Role of DNA repair genes XRCC3 and XRCC1 in predisposition to type 2 diabetes mellitus and diabetic nephropathy

array:23 ["pii" => "S2530016418302325" "issn" => "25300164" "doi" => "10.1016/j.endinu.2018.08.010" "estado" => "S300" "fechaPublicacion" => "2019-02-01" "aid" => "851" "copyright" => "SEEN y SED" "copyrightAnyo" => "2018" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2019;66:90-8" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 222 "formatos" => array:2 [ "HTML" => 161 "PDF" => 61 ] ] "itemSiguiente" => array:18 [ "pii" => "S2530016418301927" "issn" => "25300164" "doi" => "10.1016/j.endinu.2018.07.008" "estado" => "S300" "fechaPublicacion" => "2019-02-01" "aid" => "841" "copyright" => "SEEN y SED" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2019;66:99-107" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 161 "formatos" => array:2 [ "HTML" => 114 "PDF" => 47 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Haptoglobin levels are influenced by Hp1–Hp2 polymorphism, obesity, inflammation, and hypertension in type 2 diabetes mellitus" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "99" "paginaFinal" => "107" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Los niveles de haptoglobina están influenciados por el polimorfismo Hp1-Hp2, la obesidad, la inflamación y la hipertensión en la diabetes mellitus tipo 2" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1822 "Ancho" => 2344 "Tamanyo" => 199031 ] ] "descripcion" => array:1 [ "en" => "Correlation coefficients between haptoglobin levels, clinical, and laboratory data in T2DM patients. BMI (body mass index), IL (interleukin), hs-CRP (high sensitivity C reactive protein). Spearman's correlation test; *p<0.05 was considered statistically significant." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Kathryna Fontana Rodrigues, Nathalia Teixeira Pietrani, Laura Machado Lara Carvalho, Adriana Aparecida Bosco, Valéria Cristina Sandrim, Cláudia Natália Ferreira, Karina Braga Gomes" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Kathryna Fontana" "apellidos" => "Rodrigues" ] 1 => array:2 [ "nombre" => "Nathalia Teixeira" "apellidos" => "Pietrani" ] 2 => array:2 [ "nombre" => "Laura Machado Lara" "apellidos" => "Carvalho" ] 3 => array:2 [ "nombre" => "Adriana Aparecida" "apellidos" => "Bosco" ] 4 => array:2 [ "nombre" => "Valéria Cristina" "apellidos" => "Sandrim" ] 5 => array:2 [ "nombre" => "Cláudia Natália" "apellidos" => "Ferreira" ] 6 => array:2 [ "nombre" => "Karina Braga" "apellidos" => "Gomes" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418301927?idApp=UINPBA00004N" "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418301927/v1_201901250635/en/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S2530016418302350" "issn" => "25300164" "doi" => "10.1016/j.endinu.2018.08.013" "estado" => "S300" "fechaPublicacion" => "2019-02-01" "aid" => "854" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Endocrinol Diabetes Nutr. 2019;66:83-9" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 596 "formatos" => array:2 [ "HTML" => 373 "PDF" => 223 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Factores predictores de diabetes mellitus posparto en pacientes con diabetes gestacional" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "83" "paginaFinal" => "89" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Predictors of postpartum diabetes mellitus in patients with gestational diabetes" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 816 "Ancho" => 1083 "Tamanyo" => 58949 ] ] "descripcion" => array:1 [ "es" => "Valores de glucemia en los distintos puntos de la SOG con 100g, atendiendo a la reevaluación posparto (normal, GBA, IHC o DM)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Soralla Civantos, María Durán, Beatriz Flández, María Merino, Cristina Navea, Guadalupe Guijarro, Nieves Martell, Susana Monereo" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Soralla" "apellidos" => "Civantos" ] 1 => array:2 [ "nombre" => "María" "apellidos" => "Durán" ] 2 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Flández" ] 3 => array:2 [ "nombre" => "María" "apellidos" => "Merino" ] 4 => array:2 [ "nombre" => "Cristina" "apellidos" => "Navea" ] 5 => array:2 [ "nombre" => "Guadalupe" "apellidos" => "Guijarro" ] 6 => array:2 [ "nombre" => "Nieves" "apellidos" => "Martell" ] 7 => array:2 [ "nombre" => "Susana" "apellidos" => "Monereo" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2530018019300204" "doi" => "10.1016/j.endien.2019.02.002" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018019300204?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418302350?idApp=UINPBA00004N" "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418302350/v1_201901250635/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Role of DNA repair genes XRCC3 and XRCC1 in predisposition to type 2 diabetes mellitus and diabetic nephropathy" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "90" "paginaFinal" => "98" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Tugce Yesil-Devecioglu, Akın Dayan, Refik Demirtunc, Semra Sardas" "autores" => array:4 [ 0 => array:4 [ "nombre" => "Tugce" "apellidos" => "Yesil-Devecioglu" "email" => array:1 [ 0 => "tugce.yesil@marmara.edu.tr" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Akın" "apellidos" => "Dayan" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Refik" "apellidos" => "Demirtunc" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Semra" "apellidos" => "Sardas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Marmara University, Faculty of Pharmacy, Department of Pharmaceutical Toxicology, Istanbul, Turkey" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Health Sciences University, Haydarpasa Numune Training and Research Hospital, Diabetology Outpatient Department, Istanbul, Turkey" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Health Sciences University, Haydarpasa Numune Training and Research Hospital, Internal Diseases Service, Istanbul, Turkey" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Istinye University, Faculty of Pharmacy, Department of Pharmaceutical Toxicology, Istanbul, Turkey" "etiqueta" => "d" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Papel de los genes de reparación del ADN XRCC3 y XRCC1 en la predisposición a la diabetes mellitus de tipo 2 y a la nefropatía diabética" ] ] "textoCompleto" => "IntroductionDiabetes mellitus (DM) is a metabolic disease which occurs by deficiency in insulin secretion and/or insulin action that leads to inefficiency in metabolism of carbohydrate, lipid and protein.<a class="elsevierStyleCrossRef" href="#bib0210">1</a> Diabetes mellitus is recognized as a prevalent worldwide disorder with growing incidence. According to the World Health Organization (WHO) data, the number of deaths caused by diabetes was 1.5 million in 2012 and currently 422 million people have diabetes mellitus in the world and the number of patients with diabetes is expected to more than double in the next 20 years.<a class="elsevierStyleCrossRef" href="#bib0215">2</a> According to data from the International Diabetes Federation, 12.8% of the adult population of Turkey suffer from diabetes and there were over 6.7 million cases in 2017.<a class="elsevierStyleCrossRef" href="#bib0220">3</a>Type 2 diabetes mellitus (T2DM) usually causes both microvascular and macrovascular complications. Diabetic nephropathy (DN) is a late and one of the major chronic complication of T2DM and finally progresses to end-stage renal disease (ESRD) with multifactorial pathogenesis and the mechanism has not been fully understood.<a class="elsevierStyleCrossRefs" href="#bib0225">4,5</a> Increasing number of studies suggest that there is a link between hyperglycemia, oxidative stress, DNA damage and diabetic complications.<a class="elsevierStyleCrossRefs" href="#bib0235">6–9</a>In recent years; epidemiologic studies remark an association between many type of cancers (such as colorectal, liver, bladder, breast, pancreas and renal cancer) and T2DM.<a class="elsevierStyleCrossRefs" href="#bib0255">10–15</a> Increasing risk of cancer among diabetic patients may be linked with enhanced DNA damage and reduced DNA repair capacity. Also, DNA repair gene polymorphisms may modulate DNA repair capacity and affect predisposition to T2DM and its vascular complications.The X-ray repair cross-complementing group 3 (XRCC3) is a RAD51 family gene and encodes a protein that is participated in the homologous recombination repair of DNA double-strand breaks (DSB) to maintain chromosomal stability located on human chromosomes 14, at 14q32.3.<a class="elsevierStyleCrossRefs" href="#bib0285">16,17</a> T241M (rs861539), the most commonly investigated polymorphism of XRCC3 gene consists of a C/T transition leading to an amino acid substitution from Thr to Met at codon 241 and this substitution may result in DNA repair capacity change.<a class="elsevierStyleCrossRef" href="#bib0295">18</a> On the other hand, the other investigated gene X-ray repair cross-complementing group 1 (XRCC1) is located on chromosome 19, at 19q13.2 and encodes the XRCC1 protein which is a crucial enzyme that plays a series of coordinating role in stages of the base excision repair (BER) system due to its interactions with several proteins. Fifty polymorphic regions have been identified for XRCC1 gene and the most frequently studied genetic variant is Arg399Gln that consists of a G/A transition leading to an amino acid substitution from Arg to Gln at codon 399.<a class="elsevierStyleCrossRefs" href="#bib0300">19,20</a>XRCC3 T241M and XRCC1 A399G have been studied as risk factors for various cancer development in different populations.<a class="elsevierStyleCrossRefs" href="#bib0310">21–25</a> However, studies addressing the association of these polymorphisms with susceptibility to T2DM and the diabetic complications have been relatively rare. Therefore, aim of this study was to assess whether the T241M polymorphic variant of XRCC3 gene and A399G polymorphic variant of XRCC1 gene are associated with susceptibility to T2DM and DN in Turkish population.Materials and methodsStudy populationThe study population consisted of total 238 subjects from Istanbul/Turkey (age ranged between 23 and 83 years), including 116 patients with T2DM (77 females and 39 males), 50 patients with DN (15 females and 35 males) and 72 healthy volunteer with normal glucose metabolism (51 females and 21 males). Newly diagnosed T2DM or DN patients were not included in the study for accuracy's sake. Therefore, patients had been under therapy at least 1 year during the sample collection as indicated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Diagnosis of diabetes was made according to the American Diabetes Association<a class="elsevierStyleCrossRef" href="#bib0335">26</a> criteria (fasting glucose ≥126mg/dl; HbA1C ≥6.5%) in Diabetology Outpatient Department of Haydarpasa Numune Training and Research Hospital. Blood samples from DN patients were collected during their routine control in the clinic by checking their at least two previous 24h urinary albumin excretion (UAE) records and estimated glomerular filtration rate (eGFR mL/min) within 6 months. Patients with UAE<30mg/24h, 30–299mg/24h and ≥300mg/24h have been classified normoalbuminuria, microalbuminuria and macroalbuminuria, respectively.<a class="elsevierStyleCrossRef" href="#bib0340">27</a> According to the latest records, patients, who had microalbuminuria (30.6–295.2mg/24h; mean 137.55mg/24h; n=23), macroalbuminuria (309.96–5876mg/24h; mean 1442.07mg/24h; n=16 (4 of 16 was also dialysis patients)) and normoalbuminuria with eGFR<60mL/min/1.73m2 1.77–27mg/24h; mean 13.29mg/24h; n=11) were diagnosed with diabetic nephropathy. eGFR mL/min of DN patients were calculated using the Cockroft–Gault equation via current serum creatinine levels (creatinine clearance (ml/min)=[(140−age (years)]×weight (kg)/[72×serum creatinine (mg/dl)×(0.85 if female)]; <a id="intr0005" class="elsevierStyleInterRef" href="https://www.kidney.org/professionals/KDOQI/gfr_calculatorCoc">https://www.kidney.org/professionals/KDOQI/gfr_calculatorCoc</a>) and DN was classified into stages (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The Research protocol was approved by The Ethical Committee of Marmara University Institute of Health Sciences in accordance with the Declaration of Helsinki (ID number: 02.05.2014-7) and written informed consent was obtained from each subject before collecting blood samples. Also, participants answered the standardized health questionnaires relating to family history of T2DM, accompanying diseases, behavioral and lifestyle factors such as smoking, antioxidant usage, etc. as shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Determination of XRCC3 T241M and XRCC1 A399G polymorphismsGenomic DNA was extracted from peripheral blood lymphocytes by PureLink® Genomic DNA Mini Kit, Invitrogen, USA. Polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) was performed to identify the distribution of genotypes and frequency of alleles of XRCC3 T241M (rs861539) and XRCC1 A399G (rs25487). The 20μl PCR mix consisted of 10ng genomic DNA, 250μM dNTP mix, 1× PCR buffer, 0.5pmol from each primer, 3.75mM MgCl2, 2.5U Taq DNA polymerase (Thermo Scientific™) and PCR reactions were carried out by thermal cycler (Cleaver Scientific Ltd, model GTC96S). PCR-RFLP procedures are summarized in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a> in detail with thermal cycling conditions, the primer sequences,<a class="elsevierStyleCrossRef" href="#bib0330">25</a> annealing temperatures and restriction enzymes.<elsevierMultimedia ident="tbl0015"></elsevierMultimedia>Statistical analysisEach group was evaluated for Hardy–Weinberg equilibrium (HWE) by Chi-square test. Descriptive statistics are presented via mean±standard deviation for continuous variables and frequencies (%) for categorical variables. The normal distribution of continuous variables was tested by Shapiro–Wilk's test. The mean values were compared by Mann–Whitney U test (between two groups) and Kruskal–Wallis test (between three groups). Pearson Chi-square or Fisher's exact Chi-square test was used for categorical variables. In addition, the association of XRCC3 T241M, XRCC1 A399G and other covariates with T2DM and DN was analyzed by multiple logistic regression (MLR) by computing odds ratio (OR) and their respective 95% confidence interval (CI) after adjusting for potential confounding variables (as described in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>). XRCC3 T241M, XRCC1 A399G and assumed risk factors were analyzed by multiple logistic regression accepting as T2DM+DN groups as a dependent variable and other factors as independent variables to evaluate presence of T2DM (<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>) and DN group as a dependent variable to evaluate presence of DN (<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>). A two tailed p-value of <0.05 was considered statistically significant.<elsevierMultimedia ident="tbl0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0025"></elsevierMultimedia>ResultsThe demographic and clinical characteristics (body mass ındex – BMI, family history of T2DM, accompanying diseases, smoking status and antioxidant usage, etc.) of each participant has been questioned in detail and presented in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. Serum creatinine (mg/dl) levels of T2DM patients with DN were significantly higher than T2DM patients without DN as demonstrated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a> with all other clinical characteristics.Genotype distribution of XRCC3 T241M among T2DM patients were in accordance with HWE, however, DN patients and subjects with normal glucose metabolism deviated significantly from expected HWE. Otherwise, genotype distribution of XRCC1 A399G was not in accordance with HWE among all groups. Allele frequency distributions of genes among groups were evaluated. The percentage of polymorphic Met allele (CT+TT) distribution of XRCC3 gene was observed 52.6% for T2DM, 48% for DN and 40.3% for normal glucose metabolism and there was no statistically significant difference between groups (p>0.05). However, statistically significant difference (p=0.01) between groups was observed for polymorphic Gln allele (GA+AA) distribution of XRCC1 gene (66.4% for T2DM, 78% for DN and 45.8% for normal glucose metabolism). Followed by univariate and multivariate analysis; the association between disease risk and XRCC1 gene allele frequency is shown by odd ratios in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>.XRCC3 T241M had no significant impact on T2DM or DN development (OR 1.56, 95%CI 0.89–2.73 and OR 0.83 95% CI 0.43–1.67, respectively). However, polymorphic 399Gln variant of XRCC1 was found to be related with increased T2DM (OR 3.09, 95% CI 1.14–8.40) and DN (OR 3.29, 95% CI 1.23–8.80) risk. According to MLR results, male sex (p<0.05), age ≥45 years (p<0.001), BMI≥25 (p<0.001) and family history (p<0.001) demonstrated a significant association with T2DM. Also, male sex (p<0.001), age ≥65 (p<0.05) and duration of T2DM more than 10 years had a significant association with DN as demonstrated in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>.<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a> shows the combined effects of XRCC1 A399G and XRCC3 T241M in T2DM and DN risk. For this purpose, all diabetic patients (group 1+group 2) were compared with healthy donors (group 3) to evaluate combined effects of genes on T2DM and in addition diabetic patients with DN (group 2) were compared with diabetic patients without DN (group 1) to evaluate combined effects of genes on DN. The wildtype genotype of each gene was taken as reference to analyze the combined effect of XRCC1 A399G and XRCC3 T241M genotypes. Met allele of XRCC3 gene and Gln allele of XRCC1 gene were found to increase T2DM risk synergistically (p<0.001, OR 4.11, 95% CI 1.84–9.23). On the other hand, Thr allele of XRCC3 gene and Gln allele of XRCC1 gene were associated with a joint effect on DN risk (p=0.01, OR 5.11, 95% CI 1.37–19.11) (<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>).<elsevierMultimedia ident="tbl0030"></elsevierMultimedia>DiscussionDM is one of the most common metabolic diseases, the incidence of DM and its complications is increasing day by day. With regard to future of public health and health economics, it is necessary to develop emerging rationale strategies to manage and prevent the disease.Reported studies suggest that oxidative stress, DNA damage and inefficient repair may play a crucial role for progression and severity of diabetes and trigger complications.<a class="elsevierStyleCrossRefs" href="#bib0240">7,9,28–30</a> In addition, epidemiologic studies remark an increased risk of cancer among patients with T2DM.<a class="elsevierStyleCrossRef" href="#bib0360">31</a> Therefore, this study clarifies susceptibility to T2DM and DN with XRCC3 T241M and XRCC1 A399G. To the best of our knowledge, this is the first study that investigates the association between T241M polymorphism of XRCC3 gene and T2DM and DN in T2DM patients. Our results suggest T241M polymorphic variant of XRCC3 gene is not associated with an increased susceptibility to T2DM or DN in the studied population.Comparison of allele frequency of XRCC1 gene among groups (1, 2 and 3) showed statistically significant differences. Polymorphic 399 Gln variant of XRCC1 gene seems to increase T2DM and DN risk as evaluated by MLR analysis. Our data are consistent with previous findings of Majsterek et al. in which susceptibility were reported in T2DM and diabetic retinopathy.<a class="elsevierStyleCrossRef" href="#bib0365">32</a> However, in contrast to our results, no association have been reported by Kasznicki et al. between 399Gln polymorphism of XRCC1 gene and T2DM<a class="elsevierStyleCrossRef" href="#bib0370">33</a> and by Narne et al. between 399Gln polymorphism of XRCC1 gene and DN.<a class="elsevierStyleCrossRef" href="#bib0375">34</a> Besides, a number of studies reported relationship between A399G polymorphism of XRCC1 gene and other vascular complications of T2DM, association between 399Gln allele and diabetic retinopathy, coronary artery disease in T2DM and severity of these complications.<a class="elsevierStyleCrossRefs" href="#bib0365">32,35,36</a> As DN is a major cause of ESRD, we directed our research to reported studies related with A399G polymorphism in ESRD patients. In 2012, Trabulus et al. studied ESRD risk in Turkish population and reported that 399Gln variant had an association with an increased ESRD risk.<a class="elsevierStyleCrossRef" href="#bib0300">19</a> Same observation have been reported by Radwan et al. in 2015 that 399Gln variant leads to ESRD risk in Egyptian population.<a class="elsevierStyleCrossRef" href="#bib0390">37</a> In addition, DNA BER pathway gene OGG1 polymorphism have been studied by Gönül et al. and a significant association have been reported in Turkish diabetes mellitus patients.<a class="elsevierStyleCrossRef" href="#bib0390">37</a>In this study, Met allele of XRCC3 gene and Gln allele of XRCC1 gene were found to increase T2DM risk synergistically. On the other hand, Thr allele of XRCC3 gene and Gln allele of XRCC1 gene had a joint effect on DN risk.Both polymorphisms had no statistical significant association with Hb1Ac levels of T2DM patients with/without DN (data not shown). These findings suggest that there is no relationship between hyperglycemic state and polymorphisms of related DNA repair genes.Several studies have evaluated the expressions of DNA repair genes in T2DM and vascular complications but results are inconsistent. Certain studies report downregulation of selected DNA repair genes, others speculate an upregulation in consideration of increased DNA damage level in T2DM.<a class="elsevierStyleCrossRefs" href="#bib0395">38,39</a>This manuscript with limited sample size focuses on 2 main genes that encode proteins which are considered to play major role in homolog recombination of DSB and BER pathways. Confounding factors have been controlled by MLR due to different distribution of variables such as age, BMI, sex and our findings are consistent with reported literatures.<a class="elsevierStyleCrossRefs" href="#bib0405">40,41</a> Interestingly, although the current smoking had no impact on developing DN risk, the former smokers were found at high risk (<a class="elsevierStyleCrossRefs" href="#tbl0010">Tables 2 and 3</a>) which may relate to patients quitting smoking after diagnosis.In conclusion, we believe that further studies are needed to evaluate the expressions of DNA repair genes and epigenetic modifications, that may be useful to elucidate association between diabetes and cancer also the mechanism underlying the increased DNA damage and inefficient repair in T2DM. The results of our study suggest that 399Gln polymorphic variant of XRCC1 may increase T2DM and DN risk. On the other hand, genotype distribution of XRCC1 A399G among all groups were not in accordance with HWE, further meta-analysis of gene-disease studies are needed to clarify whether deviation from HWE affects the situation. Therefore, these findings need to be confirmed in different population with larger sample size." "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres1140504" "titulo" => "Abstract" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results and conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1071774" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1140503" "titulo" => "Resumen" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "abst0020" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0025" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0030" "titulo" => "Resultados y conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1071773" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Study population" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Determination of XRCC3 T241M and XRCC1 A399G polymorphisms" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Statistical analysis" ] ] ] 6 => array:2 [ "identificador" => "sec0030" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0035" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "xack388447" "titulo" => "Acknowledgement" ] 9 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2018-02-21" "fechaAceptado" => "2018-08-28" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1071774" "palabras" => array:6 [ 0 => "Type 2 diabetes mellitus" 1 => "Diabetic nephropathy" 2 => "XRCC3 T241M" 3 => "rs861539" 4 => "XRCC1 A399G" 5 => "rs25487" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1071773" "palabras" => array:6 [ 0 => "Diabetes mellitus de tipo 2" 1 => "Nefropatía diabética" 2 => "XRCC3 T241M" 3 => "rs861539" 4 => "XRCC1 A399G" 5 => "rs25487" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "IntroductionIncreasing number of experimental and clinical studies suggest a strong relationship between hyperglycemia, oxidative stress, DNA damage and diabetic nephropathy (DN). Also, epidemiologic studies remark an enhanced risk of cancer with type 2 diabetes. This research aims to assess whether the X-ray cross complementing group 3 (XRCC3) gene T241M polymorphism (rs861539) and X-ray cross complementing group 1 (XRCC1) gene A399G polymorphism (rs25487) are related with predisposition to type 2 diabetes mellitus (T2DM) and to diabetic nephropathy in Turkish population. Materials and methodsPolymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) was performed to identify the distribution of genotypes and frequency of alleles of T241M polymorphism of the XRCC3 gene (XRCC3 T241M) and A399G polymorphism of the XRCC1 gene (XRCC1 A399G). The study population included 238 subjects residing in Istanbul, Turkey; 116 with T2DM, 50 with DN and 72 with normal glucose metabolism. Results and conclusionPolymorphic Gln allele of XRCC1 gene was significantly related with T2DM and DN (OR 3.09, 95% CI 1.14–8.40 and OR 3.29 95% CI 1.23–8.80, respectively) however, there was no statistical association of XRCC3 T241M with T2DM or DN. The results of this study suggest that XRCC1 399Gln polymorphism is related with an increased susceptibility to T2DM and DN in the studied Turkish population." "secciones" => array:3 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results and conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "IntroducciónUn número creciente de estudios experimentales y clínicos sugiere una sólida relación entre hiperglucemia, estrés oxidativo, daño en el ADN y nefropatía diabética (ND). Además, los estudios epidemiológicos advierten mayor riesgo de cáncer con diabetes de tipo 2. Esta investigación tiene como objetivo evaluar si el polimorfismo del gen T241M del grupo 3 (XRCC3) complementario cruzado de rayos X (rs861539) y el polimorfismo del gen A399G del grupo 1 (XRCC1) complementario cruzado de rayos X (rs25487) están relacionados con la predisposición a la diabetes mellitus de tipo 2 (DM2) y a la nefropatía diabética en la población turca. Materiales y métodosSe realizó un polimorfismo de longitud de fragmento de restricción basado en la reacción en cadena de la polimerasa (PCR-RFLP) para identificar la distribución de genotipos y la frecuencia de los alelos del polimorfismo T241M del gen XRCC3 (XRCC3 T241M) y el polimorfismo A399G del gen XRCC1(XRCC1 A399G). La población de estudio incluyó a 238 individuos que residían en Estambul, Turquía; 116 de ellos con DM2, 50 con ND y 72 con metabolismo de la glucosa normal. Resultados y conclusiónEl alelo Gln polimórfico del gen XRCC1 se relacionó de manera importante con DM2 y ND (OR: 3,09; IC95%: 1,14-8,40 y OR: 3,29; IC95%:1,23-8,80, respectivamente). Sin embargo, no hubo asociación estadística de XRCC3 T241M con DM2 o ND. Los resultados de este estudio sugieren que el polimorfismo XRCC1 399Gln está relacionado con un aumento de la susceptibilidad a la DM2 y a la ND en la población turca estudiada." "secciones" => array:3 [ 0 => array:2 [ "identificador" => "abst0020" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0025" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0030" "titulo" => "Resultados y conclusión" ] ] ] ] "multimedia" => array:6 [ 0 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristics \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 (Type 2 diabetes mellitus n=116) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 (diabetic nephropathy n=50) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p value \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Duration of T2DM (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">10.75±8 (1–45) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">15.28±8.79 (2–45) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top">Retinopathy</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">16 (13.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">10 (20%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">No \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">100 (86.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">40 (80%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top">Neuropathy</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">9 (7.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5 (10%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">No \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">107 (92.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">45 (90%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top"></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Fasting blood glucose (mg/dl) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">168.76±60.64 (79–415) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">207.82±110.74 (94–748) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Hb1Ac \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">7.79±1.65 (5.1–13) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">8.75±2.1 (5.9–14.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Serum creatinine (mg/dl) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.79±0.13 (0.58–1.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.38±1.68 (0.67–6.92) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="4" align="left" valign="top">Diabetic Nephropathy stages</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Stage 1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">11 (22%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Stage2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">7 (14%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Stage3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">16 (32%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Stage 4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12 (24%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Stage 5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">4 (8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946217.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Clinical characteristics of diabetic subjects." ] ] 1 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 (type 2 diabetes mellitus n=116) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 (diabetic nephropathy n=50) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 3 (normal glucose metabolism n=72) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p value \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">77 (66.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">15 (30%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">51 (70.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">39 (33.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">35 (70%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">21 (29.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">56.96±8.96 (36–83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">63.49±9.72 (37–83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">36.5±10.6 (23–64) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Weight (kg, mean±SD) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">83.05±13.59 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">83.40±19.07 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">66.46±11.97 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI (kg/m2, mean±SD) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">31.88±5.87 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">30.11±6.95 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">23.74±3.73 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Family history of Diabetes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">87 (75.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">36 (73.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">41 (57.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Cardiovascular disease \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">23 (19.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">27 (54%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 (1.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Hypertension \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">52 (44.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">36 (72%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">4 (5.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Hyperlipidemia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">34 (29.34%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">9 (18%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1 (1.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.0001 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thyroid disorder \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">16 (13.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3 (6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 (8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Smoking</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non-smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">63 (54.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">18 (36.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">42 (59.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.01 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Current Smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">16 (13.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6 (12.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">17 (23.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Former smoker \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">36 (31.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">25 (51%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12 (16.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Antioxidant</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non-users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">91 (79.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">39 (79.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">57 (80.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">24 (20.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">10 (20.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">14 (19.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946213.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Demographic and clinical characteristics of each group." ] ] 2 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "F: forward primer; R: reverse primer; W: wild genotype; H: heterozygous genotype; P: polymorphic genotype." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Gene and polymorphic region \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Primers and annealing temperature</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PCR product (bp) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Restriction Enzyme and condition \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Restriction products (bp) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Genotypes \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Reference \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " rowspan="3" align="left" valign="top">XRCC3 exon 7. T/C Thr241Met (rs861539)</td><td class="td" title="table-entry " align="left" valign="top">F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5′GGTCGAGTGACAGTCCAAAC3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top">456</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top">Hin1II (NlaIII) 37°C 30min</td><td class="td" title="table-entry " align="left" valign="top">CC 316/140 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">W \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top"><a class="elsevierStyleCrossRef" href="#bib0330">25</a></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5′TGCAACGGCTGAGGGTCTT3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">TC 316/211/140/105 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">H \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">AT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">64°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">TT 211/140/105 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">P \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " rowspan="3" align="left" valign="top">XRCC1 exon 10G/A Arg399Gln (rs25487)</td><td class="td" title="table-entry " align="left" valign="top">F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5′TCTGTCTCCCCTGTCTCGTT3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top">239 bp</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top">Hpa II (Msp I) 37°C 30min</td><td class="td" title="table-entry " align="left" valign="top">GG 187/52 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">W \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " rowspan="3" align="left" valign="top"><a class="elsevierStyleCrossRef" href="#bib0330">25</a></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5′ATTGCCCAGCACAGGATAAG3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GA 239/187/52 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">H \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">AT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">63°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AA 239 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">P \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " rowspan="3" align="left" valign="top">thermal cycling conditions</td><td class="td" title="table-entry " colspan="7" align="left" valign="top">Step 1 (initial denaturation): 4min 94°C</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="7" align="left" valign="top">Step 2 (annealing-synthesis): 33 cycles 30s 94°C. 1min 64/63°C. 1min 72°C</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="7" align="left" valign="top">Step 3 (final extension): 10min 73°C</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946216.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Summary of PCR-RFLP assay." ] ] 3 => array:8 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at4" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " colspan="5" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Presence of T2DM</th></tr><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate OR (%95 CI) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate OR (%95 CI) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.95 (1.08–3.54) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.74 (1.33–10.52) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Age (years)</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≥45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">43.36 (19.42–96.85) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">44.43 (15.17–130.15) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">BMI (kg/m2)</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI<25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI≥25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">12.98 (6.54–25.79) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">10.22 (3.53–29.63) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Family history</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">No \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.01 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.20 (1.22–3.96) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6.23 (2.15–18.07) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Smoking</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non-smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Current smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.67 (0.32–1.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Former smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.64 (1.28–5.43) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Antioxidant</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non-users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.07 (0.53–2.14) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">XRCC3 T241M</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.56 (0.89–2.73) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">XRCC1 A399G</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.74 (1.55–4.85) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.09 (1.14–8.40) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946215.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Univariate and multivariate analysis for the association between type 2 diabetes mellitus (T2DM) and XRCC3 T241M polymorphism, XRCC1 A399G polymorphism and other putative risk factors." ] ] 4 => array:8 [ "identificador" => "tbl0025" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at5" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " colspan="5" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Presence of DN</th></tr><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate OR (%95 CI) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate OR (%95 CI) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">4.61 (2.25–9.44) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5.39 (2.28–12.74) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Age (years)</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≤45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">46–64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.51 (0.43–28.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.99 (0.35–25.89) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≥65 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.01 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">13.71 (1.64–114.53) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.01 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">11.31 (1.25–102.03) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">BMI (kg/m2)</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI<25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI≥25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.41 (0.16–1.09) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Duration of T2DM</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">≤5 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">6–10 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.74 (0.59–5.14) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.243 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.07 (0.61–7.03) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">>10 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.01 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.58 (1.33–9.65) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.37 (1.09–10.38) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Family history</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">No \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Yes \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.89 (0.42–1.91) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Smoking</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non-smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Current Smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.31 (0.45–3.84) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Former smokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.43 (1.17–5.05) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Antioxidant</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Non users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Users \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.97 (0.43–2.22) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">XRCC3 T241M</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.83(0.43–1.67) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top"></td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">XRCC1 A399G</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.8 (0.83–3.89) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.29 (1.23–8.80) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946212.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Univariate and multivariate analysis for the association between diabetic nephropathy (DN) and XRCC3 T241M polymorphism, XRCC1 A399G polymorphism and other putative risk factors." ] ] 5 => array:8 [ "identificador" => "tbl0030" "etiqueta" => "Table 6" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at6" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:2 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">XRCC3 Thr241Met. & XRCC1 Arg399Gln \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="4" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Risk of T2DM</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1+Group 2 (T2DM+DN) n=166 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 3 (NM) n=72 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR (95% CI) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel. Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">25 (15.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">24 (33.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel. Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">56 (33.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">19 (26.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.83 (1.32–6.08) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel. Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">25 (15.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">15 (20.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1.6 (0.69–3.75) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel. Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">60 (36.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">14 (19.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">4.11 (1.84–9.23) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946218.png" ] ] 1 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">XRCC3 Thr241Met. & XRCC1 Arg399Gln \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="4" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Risk of DN</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 (T2DM) n=116 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 (DN) n=50 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p value \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR (95% CI) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel. Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">22 (19%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3 (6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Reference \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel. Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">33 (28.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">23 (46%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.01 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">5.11 (1.37–19.11) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel. Arg allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">17 (14.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">8 (16%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">3.45 (0.79–15.01) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel. Gln allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">44 (37.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">16 (32%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2.67 (0.70–10.13) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1946214.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Combined effect of XRCC3 Thr241Met and XRCC1 Arg399Gln in T2DM and DN risk." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:41 [ 0 => array:3 [ "identificador" => "bib0210" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnosis and classification of diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. American Diabetes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/dc10-S062" "Revista" => array:7 [ "tituloSerie" => "Diabetes Care" "fecha" => "2010" "volumen" => "33" "numero" => "Suppl. 1" "paginaInicial" => "S62" "paginaFinal" => "S69" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20042775" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0215" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "WHO. Global report on diabetes. Available at: <a id="intr0010" class="elsevierStyleInterRef" href="http://wwwwhoint/campaigns/world-health-day/2016/en/">http://wwwwhoint/campaigns/world-health-day/2016/en/</a> [accessed 11.01.18]." ] ] ] 2 => array:3 [ "identificador" => "bib0220" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "IDF. Available at: <a id="intr0015" class="elsevierStyleInterRef" href="https://wwwidforg/our-network/regions-members/europe/members/163-turkeyhtml">https://wwwidforg/our-network/regions-members/europe/members/163-turkeyhtml</a> [accessed 11.01.18]." ] ] ] 3 => array:3 [ "identificador" => "bib0225" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetic nephropathy and inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.B. Duran-Salgado" 1 => "A.F. Rubio-Guerra" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4239/wjd.v5.i3.393" "Revista" => array:6 [ "tituloSerie" => "World J Diabetes" "fecha" => "2014" "volumen" => "5" "paginaInicial" => "393" "paginaFinal" => "398" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24936261" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0230" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes mellitus: the linkage between oxidative stress, inflammation, hypercoagulability and vascular complications" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C.P. Domingueti" 1 => "L.M. Dusse" 2 => "M.D. Carvalho" 3 => "L.P. de Sousa" 4 => "K.B. Gomes" 5 => "A.P. Fernandes" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diabetes Compl" "fecha" => "2015" "volumen" => "30" "paginaInicial" => "738" "paginaFinal" => "745" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0235" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Assessment of DNA strand breakage by comet assay in diabetic patients and the role of antioxidant supplementation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Sardas" 1 => "M. Yilmaz" 2 => "U. Oztok" 3 => "N. Cakir" 4 => "A.E. Karakaya" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mutat Res" "fecha" => "2001" "volumen" => "490" "paginaInicial" => "123" "paginaFinal" => "129" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11342238" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0240" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Study of urinary 8-hydroxydeoxyguanosine as a biomarker of oxidative DNA damage in diabetic nephropathy patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "G.W. Xu" 1 => "Q.H. Yao" 2 => "Q.F. Weng" 3 => "B.L. Su" 4 => "X. Zhang" 5 => "J.H. Xiong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jpba.2004.04.016" "Revista" => array:6 [ "tituloSerie" => "J Pharm Biomed Anal" "fecha" => "2004" "volumen" => "36" "paginaInicial" => "101" "paginaFinal" => "104" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15351053" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0245" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The oxidative stress status in diabetes mellitus and diabetic nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H.Z. Pan" 1 => "L. Zhang" 2 => "M.Y. Guo" 3 => "H. Sui" 4 => "H. Li" 5 => "W.H. Wu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00592-009-0128-1" "Revista" => array:7 [ "tituloSerie" => "Acta Diabetol" "fecha" => "2010" "volumen" => "47" "numero" => "Suppl. 1" "paginaInicial" => "71" "paginaFinal" => "76" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19475334" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0250" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Parameters of oxidative stress, DNA damage and DNA repair in type 1 and type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Pacal" 1 => "J. Varvarovska" 2 => "Z. Rusavy" 3 => "S. Lacigova" 4 => "R. Stetina" 5 => "J. Racek" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/13813455.2010.551135" "Revista" => array:6 [ "tituloSerie" => "Arch Physiol Biochem" "fecha" => "2011" "volumen" => "117" "paginaInicial" => "222" "paginaFinal" => "230" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21338322" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0255" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes and the risk for colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Erbach" 1 => "H. Mehnert" 2 => "O. Schnell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diabetes Compl" "fecha" => "2012" "volumen" => "26" "paginaInicial" => "50" "paginaFinal" => "55" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0260" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes mellitus as an independent risk factor for lung cancer: a meta-analysis of observational studies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.Y. Lee" 1 => "I. Jeon" 2 => "J.M. Lee" 3 => "J.M. Yoon" 4 => "S.M. Park" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejca.2013.02.025" "Revista" => array:6 [ "tituloSerie" => "Eur J Cancer" "fecha" => "2013" "volumen" => "49" "paginaInicial" => "2411" "paginaFinal" => "2423" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23562551" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0265" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes mellitus increases the risk of bladder cancer: an updated meta-analysis of observational studies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Fang" 1 => "B. Yao" 2 => "Y. Yan" 3 => "H. Xu" 4 => "Y. Liu" 5 => "H. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/dia.2013.0131" "Revista" => array:6 [ "tituloSerie" => "Diabetes Technol Ther" "fecha" => "2013" "volumen" => "15" "paginaInicial" => "914" "paginaFinal" => "922" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24180357" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0270" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The female breast and diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "E. Gouveri" 1 => "N. Papanas" 2 => "E. Maltezos" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.breast.2011.02.019" "Revista" => array:6 [ "tituloSerie" => "Breast" "fecha" => "2011" "volumen" => "20" "paginaInicial" => "205" "paginaFinal" => "211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21414785" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0275" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The relationship between new-onset diabetes mellitus and pancreatic cancer risk: a case-control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q. Ben" 1 => "Q. Cai" 2 => "Z. Li" 3 => "Y. Yuan" 4 => "X. Ning" 5 => "S. Deng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejca.2010.07.010" "Revista" => array:6 [ "tituloSerie" => "Eur J Cancer" "fecha" => "2011" "volumen" => "47" "paginaInicial" => "248" "paginaFinal" => "254" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20709528" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0280" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes mellitus and incidence and mortality of kidney cancer: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Bao" 1 => "X. Yang" 2 => "W. Xu" 3 => "H. Luo" 4 => "Z. Xu" 5 => "C. Su" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diabetes Compl" "fecha" => "2013" "volumen" => "27" "paginaInicial" => "357" "paginaFinal" => "364" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0285" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA repair gene polymorphisms, bulky DNA adducts in white blood cells and bladder cancer in a case-control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Matullo" 1 => "S. Guarrera" 2 => "S. Carturan" 3 => "M. Peluso" 4 => "C. Malaveille" 5 => "L. Davico" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Int J Cancer" "fecha" => "2001" "volumen" => "92" "paginaInicial" => "562" "paginaFinal" => "567" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11304692" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0290" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R.B. Ji" 1 => "Y.S. Qian" 2 => "A.R. Hu" 3 => "Y.R. Hu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4238/2015.December.7.11" "Revista" => array:6 [ "tituloSerie" => "Genet Mol Res" "fecha" => "2015" "volumen" => "14" "paginaInicial" => "15988" "paginaFinal" => "15996" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26662391" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0295" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Meta-analysis of the relationship between XRCC3 T241M polymorphism and colorectal cancer susceptibility" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L.Z. Zhang" 1 => "Y.S. Li" 2 => "H.Z. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4238/2015.November.18.48" "Revista" => array:6 [ "tituloSerie" => "Genet Mol Res" "fecha" => "2015" "volumen" => "14" "paginaInicial" => "14831" "paginaFinal" => "14839" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26600544" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0300" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Trabulus" 1 => "G.S. Guven" 2 => "M.R. Altiparmak" 3 => "B. Batar" 4 => "O. Tun" 5 => "A.S. Yalin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11033-012-1529-8" "Revista" => array:6 [ "tituloSerie" => "Mol Biol Rep" "fecha" => "2012" "volumen" => "39" "paginaInicial" => "6995" "paginaFinal" => "7001" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22302399" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0305" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of the 399Arg/Gln XRCC1, the 194 Arg/Trp XRCC1, the 326Ser/Cys OGG1, and the 324Gln/His MUTYH gene polymorphisms with clinical parameters and the risk for development of primary open-angle glaucoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.P. Szaflik" 1 => "M. Cuchra" 2 => "K. Przybylowska-Sygut" 3 => "L. Dziki" 4 => "A.K. Kurowska" 5 => "M. Gacek" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.mrgentox.2012.12.019" "Revista" => array:6 [ "tituloSerie" => "Mutat Res" "fecha" => "2013" "volumen" => "753" "paginaInicial" => "12" "paginaFinal" => "22" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23499241" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0310" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between XRCC3 Thr241Met polymorphism and nasopharyngeal carcinoma risk: evidence from a large-scale case-control study and a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q. Cui" 1 => "X.Y. Zuo" 2 => "Y.F. Lian" 3 => "Q.S. Feng" 4 => "Y.F. Xia" 5 => "C.Y. He" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s13277-016-5300-y" "Revista" => array:6 [ "tituloSerie" => "Tumour Biol" "fecha" => "2016" "volumen" => "37" "paginaInicial" => "14825" "paginaFinal" => "21483" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27639382" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0315" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "XRCC3 Thr241Met polymorphism is not associated with lung cancer risk in a romanian population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Catana" 1 => "M. Pop" 2 => "D.H. Marginean" 3 => "I.C. Blaga" 4 => "M.D. Porojan" 5 => "R.A. Popp" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.15386/cjmed-523" "Revista" => array:6 [ "tituloSerie" => "Clujul Med" "fecha" => "2016" "volumen" => "89" "paginaInicial" => "89" "paginaFinal" => "93" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27004030" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0320" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between single nucleotide polymorphisms (SNPs) of XRCC2 and XRCC3 homologous recombination repair genes and ovarian cancer in Polish women" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.M. Michalska" 1 => "D. Samulak" 2 => "H. Romanowicz" 3 => "F. Jablonski" 4 => "B. Smolarz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.yexmp.2016.01.007" "Revista" => array:6 [ "tituloSerie" => "Exp Mol Pathol" "fecha" => "2016" "volumen" => "100" "paginaInicial" => "243" "paginaFinal" => "247" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26801223" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0325" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of the XPD and XRCC3 gene polymorphisms with oral squamous cell carcinoma in a Northeastern Brazilian population: a pilot study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. dos Santos Pereira" 1 => "F.L. Fontes" 2 => "S.R. de Medeiros" 3 => "R. de Almeida Freitas" 4 => "L.B. de Souza" 5 => "M.C. da Costa Miguel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.archoralbio.2015.12.004" "Revista" => array:6 [ "tituloSerie" => "Arch Oral Biol" "fecha" => "2016" "volumen" => "64" "paginaInicial" => "19" "paginaFinal" => "23" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26742000" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0330" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Allelic variants of XRCC1 and XRCC3 repair genes and susceptibility of oral cancer in Brazilian patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.B. Dos Reis" 1 => "R. Losi-Guembarovski" 2 => "E.M. de Souza Fonseca Ribeiro" 3 => "I.J. Cavalli" 4 => "M.C. Morita" 5 => "G.H. Ramos" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1600-0714.2012.01192.x" "Revista" => array:6 [ "tituloSerie" => "J Oral Pathol Med" "fecha" => "2013" "volumen" => "42" "paginaInicial" => "180" "paginaFinal" => "185" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22775506" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0335" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Standards of medical care in diabetes-2015 abridged for primary care providers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. American Diabetes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/diaclin.33.2.97" "Revista" => array:6 [ "tituloSerie" => "Clin Diabetes" "fecha" => "2015" "volumen" => "33" "paginaInicial" => "97" "paginaFinal" => "111" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25897193" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0340" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A new classification of diabetic nephropathy 2014: a report from Joint Committee on Diabetic Nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Haneda" 1 => "K. Utsunomiya" 2 => "D. Koya" 3 => "T. Babazono" 4 => "T. Moriya" 5 => "H. Makino" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diabetes Invest" "fecha" => "2015" "volumen" => "6" "paginaInicial" => "242" "paginaFinal" => "246" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0345" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA damage and repair in type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Blasiak" 1 => "M. Arabski" 2 => "R. Krupa" 3 => "K. Wozniak" 4 => "M. Zadrozny" 5 => "J. Kasznicki" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.mrfmmm.2004.05.011" "Revista" => array:6 [ "tituloSerie" => "Mutat Res" "fecha" => "2004" "volumen" => "554" "paginaInicial" => "297" "paginaFinal" => "304" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15450427" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0350" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oxidative damage to DNA and its relationship with diabetic complications" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H.Z. Pan" 1 => "D. Chang" 2 => "L.G. Feng" 3 => "F.J. Xu" 4 => "H.Y. Kuang" 5 => "M.J. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biomed Environ Sci" "fecha" => "2007" "volumen" => "20" "paginaInicial" => "160" "paginaFinal" => "163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17624192" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0355" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Urinary 8-OHdG: a marker of oxidative stress to DNA and a risk factor for cancer, atherosclerosis and diabetics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.L. Wu" 1 => "C.-C. Chiou" 2 => "P.-Y. Chang" 3 => "J.T. Wu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Chim Acta" "fecha" => "2004" "volumen" => "339" "paginaInicial" => "1" "paginaFinal" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14687888" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0360" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes and cancer: a 2013 synopsis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Buysschaert" 1 => "S. Sadikot" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.dsx.2013.08.001" "Revista" => array:6 [ "tituloSerie" => "Diabetes Metab Syndr" "fecha" => "2013" "volumen" => "7" "paginaInicial" => "247" "paginaFinal" => "250" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24290094" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0365" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of oxidative DNA damage in pathogenesis of diabetic neuropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "I. Majsterek" 1 => "A. Merecz" 2 => "A. Sliwinska" 3 => "M. Kosmalski" 4 => "J. Kasznicki" 5 => "J. Drzewoski" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "World Acad Sci Eng Technol" "fecha" => "2012" "volumen" => "6" "paginaInicial" => "12" "paginaFinal" => "15" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0370" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between polymorphisms of the DNA repair genes XRCC1 and hOGG1 and type 2 diabetes mellitus in the Polish population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Kasznicki" 1 => "R. Krupa" 2 => "J. Blasiak" 3 => "J. Drzewoski" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pol Arch Med Wewn" "fecha" => "2009" "volumen" => "119" "paginaInicial" => "122" "paginaFinal" => "128" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19514640" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0375" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphisms in oxidative stress pathway genes and risk of diabetic nephropathy in South Indian type 2 diabetic patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "P. Narne" 1 => "K.C. Ponnaluri" 2 => "M. Siraj" 3 => "M. Ishaq" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Nephrology (Carlton, Vic)" "fecha" => "2014" "volumen" => "19" "paginaInicial" => "623" "paginaFinal" => "629" ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0380" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Arg399Gln polymorphism of X-ray repair cross-complementing group 1 gene is associated with angiographically documented coronary artery disease in South Indian type 2 diabetic patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "P. Narne" 1 => "K.C. Ponnaluri" 2 => "S. Singh" 3 => "M. Siraj" 4 => "M. Ishaq" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Genet Test Mol Biomark" "fecha" => "2013" "volumen" => "17" "paginaInicial" => "236" "paginaFinal" => "241" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0385" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association analysis of polymorphisms in genes related to oxidative stress in south indian type 2 diabetic patients with retinopathy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "P. Narne" 1 => "K.C. Ponnaluri" 2 => "M. Siraj" 3 => "M. Ishaq" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Ophth Genet" "fecha" => "2016" "volumen" => "37" "paginaInicial" => "1" "paginaFinal" => "8" ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0390" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA repair genes XPD and XRCC1 polymorphisms and risk of end-stage renal disease in Egyptian population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "W.M. Radwan" 1 => "H.S. Elbarbary" 2 => "N.M. Alsheikh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/0886022X.2014.967646" "Revista" => array:6 [ "tituloSerie" => "Ren Fail" "fecha" => "2015" "volumen" => "37" "paginaInicial" => "122" "paginaFinal" => "128" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25310768" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0395" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diabetes causes multiple genetic alterations and downregulates expression of DNA repair genes in the prostate" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Ye" 1 => "X. Li" 2 => "Y. Wang" 3 => "Y. Zhang" 4 => "M. Cai" 5 => "B. Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/labinvest.2011.87" "Revista" => array:6 [ "tituloSerie" => "Lab Invest" "fecha" => "2011" "volumen" => "91" "paginaInicial" => "1363" "paginaFinal" => "1374" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21647090" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0400" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Up-regulation of MSH2, XRCC1 and ATM genes in patients with type 2 diabetes and coronary artery disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Ahmadi" 1 => "M. Behmanesh" 2 => "M.A. Boroumand" 3 => "M. Tavallaei" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.diabres.2015.05.049" "Revista" => array:6 [ "tituloSerie" => "Diabetes Res Clin Pract" "fecha" => "2015" "volumen" => "109" "paginaInicial" => "500" "paginaFinal" => "506" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26088318" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0405" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gender aspects in type 2 diabetes mellitus and cardiometabolic risk" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "N. Sattar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.beem.2013.05.006" "Revista" => array:6 [ "tituloSerie" => "Best Pract Res Clin Endocrinol Metab" "fecha" => "2013" "volumen" => "27" "paginaInicial" => "501" "paginaFinal" => "507" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24054927" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0410" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The pathogenesis and pathophysiology of type 1 and type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.C. Ozougwu" 1 => "K.C. Obimba" 2 => "C.D. Belonwu" 3 => "C.B. Unakalamba" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Physiol Pathophysiol" "fecha" => "2013" "volumen" => "4" "paginaInicial" => "46" "paginaFinal" => "57" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack388447" "titulo" => "Acknowledgement" "texto" => "This study was supported by Research Foundation of Marmara University [grant no. SAG-C-DRP-100914-0320]. We thank Dr. Mehmet Tepe from Haydarpasa Numune Training and Research Hospital Internal Diseases Policlinics for his precious efforts in supplying blood samples and Prof. Dr. Pınar Ay from Marmara University, Faculty of Medicine, Department of Public Health for her rigorous statistical evaluations.Conflict of interestThe authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418302325/v1_201901250635/en/main.assets" "Apartado" => array:4 [ "identificador" => "63844" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/25300164/0000006600000002/v1_201901250635/S2530016418302325/v1_201901250635/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418302325?idApp=UINPBA00004N"]

Statistics

Original article

Role of DNA repair genes XRCC3 and XRCC1 in predisposition to type 2 diabetes mellitus and diabetic nephropathy

Papel de los genes de reparación del ADN XRCC3 y XRCC1 en la predisposición a la diabetes mellitus de tipo 2 y a la nefropatía diabética

Tugce Yesil-Devecioglua,

Corresponding author

tugce.yesil@marmara.edu.tr

Corresponding author.

, Akın Dayanb, Refik Demirtuncc, Semra Sardasd

a Marmara University, Faculty of Pharmacy, Department of Pharmaceutical Toxicology, Istanbul, Turkey

b Health Sciences University, Haydarpasa Numune Training and Research Hospital, Diabetology Outpatient Department, Istanbul, Turkey

c Health Sciences University, Haydarpasa Numune Training and Research Hospital, Internal Diseases Service, Istanbul, Turkey

d Istinye University, Faculty of Pharmacy, Department of Pharmaceutical Toxicology, Istanbul, Turkey

Read

2071

Times
was read the article

501

Total PDF

1570

Total HTML

Share statistics

 array:23 [
  "pii" => "S2530016418302325"
  "issn" => "25300164"
  "doi" => "10.1016/j.endinu.2018.08.010"
  "estado" => "S300"
  "fechaPublicacion" => "2019-02-01"
  "aid" => "851"
  "copyright" => "SEEN y SED"
  "copyrightAnyo" => "2018"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Endocrinol Diabetes Nutr. 2019;66:90-8"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:2 [
    "total" => 222
    "formatos" => array:2 [
      "HTML" => 161
      "PDF" => 61
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S2530016418301927"
    "issn" => "25300164"
    "doi" => "10.1016/j.endinu.2018.07.008"
    "estado" => "S300"
    "fechaPublicacion" => "2019-02-01"
    "aid" => "841"
    "copyright" => "SEEN y SED"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Endocrinol Diabetes Nutr. 2019;66:99-107"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 161
      "formatos" => array:2 [
        "HTML" => 114
        "PDF" => 47
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Haptoglobin levels are influenced by Hp1&#8211;Hp2 polymorphism&#44; obesity&#44; inflammation&#44; and hypertension in type 2 diabetes mellitus"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "99"
          "paginaFinal" => "107"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Los niveles de haptoglobina est&#225;n influenciados por el polimorfismo Hp1-Hp2&#44; la obesidad&#44; la inflamaci&#243;n y la hipertensi&#243;n en la diabetes mellitus tipo 2"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1822
              "Ancho" => 2344
              "Tamanyo" => 199031
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Correlation coefficients between haptoglobin levels&#44; clinical&#44; and laboratory data in T2DM patients&#46; BMI &#40;body mass index&#41;&#44; IL &#40;interleukin&#41;&#44; hs-CRP &#40;high sensitivity C reactive protein&#41;&#46; Spearman&#39;s correlation test&#59; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 was considered statistically significant&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Kathryna Fontana Rodrigues, Nathalia Teixeira Pietrani, Laura Machado Lara Carvalho, Adriana Aparecida Bosco, Val&#233;ria Cristina Sandrim, Cl&#225;udia Nat&#225;lia Ferreira, Karina Braga Gomes"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Kathryna Fontana"
              "apellidos" => "Rodrigues"
            ]
            1 => array:2 [
              "nombre" => "Nathalia Teixeira"
              "apellidos" => "Pietrani"
            ]
            2 => array:2 [
              "nombre" => "Laura Machado Lara"
              "apellidos" => "Carvalho"
            ]
            3 => array:2 [
              "nombre" => "Adriana Aparecida"
              "apellidos" => "Bosco"
            ]
            4 => array:2 [
              "nombre" => "Val&#233;ria Cristina"
              "apellidos" => "Sandrim"
            ]
            5 => array:2 [
              "nombre" => "Cl&#225;udia Nat&#225;lia"
              "apellidos" => "Ferreira"
            ]
            6 => array:2 [
              "nombre" => "Karina Braga"
              "apellidos" => "Gomes"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418301927?idApp=UINPBA00004N"
    "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418301927/v1_201901250635/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S2530016418302350"
    "issn" => "25300164"
    "doi" => "10.1016/j.endinu.2018.08.013"
    "estado" => "S300"
    "fechaPublicacion" => "2019-02-01"
    "aid" => "854"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Endocrinol Diabetes Nutr. 2019;66:83-9"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 596
      "formatos" => array:2 [
        "HTML" => 373
        "PDF" => 223
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Factores predictores de diabetes mellitus posparto en pacientes con diabetes gestacional"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "83"
          "paginaFinal" => "89"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Predictors of postpartum diabetes mellitus in patients with gestational diabetes"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 816
              "Ancho" => 1083
              "Tamanyo" => 58949
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Valores de glucemia en los distintos puntos de la SOG con 100g&#44; atendiendo a la reevaluaci&#243;n posparto &#40;normal&#44; GBA&#44; IHC o DM&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Soralla Civantos, Mar&#237;a Dur&#225;n, Beatriz Fl&#225;ndez, Mar&#237;a Merino, Cristina Navea, Guadalupe Guijarro, Nieves Martell, Susana Monereo"
          "autores" => array:8 [
            0 => array:2 [
              "nombre" => "Soralla"
              "apellidos" => "Civantos"
            ]
            1 => array:2 [
              "nombre" => "Mar&#237;a"
              "apellidos" => "Dur&#225;n"
            ]
            2 => array:2 [
              "nombre" => "Beatriz"
              "apellidos" => "Fl&#225;ndez"
            ]
            3 => array:2 [
              "nombre" => "Mar&#237;a"
              "apellidos" => "Merino"
            ]
            4 => array:2 [
              "nombre" => "Cristina"
              "apellidos" => "Navea"
            ]
            5 => array:2 [
              "nombre" => "Guadalupe"
              "apellidos" => "Guijarro"
            ]
            6 => array:2 [
              "nombre" => "Nieves"
              "apellidos" => "Martell"
            ]
            7 => array:2 [
              "nombre" => "Susana"
              "apellidos" => "Monereo"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2530018019300204"
        "doi" => "10.1016/j.endien.2019.02.002"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530018019300204?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418302350?idApp=UINPBA00004N"
    "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418302350/v1_201901250635/es/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Role of DNA repair genes <span class="elsevierStyleItalic">XRCC3</span> and <span class="elsevierStyleItalic">XRCC1</span> in predisposition to type 2 diabetes mellitus and diabetic nephropathy"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "90"
        "paginaFinal" => "98"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Tugce Yesil-Devecioglu, Ak&#305;n Dayan, Refik Demirtunc, Semra Sardas"
        "autores" => array:4 [
          0 => array:4 [
            "nombre" => "Tugce"
            "apellidos" => "Yesil-Devecioglu"
            "email" => array:1 [
              0 => "tugce&#46;yesil&#64;marmara&#46;edu&#46;tr"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Ak&#305;n"
            "apellidos" => "Dayan"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Refik"
            "apellidos" => "Demirtunc"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Semra"
            "apellidos" => "Sardas"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Marmara University&#44; Faculty of Pharmacy&#44; Department of Pharmaceutical Toxicology&#44; Istanbul&#44; Turkey"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Health Sciences University&#44; Haydarpasa Numune Training and Research Hospital&#44; Diabetology Outpatient Department&#44; Istanbul&#44; Turkey"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Health Sciences University&#44; Haydarpasa Numune Training and Research Hospital&#44; Internal Diseases Service&#44; Istanbul&#44; Turkey"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Istinye University&#44; Faculty of Pharmacy&#44; Department of Pharmaceutical Toxicology&#44; Istanbul&#44; Turkey"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Papel de los genes de reparaci&#243;n del ADN <span class="elsevierStyleItalic">XRCC3</span> y <span class="elsevierStyleItalic">XRCC1</span> en la predisposici&#243;n a la diabetes mellitus de tipo 2 y a la nefropat&#237;a diab&#233;tica"
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Diabetes mellitus &#40;DM&#41; is a metabolic disease which occurs by deficiency in insulin secretion and&#47;or insulin action that leads to inefficiency in metabolism of carbohydrate&#44; lipid and protein&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">1</span></a> Diabetes mellitus is recognized as a prevalent worldwide disorder with growing incidence&#46; According to the World Health Organization &#40;WHO&#41; data&#44; the number of deaths caused by diabetes was 1&#46;5 million in 2012 and currently 422 million people have diabetes mellitus in the world and the number of patients with diabetes is expected to more than double in the next 20 years&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">2</span></a> According to data from the International Diabetes Federation&#44; 12&#46;8&#37; of the adult population of Turkey suffer from diabetes and there were over 6&#46;7 million cases in 2017&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Type 2 diabetes mellitus &#40;T2DM&#41; usually causes both microvascular and macrovascular complications&#46; Diabetic nephropathy &#40;DN&#41; is a late and one of the major chronic complication of T2DM and finally progresses to end-stage renal disease &#40;ESRD&#41; with multifactorial pathogenesis and the mechanism has not been fully understood&#46;<a class="elsevierStyleCrossRefs" href="#bib0225"><span class="elsevierStyleSup">4&#44;5</span></a> Increasing number of studies suggest that there is a link between hyperglycemia&#44; oxidative stress&#44; DNA damage and diabetic complications&#46;<a class="elsevierStyleCrossRefs" href="#bib0235"><span class="elsevierStyleSup">6&#8211;9</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">In recent years&#59; epidemiologic studies remark an association between many type of cancers &#40;such as colorectal&#44; liver&#44; bladder&#44; breast&#44; pancreas and renal cancer&#41; and T2DM&#46;<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">10&#8211;15</span></a> Increasing risk of cancer among diabetic patients may be linked with enhanced DNA damage and reduced DNA repair capacity&#46; Also&#44; DNA repair gene polymorphisms may modulate DNA repair capacity and affect predisposition to T2DM and its vascular complications&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">The X-ray repair cross-complementing group 3 &#40;<span class="elsevierStyleItalic">XRCC3</span>&#41; is a <span class="elsevierStyleItalic">RAD</span>51 family gene and encodes a protein that is participated in the homologous recombination repair of DNA double-strand breaks &#40;DSB&#41; to maintain chromosomal stability located on human chromosomes 14&#44; at 14q32&#46;3&#46;<a class="elsevierStyleCrossRefs" href="#bib0285"><span class="elsevierStyleSup">16&#44;17</span></a> T241M &#40;rs861539&#41;&#44; the most commonly investigated polymorphism of <span class="elsevierStyleItalic">XRCC3</span> gene consists of a C&#47;T transition leading to an amino acid substitution from Thr to Met at codon 241 and this substitution may result in DNA repair capacity change&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">18</span></a> On the other hand&#44; the other investigated gene X-ray repair cross-complementing group 1 &#40;<span class="elsevierStyleItalic">XRCC1</span>&#41; is located on chromosome 19&#44; at 19q13&#46;2 and encodes the XRCC1 protein which is a crucial enzyme that plays a series of coordinating role in stages of the base excision repair &#40;BER&#41; system due to its interactions with several proteins&#46; Fifty polymorphic regions have been identified for <span class="elsevierStyleItalic">XRCC1</span> gene and the most frequently studied genetic variant is Arg399Gln that consists of a G&#47;A transition leading to an amino acid substitution from Arg to Gln at codon 399&#46;<a class="elsevierStyleCrossRefs" href="#bib0300"><span class="elsevierStyleSup">19&#44;20</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">XRCC3</span> T241M and <span class="elsevierStyleItalic">XRCC1</span> A399G have been studied as risk factors for various cancer development in different populations&#46;<a class="elsevierStyleCrossRefs" href="#bib0310"><span class="elsevierStyleSup">21&#8211;25</span></a> However&#44; studies addressing the association of these polymorphisms with susceptibility to T2DM and the diabetic complications have been relatively rare&#46; Therefore&#44; aim of this study was to assess whether the T241M polymorphic variant of <span class="elsevierStyleItalic">XRCC3</span> gene and A399G polymorphic variant of <span class="elsevierStyleItalic">XRCC1</span> gene are associated with susceptibility to T2DM and DN in Turkish population&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Study population</span><p id="par0030" class="elsevierStylePara elsevierViewall">The study population consisted of total 238 subjects from Istanbul&#47;Turkey &#40;age ranged between 23 and 83 years&#41;&#44; including 116 patients with T2DM &#40;77 females and 39 males&#41;&#44; 50 patients with DN &#40;15 females and 35 males&#41; and 72 healthy volunteer with normal glucose metabolism &#40;51 females and 21 males&#41;&#46; Newly diagnosed T2DM or DN patients were not included in the study for accuracy&#39;s sake&#46; Therefore&#44; patients had been under therapy at least 1 year during the sample collection as indicated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; Diagnosis of diabetes was made according to the American Diabetes Association<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">26</span></a> criteria &#40;fasting glucose &#8805;126<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#59; HbA1C &#8805;6&#46;5&#37;&#41; in Diabetology Outpatient Department of Haydarpasa Numune Training and Research Hospital&#46; Blood samples from DN patients were collected during their routine control in the clinic by checking their at least two previous 24<span class="elsevierStyleHsp" style=""></span>h urinary albumin excretion &#40;UAE&#41; records and estimated glomerular filtration rate &#40;eGFR mL&#47;min&#41; within 6 months&#46; Patients with UAE<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>30<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#44; 30&#8211;299<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h and &#8805;300<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h have been classified normoalbuminuria&#44; microalbuminuria and macroalbuminuria&#44; respectively&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">27</span></a> According to the latest records&#44; patients&#44; who had microalbuminuria &#40;30&#46;6&#8211;295&#46;2<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; mean 137&#46;55<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>23&#41;&#44; macroalbuminuria &#40;309&#46;96&#8211;5876<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; mean 1442&#46;07<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>16 &#40;4 of 16 was also dialysis patients&#41;&#41; and normoalbuminuria with eGFR<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>60<span class="elsevierStyleHsp" style=""></span>mL&#47;min&#47;1&#46;73<span class="elsevierStyleHsp" style=""></span>m<span class="elsevierStyleSup">2</span> 1&#46;77&#8211;27<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; mean 13&#46;29<span class="elsevierStyleHsp" style=""></span>mg&#47;24<span class="elsevierStyleHsp" style=""></span>h&#59; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>11&#41; were diagnosed with diabetic nephropathy&#46; eGFR mL&#47;min of DN patients were calculated using the Cockroft&#8211;Gault equation via current serum creatinine levels &#40;creatinine clearance &#40;ml&#47;min&#41;<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>&#91;&#40;140<span class="elsevierStyleHsp" style=""></span>&#8722;<span class="elsevierStyleHsp" style=""></span>age &#40;years&#41;&#93;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>weight &#40;kg&#41;&#47;&#91;72<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>serum creatinine &#40;mg&#47;dl&#41;<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>&#40;0&#46;85 if female&#41;&#93;&#59; <a id="intr0005" class="elsevierStyleInterRef" href="https://www.kidney.org/professionals/KDOQI/gfr_calculatorCoc">https&#58;&#47;&#47;www&#46;kidney&#46;org&#47;professionals&#47;KDOQI&#47;gfr&#95;calculatorCoc</a>&#41; and DN was classified into stages &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; The Research protocol was approved by The Ethical Committee of Marmara University Institute of Health Sciences in accordance with the Declaration of Helsinki &#40;ID number&#58; 02&#46;05&#46;2014-7&#41; and written informed consent was obtained from each subject before collecting blood samples&#46; Also&#44; participants answered the standardized health questionnaires relating to family history of T2DM&#44; accompanying diseases&#44; behavioral and lifestyle factors such as smoking&#44; antioxidant usage&#44; etc&#46; as shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Determination of XRCC3 T241M and XRCC1 A399G polymorphisms</span><p id="par0035" class="elsevierStylePara elsevierViewall">Genomic DNA was extracted from peripheral blood lymphocytes by PureLink<span class="elsevierStyleSup">&#174;</span> Genomic DNA Mini Kit&#44; Invitrogen&#44; USA&#46; Polymerase chain reaction-based restriction fragment length polymorphism &#40;PCR-RFLP&#41; was performed to identify the distribution of genotypes and frequency of alleles of <span class="elsevierStyleItalic">XRCC3</span> T241M &#40;rs861539&#41; and <span class="elsevierStyleItalic">XRCC1</span> A399G &#40;rs25487&#41;&#46; The 20<span class="elsevierStyleHsp" style=""></span>&#956;l PCR mix consisted of 10<span class="elsevierStyleHsp" style=""></span>ng genomic DNA&#44; 250<span class="elsevierStyleHsp" style=""></span>&#956;M dNTP mix&#44; 1&#215; PCR buffer&#44; 0&#46;5<span class="elsevierStyleHsp" style=""></span>pmol from each primer&#44; 3&#46;75<span class="elsevierStyleHsp" style=""></span>mM MgCl<span class="elsevierStyleInf">2</span>&#44; 2&#46;5<span class="elsevierStyleHsp" style=""></span>U Taq DNA polymerase &#40;Thermo Scientific&#8482;&#41; and PCR reactions were carried out by thermal cycler &#40;Cleaver Scientific Ltd&#44; model GTC96S&#41;&#46; PCR-RFLP procedures are summarized in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a> in detail with thermal cycling conditions&#44; the primer sequences&#44;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">25</span></a> annealing temperatures and restriction enzymes&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Statistical analysis</span><p id="par0040" class="elsevierStylePara elsevierViewall">Each group was evaluated for Hardy&#8211;Weinberg equilibrium &#40;HWE&#41; by Chi-square test&#46; Descriptive statistics are presented via mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>standard deviation for continuous variables and frequencies &#40;&#37;&#41; for categorical variables&#46; The normal distribution of continuous variables was tested by Shapiro&#8211;Wilk&#39;s test&#46; The mean values were compared by Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test &#40;between two groups&#41; and Kruskal&#8211;Wallis test &#40;between three groups&#41;&#46; Pearson Chi-square or Fisher&#39;s exact Chi-square test was used for categorical variables&#46; In addition&#44; the association of <span class="elsevierStyleItalic">XRCC3</span> T241M&#44; <span class="elsevierStyleItalic">XRCC1</span> A399G and other covariates with T2DM and DN was analyzed by multiple logistic regression &#40;MLR&#41; by computing odds ratio &#40;OR&#41; and their respective 95&#37; confidence interval &#40;<span class="elsevierStyleItalic">CI</span>&#41; after adjusting for potential confounding variables &#40;as described in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>&#41;&#46; <span class="elsevierStyleItalic">XRCC3</span> T241M&#44; <span class="elsevierStyleItalic">XRCC1</span> A399G and assumed risk factors were analyzed by multiple logistic regression accepting as T2DM<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>DN groups as a dependent variable and other factors as independent variables to evaluate presence of T2DM &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41; and DN group as a dependent variable to evaluate presence of DN &#40;<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>&#41;&#46; A two tailed <span class="elsevierStyleItalic">p</span>-value of &#60;0&#46;05 was considered statistically significant&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia><elsevierMultimedia ident="tbl0025"></elsevierMultimedia></span></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Results</span><p id="par0045" class="elsevierStylePara elsevierViewall">The demographic and clinical characteristics &#40;body mass &#305;ndex &#8211; BMI&#44; family history of T2DM&#44; accompanying diseases&#44; smoking status and antioxidant usage&#44; etc&#46;&#41; of each participant has been questioned in detail and presented in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; Serum creatinine &#40;mg&#47;dl&#41; levels of T2DM patients with DN were significantly higher than T2DM patients without DN as demonstrated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a> with all other clinical characteristics&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">Genotype distribution of <span class="elsevierStyleItalic">XRCC3</span> T241M among T2DM patients were in accordance with HWE&#44; however&#44; DN patients and subjects with normal glucose metabolism deviated significantly from expected HWE&#46; Otherwise&#44; genotype distribution of <span class="elsevierStyleItalic">XRCC1</span> A399G was not in accordance with HWE among all groups&#46; Allele frequency distributions of genes among groups were evaluated&#46; The percentage of polymorphic Met allele &#40;CT<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>TT&#41; distribution of <span class="elsevierStyleItalic">XRCC3</span> gene was observed 52&#46;6&#37; for T2DM&#44; 48&#37; for DN and 40&#46;3&#37; for normal glucose metabolism and there was no statistically significant difference between groups &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; However&#44; statistically significant difference &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41; between groups was observed for polymorphic Gln allele &#40;GA<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>AA&#41; distribution of <span class="elsevierStyleItalic">XRCC1</span> gene &#40;66&#46;4&#37; for T2DM&#44; 78&#37; for DN and 45&#46;8&#37; for normal glucose metabolism&#41;&#46; Followed by univariate and multivariate analysis&#59; the association between disease risk and <span class="elsevierStyleItalic">XRCC1</span> gene allele frequency is shown by odd ratios in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">XRCC3</span> T241M had no significant impact on T2DM or DN development &#40;OR 1&#46;56&#44; 95&#37;<span class="elsevierStyleItalic">CI</span> 0&#46;89&#8211;2&#46;73 and OR 0&#46;83 95&#37; <span class="elsevierStyleItalic">CI</span> 0&#46;43&#8211;1&#46;67&#44; respectively&#41;&#46; However&#44; polymorphic 399Gln variant of <span class="elsevierStyleItalic">XRCC1</span> was found to be related with increased T2DM &#40;OR 3&#46;09&#44; 95&#37; <span class="elsevierStyleItalic">CI</span> 1&#46;14&#8211;8&#46;40&#41; and DN &#40;OR 3&#46;29&#44; 95&#37; <span class="elsevierStyleItalic">CI</span> 1&#46;23&#8211;8&#46;80&#41; risk&#46; According to MLR results&#44; male sex &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#44; age &#8805;45 years &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#44; BMI<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>25 &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; and family history &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; demonstrated a significant association with T2DM&#46; Also&#44; male sex &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#44; age &#8805;65 &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; and duration of T2DM more than 10 years had a significant association with DN as demonstrated in <a class="elsevierStyleCrossRefs" href="#tbl0020">Tables 4 and 5</a>&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a> shows the combined effects of <span class="elsevierStyleItalic">XRCC1</span> A399G and <span class="elsevierStyleItalic">XRCC3</span> T241M in T2DM and DN risk&#46; For this purpose&#44; all diabetic patients &#40;group 1<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>group 2&#41; were compared with healthy donors &#40;group 3&#41; to evaluate combined effects of genes on T2DM and in addition diabetic patients with DN &#40;group 2&#41; were compared with diabetic patients without DN &#40;group 1&#41; to evaluate combined effects of genes on DN&#46; The wildtype genotype of each gene was taken as reference to analyze the combined effect of <span class="elsevierStyleItalic">XRCC1</span> A399G and <span class="elsevierStyleItalic">XRCC3</span> T241M genotypes&#46; Met allele of <span class="elsevierStyleItalic">XRCC3</span> gene and Gln allele of <span class="elsevierStyleItalic">XRCC1</span> gene were found to increase T2DM risk synergistically &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#44; OR 4&#46;11&#44; 95&#37; CI 1&#46;84&#8211;9&#46;23&#41;&#46; On the other hand&#44; Thr allele of <span class="elsevierStyleItalic">XRCC3</span> gene and Gln allele of <span class="elsevierStyleItalic">XRCC1</span> gene were associated with a joint effect on DN risk &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#44; OR 5&#46;11&#44; 95&#37; CI 1&#46;37&#8211;19&#46;11&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0030"></elsevierMultimedia></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Discussion</span><p id="par0065" class="elsevierStylePara elsevierViewall">DM is one of the most common metabolic diseases&#44; the incidence of DM and its complications is increasing day by day&#46; With regard to future of public health and health economics&#44; it is necessary to develop emerging rationale strategies to manage and prevent the disease&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">Reported studies suggest that oxidative stress&#44; DNA damage and inefficient repair may play a crucial role for progression and severity of diabetes and trigger complications&#46;<a class="elsevierStyleCrossRefs" href="#bib0240"><span class="elsevierStyleSup">7&#44;9&#44;28&#8211;30</span></a> In addition&#44; epidemiologic studies remark an increased risk of cancer among patients with T2DM&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">31</span></a> Therefore&#44; this study clarifies susceptibility to T2DM and DN with <span class="elsevierStyleItalic">XRCC3</span> T241M and <span class="elsevierStyleItalic">XRCC1</span> A399G&#46; To the best of our knowledge&#44; this is the first study that investigates the association between T241M polymorphism of <span class="elsevierStyleItalic">XRCC3</span> gene and T2DM and DN in T2DM patients&#46; Our results suggest T241M polymorphic variant of <span class="elsevierStyleItalic">XRCC3</span> gene is not associated with an increased susceptibility to T2DM or DN in the studied population&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">Comparison of allele frequency of <span class="elsevierStyleItalic">XRCC1</span> gene among groups &#40;1&#44; 2 and 3&#41; showed statistically significant differences&#46; Polymorphic 399 Gln variant of <span class="elsevierStyleItalic">XRCC1</span> gene seems to increase T2DM and DN risk as evaluated by MLR analysis&#46; Our data are consistent with previous findings of Majsterek et al&#46; in which susceptibility were reported in T2DM and diabetic retinopathy&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">32</span></a> However&#44; in contrast to our results&#44; no association have been reported by Kasznicki et al&#46; between 399Gln polymorphism of <span class="elsevierStyleItalic">XRCC1</span> gene and T2DM<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">33</span></a> and by Narne et al&#46; between 399Gln polymorphism of <span class="elsevierStyleItalic">XRCC1</span> gene and DN&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">34</span></a> Besides&#44; a number of studies reported relationship between A399G polymorphism of <span class="elsevierStyleItalic">XRCC1 gene</span> and other vascular complications of T2DM&#44; association between 399Gln allele and diabetic retinopathy&#44; coronary artery disease in T2DM and severity of these complications&#46;<a class="elsevierStyleCrossRefs" href="#bib0365"><span class="elsevierStyleSup">32&#44;35&#44;36</span></a> As DN is a major cause of ESRD&#44; we directed our research to reported studies related with A399G polymorphism in ESRD patients&#46; In 2012&#44; Trabulus et al&#46; studied ESRD risk in Turkish population and reported that 399Gln variant had an association with an increased ESRD risk&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">19</span></a> Same observation have been reported by Radwan et al&#46; in 2015 that 399Gln variant leads to ESRD risk in Egyptian population&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">37</span></a> In addition&#44; DNA BER pathway gene OGG1 polymorphism have been studied by G&#246;n&#252;l et al<span class="elsevierStyleItalic">&#46;</span> and a significant association have been reported in Turkish diabetes mellitus patients&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">37</span></a></p><p id="par0080" class="elsevierStylePara elsevierViewall">In this study&#44; Met allele of <span class="elsevierStyleItalic">XRCC3</span> gene and Gln allele of <span class="elsevierStyleItalic">XRCC1</span> gene were found to increase T2DM risk synergistically&#46; On the other hand&#44; Thr allele of <span class="elsevierStyleItalic">XRCC3</span> gene and Gln allele of <span class="elsevierStyleItalic">XRCC1</span> gene had a joint effect on DN risk&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">Both polymorphisms had no statistical significant association with Hb1Ac levels of T2DM patients with&#47;without DN &#40;data not shown&#41;&#46; These findings suggest that there is no relationship between hyperglycemic state and polymorphisms of related DNA repair genes&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">Several studies have evaluated the expressions of DNA repair genes in T2DM and vascular complications but results are inconsistent&#46; Certain studies report downregulation of selected DNA repair genes&#44; others speculate an upregulation in consideration of increased DNA damage level in T2DM&#46;<a class="elsevierStyleCrossRefs" href="#bib0395"><span class="elsevierStyleSup">38&#44;39</span></a></p><p id="par0095" class="elsevierStylePara elsevierViewall">This manuscript with limited sample size focuses on 2 main genes that encode proteins which are considered to play major role in homolog recombination of DSB and BER pathways&#46; Confounding factors have been controlled by MLR due to different distribution of variables such as age&#44; BMI&#44; sex and our findings are consistent with reported literatures&#46;<a class="elsevierStyleCrossRefs" href="#bib0405"><span class="elsevierStyleSup">40&#44;41</span></a> Interestingly&#44; although the current smoking had no impact on developing DN risk&#44; the former smokers were found at high risk &#40;<a class="elsevierStyleCrossRefs" href="#tbl0010">Tables 2 and 3</a>&#41; which may relate to patients quitting smoking after diagnosis&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">In conclusion&#44; we believe that further studies are needed to evaluate the expressions of DNA repair genes and epigenetic modifications&#44; that may be useful to elucidate association between diabetes and cancer also the mechanism underlying the increased DNA damage and inefficient repair in T2DM&#46; The results of our study suggest that 399Gln polymorphic variant of <span class="elsevierStyleItalic">XRCC1</span> may increase T2DM and DN risk&#46; On the other hand&#44; genotype distribution of <span class="elsevierStyleItalic">XRCC1</span> A399G among all groups were not in accordance with HWE&#44; further meta-analysis of gene-disease studies are needed to clarify whether deviation from HWE affects the situation&#46; Therefore&#44; these findings need to be confirmed in different population with larger sample size&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:3 [
          "identificador" => "xres1140504"
          "titulo" => "Abstract"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results and conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1071774"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1140503"
          "titulo" => "Resumen"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Materiales y m&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Resultados y conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1071773"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study population"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Determination of XRCC3 T241M and XRCC1 A399G polymorphisms"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0030"
          "titulo" => "Results"
        ]
        7 => array:2 [
          "identificador" => "sec0035"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "xack388447"
          "titulo" => "Acknowledgement"
        ]
        9 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2018-02-21"
    "fechaAceptado" => "2018-08-28"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1071774"
          "palabras" => array:6 [
            0 => "Type 2 diabetes mellitus"
            1 => "Diabetic nephropathy"
            2 => "<span class="elsevierStyleItalic">XRCC3</span> T241M"
            3 => "rs861539"
            4 => "<span class="elsevierStyleItalic">XRCC1</span> A399G"
            5 => "rs25487"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1071773"
          "palabras" => array:6 [
            0 => "Diabetes mellitus de tipo 2"
            1 => "Nefropat&#237;a diab&#233;tica"
            2 => "<span class="elsevierStyleItalic">XRCC3</span> T241M"
            3 => "rs861539"
            4 => "<span class="elsevierStyleItalic">XRCC1</span> A399G"
            5 => "rs25487"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Increasing number of experimental and clinical studies suggest a strong relationship between hyperglycemia&#44; oxidative stress&#44; DNA damage and diabetic nephropathy &#40;DN&#41;&#46; Also&#44; epidemiologic studies remark an enhanced risk of cancer with type 2 diabetes&#46; This research aims to assess whether the X-ray cross complementing group 3 &#40;<span class="elsevierStyleItalic">XRCC3</span>&#41; gene T241M polymorphism &#40;rs861539&#41; and X-ray cross complementing group 1 &#40;<span class="elsevierStyleItalic">XRCC1</span>&#41; gene A399G polymorphism &#40;rs25487&#41; are related with predisposition to type 2 diabetes mellitus &#40;T2DM&#41; and to diabetic nephropathy in Turkish population&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Polymerase chain reaction-based restriction fragment length polymorphism &#40;PCR-RFLP&#41; was performed to identify the distribution of genotypes and frequency of alleles of T241M polymorphism of the <span class="elsevierStyleItalic">XRCC3</span> gene &#40;<span class="elsevierStyleItalic">XRCC3</span> T241M&#41; and A399G polymorphism of the <span class="elsevierStyleItalic">XRCC1</span> gene &#40;<span class="elsevierStyleItalic">XRCC1</span> A399G&#41;&#46; The study population included 238 subjects residing in Istanbul&#44; Turkey&#59; 116 with T2DM&#44; 50 with DN and 72 with normal glucose metabolism&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results and conclusion</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Polymorphic Gln allele of <span class="elsevierStyleItalic">XRCC1</span> gene was significantly related with T2DM and DN &#40;OR 3&#46;09&#44; 95&#37; <span class="elsevierStyleItalic">CI</span> 1&#46;14&#8211;8&#46;40 and OR 3&#46;29 95&#37; <span class="elsevierStyleItalic">CI</span> 1&#46;23&#8211;8&#46;80&#44; respectively&#41; however&#44; there was no statistical association of <span class="elsevierStyleItalic">XRCC3</span> T241M with T2DM or DN&#46; The results of this study suggest that <span class="elsevierStyleItalic">XRCC1</span> 399Gln polymorphism is related with an increased susceptibility to T2DM and DN in the studied Turkish population&#46;</p></span>"
        "secciones" => array:3 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results and conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Introducci&#243;n</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Un n&#250;mero creciente de estudios experimentales y cl&#237;nicos sugiere una s&#243;lida relaci&#243;n entre hiperglucemia&#44; estr&#233;s oxidativo&#44; da&#241;o en el ADN y nefropat&#237;a diab&#233;tica &#40;ND&#41;&#46; Adem&#225;s&#44; los estudios epidemiol&#243;gicos advierten mayor riesgo de c&#225;ncer con diabetes de tipo 2&#46; Esta investigaci&#243;n tiene como objetivo evaluar si el polimorfismo del gen T241M del grupo 3 &#40;<span class="elsevierStyleItalic">XRCC3</span>&#41; complementario cruzado de rayos X &#40;rs861539&#41; y el polimorfismo del gen A399G del grupo 1 &#40;<span class="elsevierStyleItalic">XRCC1</span>&#41; complementario cruzado de rayos X &#40;rs25487&#41; est&#225;n relacionados con la predisposici&#243;n a la diabetes mellitus de tipo 2 &#40;DM2&#41; y a la nefropat&#237;a diab&#233;tica en la poblaci&#243;n turca&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Materiales y m&#233;todos</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Se realiz&#243; un polimorfismo de longitud de fragmento de restricci&#243;n basado en la reacci&#243;n en cadena de la polimerasa &#40;PCR-RFLP&#41; para identificar la distribuci&#243;n de genotipos y la frecuencia de los alelos del polimorfismo T241M del gen <span class="elsevierStyleItalic">XRCC3</span> &#40;<span class="elsevierStyleItalic">XRCC3</span> T241M&#41; y el polimorfismo A399G del gen <span class="elsevierStyleItalic">XRCC1</span>&#40;<span class="elsevierStyleItalic">XRCC1</span> A399G&#41;&#46; La poblaci&#243;n de estudio incluy&#243; a 238 individuos que resid&#237;an en Estambul&#44; Turqu&#237;a&#59; 116 de ellos con DM2&#44; 50 con ND y 72 con metabolismo de la glucosa normal&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Resultados y conclusi&#243;n</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">El alelo Gln polim&#243;rfico del gen <span class="elsevierStyleItalic">XRCC1</span> se relacion&#243; de manera importante con DM2 y ND &#40;OR&#58; 3&#44;09&#59; IC95&#37;&#58; 1&#44;14-8&#44;40 y OR&#58; 3&#44;29&#59; IC95&#37;&#58;1&#44;23-8&#44;80&#44; respectivamente&#41;&#46; Sin embargo&#44; no hubo asociaci&#243;n estad&#237;stica de <span class="elsevierStyleItalic">XRCC3</span> T241M con DM2 o ND&#46; Los resultados de este estudio sugieren que el polimorfismo <span class="elsevierStyleItalic">XRCC1</span> 399Gln est&#225; relacionado con un aumento de la susceptibilidad a la DM2 y a la ND en la poblaci&#243;n turca estudiada&#46;</p></span>"
        "secciones" => array:3 [
          0 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Materiales y m&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Resultados y conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:6 [
      0 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristics&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 &#40;Type 2 diabetes mellitus <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>116&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 &#40;diabetic nephropathy <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">Duration of T2DM &#40;years&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">10&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8 &#40;1&#8211;45&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">15&#46;28<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;79<br>&#40;2&#8211;45&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleItalic">Retinopathy</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">16 &#40;13&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">10 &#40;20&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">100 &#40;86&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">40 &#40;80&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleItalic">Neuropathy</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">9 &#40;7&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5 &#40;10&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">107 &#40;92&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">45 &#40;90&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">Fasting blood glucose &#40;mg&#47;dl&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">168&#46;76<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>60&#46;64 &#40;79&#8211;415&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">207&#46;82<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>110&#46;74 &#40;94&#8211;748&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">Hb1Ac</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">7&#46;79<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;65 &#40;5&#46;1&#8211;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">8&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2&#46;1 &#40;5&#46;9&#8211;14&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">Serum creatinine &#40;mg&#47;dl&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;79<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;13 &#40;0&#46;58&#8211;1&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;38<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;68 &#40;0&#46;67&#8211;6&#46;92&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="4" align="left" valign="top"><span class="elsevierStyleItalic">Diabetic Nephropathy stages</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Stage 1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">11 &#40;22&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Stage2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">7 &#40;14&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Stage3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">16 &#40;32&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Stage 4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">12 &#40;24&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Stage 5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">4 &#40;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946217.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Clinical characteristics of diabetic subjects&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 &#40;type 2 diabetes mellitus <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>116&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 &#40;diabetic nephropathy <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 3 &#40;normal glucose metabolism <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>72&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">77 &#40;66&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">15 &#40;30&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">51 &#40;70&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">39 &#40;33&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">35 &#40;70&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">21 &#40;29&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">56&#46;96<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;96 &#40;36&#8211;83&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">63&#46;49<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>9&#46;72 &#40;37&#8211;83&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">36&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;6 &#40;23&#8211;64&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Weight &#40;kg&#44; mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">83&#46;05<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>13&#46;59&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">83&#46;40<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>19&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">66&#46;46<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;97&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI &#40;kg&#47;m<span class="elsevierStyleSup">2</span>&#44; mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">31&#46;88<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>5&#46;87&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">30&#46;11<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>6&#46;95&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">23&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;73&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Family history of Diabetes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">87 &#40;75&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">36 &#40;73&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">41 &#40;57&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Cardiovascular disease&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">23 &#40;19&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">27 &#40;54&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1 &#40;1&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Hypertension&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">52 &#40;44&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">36 &#40;72&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">4 &#40;5&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Hyperlipidemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">34 &#40;29&#46;34&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">9 &#40;18&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1 &#40;1&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thyroid disorder&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">16 &#40;13&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">6 &#40;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Smoking</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non-smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">63 &#40;54&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">18 &#40;36&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">42 &#40;59&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Current Smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">16 &#40;13&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">6 &#40;12&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">17 &#40;23&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Former smoker&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">36 &#40;31&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">25 &#40;51&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">12 &#40;16&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Antioxidant</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non-users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">91 &#40;79&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">39 &#40;79&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">57 &#40;80&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">24 &#40;20&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">10 &#40;20&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">14 &#40;19&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946213.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Demographic and clinical characteristics of each group&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">F&#58; forward primer&#59; R&#58; reverse primer&#59; W&#58; wild genotype&#59; H&#58; heterozygous genotype&#59; P&#58; polymorphic genotype&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Gene and polymorphic region&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Primers and annealing temperature</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PCR product &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Restriction Enzyme and condition&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Restriction products &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Genotypes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry  " rowspan="3" align="left" valign="top"><span class="elsevierStyleItalic">XRCC3</span> exon 7&#46; T&#47;C Thr241Met &#40;rs861539&#41;</td><td class="td" title="table-entry  " align="left" valign="top">F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#8242;GGTCGAGTGACAGTCCAAAC3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top">456</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top">Hin1II &#40;NlaIII&#41;<br>37<span class="elsevierStyleHsp" style=""></span>&#176;C<br>30<span class="elsevierStyleHsp" style=""></span>min</td><td class="td" title="table-entry  " align="left" valign="top">CC 316&#47;140&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">W&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top"><a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">25</span></a></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#8242;TGCAACGGCTGAGGGTCTT3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">TC 316&#47;211&#47;140&#47;105&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">H&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">AT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">64<span class="elsevierStyleHsp" style=""></span>&#176;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">TT 211&#47;140&#47;105&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">P&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " rowspan="3" align="left" valign="top"><span class="elsevierStyleItalic">XRCC1</span> exon 10<span class="elsevierStyleHsp" style=""></span>G&#47;A Arg399Gln &#40;rs25487&#41;</td><td class="td" title="table-entry  " align="left" valign="top">F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#8242;TCTGTCTCCCCTGTCTCGTT3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top">239 bp</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top">Hpa II &#40;Msp I&#41;<br>37<span class="elsevierStyleHsp" style=""></span>&#176;C<br>30<span class="elsevierStyleHsp" style=""></span>min</td><td class="td" title="table-entry  " align="left" valign="top">GG 187&#47;52&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">W&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " rowspan="3" align="left" valign="top"><a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">25</span></a></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#8242;ATTGCCCAGCACAGGATAAG3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">GA 239&#47;187&#47;52&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">H&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">AT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">63<span class="elsevierStyleHsp" style=""></span>&#176;C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">AA 239&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">P&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " rowspan="3" align="left" valign="top">thermal cycling conditions</td><td class="td" title="table-entry  " colspan="7" align="left" valign="top">Step 1 &#40;initial denaturation&#41;&#58; 4<span class="elsevierStyleHsp" style=""></span>min 94<span class="elsevierStyleHsp" style=""></span>&#176;C</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="7" align="left" valign="top">Step 2 &#40;annealing-synthesis&#41;&#58; 33 cycles 30<span class="elsevierStyleHsp" style=""></span>s 94<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; 1<span class="elsevierStyleHsp" style=""></span>min 64&#47;63<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; 1<span class="elsevierStyleHsp" style=""></span>min 72<span class="elsevierStyleHsp" style=""></span>&#176;C</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="7" align="left" valign="top">Step 3 &#40;final extension&#41;&#58; 10<span class="elsevierStyleHsp" style=""></span>min 73<span class="elsevierStyleHsp" style=""></span>&#176;C</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946216.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Summary of PCR-RFLP assay&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " colspan="5" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Presence of T2DM</th></tr><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate <span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate OR &#40;&#37;95 <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate <span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate OR &#40;&#37;95 <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;95 &#40;1&#46;08&#8211;3&#46;54&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;74 &#40;1&#46;33&#8211;10&#46;52&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Age &#40;years&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#60;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#8805;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">43&#46;36 &#40;19&#46;42&#8211;96&#46;85&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">44&#46;43 &#40;15&#46;17&#8211;130&#46;15&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">BMI &#40;kg&#47;m</span><span class="elsevierStyleSup"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>BMI<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>BMI<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">12&#46;98 &#40;6&#46;54&#8211;25&#46;79&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">10&#46;22 &#40;3&#46;53&#8211;29&#46;63&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Family history</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;20 &#40;1&#46;22&#8211;3&#46;96&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">6&#46;23 &#40;2&#46;15&#8211;18&#46;07&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Smoking</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non-smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Current smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;67 &#40;0&#46;32&#8211;1&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Former smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;64 &#40;1&#46;28&#8211;5&#46;43&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Antioxidant</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non-users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;07 &#40;0&#46;53&#8211;2&#46;14&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">XRCC3 T241M</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Thr</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Met</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;56 &#40;0&#46;89&#8211;2&#46;73&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">XRCC1 A399G</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Arg</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Gln</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;74 &#40;1&#46;55&#8211;4&#46;85&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;09 &#40;1&#46;14&#8211;8&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946215.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Univariate and multivariate analysis for the association between type 2 diabetes mellitus &#40;T2DM&#41; and <span class="elsevierStyleItalic">XRCC3</span> T241M polymorphism&#44; <span class="elsevierStyleItalic">XRCC1</span> A399G polymorphism and other putative risk factors&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0025"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at5"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " colspan="5" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Presence of DN</th></tr><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristic&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate <span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Univariate OR &#40;&#37;95 <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate <span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Multivariate OR &#40;&#37;95 <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Male sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">4&#46;61 &#40;2&#46;25&#8211;9&#46;44&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#46;39 &#40;2&#46;28&#8211;12&#46;74&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Age &#40;years&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#8804;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>46&#8211;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;51 &#40;0&#46;43&#8211;28&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;99 &#40;0&#46;35&#8211;25&#46;89&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#8805;65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">13&#46;71 &#40;1&#46;64&#8211;114&#46;53&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">11&#46;31 &#40;1&#46;25&#8211;102&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">BMI &#40;kg&#47;m</span><span class="elsevierStyleSup"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>BMI<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>BMI<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;41 &#40;0&#46;16&#8211;1&#46;09&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Duration of T2DM</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#8804;5 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>6&#8211;10 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;74 &#40;0&#46;59&#8211;5&#46;14&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;243&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;07 &#40;0&#46;61&#8211;7&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>&#62;10 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;58 &#40;1&#46;33&#8211;9&#46;65&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;37 &#40;1&#46;09&#8211;10&#46;38&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Family history</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;89 &#40;0&#46;42&#8211;1&#46;91&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Smoking</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non-smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Current Smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;31 &#40;0&#46;45&#8211;3&#46;84&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Former smokers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;43 &#40;1&#46;17&#8211;5&#46;05&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">Antioxidant</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Non users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span>Users&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;97 &#40;0&#46;43&#8211;2&#46;22&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">XRCC3 T241M</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Thr</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Met</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;83&#40;0&#46;43&#8211;1&#46;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic">XRCC1 A399G</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Arg</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Gln</span> allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;8 &#40;0&#46;83&#8211;3&#46;89&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;29 &#40;1&#46;23&#8211;8&#46;80&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946212.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Univariate and multivariate analysis for the association between diabetic nephropathy &#40;DN&#41; and <span class="elsevierStyleItalic">XRCC3</span> T241M polymorphism&#44; <span class="elsevierStyleItalic">XRCC1</span> A399G polymorphism and other putative risk factors&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0030"
        "etiqueta" => "Table 6"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at6"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:2 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col"><span class="elsevierStyleItalic">XRCC3</span> Thr241Met&#46; &#38; <span class="elsevierStyleItalic">XRCC1</span> Arg399Gln&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="4" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Risk of T2DM</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Group 2 &#40;T2DM<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>DN&#41;<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>166&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 3 &#40;NM&#41;<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>72&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR &#40;95&#37; <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel&#46; Arg allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">25 &#40;15&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">24 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel&#46; Gln allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">56 &#40;33&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">19 &#40;26&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;83 &#40;1&#46;32&#8211;6&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel&#46; Arg allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">25 &#40;15&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">15 &#40;20&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">1&#46;6 &#40;0&#46;69&#8211;3&#46;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel&#46; Gln allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">60 &#40;36&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">14 &#40;19&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">4&#46;11 &#40;1&#46;84&#8211;9&#46;23&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946218.png"
              ]
            ]
            1 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col"><span class="elsevierStyleItalic">XRCC</span>3 Thr241Met&#46; &#38; <span class="elsevierStyleItalic">XRCC1</span> Arg399Gln&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="4" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Risk of DN</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 1 &#40;T2DM&#41;<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>116&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group 2 &#40;DN&#41;<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR &#40;95&#37; <span class="elsevierStyleItalic">CI</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel&#46; Arg allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">22 &#40;19&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr allel&#46; Gln allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">33 &#40;28&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">23 &#40;46&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">5&#46;11 &#40;1&#46;37&#8211;19&#46;11&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel&#46; Arg allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">17 &#40;14&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8 &#40;16&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">3&#46;45 &#40;0&#46;79&#8211;15&#46;01&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met allel&#46; Gln allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">44 &#40;37&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">16 &#40;32&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#62;0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2&#46;67 &#40;0&#46;70&#8211;10&#46;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1946214.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Combined effect of <span class="elsevierStyleItalic">XRCC3</span> Thr241Met and <span class="elsevierStyleItalic">XRCC1</span> Arg399Gln in T2DM and DN risk&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:41 [
            0 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnosis and classification of diabetes mellitus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "A&#46; American Diabetes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2337/dc10-S062"
                      "Revista" => array:7 [
                        "tituloSerie" => "Diabetes Care"
                        "fecha" => "2010"
                        "volumen" => "33"
                        "numero" => "Suppl&#46; 1"
                        "paginaInicial" => "S62"
                        "paginaFinal" => "S69"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20042775"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "WHO&#46; Global report on diabetes&#46; Available at&#58; <a id="intr0010" class="elsevierStyleInterRef" href="http://wwwwhoint/campaigns/world-health-day/2016/en/">http&#58;&#47;&#47;wwwwhoint&#47;campaigns&#47;world-health-day&#47;2016&#47;en&#47;</a> &#91;accessed 11&#46;01&#46;18&#93;&#46;"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "IDF&#46; Available at&#58; <a id="intr0015" class="elsevierStyleInterRef" href="https://wwwidforg/our-network/regions-members/europe/members/163-turkeyhtml">https&#58;&#47;&#47;wwwidforg&#47;our-network&#47;regions-members&#47;europe&#47;members&#47;163-turkeyhtml</a> &#91;accessed 11&#46;01&#46;18&#93;&#46;"
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetic nephropathy and inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;B&#46; Duran-Salgado"
                            1 => "A&#46;F&#46; Rubio-Guerra"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4239/wjd.v5.i3.393"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Diabetes"
                        "fecha" => "2014"
                        "volumen" => "5"
                        "paginaInicial" => "393"
                        "paginaFinal" => "398"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24936261"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes mellitus&#58; the linkage between oxidative stress&#44; inflammation&#44; hypercoagulability and vascular complications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46;P&#46; Domingueti"
                            1 => "L&#46;M&#46; Dusse"
                            2 => "M&#46;D&#46; Carvalho"
                            3 => "L&#46;P&#46; de Sousa"
                            4 => "K&#46;B&#46; Gomes"
                            5 => "A&#46;P&#46; Fernandes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diabetes Compl"
                        "fecha" => "2015"
                        "volumen" => "30"
                        "paginaInicial" => "738"
                        "paginaFinal" => "745"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Assessment of DNA strand breakage by comet assay in diabetic patients and the role of antioxidant supplementation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Sardas"
                            1 => "M&#46; Yilmaz"
                            2 => "U&#46; Oztok"
                            3 => "N&#46; Cakir"
                            4 => "A&#46;E&#46; Karakaya"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mutat Res"
                        "fecha" => "2001"
                        "volumen" => "490"
                        "paginaInicial" => "123"
                        "paginaFinal" => "129"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11342238"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Study of urinary 8-hydroxydeoxyguanosine as a biomarker of oxidative DNA damage in diabetic nephropathy patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "G&#46;W&#46; Xu"
                            1 => "Q&#46;H&#46; Yao"
                            2 => "Q&#46;F&#46; Weng"
                            3 => "B&#46;L&#46; Su"
                            4 => "X&#46; Zhang"
                            5 => "J&#46;H&#46; Xiong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jpba.2004.04.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Pharm Biomed Anal"
                        "fecha" => "2004"
                        "volumen" => "36"
                        "paginaInicial" => "101"
                        "paginaFinal" => "104"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15351053"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The oxidative stress status in diabetes mellitus and diabetic nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46;Z&#46; Pan"
                            1 => "L&#46; Zhang"
                            2 => "M&#46;Y&#46; Guo"
                            3 => "H&#46; Sui"
                            4 => "H&#46; Li"
                            5 => "W&#46;H&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00592-009-0128-1"
                      "Revista" => array:7 [
                        "tituloSerie" => "Acta Diabetol"
                        "fecha" => "2010"
                        "volumen" => "47"
                        "numero" => "Suppl&#46; 1"
                        "paginaInicial" => "71"
                        "paginaFinal" => "76"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19475334"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Parameters of oxidative stress&#44; DNA damage and DNA repair in type 1 and type 2 diabetes mellitus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Pacal"
                            1 => "J&#46; Varvarovska"
                            2 => "Z&#46; Rusavy"
                            3 => "S&#46; Lacigova"
                            4 => "R&#46; Stetina"
                            5 => "J&#46; Racek"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/13813455.2010.551135"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Physiol Biochem"
                        "fecha" => "2011"
                        "volumen" => "117"
                        "paginaInicial" => "222"
                        "paginaFinal" => "230"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21338322"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes and the risk for colorectal cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Erbach"
                            1 => "H&#46; Mehnert"
                            2 => "O&#46; Schnell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diabetes Compl"
                        "fecha" => "2012"
                        "volumen" => "26"
                        "paginaInicial" => "50"
                        "paginaFinal" => "55"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes mellitus as an independent risk factor for lung cancer&#58; a meta-analysis of observational studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;Y&#46; Lee"
                            1 => "I&#46; Jeon"
                            2 => "J&#46;M&#46; Lee"
                            3 => "J&#46;M&#46; Yoon"
                            4 => "S&#46;M&#46; Park"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejca.2013.02.025"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Cancer"
                        "fecha" => "2013"
                        "volumen" => "49"
                        "paginaInicial" => "2411"
                        "paginaFinal" => "2423"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23562551"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes mellitus increases the risk of bladder cancer&#58; an updated meta-analysis of observational studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Fang"
                            1 => "B&#46; Yao"
                            2 => "Y&#46; Yan"
                            3 => "H&#46; Xu"
                            4 => "Y&#46; Liu"
                            5 => "H&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/dia.2013.0131"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes Technol Ther"
                        "fecha" => "2013"
                        "volumen" => "15"
                        "paginaInicial" => "914"
                        "paginaFinal" => "922"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24180357"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The female breast and diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46; Gouveri"
                            1 => "N&#46; Papanas"
                            2 => "E&#46; Maltezos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.breast.2011.02.019"
                      "Revista" => array:6 [
                        "tituloSerie" => "Breast"
                        "fecha" => "2011"
                        "volumen" => "20"
                        "paginaInicial" => "205"
                        "paginaFinal" => "211"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21414785"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The relationship between new-onset diabetes mellitus and pancreatic cancer risk&#58; a case-control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q&#46; Ben"
                            1 => "Q&#46; Cai"
                            2 => "Z&#46; Li"
                            3 => "Y&#46; Yuan"
                            4 => "X&#46; Ning"
                            5 => "S&#46; Deng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejca.2010.07.010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Cancer"
                        "fecha" => "2011"
                        "volumen" => "47"
                        "paginaInicial" => "248"
                        "paginaFinal" => "254"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20709528"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes mellitus and incidence and mortality of kidney cancer&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Bao"
                            1 => "X&#46; Yang"
                            2 => "W&#46; Xu"
                            3 => "H&#46; Luo"
                            4 => "Z&#46; Xu"
                            5 => "C&#46; Su"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diabetes Compl"
                        "fecha" => "2013"
                        "volumen" => "27"
                        "paginaInicial" => "357"
                        "paginaFinal" => "364"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA repair gene polymorphisms&#44; bulky DNA adducts in white blood cells and bladder cancer in a case-control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Matullo"
                            1 => "S&#46; Guarrera"
                            2 => "S&#46; Carturan"
                            3 => "M&#46; Peluso"
                            4 => "C&#46; Malaveille"
                            5 => "L&#46; Davico"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Cancer"
                        "fecha" => "2001"
                        "volumen" => "92"
                        "paginaInicial" => "562"
                        "paginaFinal" => "567"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11304692"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46;B&#46; Ji"
                            1 => "Y&#46;S&#46; Qian"
                            2 => "A&#46;R&#46; Hu"
                            3 => "Y&#46;R&#46; Hu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4238/2015.December.7.11"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genet Mol Res"
                        "fecha" => "2015"
                        "volumen" => "14"
                        "paginaInicial" => "15988"
                        "paginaFinal" => "15996"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26662391"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Meta-analysis of the relationship between XRCC3 T241M polymorphism and colorectal cancer susceptibility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L&#46;Z&#46; Zhang"
                            1 => "Y&#46;S&#46; Li"
                            2 => "H&#46;Z&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4238/2015.November.18.48"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genet Mol Res"
                        "fecha" => "2015"
                        "volumen" => "14"
                        "paginaInicial" => "14831"
                        "paginaFinal" => "14839"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26600544"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Trabulus"
                            1 => "G&#46;S&#46; Guven"
                            2 => "M&#46;R&#46; Altiparmak"
                            3 => "B&#46; Batar"
                            4 => "O&#46; Tun"
                            5 => "A&#46;S&#46; Yalin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11033-012-1529-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Biol Rep"
                        "fecha" => "2012"
                        "volumen" => "39"
                        "paginaInicial" => "6995"
                        "paginaFinal" => "7001"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22302399"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of the 399Arg&#47;Gln XRCC1&#44; the 194 Arg&#47;Trp XRCC1&#44; the 326Ser&#47;Cys OGG1&#44; and the 324Gln&#47;His MUTYH gene polymorphisms with clinical parameters and the risk for development of primary open-angle glaucoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;P&#46; Szaflik"
                            1 => "M&#46; Cuchra"
                            2 => "K&#46; Przybylowska-Sygut"
                            3 => "L&#46; Dziki"
                            4 => "A&#46;K&#46; Kurowska"
                            5 => "M&#46; Gacek"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.mrgentox.2012.12.019"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mutat Res"
                        "fecha" => "2013"
                        "volumen" => "753"
                        "paginaInicial" => "12"
                        "paginaFinal" => "22"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23499241"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between XRCC3 Thr241Met polymorphism and nasopharyngeal carcinoma risk&#58; evidence from a large-scale case-control study and a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q&#46; Cui"
                            1 => "X&#46;Y&#46; Zuo"
                            2 => "Y&#46;F&#46; Lian"
                            3 => "Q&#46;S&#46; Feng"
                            4 => "Y&#46;F&#46; Xia"
                            5 => "C&#46;Y&#46; He"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s13277-016-5300-y"
                      "Revista" => array:6 [
                        "tituloSerie" => "Tumour Biol"
                        "fecha" => "2016"
                        "volumen" => "37"
                        "paginaInicial" => "14825"
                        "paginaFinal" => "21483"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27639382"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "XRCC3 Thr241Met polymorphism is not associated with lung cancer risk in a romanian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Catana"
                            1 => "M&#46; Pop"
                            2 => "D&#46;H&#46; Marginean"
                            3 => "I&#46;C&#46; Blaga"
                            4 => "M&#46;D&#46; Porojan"
                            5 => "R&#46;A&#46; Popp"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.15386/cjmed-523"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clujul Med"
                        "fecha" => "2016"
                        "volumen" => "89"
                        "paginaInicial" => "89"
                        "paginaFinal" => "93"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27004030"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between single nucleotide polymorphisms &#40;SNPs&#41; of XRCC2 and XRCC3 homologous recombination repair genes and ovarian cancer in Polish women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;M&#46; Michalska"
                            1 => "D&#46; Samulak"
                            2 => "H&#46; Romanowicz"
                            3 => "F&#46; Jablonski"
                            4 => "B&#46; Smolarz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.yexmp.2016.01.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Mol Pathol"
                        "fecha" => "2016"
                        "volumen" => "100"
                        "paginaInicial" => "243"
                        "paginaFinal" => "247"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26801223"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of the XPD and XRCC3 gene polymorphisms with oral squamous cell carcinoma in a Northeastern Brazilian population&#58; a pilot study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "J&#46; dos Santos Pereira"
                            1 => "F&#46;L&#46; Fontes"
                            2 => "S&#46;R&#46; de Medeiros"
                            3 => "R&#46; de Almeida Freitas"
                            4 => "L&#46;B&#46; de Souza"
                            5 => "M&#46;C&#46; da Costa Miguel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.archoralbio.2015.12.004"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Oral Biol"
                        "fecha" => "2016"
                        "volumen" => "64"
                        "paginaInicial" => "19"
                        "paginaFinal" => "23"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26742000"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Allelic variants of XRCC1 and XRCC3 repair genes and susceptibility of oral cancer in Brazilian patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;B&#46; Dos Reis"
                            1 => "R&#46; Losi-Guembarovski"
                            2 => "E&#46;M&#46; de Souza Fonseca Ribeiro"
                            3 => "I&#46;J&#46; Cavalli"
                            4 => "M&#46;C&#46; Morita"
                            5 => "G&#46;H&#46; Ramos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1600-0714.2012.01192.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Oral Pathol Med"
                        "fecha" => "2013"
                        "volumen" => "42"
                        "paginaInicial" => "180"
                        "paginaFinal" => "185"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22775506"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Standards of medical care in diabetes-2015 abridged for primary care providers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "A&#46; American Diabetes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2337/diaclin.33.2.97"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Diabetes"
                        "fecha" => "2015"
                        "volumen" => "33"
                        "paginaInicial" => "97"
                        "paginaFinal" => "111"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25897193"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A new classification of diabetic nephropathy 2014&#58; a report from Joint Committee on Diabetic Nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Haneda"
                            1 => "K&#46; Utsunomiya"
                            2 => "D&#46; Koya"
                            3 => "T&#46; Babazono"
                            4 => "T&#46; Moriya"
                            5 => "H&#46; Makino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diabetes Invest"
                        "fecha" => "2015"
                        "volumen" => "6"
                        "paginaInicial" => "242"
                        "paginaFinal" => "246"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA damage and repair in type 2 diabetes mellitus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Blasiak"
                            1 => "M&#46; Arabski"
                            2 => "R&#46; Krupa"
                            3 => "K&#46; Wozniak"
                            4 => "M&#46; Zadrozny"
                            5 => "J&#46; Kasznicki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.mrfmmm.2004.05.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mutat Res"
                        "fecha" => "2004"
                        "volumen" => "554"
                        "paginaInicial" => "297"
                        "paginaFinal" => "304"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15450427"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative damage to DNA and its relationship with diabetic complications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46;Z&#46; Pan"
                            1 => "D&#46; Chang"
                            2 => "L&#46;G&#46; Feng"
                            3 => "F&#46;J&#46; Xu"
                            4 => "H&#46;Y&#46; Kuang"
                            5 => "M&#46;J&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biomed Environ Sci"
                        "fecha" => "2007"
                        "volumen" => "20"
                        "paginaInicial" => "160"
                        "paginaFinal" => "163"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17624192"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Urinary 8-OHdG&#58; a marker of oxidative stress to DNA and a risk factor for cancer&#44; atherosclerosis and diabetics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46;L&#46; Wu"
                            1 => "C&#46;-C&#46; Chiou"
                            2 => "P&#46;-Y&#46; Chang"
                            3 => "J&#46;T&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta"
                        "fecha" => "2004"
                        "volumen" => "339"
                        "paginaInicial" => "1"
                        "paginaFinal" => "9"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14687888"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes and cancer&#58; a 2013 synopsis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Buysschaert"
                            1 => "S&#46; Sadikot"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.dsx.2013.08.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes Metab Syndr"
                        "fecha" => "2013"
                        "volumen" => "7"
                        "paginaInicial" => "247"
                        "paginaFinal" => "250"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24290094"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of oxidative DNA damage in pathogenesis of diabetic neuropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "I&#46; Majsterek"
                            1 => "A&#46; Merecz"
                            2 => "A&#46; Sliwinska"
                            3 => "M&#46; Kosmalski"
                            4 => "J&#46; Kasznicki"
                            5 => "J&#46; Drzewoski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "World Acad Sci Eng Technol"
                        "fecha" => "2012"
                        "volumen" => "6"
                        "paginaInicial" => "12"
                        "paginaFinal" => "15"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between polymorphisms of the DNA repair genes XRCC1 and hOGG1 and type 2 diabetes mellitus in the Polish population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Kasznicki"
                            1 => "R&#46; Krupa"
                            2 => "J&#46; Blasiak"
                            3 => "J&#46; Drzewoski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pol Arch Med Wewn"
                        "fecha" => "2009"
                        "volumen" => "119"
                        "paginaInicial" => "122"
                        "paginaFinal" => "128"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19514640"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Polymorphisms in oxidative stress pathway genes and risk of diabetic nephropathy in South Indian type 2 diabetic patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Narne"
                            1 => "K&#46;C&#46; Ponnaluri"
                            2 => "M&#46; Siraj"
                            3 => "M&#46; Ishaq"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Nephrology &#40;Carlton&#44; Vic&#41;"
                        "fecha" => "2014"
                        "volumen" => "19"
                        "paginaInicial" => "623"
                        "paginaFinal" => "629"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Arg399Gln polymorphism of X-ray repair cross-complementing group 1 gene is associated with angiographically documented coronary artery disease in South Indian type 2 diabetic patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P&#46; Narne"
                            1 => "K&#46;C&#46; Ponnaluri"
                            2 => "S&#46; Singh"
                            3 => "M&#46; Siraj"
                            4 => "M&#46; Ishaq"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Genet Test Mol Biomark"
                        "fecha" => "2013"
                        "volumen" => "17"
                        "paginaInicial" => "236"
                        "paginaFinal" => "241"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association analysis of polymorphisms in genes related to oxidative stress in south indian type 2 diabetic patients with retinopathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Narne"
                            1 => "K&#46;C&#46; Ponnaluri"
                            2 => "M&#46; Siraj"
                            3 => "M&#46; Ishaq"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Ophth Genet"
                        "fecha" => "2016"
                        "volumen" => "37"
                        "paginaInicial" => "1"
                        "paginaFinal" => "8"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA repair genes XPD and XRCC1 polymorphisms and risk of end-stage renal disease in Egyptian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "W&#46;M&#46; Radwan"
                            1 => "H&#46;S&#46; Elbarbary"
                            2 => "N&#46;M&#46; Alsheikh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/0886022X.2014.967646"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ren Fail"
                        "fecha" => "2015"
                        "volumen" => "37"
                        "paginaInicial" => "122"
                        "paginaFinal" => "128"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25310768"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diabetes causes multiple genetic alterations and downregulates expression of DNA repair genes in the prostate"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Ye"
                            1 => "X&#46; Li"
                            2 => "Y&#46; Wang"
                            3 => "Y&#46; Zhang"
                            4 => "M&#46; Cai"
                            5 => "B&#46; Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/labinvest.2011.87"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lab Invest"
                        "fecha" => "2011"
                        "volumen" => "91"
                        "paginaInicial" => "1363"
                        "paginaFinal" => "1374"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21647090"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Up-regulation of MSH2&#44; XRCC1 and ATM genes in patients with type 2 diabetes and coronary artery disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46; Ahmadi"
                            1 => "M&#46; Behmanesh"
                            2 => "M&#46;A&#46; Boroumand"
                            3 => "M&#46; Tavallaei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.diabres.2015.05.049"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes Res Clin Pract"
                        "fecha" => "2015"
                        "volumen" => "109"
                        "paginaInicial" => "500"
                        "paginaFinal" => "506"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26088318"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0405"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gender aspects in type 2 diabetes mellitus and cardiometabolic risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "N&#46; Sattar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.beem.2013.05.006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Best Pract Res Clin Endocrinol Metab"
                        "fecha" => "2013"
                        "volumen" => "27"
                        "paginaInicial" => "501"
                        "paginaFinal" => "507"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24054927"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0410"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The pathogenesis and pathophysiology of type 1 and type 2 diabetes mellitus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46;C&#46; Ozougwu"
                            1 => "K&#46;C&#46; Obimba"
                            2 => "C&#46;D&#46; Belonwu"
                            3 => "C&#46;B&#46; Unakalamba"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Physiol Pathophysiol"
                        "fecha" => "2013"
                        "volumen" => "4"
                        "paginaInicial" => "46"
                        "paginaFinal" => "57"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack388447"
        "titulo" => "Acknowledgement"
        "texto" => "<p id="par0105" class="elsevierStylePara elsevierViewall">This study was supported by <span class="elsevierStyleGrantSponsor" id="gs1">Research Foundation of Marmara University</span> &#91;grant no&#46; <span class="elsevierStyleGrantNumber" refid="gs1">SAG-C-DRP-100914-0320</span>&#93;&#46;</p> <p id="par0110" class="elsevierStylePara elsevierViewall">We thank Dr&#46; Mehmet Tepe from Haydarpasa Numune Training and Research Hospital Internal Diseases Policlinics for his precious efforts in supplying blood samples and Prof&#46; Dr&#46; P&#305;nar Ay from Marmara University&#44; Faculty of Medicine&#44; Department of Public Health for her rigorous statistical evaluations&#46;</p><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Conflict of interest</span><p id="par0115" class="elsevierStylePara elsevierViewall">The authors report no conflicts of interest&#46; The authors alone are responsible for the content and writing of the paper&#46;</p></span>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/25300164/0000006600000002/v1_201901250635/S2530016418302325/v1_201901250635/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "63844"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/25300164/0000006600000002/v1_201901250635/S2530016418302325/v1_201901250635/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2530016418302325?idApp=UINPBA00004N"
]

Article information

ISSN: 25300164
Original language: English

DOI:10.1016/j.endinu.2018.08.010

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	4	0	4
2024 October	27	2	29
2024 September	22	8	30
2024 August	24	3	27
2024 July	17	2	19
2024 June	24	4	28
2024 May	16	3	19
2024 April	12	2	14
2024 March	30	3	33
2024 February	21	1	22
2024 January	23	1	24
2023 December	19	2	21
2023 November	40	6	46
2023 October	26	2	28
2023 September	10	0	10
2023 August	16	1	17
2023 July	10	3	13
2023 June	19	5	24
2023 May	61	0	61
2023 April	42	5	47
2023 March	32	6	38
2023 February	14	1	15
2023 January	15	7	22
2022 December	38	7	45
2022 November	41	12	53
2022 October	24	14	38
2022 September	26	12	38
2022 August	27	12	39
2022 July	21	13	34
2022 June	31	10	41
2022 May	38	8	46
2022 April	29	20	49
2022 March	28	20	48
2022 February	41	6	47
2022 January	62	14	76
2021 December	29	8	37
2021 November	15	9	24
2021 October	22	12	34
2021 September	17	12	29
2021 August	18	7	25
2021 July	14	11	25
2021 June	17	10	27
2021 May	19	8	27
2021 April	33	29	62
2021 March	45	9	54
2021 February	28	8	36
2021 January	30	11	41
2020 December	18	7	25
2020 November	26	11	37
2020 October	11	7	18
2020 September	19	8	27
2020 August	31	13	44
2020 July	14	12	26
2020 June	11	6	17
2020 May	22	16	38
2020 April	11	5	16
2020 March	21	4	25
2020 February	22	6	28
2020 January	34	13	47
2019 December	26	8	34
2019 November	18	5	23
2019 October	19	10	29
2019 September	14	10	24
2019 August	10	3	13
2019 March	2	0	2
2019 February	17	6	23
2019 January	7	2	9

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter