; We sought to understand and to establish the correlation between these genetic phenomena and the immunohistochemical markers of apoptosis &#40;by TUNEL staining&#41; and cell proliferation &#40;by Ki-67 staining&#41;&#46;</p><p id="para290" class="elsevierStylePara elsevierViewall">Immunohistochemical analysis via the TUNEL assay revealed a statistically significant increase in the number of apoptotic cells at 60 min after I&#47;R in the I&#47;R-injured cecum compared with the control cecum&#44; indicating that the induction of apoptosis&#44; but not necrosis&#44; occurred early <a class="elsevierStyleCrossRef" href="#bib15">15</a>&#46; This finding is in agreement with reports in the literature showing that apoptotic cells appear several minutes after stimulation and that the full sequence of apoptosis is completed within 1-4 h <a class="elsevierStyleCrossRef" href="#bib16">16</a>&#46; We also found a statistically significant difference in the number of proliferating cells at 60 min after reperfusion&#44; as demonstrated by the increased expression of Ki-67&#46; Thus&#44; the IEGs c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> together may be responsible for cell proliferation and apoptosis&#46; The major questions that remain to be answered concern the exact time at which these phenomena occur and whether it is possible to control apoptosis to improve the preservation of intestinal grafts&#46; Our results showed that cold graft preservation was not sufficiently protective because the IEGs were induced quite early after reperfusion&#46; Oxygen free radicals are likely an important trigger of the expression of IEGs&#44; and these species may also play definitive roles in cold ischemic graft preservation&#59; however&#44; these possibilities require further study&#46; In conclusion&#44; the early activation of the <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span> genes occurred after intestinal I&#47;R injury&#44; and these genes together can trigger cell proliferation and apoptosis&#46;</p></span><span id="cesec180" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle230">AUTHOR CONTRIBUTIONS</span><p id="para300" class="elsevierStylePara elsevierViewall">Santos MM and Tannuri AC performed the experiments&#46; Coelho MC&#44; Gon&#231;alves JO&#44; Serafini S and Silva LF performed the laboratory analysis&#46; Tannuri U revised the manuscript&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:7 [
        0 => array:2 [
          "identificador" => "xpalclavsec1582304"
          "titulo" => "KEYWORDS"
        ]
        1 => array:2 [
          "identificador" => "cesec10"
          "titulo" => "INTRODUCTION"
        ]
        2 => array:3 [
          "identificador" => "cesec20"
          "titulo" => "MATERIALS AND METHODS"
          "secciones" => array:4 [
            0 => array:3 [
              "identificador" => "cesec30"
              "titulo" => "Immunohistochemical methods"
              "secciones" => array:2 [
                0 => array:2 [
                  "identificador" => "cesec40"
                  "titulo" => "TUNEL assay"
                ]
                1 => array:2 [
                  "identificador" => "cesec50"
                  "titulo" => "Ki-67 staining"
                ]
              ]
            ]
            1 => array:2 [
              "identificador" => "cesec60"
              "titulo" => "Histomorphometric analysis"
            ]
            2 => array:3 [
              "identificador" => "cesec70"
              "titulo" => "Molecular methods"
              "secciones" => array:4 [
                0 => array:2 [
                  "identificador" => "cesec80"
                  "titulo" => "Extraction of total RNA and reverse transcription"
                ]
                1 => array:2 [
                  "identificador" => "cesec90"
                  "titulo" => "PCR and semiquantitative analysis of PCR products"
                ]
                2 => array:2 [
                  "identificador" => "cesec100"
                  "titulo" => "Semiquantitative analysis of PCR products"
                ]
                3 => array:2 [
                  "identificador" => "cesec110"
                  "titulo" => "Real-time PCR and quantitative analysis of PCR products"
                ]
              ]
            ]
            3 => array:2 [
              "identificador" => "cesec120"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        3 => array:3 [
          "identificador" => "cesec130"
          "titulo" => "RESULTS"
          "secciones" => array:2 [
            0 => array:3 [
              "identificador" => "cesec140"
              "titulo" => "Molecular studies"
              "secciones" => array:1 [
                0 => array:2 [
                  "identificador" => "cesec150"
                  "titulo" => "Semiquantitative and quantitative analysis of PCR products"
                ]
              ]
            ]
            1 => array:2 [
              "identificador" => "cesec160"
              "titulo" => "Immunohistochemical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "cesec170"
          "titulo" => "DISCUSSION"
        ]
        5 => array:2 [
          "identificador" => "cesec180"
          "titulo" => "AUTHOR CONTRIBUTIONS"
        ]
        6 => array:1 [
          "titulo" => "REFERENCES"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2014-12-03"
    "fechaAceptado" => "2015-02-06"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "KEYWORDS"
          "identificador" => "xpalclavsec1582304"
          "palabras" => array:6 [
            0 => "Ischemia-reperfusion injury"
            1 => "Immediate early genes"
            2 => "Activator protein 1"
            3 => "Small intestine"
            4 => "C-fos"
            5 => "C-jun gene"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:2 [
        "resumen" => "<span id="ceabs10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle10">OBJECTIVE&#58;</span><p id="spara70" class="elsevierStyleSimplePara elsevierViewall">Intestinal ischemia-reperfusion injury occurs in several clinical conditions and after intestinal transplantation&#46; The aim of the present study was to investigate the phenomena of apoptosis and cell proliferation in a previously described intestinal ischemia-reperfusion injury autograft model using immunohistochemical markers&#46; The molecular mechanisms involved in ischemia-reperfusion injury repair were also investigated by measuring the expression of the early activation genes <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span>&#44; which induce apoptosis and cell proliferation&#46;</p></span> <span id="ceabs20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle20">MATERIALS AND METHODS&#58;</span><p id="spara80" class="elsevierStyleSimplePara elsevierViewall">Thirty adult male Wistar rats were subjected to surgery for a previously described ischemia-reperfusion model that preserved the small intestine&#44; the cecum and the ascending colon&#46; Following reperfusion&#44; the cecum was harvested at different time points as a representative segment of the intestine&#46; The rats were allocated to the following four subgroups according to the reperfusion time&#58; subgroup 1&#58; 5 min&#59; subgroup 2&#58; 15 min&#59; subgroup 3&#58; 30 min&#59; and subgroup 4&#58; 60 min&#46; A control group of cecum samples was also collected&#46; The expression of <span class="elsevierStyleItalic">c-fos</span>&#44; <span class="elsevierStyleItalic">c-jun</span> and immunohistochemical markers of cell proliferation and apoptosis &#40;Ki67 and TUNEL&#44; respectively&#41; was studied&#46;</p></span> <span id="ceabs30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle30">RESULTS&#58;</span><p id="spara90" class="elsevierStyleSimplePara elsevierViewall">The expression of both <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span> in the cecum was increased beginning at 5 min after ischemia-reperfusion compared with the control&#46; The expression of <span class="elsevierStyleItalic">c-fos</span> began to increase at 5 min&#44; peaked at 30 min&#44; and exhibited a declining tendency at 60 min after reperfusion&#46; A progressive increase in <span class="elsevierStyleItalic">c-jun</span> expression was observed&#46; Immunohistochemical analyses confirmed these observations&#46;</p></span> <span id="ceabs40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle40">CONCLUSION&#58;</span><p id="spara100" class="elsevierStyleSimplePara elsevierViewall">The early activation of the <span class="elsevierStyleItalic">c-fos</span> and <span class="elsevierStyleItalic">c-jun</span> genes occurred after intestinal ischemia-reperfusion injury&#44; and these genes can act together to trigger cell proliferation and apoptosis&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "ceabs10"
            "titulo" => "OBJECTIVE&#58;"
          ]
          1 => array:2 [
            "identificador" => "ceabs20"
            "titulo" => "MATERIALS AND METHODS&#58;"
          ]
          2 => array:2 [
            "identificador" => "ceabs30"
            "titulo" => "RESULTS&#58;"
          ]
          3 => array:2 [
            "identificador" => "ceabs40"
            "titulo" => "CONCLUSION&#58;"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:1 [
        "nota" => "<p class="elsevierStyleNotepara" id="cenpara10">No potential conflict of interest was reported&#46;</p>"
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig1"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1020
            "Ancho" => 666
            "Tamanyo" => 187869
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">A&#41;</span> Cannulation of the distal branch of the superior mesenteric artery using a silicone catheter&#46; <span class="elsevierStyleBold">B&#41;</span> Aspect of the intestine after irrigation with lactated Ringer&#39;s solution at 4&#176;C&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig2"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 514
            "Ancho" => 750
            "Tamanyo" => 43488
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara20" class="elsevierStyleSimplePara elsevierViewall">The sequential expression patterns of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> mRNA &#40;semiquantitative method&#41; and images of the respective bands&#46; The numbers in the vertical axis correspond to the relative expression levels normalized to the internal control gene &#40;<span class="elsevierStyleItalic">&#946;-actin</span>&#41;&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig3"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 515
            "Ancho" => 750
            "Tamanyo" => 32171
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara30" class="elsevierStyleSimplePara elsevierViewall">The sequential expression patterns of c-<span class="elsevierStyleItalic">fos</span> and c-<span class="elsevierStyleItalic">jun</span> mRNA &#40;quantitative method&#41;&#46; Note that these results are similar to those obtained using the semiquantitative method&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig4"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 462
            "Ancho" => 744
            "Tamanyo" => 23477
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara40" class="elsevierStyleSimplePara elsevierViewall">The numbers of apoptotic cells &#40;left - TUNEL assay&#41; and proliferating cells &#40;right - Ki-67 staining&#41; in the control and I&#47;R-injured groups &#40;60 min after reperfusion&#41;&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig5"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 259
            "Ancho" => 691
            "Tamanyo" => 64602
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara50" class="elsevierStyleSimplePara elsevierViewall">Immunohistochemical analyses of TUNEL &#40;A&#41; and Ki-67 &#40;B&#41; staining at 60 min after reperfusion&#46; Note the increased numbers of positively stained cells at this time point compared to the control&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "tbl1"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="tfn1" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">T<span class="elsevierStyleInf">a</span>&#61;</span>annealing temperature</p><p id="tfn2" class="elsevierStyleSimplePara elsevierViewall">bp&#61;base pair</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleBold">Gene</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleBold">Primer sequence</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleBold">Amplicon size &#40;bp&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleBold">T<span class="elsevierStyleInf">a</span></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col"><span class="elsevierStyleBold">Number of cycles</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#946;-actin</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - gcc aga gcg gga gtg gtg aa - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">309&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">53&#176;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - ggc ttg ggc tca ggg tca tt - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">c-fos</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - gcc tcg ttc ctc cag tcc ga - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">434&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">53&#176;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - tgc gat gga aag gcc agc cc - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">c-jun</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - acc ttc aac acc cca gcc atg - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">554&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&#176;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#8216; - ggc cat ctc ttg ctc gaa gtc - 3&#8216;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara60" class="elsevierStyleSimplePara elsevierViewall">Primer sequences and amplification conditions&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "REFERENCES"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec10"
          "bibliografiaReferencia" => array:16 [
            0 => array:3 [
              "identificador" => "bib1"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gut ischaemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => """
                              U Haglund \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/gut.35.1_suppl.s73"
                      "Revista" => array:7 [
                        "tituloSerie" => "Gut"
                        "fecha" => "1994"
                        "volumen" => "35"
                        "numero" => "1 Suppl"
                        "paginaInicial" => "S73"
                        "paginaFinal" => "S76"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8125397"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib2"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Description of a new model of intestinal denervation and in&#63;situ ischemia-reperfusion injury using the cecal artery for perfusion"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => """
                              MM Santos \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              U Tannuri \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              AC Tannuri \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              MC Coelho \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.transproceed.2009.05.037"
                      "Revista" => array:7 [
                        "tituloSerie" => "Transplant Proc"
                        "fecha" => "2009"
                        "volumen" => "41"
                        "numero" => "9"
                        "paginaInicial" => "3617"
                        "paginaFinal" => "3621"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19917354"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.transproceed.2009.05.037"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;transproceed&#46;2009&#46;05&#46;037"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib3"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apoptosis is a major mode of cell death caused by ischaemia and ischaemia&#47;reperfusion injury to the rat intestinal epithelium"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              H Ikeda \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              Y Suzuki \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              M Suzuki \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              M Koike \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              J Tamura \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              J Tong \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1136/gut.42.4.530"
                      "Revista" => array:7 [
                        "tituloSerie" => "Gut"
                        "fecha" => "1998"
                        "volumen" => "42"
                        "numero" => "4"
                        "paginaInicial" => "530"
                        "paginaFinal" => "537"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9616316"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1136/gut.42.4.530"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1136&#47;gut&#46;42&#46;4&#46;530"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib4"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased expression of c-fos and c-jun in the rat small intestinal epithelium after ischemia-reperfusion injury&#58; a possible correlation with the proliferation or apoptosis of intestinal epithelial cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => """
                              Y Shima \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              T Tajiri \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              T Taguchi \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              S Suita \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jpedsurg.2005.12.025"
                      "Revista" => array:8 [
                        "tituloSerie" => "J Pediatr Surg"
                        "fecha" => "2006"
                        "volumen" => "41"
                        "numero" => "4"
                        "paginaInicial" => "830"
                        "paginaFinal" => "836"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16567203"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0967586815005895"
                          "estado" => "S300"
                          "issn" => "09675868"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.jpedsurg.2005.12.025"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;jpedsurg&#46;2005&#46;12&#46;025"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib5"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The apoptosis cascade&#8211;morphological and immunohistochemical methods for its visualization"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              B Huppertz \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              HG Frank \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              P Kaufmann \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s004290050254"
                      "Revista" => array:8 [
                        "tituloSerie" => "Anat Embryol &#40;Berl&#41;"
                        "fecha" => "1999"
                        "volumen" => "200"
                        "numero" => "1"
                        "paginaInicial" => "1"
                        "paginaFinal" => "18"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10395001"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1525505019303166"
                          "estado" => "S300"
                          "issn" => "15255050"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib6"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of apoptosis in intestinal ischaemia-reperfusion injury&#8211;a light and electron microscopic study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              KA Shah \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              S Shurey \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              CJ Green \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1046/j.1365-2613.1997.420369.x"
                      "Revista" => array:7 [
                        "tituloSerie" => "Int J Exp Pathol"
                        "fecha" => "1997"
                        "volumen" => "78"
                        "numero" => "5"
                        "paginaInicial" => "355"
                        "paginaFinal" => "363"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9462233"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1046/j.1365-2613.1997.420369.x"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1046&#47;j&#46;1365-2613&#46;1997&#46;420369&#46;x"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib7"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anatomic and histologic variability of epithelial apoptosis in small bowel transplants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              BA Pasternak \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              MH Collins \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              GM Tiao \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              JA Rudolph \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              MH Alonso \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              FC Ryckman \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1399-3046.2008.01125.x"
                      "Revista" => array:7 [
                        "tituloSerie" => "Pediatr Transplant"
                        "fecha" => "2010"
                        "volumen" => "14"
                        "numero" => "1"
                        "paginaInicial" => "72"
                        "paginaFinal" => "76"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19207229"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1111/j.1399-3046.2008.01125.x"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1111&#47;ptr&#46;2009&#46;14&#46;issue-1"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib8"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "c-fos and c-jun mRNA expression in a pig liver model of ischemia&#47;reperfusion&#58; effect of extended cold storage and the antioxidant idebenone"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => """
                              E Wieland \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              M Oellerich \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              F Braun \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              E Schtuz \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/s0009-9120(00)00070-9"
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Biochem"
                        "fecha" => "2000"
                        "volumen" => "33"
                        "numero" => "4"
                        "paginaInicial" => "285"
                        "paginaFinal" => "290"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10936587"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/s0009-9120(00)00070-9"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;S0009-9120&#40;00&#41;00070-9"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib9"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Regional hypothermia reduces mucosal NFkappaB and PMN priming via gut lymph during canine mesenteric ischemia&#47;reperfusion"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              HT Hassoun \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              UM Fischer \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              BO Attuwaybi \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              FA Moore \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              HJ Safi \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              SJ Allen \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/s0022-4804(03)00298-1"
                      "Revista" => array:8 [
                        "tituloSerie" => "J Surg Res"
                        "fecha" => "2003"
                        "volumen" => "115"
                        "numero" => "1"
                        "paginaInicial" => "121"
                        "paginaFinal" => "126"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14572782"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0920121116303035"
                          "estado" => "S300"
                          "issn" => "09201211"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/s0022-4804(03)00298-1"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;S0022-4804&#40;03&#41;00298-1"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib10"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hypothermia protects against gut ischemia&#47;reperfusion-induced impaired intestinal transit by inducing heme oxygenase-1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              BO Attuwaybi \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              HT Hassoun \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              L Zou \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              RA Kozar \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              BC Kone \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              NW Weisbrodt \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/s0022-4804(03)00313-5"
                      "Revista" => array:8 [
                        "tituloSerie" => "J Surg Res"
                        "fecha" => "2003"
                        "volumen" => "115"
                        "numero" => "1"
                        "paginaInicial" => "48"
                        "paginaFinal" => "55"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14572772"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0140673606690430"
                          "estado" => "S300"
                          "issn" => "01406736"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/s0022-4804(03)00313-5"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;S0022-4804&#40;03&#41;00313-5"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib11"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2&#40;-Delta Delta C&#40;T&#41;&#41; Method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => """
                              KJ Livak \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              TD Schmittgen \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1006/meth.2001.1262"
                      "Revista" => array:7 [
                        "tituloSerie" => "Methods"
                        "fecha" => "2001"
                        "volumen" => "25"
                        "numero" => "4"
                        "paginaInicial" => "402"
                        "paginaFinal" => "408"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1006/meth.2001.1262"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1006&#47;meth&#46;2001&#46;1262"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib12"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dynamic expression of desmin&#44; &#945;-SMA and TGF-&#946;1 during hepatic fibrogenesis induced by selective bile duct ligation in young rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => """
                              JO Gon&#231;alves \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              AC Tannuri \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              MC Coelho \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              I Bendit \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              U Tannuri \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/1414-431x20143679"
                      "Revista" => array:7 [
                        "tituloSerie" => "Braz J Med Biol Res"
                        "fecha" => "2014"
                        "volumen" => "47"
                        "numero" => "10"
                        "paginaInicial" => "850"
                        "paginaFinal" => "857"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25140817"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib13"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression of immediate-early genes c-fos and c-jun in small intestinal transplantation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => """
                              T Taguchi \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              Y Fujii \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              M Nakao \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              K Ogita \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              Y Shima \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              S Suita \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Transplant Proc"
                        "fecha" => "2000"
                        "volumen" => "32"
                        "numero" => "6"
                      ]
                    ]
                    1 => array:1 [
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;S0041-1345&#40;00&#41;01224-0"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib14"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "JNK activation and apoptosis during ischemia-reperfusion"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => """
                              I Onishi \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              K Shimizu \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              T Tani \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              T Hashimoto \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              K Miwa \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/s0041-1345(98)01912-5"
                      "Revista" => array:8 [
                        "tituloSerie" => "Transplant Proc"
                        "fecha" => "1999"
                        "volumen" => "31"
                        "numero" => "1-2"
                        "paginaInicial" => "1077"
                        "paginaFinal" => "1079"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10083482"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1059131119306016"
                          "estado" => "S300"
                          "issn" => "10591311"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/s0041-1345(98)01912-5"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;S0041-1345&#40;98&#41;01912-5"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib15"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inhibition of c-jun N-terminal kinase pathway improves cell viability in response to oxidant injury"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => """
                              Y Li \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              Y Arita \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              HC Koo \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              JM Davis \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              JA Kazzaz \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1165/rcmb.2003-0087RC"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Respir Cell Mol Biol"
                        "fecha" => "2003"
                        "volumen" => "29"
                        "numero" => "6"
                        "paginaInicial" => "779"
                        "paginaFinal" => "783"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12842852"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1165/rcmb.2003-0087RC"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1165&#47;rcmb&#46;2003-0087RC"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib16"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Programmed cell death induced by ischemia-reperfusion in rat intestinal mucosa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => """
                              T Noda \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              R Iwakiri \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              K Fujimoto \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              S Matsuo \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              TY Aw \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpgi.1998.274.2.G270"
                      "Revista" => array:8 [
                        "tituloSerie" => "Am J Physiol"
                        "fecha" => "1998"
                        "volumen" => "274"
                        "numero" => "2 Pt 1"
                        "paginaInicial" => "G270"
                        "paginaFinal" => "G276"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9486179"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0920121117302449"
                          "estado" => "S300"
                          "issn" => "09201211"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/18075932/0000007000000005/v1_202212011403/S1807593222013886/v1_202212011403/en/main.assets"
  "Apartado" => null
  "PDF" => "https://static.elsevier.es/multimedia/18075932/0000007000000005/v1_202212011403/S1807593222013886/v1_202212011403/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013886?idApp=UINPBA00004N"
]

Article information

ISSN: 18075932
Original language: English

DOI:10.6061/clinics/2015(05)12

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	2	0	2
2024 October	42	25	67
2024 September	25	22	47
2024 August	30	13	43
2024 July	21	19	40
2024 June	25	10	35
2024 May	22	13	35
2024 April	18	10	28
2024 March	12	12	24
2024 February	15	7	22
2024 January	17	9	26
2023 December	5	13	18
2023 November	10	17	27
2023 October	13	22	35
2023 September	4	7	11
2023 August	4	7	11
2023 July	5	8	13
2023 June	3	0	3
2023 May	2	3	5
2023 April	2	0	2
2023 March	2	2	4
2023 February	1	1	2
2023 January	9	2	11
2022 December	33	5	38

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter