Sequence-based typing of clinical and environmental Legionella pneumophila isolates in Shenyang, China | Enfermedades Infecciosas y Microbiología Clínica

array:24 ["pii" => "S0213005X20302433" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2020.06.012" "estado" => "S300" "fechaPublicacion" => "2021-10-01" "aid" => "2244" "copyright" => "The Authors" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Enferm Infecc Microbiol Clin. 2021;39:383-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S0213005X2030255X" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2020.06.018" "estado" => "S300" "fechaPublicacion" => "2021-10-01" "aid" => "2253" "copyright" => "Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Enferm Infecc Microbiol Clin. 2021;39:390-4" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Encuesta de recursos diagnósticos de las ITS en España" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "390" "paginaFinal" => "394" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Survey of diagnostic resources for STI in Spain" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Luis Otero-Guerra, Leire Gil-Alonso, Josefina López-de Munain, Jorge del Romero-Guerrero, Judit Serra-Pladevall, Fernando Vazquez" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Luis" "apellidos" => "Otero-Guerra" ] 1 => array:2 [ "nombre" => "Leire" "apellidos" => "Gil-Alonso" ] 2 => array:2 [ "nombre" => "Josefina" "apellidos" => "López-de Munain" ] 3 => array:2 [ "nombre" => "Jorge" "apellidos" => "del Romero-Guerrero" ] 4 => array:2 [ "nombre" => "Judit" "apellidos" => "Serra-Pladevall" ] 5 => array:2 [ "nombre" => "Fernando" "apellidos" => "Vazquez" ] 6 => array:1 [ "colaborador" => "miembros del Grupo GEITS" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2529993X21001490" "doi" => "10.1016/j.eimce.2021.07.002" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529993X21001490?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X2030255X?idApp=UINPBA00004N" "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X2030255X/v1_202110050758/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0213005X20302202" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2020.05.021" "estado" => "S300" "fechaPublicacion" => "2021-10-01" "aid" => "2227" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Enferm Infecc Microbiol Clin. 2021;39:372-82" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Diferencias epidemiológicas y de mortalidad entre hombres y mujeres con infección por VIH en la cohorte CoRIS entre los años 2004 y 2014" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "372" "paginaFinal" => "382" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Differences in epidemiology and mortality between men and women with HIV infection in the CoRIS cohort from 2004 to 2014" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1188 "Ancho" => 2591 "Tamanyo" => 138337 ] ] "descripcion" => array:1 [ "es" => "Supervivencia según el sexo durante los tres periodos de tiempo. Nota: El eje de abscisas varía entre los tres gráficos y el eje de ordenadas no se inicia en 0." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Constanza Muñoz Hornero, Alfonso Muriel, Marta Montero, José Antonio Iribarren, Mar Masía, Leopoldo Muñoz, Gloria Sampériz, Gemma Navarro, Santiago Moreno, María Jesús Pérez-Elías" "autores" => array:10 [ 0 => array:2 [ "nombre" => "Constanza" "apellidos" => "Muñoz Hornero" ] 1 => array:2 [ "nombre" => "Alfonso" "apellidos" => "Muriel" ] 2 => array:2 [ "nombre" => "Marta" "apellidos" => "Montero" ] 3 => array:2 [ "nombre" => "José Antonio" "apellidos" => "Iribarren" ] 4 => array:2 [ "nombre" => "Mar" "apellidos" => "Masía" ] 5 => array:2 [ "nombre" => "Leopoldo" "apellidos" => "Muñoz" ] 6 => array:2 [ "nombre" => "Gloria" "apellidos" => "Sampériz" ] 7 => array:2 [ "nombre" => "Gemma" "apellidos" => "Navarro" ] 8 => array:2 [ "nombre" => "Santiago" "apellidos" => "Moreno" ] 9 => array:2 [ "nombre" => "María Jesús" "apellidos" => "Pérez-Elías" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2529993X21001787" "doi" => "10.1016/j.eimce.2021.06.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529993X21001787?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X20302202?idApp=UINPBA00004N" "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X20302202/v1_202110050758/es/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Sequence-based typing of clinical and environmental Legionella pneumophila isolates in Shenyang, China" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "383" "paginaFinal" => "389" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Luxi Jiang, Sihong Zhao, Xu Cai, Deguang Mu, Xianghua Zhang, Jian Kang, Li Zhao, Yu Chen" "autores" => array:8 [ 0 => array:3 [ "nombre" => "Luxi" "apellidos" => "Jiang" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] ] ] 1 => array:3 [ "nombre" => "Sihong" "apellidos" => "Zhao" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 2 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] ] ] 2 => array:3 [ "nombre" => "Xu" "apellidos" => "Cai" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 3 => array:3 [ "nombre" => "Deguang" "apellidos" => "Mu" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "Xianghua" "apellidos" => "Zhang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 5 => array:3 [ "nombre" => "Jian" "apellidos" => "Kang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 6 => array:3 [ "nombre" => "Li" "apellidos" => "Zhao" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 7 => array:4 [ "nombre" => "Yu" "apellidos" => "Chen" "email" => array:1 [ 0 => "chenyusy@hotmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Department of Pulmonary and Critical Care Medicine, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Department of Respiratory Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, Hangzhou, Zhejiang, China" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Department of Respiratory Medicine, the First Hospital of Shijiazhuang, Hebei, China" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Institute of Respiratory Disease, The First Hospital of China Medical University, Shenyang, China" "etiqueta" => "d" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Tipificación mediante secuenciación de aislados clínicos y ambientales de Legionella pneumophila en Shenyang, China" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1807 "Ancho" => 2167 "Tamanyo" => 139474 ] ] "descripcion" => array:1 [ "en" => "Cluster analysis results for 22 L. pneumophila strains. 1-N22: strain1-strain22; LP1, LP7, LP8: L. pneumophila serotypes 1, 7 and 8; SYA-SYN: 14 different PFGE types." ] ] ] "textoCompleto" => "INTRODUCTIONLegionella pneumophila (LP) is a Gram-negative organism ubiquitously found in natural rivers, lakes, soils, and man-made water systems that include fountains, cooling towers, and bathing facilities.<a class="elsevierStyleCrossRef" href="#bib0200">1</a> LP withstands temperatures of 50°C for several hours yet does not multiply at temperatures below 20°C.<a class="elsevierStyleCrossRef" href="#bib0205">2</a> These organisms survive as intracellular parasites of amoebae, ciliated protozoa, or slime moulds.<a class="elsevierStyleCrossRef" href="#bib0210">3</a> Infected amoebae are found in naturally occurring microbial communities that form biofilms.<a class="elsevierStyleCrossRef" href="#bib0205">2</a> In humans, the disease can occur as sporadic cases or as epidemics. In the United States, nearly 8,000 people are hospitalized annually due to LP infection, most commonly pneumonia.<a class="elsevierStyleCrossRef" href="#bib0215">4</a> LP is the most or second most frequent community-acquired pneumonia that requires admission in intensive care units. The mortality rate is higher than that due to other organisms, particularly in immunocompromised patients, and can reach 50%.<a class="elsevierStyleCrossRef" href="#bib0220">5</a> In China, the proportion of L. pneumonia as a cause of community-acquired pneumonia (CAP) is 5.08%.<a class="elsevierStyleCrossRef" href="#bib0225">6</a> LP pneumonia often leads to severe pneumonia. Nearly 50% of hospitalized patients with LP pneumonia need to be admitted to the ICU, with a mortality rate of 5-30%.<a class="elsevierStyleCrossRef" href="#bib0230">7</a> Since Legionnaires’ disease is mainly transmitted via inhalation of infectious aerosols,<a class="elsevierStyleCrossRef" href="#bib0200">1</a> it is of great epidemiological significance to perform molecular epidemiology analysis of LP isolates and to trace the source of infection.The European Working Group for Legionella Infections (EWGLI) has established a global database of Legionella spp. infections and identified sequence-based typing (SBT) as the “gold standard” for investigations of Legionella spp. outbreaks.<a class="elsevierStyleCrossRef" href="#bib0235">8</a> This method amplifies and sequences multiple Legionella-specific gene loci of the target isolate using polymerase chain reaction (PCR). The sequence obtained is compared with that in the SBT database established by EWGLI in order to obtain the corresponding gene locus type. Finally, the combination of all gene locus types for each isolate is used to obtain the Sequence Type (ST) of the target isolate.In the present study, SBT was performed on seven specific gene loci (flaA, pilE, asd, mip, mompS, proA, neuA) in 22 LP isolates. The results were compared with our previous research results, that is, pulsed field gel electrophoresis (PFGE) typing results, and this provides evidence of the epidemiology of LP infection in Shenyang, China.METHODSBacterial isolatesFrom July 2012 to September 2014, 22 LP isolates were obtained, including two respiratory clinical isolates and 20 environmental water isolates. The two clinical isolates were collected from two large hospitals in Shenyang. The hospitals have more than 6,750 operational beds and they occupy a total land area of 625,800 square meters. The isolates were gathered from different patients, and they corresponded to sporadic cases. Twenty environment isolates were collected from 13 office buildings in different areas of Shenyang. The sources of these isolates were: domestic tap water (one isolate), shower water (one isolate), and cooling tower water (18 isolates). All these isolates were plated and cultured on buffered charcoal yeast extract (BCYE) agar plates (Oxoid, Germany) for 48 h-72h at 37°C under a 5% CO2 atmosphere. The serogroup of the strains was identified by using a serum agglutination kit (Legionella antisera, Tianjin Biochip Corporatio, China). -Experimental methodsDNA extractionGenomic template extraction kits (QIAamp DNA minikits; Qiagen, Hilden, Germany) were purchased from Qiagen (Beijing, China). DNA templates were extracted by DNA extraction kit (QIAamp DNA Mini Kits, Hilden, Germany) according to the manufacturer's instructions (<a href="https://www.qiagen.com/">https://www.qiagen.com</a> /us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/genomic-dna/qiaamp-dna-mini-kit/?clear=true#orderinginformation). Nine hundred microliters of phosphate buffer was added to a 1.5-ml centrifuge tube. One colony of every isolate was picked using an inoculating loop and added to the buffer. The tube was vortexed and centrifuged using a low-temperature high-speed benchtop centrifuge (Kendro Laboratories, USA) at 8000 xp/min for 5min. The supernatant was discarded. ATL tissue lysis buffer (provided by QlAamp DNA Mini Kit) (180μl) was added to the centrifuge tube, followed by 20μl of proteinase K. The content was mixed by repeated resuspension and vortexing, and was subsequently placed in a constant temperature water bath at 56°C for 2h. AL lysis buffer (provided by QlAamp DNA Mini Kit) (200μl) was added to the centrifuge tube and the tube was vortexed. The tube was placed in a constant temperature metal bath at 70°C for 10min, followed by the addition of 200μl of absolute ethanol and vortexing. The adsorption column (provided by QlAamp DNA Mini Kit) and collection tube (provided by QlAamp DNA Mini Kit) were assembled. All the above liquids were transferred to the tube and centrifuged at 8000 xp/min for 1min. The collection tube and the liquid were discarded and replaced with a new collection tube. Subsequently, 500μl of AW1 (provided by QlAamp DNA Mini Kit) was added to the adsorption column and centrifugation was performed at 8000 xp/min for 1min. The collection tube and the liquid were once again discarded and replaced with a new collection tube, and 500μl of AW2 (provided by QlAamp DNA Mini Kit) was added to the adsorption column. Centrifugation was performed at 13,000 xp/min for 1min. The collection tube and the liquid were once again discarded. Centrifugation was performed at 13000 xp/min for 1min and then 100μl of elution buffer AE (provided by QlAamp DNA Mini Kit) was added. The collection tube and the liquid were discarded. The collection tube was replaced with a 1.5-ml centrifuge tube. The centrifuge tube and adsorption column were left open for 5minutes to reduce DNA damage by ethanol. Centrifugation was performed again at 8000 xp/min for 1min. The liquid after centrifugation was retained and the adsorption column discarded. The resulting liquid contained the DNA of the target isolates.Primer synthesisSpecific upstream and downstream primers targeting the flaA, pilE, asd, mip, mompS, proA, and neuA genes of LP were synthesized by Sangon Biotech (Shanghai) Co., Ltd, China. The sequences of the Legionella-specific primers are shown in the SBT database on the EWGLI website (<a href="http://www.ewgli.org/">http://www.ewgli.org</a>).PCRPremix Taq reaction system (30μl) comprising 15μl of Premix TaqTM (TaKaRa Bio, Japan), 1μl of upstream primer, 1μl of downstream primer, 8μl of double-distilled water, and 5μl of the extracted DNA samples were added to a 0.2-ml centrifuge tube and vortexed. The PCR reactions were performed in a Thermo Cycler (Thermo Fisher Scientific, USA). The PCR cycling parameters were as follows: denaturation at 95°C for 5min; followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 60 s; and a final extension at 72°C for 10min.Sequencing of PCR productsThe sequencing primers for flaA, pilE, asd, mip, proA, and neuA were identical to the respective amplification primers. The sequencing primers for mompS were mompS-450F: TTGACCATGAGTGGGATTGG and mompS1015R: CAGAAGCTG CGAAATCAG. The obtained PCR amplicons were sequenced by Sangon Biotech (Shanghai) Co., Ltd. (China).Data analysisThe obtained gene sequences were uploaded to the SBT database on the EWGLI website (<a href="http://www.ewgli.org/">http://www.ewgli.org</a>) for comparison, and the allele number of each gene locus was obtained. All allele numbers of the target isolates were uploaded, and the STs of the target isolates were obtained.PFGE (Pulsed-Field Gel Electrophoresis)PFGE is based on the separation of macro-restriction fragments of the bacterial chromosome generated by digestion with an infrequent cutting site restriction endonuclease by pulse-field gel electrophoresis. In our previous study, we used the enzyme AscI as restriction endonuclease.<a class="elsevierStyleCrossRef" href="#bib0240">9</a> Detailed PFGE experimental methods are available at <a href="http://rs.yiigle.com/CN112137201722/992083.htm">http://rs.yiigle.com/CN112137201722/992083.htm</a>RESULTSSerogroups of the isolatesSerogroup identification using serum agglutination tests showed that the isolates belonged to LP serogroup 1 (n=20), serogroup 7 (n=1), and serogroup 8 (n=1).PCR amplicons of specific gene lociThe sizes of the PCR amplicons of the seven specific loci were: flaA, 414bp; pilE, 460bp; asd, 576bp; mip, 559bp; mompS, 711bp; proA, 481bp; and neuA, 459bp.<a class="elsevierStyleCrossRef" href="#bib0245">10</a> Of the 22 LP isolates, 20 had all 7 target genes amplified. The target genes asd and mip of isolates 10 and 11 were negative after repeated amplification attempts.SBT resultsThe sequences were uploaded to the EWGLI database, and the allele numbers of the various housekeeping genes were obtained (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The allele numbers of the seven housekeeping genes of each target isolate were uploaded to the database to obtain the ST of the isolate. Of the 20 LP isolates with complete sequences, 14 belonged to ST1, one belonged to ST328, and the remaining five belonged to ST types that have not been reported internationally. The sequences were uploaded to the EWGLI website, with assigned ST numbers of ST2345, ST2344, ST2406, ST2407, and ST2408. The pulsotypes and STs of the 22 LP isolates are summarized in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Results of SBT and PFGE typingThe 22 Legionella isolates in the present study had been previously tested by PFGE.<a class="elsevierStyleCrossRef" href="#bib0250">11</a> The serogroups, PFGE types, SBT types, and sources of the isolates are summarized in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. The results of cluster analysis of the 22 isolates are shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia>DISCUSSIONL. pneumophila is widely found in the environment. It can cause sporadic outbreaks through contaminated aerosols and can lead to fatal infections.<a class="elsevierStyleCrossRef" href="#bib0255">12</a> Homologous analysis of clinical and environmental LP isolates for the determination of their genetic relationships can facilitate the tracing of the source of infection and can further the understanding of the prevalence of this organism. This knowledge is important for the prevention and control of LP infections. Current molecular typing methods used for bacterial homology analysis include PFGE, amplified fragment length polymorphism (AFLP) analysis, random amplified polymorphic DNA (RAPD) analysis, and restriction fragment length polymorphism (RFLP). However, even in a laboratory with sophisticated experimental techniques, the results of experiments conducted at different times are not 100% consistent. Disadvantages of AFLP include the imprecision of fragment sizing resulting in difficulty in comparing patterns between laboratories and platforms. For LP this method has largely been replaced by SBT.<a class="elsevierStyleCrossRef" href="#bib0245">10</a> Since LP can cause travel-related infections, it is of considerable epidemiological significance to perform standardized molecular typing of isolates from different countries and to determine their homology.Multilocus sequence typing was originally proposed by Enright et al.<a class="elsevierStyleCrossRef" href="#bib0260">13</a> for the epidemiological analysis of Streptococcus pneumoniae. Gaia et al.<a class="elsevierStyleCrossRef" href="#bib0220">5</a> applied this method to establish and evaluate the SBT method for the analysis of LP serogroup 1. The authors subsequently made improvements and performed typing using five virulence genes (flaA, pilE, mip, mompS, and proA) and one housekeeping gene (asd), and extended the application to non–serogroup 1 LP isolates. Ratzow et al.<a class="elsevierStyleCrossRef" href="#bib0235">8</a> added a housekeeping gene (neuA) based on the data of Gaia et al.,<a class="elsevierStyleCrossRef" href="#bib0220">5</a> which further improved the discriminatory ability of SBT. Of the seven gene loci, flaA encodes the flagellar subunit protein, pilE encodes type IV pili, asd encodes aspartate-β-semialdehyde dehydrogenase, mip encodes a protein that enhances macrophage infection, mompS encodes an outer membrane protein, proA encodes a zinc metalloproteinase, and neuA encodes an N-acyl-neuraminic cytidine transferase. EWGLI has established a standard operating procedure for SBT of Legionella spp. with accurate and objective results, and has created an online database. The database is available to the global research community and the results from each laboratory in all regions can be uploaded and compared. The SBT database for LP is constantly expanding and is important in the epidemiology of Legionella spp.<a class="elsevierStyleCrossRefs" href="#bib0220">5,8</a>Qin et al.<a class="elsevierStyleCrossRef" href="#bib0265">14</a> conducted SBT typing on 164 LP serogroup 1 isolates from cooling towers, hot springs, and drinking water in the six cities of Shanghai, Beijing, Shenzhen, Wuxi, Jinan, and Shijiazhuang over a 7-year period. Most of the isolates belonged to ST1, accounting for 49.4% of the cases (81 isolates). ST1 existed in all cities and was the most predominant ST in China. In addition, the STs varied in different water sources and in different cities. The present study is the first to perform SBT typing of LP isolated from Shenyang. ST1 predominated (63.6%, 14 isolates) and was the main epidemic type in this region. Our findings, ST1 was the main epidemic type in this region of China, was consistent with data from other domestic studies.<a class="elsevierStyleCrossRefs" href="#bib0270">15–17</a> In addition, LP ST1 isolates of clinical relevance are spread worldwide.<a class="elsevierStyleCrossRef" href="#bib0285">18</a> In a study performed in the United States, of clinical and environmental isolates of LP serotype 1 (LP1) from 1982 to 2012, ST1, ST35, ST36, ST37, and ST222 were responsible for both outbreak-associated and sporadic cases.<a class="elsevierStyleCrossRef" href="#bib0290">19</a> In Germany the most common clinical ST was ST1.<a class="elsevierStyleCrossRef" href="#bib0200">1</a> In this study, we also found ST328 in Shenyang's cooling tower water environment. This ST328 type was also isolated in hot water circuits in a large Spanish hospital.<a class="elsevierStyleCrossRef" href="#bib0295">20</a> These environmental strains were isolated from taps and showers throughout the whole Spanish hospital.<a class="elsevierStyleCrossRef" href="#bib0295">20</a> Besides, this ST328 environmental strain has been isolated sporadically, among others, in a nursing facility in Italy, where several cases of atypical pneumonia were recorded.<a class="elsevierStyleCrossRef" href="#bib0300">21</a> The climate and water sources of these countries are different, so we consider that ST328 may also be widely spread globally. In addition, there were five STs that have not been previously reported in China or elsewhere. These STs were confirmed using the EWGLI website and were designated ST2345, ST2344, ST2406, ST2407, and ST2408. These results indicate that LP isolates in Shenyang display a unique gene specificity. The two LP isolates from the respiratory clinical specimens from patients belonged to novel STs (ST2345, ST2344) that have not been previously reported. Isolate 1 was collected from a 59-year-old male patient with a history of cirrhosis. Two weeks prior to disease onset, the patient received root canal treatment in a private dental clinic. The suspected route of infection was the inhalation of water contaminated with LP that was present in the tubes of the dental instruments. Isolate 2 was collected from a 45-year-old male plumber who had a history of sewer operations before the onset of the disease; the inhalation of LP present in the sewage could be a possible route of infection. These two new pathogenic STs of LP exist in the environment or in certain medical facilities in Shenyang. Isolates 20, 21, and 22 were from the environment and have not been previously reported in China and elsewhere, indicating the uniqueness of L. pneumoniae in environmental waters of Shenyang. The virulence of these three types of L. pneumoniae remains to be elucidated in future studies.Legionella spp. can exist for a long period in low-temperature environments and in amoeba in water.<a class="elsevierStyleCrossRef" href="#bib0305">22</a> Oberdorfer et al.<a class="elsevierStyleCrossRef" href="#bib0310">23</a> demonstrated that this organism can also exist for a long period of time in constructed water supply systems. Therefore, long-term monitoring and genetic analyses should be performed on Legionella spp. isolated from the environment and water supply systems.Both isolates 9 and 21 were collected from the cooling tower of the central air-conditioning system in the same office building. However, the water samples collected from different parts contained different STs, suggesting that multiple types of genetically unrelated strains could coexist in the same environment. Therefore, if an outbreak occurs, multipoint sampling should be performed in all suspicious environments for molecular analysis. For isolates 10 and 11, not all housekeeping genes could be amplified, with asd and mip genes unable to be amplified. Certain genes may differ from the housekeeping genes in the SBT database because of genetic variations in the bases within the specific primer-binding regions. It has been reported the loss of the neuA, flaA, and proA genes in LP isolates.<a class="elsevierStyleCrossRefs" href="#bib0315">24–26</a>PFGE has been widely used as the “gold standard” for the molecular typing of pathogenic bacteria,<a class="elsevierStyleCrossRef" href="#bib0325">26</a> such as Salmonella spp., Escherichia coli, and Staphylococcus aureus. PFGE is important in the study and confirmation of the outbreaks of pathogenic bacteria.<a class="elsevierStyleCrossRef" href="#bib0330">27</a> Zhou et al.<a class="elsevierStyleCrossRef" href="#bib0335">28</a> optimized PFGE for LP and selected AscI as the preferred restriction endonuclease to analyze various serogroups of LP. The results indicated that clustering of PFGE patterns demonstrated high discriminatory power in typing. Despite its high discriminatory power, this method suffers some drawbacks: it is time consuming, inter-gel reproducibility is often poor, electrophoresis requires specific equipment and computer-aided imaging analysis is needed, data are difficult to exchange between laboratories making investigations of travel associated Legionella spp. disease cases more difficult.<a class="elsevierStyleCrossRef" href="#bib0340">29</a> Despite international efforts for standardization of PFGE typing protocols (restriction endonuclease, plug preparation and electrophoretic parameters) the obtained data remain difficult to exchange. Our group has previously shown<a class="elsevierStyleCrossRef" href="#bib0250">11</a> that the predominant PFGE type of LP in Shenyang is SYC, which includes seven molecular types isolated from four different locations and water systems, with 100% homology. Isolates belonging to serogroup LP1 can show different PFGE patterns. As shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>, the 22 isolates belonged to 14 PFGE types, which also suggests the polymorphism of LP pulsotypes in Shenyang. Isolates 1 and 2 were collected from respiratory samples of two patients with L. pneumoniae pneumonia. The two isolates were genetically unrelated and were also genetically unrelated to isolates 3 and 4 collected from the same hospital environment. In addition, the two patients had symptoms related to LP infection before admission, and both had a suspected history of exposure to a water source contaminated with LP. After admission, the initial antibiotics did not cover legionellosis, and the patients’ condition worsened. Only after adequate treatment, the patients’ condition improved. These findings suggest that the two patients were infected with LP from outside the hospital. Isolates 10 and 11 were collected from different outlets of the cooling tower in company C; their homology was 100%. Isolates 3 and 4 were collected from different outlets of the cooling tower in hospital A, and the bands were identical. These results indicate the presence of a predominant strain in the same cooling tower. Isolates 6, 7, and 8 were collected from the air-conditioning cooling tower water, drinking water, and shower water of hospital B. The three isolates belonged to the same clonal line, indicating the presence of cross-contamination of LP in different water systems of the same location. Blowing devices are often located near the cooling tower of air-conditioning system. Once LP is present in the cooling tower water system, aerosols containing the bacterium are readily formed and spread, leading to cross-contamination in different water systems. A study reported a LP in a Swedish hospital due to contamination of the shower water system.<a class="elsevierStyleCrossRef" href="#bib0345">30</a>The present study used SBT for the typing for 22 clinical and environmental LP isolates in Shenyang. In addition, we also compared the SBT results with the PFGE results previously obtained. PFGE typing separated 14 types of patterns and SBT discriminated 7 SBT types. Both typing methods showed that predominant clonal lines exist in the region, with high levels of genetic polymorphisms. Meanwhile, five novel SBT types have been identified, indicating that the types of LP strains in this region are unique in genetic composition and differ significantly from others described from environmental water systems elsewhere in the world.Twenty of the 22 LP isolates were assigned an ST, of which 14 isolates belonged to ST1. These 14 LP isolates displayed a certain molecular homology, but it was difficult to further analyze them by using SBT. SBT primarily distinguishes the genetic diversity of LP isolates that belong to different STs. By using this technique it is possible to compare LP isolates of different STs with the genetics of LP globally. However, it is difficult to analyze LP isolates that belong to the same ST by using this method, and its discriminatory ability is weak. The present data show that isolates of the same ST belonged to different PFGE types, suggesting that analysis by PFGE is better to SBT in tracking infections. Amemura-Maekawa et al.<a class="elsevierStyleCrossRef" href="#bib0350">31</a> performed the typing of 31 LP1 by using SBT combined with PFGE, and found that PFGE was able to divide the isolates into 30 different types, whereas SBT could only divide the isolates into 16 types. The authors reported that the efficiency of SBT was lower than the PFGE typing method. A Japanese study divided the LP isolate ST505 into two distinct types using PFGE typing.<a class="elsevierStyleCrossRef" href="#bib0355">32</a> Several studies utilized seven housekeeping genes to perform SBT and could not effectively trace the source of infection in hospital and community outbreaks of Legionnaires’ disease.<a class="elsevierStyleCrossRefs" href="#bib0360">33–35</a> Therefore, when SBT is unable to trace the source of infection, other methods, such as PFGE, should be used in combination. Quero et al.<a class="elsevierStyleCrossRef" href="#bib0375">36</a> conducted an epidemiological study on 25 Legionnaires’ disease outbreaks, and concluded that the concordance between SBT and PFGE in epidemiological investigations was 100%, but their concordance in molecular typing studies was 64%.<a class="elsevierStyleCrossRefs" href="#bib0350">31–36</a> Due to the respective advantages and disadvantages of SBT and PFGE, the two methods should be used in combination when conducting epidemiological studies and tracing outbreaks due to LP.SBT is based on the sequence comparison of several PCR-amplified DNA fragments. Since 2007, a consensus was defined and SBT is the gold standard method recommended by EWGLI for LP subtyping.<a class="elsevierStyleCrossRef" href="#bib0380">37</a> Isolation of clinical or environmental LP strains is not an easy task. This impairs the epidemiological investigations, as both clinical and environmental isolates are required for comparisons to find the source of infection. In this respect, SBT as PCR-based methods have an advantage as they can be applied directly to DNA extracted from clinical or environmental samples without the need to isolate the strains.<a class="elsevierStyleCrossRef" href="#bib0340">29</a> Besides, SBT is effective for epidemiological investigations on environmental and clinical isolates,<a class="elsevierStyleCrossRefs" href="#bib0385">38,39</a> and SBT has considerable advantages in the analysis of the evolutionary relationships and distribution of epidemics of bacterial strains. EWGLI has established a standard operating procedure for SBT and created an online Legionella SBT database (<a href="http://www.ewgli.org/">http://www.ewgli.org</a>) that can be shared worldwide. SBT is simple to perform and is rapid. It has standardized procedures, and can provide objective and definitive results. In addition, the obtained isolate sequences can be compared with the data from other laboratories. Currently, SBT is widely used globally for the investigations of Legionella spp. epidemiology. Furthermore, SBT displays good discriminatory power for the typing of LP1.<a class="elsevierStyleCrossRefs" href="#bib0385">38,39</a> SBT is superior to the PFGE method for epidemiological and evolutionary analysis.<a class="elsevierStyleCrossRef" href="#bib0340">29</a>In summary, our study indicates that LP is prevalent in public water systems and hospital water systems in Shenyang, China. SBT typing of isolates show that LP in Shenyang displays extensive genetic polymorphisms. Although some variations in SBT types have been identified, the same types of isolates still exist in some water sources. LP colonization of hospitals and public water systems may lead to LP outbreaks. The key to prevention of legionellosis is the proper maintenance of water systems in which Legionella spp. is able to grow. Active surveillance of water systems in hospitals and other facilities is required and regularly disinfection is needed.Author contributionsLuxi Jiang, Sihong Zhao and Yu Chen designed and conducted the experiments, collected and analyzed the data, and wrote the paper. Deguang Mu, Xianghua Zhang, Jian Kang and Li Zhao designed the experiments and contributed to revising the paper. Luxi Jiang, Xu Cai, Sihong Zhao and Yu Chen conducted the experiments, collected and processed the clinical specimens.Conflicts of InterestThe authors declare no conflict of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1582905" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1424648" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1582906" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1424649" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "INTRODUCTION" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "METHODS" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Bacterial isolates" ] 1 => array:3 [ "identificador" => "sec0020" "titulo" => "Experimental methods" "secciones" => array:1 [ 0 => array:2 [ "identificador" => "sec0025" "titulo" => "DNA extraction" ] ] ] 2 => array:2 [ "identificador" => "sec0030" "titulo" => "Primer synthesis" ] 3 => array:2 [ "identificador" => "sec0035" "titulo" => "PCR" ] 4 => array:2 [ "identificador" => "sec0040" "titulo" => "Sequencing of PCR products" ] 5 => array:2 [ "identificador" => "sec0045" "titulo" => "Data analysis" ] 6 => array:2 [ "identificador" => "sec0050" "titulo" => "PFGE (Pulsed-Field Gel Electrophoresis)" ] ] ] 6 => array:3 [ "identificador" => "sec0055" "titulo" => "RESULTS" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0060" "titulo" => "Serogroups of the isolates" ] 1 => array:2 [ "identificador" => "sec0065" "titulo" => "PCR amplicons of specific gene loci" ] 2 => array:2 [ "identificador" => "sec0070" "titulo" => "SBT results" ] 3 => array:2 [ "identificador" => "sec0075" "titulo" => "Results of SBT and PFGE typing" ] ] ] 7 => array:2 [ "identificador" => "sec0080" "titulo" => "DISCUSSION" ] 8 => array:2 [ "identificador" => "sec0085" "titulo" => "Author contributions" ] 9 => array:2 [ "identificador" => "sec0090" "titulo" => "Conflicts of Interest" ] 10 => array:2 [ "identificador" => "xack559119" "titulo" => "Acknowledgements" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-02-17" "fechaAceptado" => "2020-06-04" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1424648" "palabras" => array:5 [ 0 => "Legionella" 1 => "Serogroup" 2 => "SBT" 3 => "PFGE" 4 => "Sequence Type" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1424649" "palabras" => array:5 [ 0 => "Legionella" 1 => "Serogrupo" 2 => "SBT" 3 => "PFGE" 4 => "Tipo de secuencia" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "IntroductionWe performed SBT (sequence-based typing) on clinical and environmental Legionellapneumophila isolates in Shenyang (China). We analyzed and compared the results with those obtained by PFGE (pulsed field gel electrophoresis). MethodsTwenty-two L. pneumophila isolates were collected from two patients with L. pneumophila infection, two hospitals, and 13 office buildings. There were two clinical isolates, one strain isolated from domestic tap water, another from shower water and 18 strains from cooling tower water. All these isolates were analyzed by SBT and PFGE methods. ResultsThe 22 isolates were divided into 7 types by SBT. Five isolates belonged to novel sequence types (ST2345, ST2344, ST2406, ST2407, and ST2408) and one isolate belonged to ST328. The STs were not obtained for two of the isolates. The remaining 14 isolates belonged to ST1. PFGE typing divided the 22 isolates into 14 pulsotypes. The main pulsotype was SYC, which included seven isolates. ConclusionBoth typing methods showed that predominant clonal lines exist in the Shenyang region, with high levels of genetic polymorphisms. Five novel STs were identified, indicating a unique genetic composition of L. pneumophila strains in this region, which are significantly different from those found in other environmental water systems in the world." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "IntroducciónRealizamos una tipificación mediante secuenciación (SBT) de aislados clínicos y ambientales de Legionellapneumophila en Shenyang, China. Analizamos y comparamos los resultados con los obtenidos por electroforesis en campo pulsado (PFGE). MétodosSe recogieron 22 aislados de Legionella pneumophila de dos pacientes con infección por Legionella pneumophila, dos hospitales y 13 edificios de oficinas. Hubo dos aislados clínicos, una cepa aislada del agua del grifo doméstico, otra del agua de la ducha y 18 cepas del agua de la torre de refrigeración. Todos estos aislados se analizaron por los métodos SBT y PFGE. ResultadosLos 22 aislados se dividieron en siete tipos de SBT; cinco aislados pertenecían a nuevos tipos de secuencia (ST2345, ST2344, ST2406, ST2407 y ST2408) y un aislado pertenecía a ST328. No se obtuvieron secuenciotipos (ST) de dos de los aislados. Los 14 aislados restantes pertenecían a ST1. La tipificación por PGGE dividió los 22 aislados en 14 pulsotipos. El pulsotipo principal fue SYC, e incluyó siete aislados. ConclusiónAmbos métodos de tipificación mostraron que existen líneas clonales predominantes en la región de Shenyang, con altos niveles de polimorfismos genéticos. Se identificaron cinco nuevos ST, lo que indica una composición genética única de las cepas de Legionellapneumophila en esta región, que difieren significativamente de las que se encuentran en otros sistemas hídricos ambientales del mundo." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "Luxi Jiang and Sihong Zhao, contributed equally to this work." "identificador" => "fn0005" ] ] "multimedia" => array:3 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1807 "Ancho" => 2167 "Tamanyo" => 139474 ] ] "descripcion" => array:1 [ "en" => "Cluster analysis results for 22 L. pneumophila strains. 1-N22: strain1-strain22; LP1, LP7, LP8: L. pneumophila serotypes 1, 7 and 8; SYA-SYN: 14 different PFGE types." ] ] 1 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="7" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Allele number</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Sequence type \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Number of isolates \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">asd \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">flaA \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">mip \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">mompS \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">neuA \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">pilE \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">proA \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST328 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST2345<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST2344<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">21 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">40 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST2406<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">215 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST2407<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">207 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ST2408<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2711472.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "*" "nota" => "Five isolates belonged to novel sequence types (ST2345, ST2344, ST2406, ST2407, and ST2408)." ] ] ] "descripcion" => array:1 [ "en" => "Description of allele number, sequence type, and number of isolates (analysis of 22 Legionella pneumophila strains)." ] ] 2 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "LP: Legionella pneumophila; SYA∼SYN:14 PFGE patterns; “-”: Don’t have ST type; P: patient; H: hospital; OB: office building; S: sputum; CT: cooling tower; SW: shower water; PW: pipe water;." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Strain number \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">1 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">2 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">3 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">4 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">5 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">6 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">7 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">8 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">9 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">10 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">11 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">12 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">13 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">14 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">15 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">16 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">17 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">18 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">19 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">20 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">21 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">22 \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Serotype \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LP8 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PFGE pattern \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYK \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYE \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYM \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYM \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYB \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYF \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYJ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYN \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SYI \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sequence type (ST) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2345 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2344 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">328 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2406 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2407 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2408 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Source of strain \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">P-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">P-2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H-A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H-A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H-B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H-B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">H-B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-D \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-E \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB- F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB- H \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-I \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-J \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-K \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-L \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">OB-M \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">sample \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PW \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SW \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CT \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2711473.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Serotypes, PFGE patterns, sequence types and source (analysis of 22 Legionella pneumophila strains)." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0200" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionnaires’ disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B.A. Cunha" 1 => "A. Burillo" 2 => "E. Bouza" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "The Lancet." "fecha" => "2016" "volumen" => "387" "numero" => "10016" "paginaInicial" => "376" "paginaFinal" => "385" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0205" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionella and the prevention of legionellosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Bartram" 1 => "C.Y. Lee" 2 => "J.V. Pond" 3 => "K.S. Surman-Lee" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "2007" "editorial" => "World Health Organization Press" "editorialLocalizacion" => "Geneva, Switzerland" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0210" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionella and Legionnaires’disease: 25 years of investigation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B.S. Fields" 1 => "R.F. Benson" 2 => "R.E. Besser" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.15.3.506-526.2002" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev." "fecha" => "2002" "volumen" => "15" "paginaInicial" => "506" "paginaFinal" => "526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12097254" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0215" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Are fluoroquinolones or macrolides better for treating Legionella pneumonia?. A systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.S. Jasper" 1 => "J.S. Musuuza" 2 => "J.S. Tischendorf" 3 => "V.W. Stevens" 4 => "S.D. Gamage" 5 => "F. Osman" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Infect Dis." "fecha" => "2007" "volumen" => "104" "paginaInicial" => "2295" "paginaFinal" => "2300" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0220" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequence-based typing of Legionellapneumophila serogroup 1 offers the potential for true portability in legionellosis outbreak investigation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "V. Gaia" 1 => "N.K. Fry" 2 => "T.G. Harrison" 3 => "R. Peduzzi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.41.7.2932-2939.2003" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol." "fecha" => "2003" "volumen" => "41" "paginaInicial" => "2932" "paginaFinal" => "2939" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12843023" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0225" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A multicentre study on the pathogenic agents in 665 adult patients with community-acquired pneumonia in cities of China" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.N. Liu" 1 => "M.J. Chen" 2 => "T.M. Zhao" 3 => "H. Wang" 4 => "R. Wang" 5 => "Q.F. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Chin J Tuberc Respir Dis." "fecha" => "2006" "volumen" => "9" "paginaInicial" => "3" "paginaFinal" => "8" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0230" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnostic, therapeutic and economic consequences of a positive urinary antigen test for Legionella spp. in patients admitted with community-acquired pneumonia: A 7-year retrospective evaluation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.F. Engel" 1 => "Manen Lv" 2 => "A.I. Hoepelman" 3 => "S. Thijsen" 4 => "J.J. Oosterheert" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/jclinpath-2012-201209" "Revista" => array:6 [ "tituloSerie" => "J Clin Pathol." "fecha" => "2013" "volumen" => "66" "paginaInicial" => "797" "paginaFinal" => "802" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23775436" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0235" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Addition of neuA, the gene encoding N-acylneuraminate cytidylyl transferase, increases the discriminatory ability of the consensus sequence-based scheme for typing Legionella pneumophila serogroup 1 strains" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Ratzow" 1 => "V. Gaia" 2 => "J.H. Helbig" 3 => "N.K. Fry" 4 => "P.C. Luck" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.00261-07" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol." "fecha" => "2007" "volumen" => "45" "paginaInicial" => "1965" "paginaFinal" => "1968" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17409215" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0240" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Homology of Legionella strains isolated from clinical cases and environmental water in Shenyang" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S.H. Zhao" 1 => "Y. Chen" 2 => "Zhang Ping" 3 => "B.Y. Hou" 4 => "L.I. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Natl Med J China" "fecha" => "2017" "volumen" => "97" "paginaInicial" => "1745" "paginaFinal" => "1748" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0245" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Typing methods for Legionella" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C. Lück" 1 => "N.K. Fry" 2 => "J.H. Helbig" 3 => "S. Jarraud" 4 => "T.G. Harrison" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-62703-161-5_6" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol." "fecha" => "2013" "volumen" => "954" "paginaInicial" => "119" "paginaFinal" => "148" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23150392" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0250" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Homology of Legionella strains isolated from clinical cases and environmental water in Shenyang" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Zhao" 1 => "Y. Chen" 2 => "P. Zhang" 3 => "B. Hou" 4 => "L. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3760/cma.j.issn.0376-2491.2017.22.015" "Revista" => array:6 [ "tituloSerie" => "National Medical Journal of China." "fecha" => "2017" "volumen" => "97" "paginaInicial" => "1745" "paginaFinal" => "1748" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28606287" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0255" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An update on Legionella" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Carratala" 1 => "C. Garcia-Vidal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/QCO.0b013e328336835b" "Revista" => array:6 [ "tituloSerie" => "Curr Opin Infect Dis." "fecha" => "2010" "volumen" => "23" "paginaInicial" => "152" "paginaFinal" => "157" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20051846" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0260" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multilocus sequence typing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.C. Enright" 1 => "B.G. Spratt" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0966-842x(99)01609-1" "Revista" => array:6 [ "tituloSerie" => "Trends Microbiol." "fecha" => "1999" "volumen" => "7" "paginaInicial" => "482" "paginaFinal" => "487" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10603483" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0265" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Distribution of sequence-based types of Legionella pneumophila serogroup 1 strains isolated from cooling towers, hot springs, and potable water systems in China" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Qin" 1 => "H.J. Zhou" 2 => "H.Y. Ren" 3 => "H. Guan" 4 => "M.C. Li" 5 => "B.Q. Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Appl. Environmen Microbiol." "fecha" => "2014" "volumen" => "80" "paginaInicial" => "2150" "paginaFinal" => "2157" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0270" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequence-based typing of Legionella pneumophila isolates from the public cooling tower water" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y. Zhang Li" 1 => "W.L. Zheng" 2 => "X.L. Ma" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin J Zoonoses." "fecha" => "2013" "volumen" => "29" "paginaInicial" => "262" "paginaFinal" => "266" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0275" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison among SBT. PFGE. AFLP molecular typing methods of Legionella pneumophila" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y.M. Guo" 1 => "J.K. Zhou" 2 => "H.X. Zhang" 3 => "L.Y. Qin" 4 => "D. Zhao" 5 => "H.D. Ju" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Journal of Microbiology." "fecha" => "2014" "volumen" => "34" "paginaInicial" => "72" "paginaFinal" => "77" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0280" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Research for gene typing of Legionella pneumophila in Sichuan province" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "H.X. Li" 1 => "W. Yao" 2 => "H.Y. Liao" 3 => "L.Z. Luo" 4 => "Z.L. Zeng" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Lab Med Clin." "fecha" => "2017" "volumen" => "12" "paginaInicial" => "3458" "paginaFinal" => "3460" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0285" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Air-conditioner cooling towers as complex reservoirs and continuous source of Legionella pneumophila infection evidenced by a genomic analysis study in 2017" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Wüthrich" 1 => "S. Gautsch" 2 => "R. Spieler-Denz" 3 => "O. Dubuis" 4 => "V. Gaia" 5 => "J. Moran-Gilad" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Switzerland. Euro Surveill." "fecha" => "2019" "volumen" => "24" "paginaInicial" => "1800192" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0290" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of sequence types among clinical and environmental isolates of Legionella pneumophila Serogroup 1 in the United States from 1982 to 2012" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N.A. Kozak-Muiznieks" 1 => "C.E. Lucas" 2 => "E. Brown" 3 => "T. Pondo" 4 => "T.H. Taylor Jr." 5 => "M. Frace" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.01973-13" "Revista" => array:7 [ "tituloSerie" => "J Clin Microbiol." "fecha" => "2013" "volumen" => "52" "paginaInicial" => "201" "paginaFinal" => "211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24197883" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1098301519300373" "estado" => "S300" "issn" => "10983015" ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0295" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionella pneumophila recurrently isolated in a Spanish hospital: Two years of antimicrobial resistance surveillance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "T. Graells" 1 => "M. Hernández-García" 2 => "J. Pérez-Jové" 3 => "L. Guy" 4 => "E. Padilla" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.envres.2018.06.045" "Revista" => array:6 [ "tituloSerie" => "Environ Res." "fecha" => "2018" "volumen" => "166" "paginaInicial" => "638" "paginaFinal" => "646" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29982152" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0300" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotypic diversity of Legionella pneumophila in environmental and clinical strains assessed by sequence based typing, in association with retrospective clinical surveillance in Northern Italy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Bianchi" 1 => "F. Pregliasco" 2 => "M. Consonni" 3 => "M. Tesauro" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.5604/12321966.1203885" "Revista" => array:6 [ "tituloSerie" => "Ann Agric Environ Med." "fecha" => "2016" "volumen" => "23" "paginaInicial" => "248" "paginaFinal" => "253" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27294627" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0305" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Importance of type II secretion for survival of Legionella pneumophila in tap water and in amoebae at low temperatures" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M.A. Soderberg" 1 => "J. Dao" 2 => "S.R. Starkenburg" 3 => "N.P. Cianciotto" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "App Environmen Microbiol." "fecha" => "2008" "volumen" => "74" "paginaInicial" => "5583" "paginaFinal" => "5588" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0310" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic diversity of Legionella pneumophila in hospital water systems" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "K. Oberdorfer" 1 => "G. Mussigbrodt" 2 => "C. Wendt" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ijheh.2007.04.003" "Revista" => array:6 [ "tituloSerie" => "Int J Hyg Environ Health." "fecha" => "2008" "volumen" => "211" "paginaInicial" => "172" "paginaFinal" => "178" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17652025" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0315" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequence types diversity of Legionella pneumophila isolates from environmental water sources in Guangzhou and Jiangmen" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Guo" 1 => "T. Liang" 2 => "C. Hu" 3 => "R. Lv" 4 => "X. Yang" 5 => "Y. Cui" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.meegid.2014.10.023" "Revista" => array:6 [ "tituloSerie" => "China. Infect Genet Evol." "fecha" => "2015" "volumen" => "29" "paginaInicial" => "35" "paginaFinal" => "41" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25445655" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0320" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequence-based typing research for Legionella pneumophila isolated from the air-conditioning cooling towers in Shijiazhuang" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Guo" 1 => "J. Zhou" 2 => "H. Ju" 3 => "L. Qin" 4 => "X. Wang" 5 => "B. Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Environ Health." "fecha" => "2012" "volumen" => "29" "paginaInicial" => "819" "paginaFinal" => "821" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0325" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "NPC. Pathogenicity of Legionella pneumophila Int J Med Microbiol. 291 2001. 331-343" ] ] ] 26 => array:3 [ "identificador" => "bib0330" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PulseNet USA: a five-year update" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Gerner-Smidt" 1 => "K. Hise" 2 => "J. Kincaid" 3 => "S. Hunter" 4 => "S. Rolando" 5 => "E. Hyytiä-Trees" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/fpd.2006.3.9" "Revista" => array:6 [ "tituloSerie" => "Foodborne Pathog Dis." "fecha" => "2006" "volumen" => "3" "paginaInicial" => "9" "paginaFinal" => "19" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16602975" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0335" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Optimization of pulsed-field gel electrophoresis for Legionella pneumophila subtyping" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Zhou" 1 => "H. Ren" 2 => "B. Zhu" 3 => "B. Kan" 4 => "J. Xu" 5 => "Z. Shao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AEM.01455-09" "Revista" => array:6 [ "tituloSerie" => "Appl Environ Microbiol." "fecha" => "2010" "volumen" => "76" "paginaInicial" => "1334" "paginaFinal" => "1340" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20061458" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0340" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A.E.K. Khodr" 1 => "L. Gomez-Valero" 2 => "C. Ginevra" 3 => "P. Doublet" 4 => "C.S. Buchrieser" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Jarraud. Molecular epidemiology, phylogeny and evolution of Legionella. Infect Genet Evol" "fecha" => "2016" "volumen" => "43" "paginaInicial" => "108" "paginaFinal" => "122" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0345" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An outbreak of Legionnaires’ disease in a Swedish hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Darelid" 1 => "L. Bengtsson" 2 => "B. Gästrin" 3 => "H. Hallander" 4 => "S. Löfgren" 5 => "B.E. Malmvall" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/00365549409008615" "Revista" => array:6 [ "tituloSerie" => "Scand J Infect Dis." "fecha" => "1994" "volumen" => "26" "paginaInicial" => "417" "paginaFinal" => "425" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7984974" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0350" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionella pneumophila serogroup 1 isolates from cooling towers in Japan form a distinct genetic cluster" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Amemura-Maekawa" 1 => "F. Kura" 2 => "B. Chang" 3 => "H. Watanabe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1348-0421.2005.tb03699.x" "Revista" => array:6 [ "tituloSerie" => "Microbiol Immunol." "fecha" => "2005" "volumen" => "49" "paginaInicial" => "1027" "paginaFinal" => "1033" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16365527" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0355" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Legionella pneumophila monoclonal antibody subgroups and DNA sequence types isolated in Canada between 1981 and 2009: Laboratory Component of National Surveillance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A.R. Reimer" 1 => "S. Au" 2 => "S. Schindle" 3 => "K.A. Bernard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10096-009-0840-3" "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis." "fecha" => "2010" "volumen" => "29" "paginaInicial" => "191" "paginaFinal" => "205" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19960359" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0360" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiological investigation of a legionellosis outbreak in a Slovenian nursing home" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Trop Skaza" 1 => "L. Beskovnik" 2 => "A. Storman" 3 => "D. Kese" 4 => "S. Ursic" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/00365548.2011.635313" "Revista" => array:6 [ "tituloSerie" => "August 2010. Scand J Infect Dis." "fecha" => "2012" "volumen" => "44" "paginaInicial" => "263" "paginaFinal" => "269" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22339541" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0365" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An outbreak of Legionnaires disease associated with a decorative water wall fountain in a hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T.E. Haupt" 1 => "R.T. Heffernan" 2 => "J.J. Kazmierczak" 3 => "H. Nehls-Lowe" 4 => "B. Rheineck" 5 => "C. Powell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Infec Control Hosp Epidemiol." "fecha" => "2012" "volumen" => "33" "paginaInicial" => "185" "paginaFinal" => "191" ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0370" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cluster of travel-associated Legionnaires disease in Lazise, Italy July to August 2011" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Rota" 1 => "M. Scaturro" 2 => "S. Fontana" 3 => "M. Foroni" 4 => "G. Boschetto" 5 => "L. Trentin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2807/ese.16.40.19982-en" "Revista" => array:5 [ "tituloSerie" => "Euro Surveill." "fecha" => "2011" "volumen" => "16" "paginaInicial" => "19982" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21996379" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0375" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Discriminatory usefulness of pulsed-field gel electrophoresis and sequence-based typing in Legionella outbreaks" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Quero" 1 => "M. Garcia-Nunez" 2 => "N. Parraga-Nino" 3 => "I. Barrabeig" 4 => "M. Pedro-Botet" 5 => "M. Simon" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2217/fmb-2015-0030" "Revista" => array:6 [ "tituloSerie" => "Future Microbiol." "fecha" => "2016" "volumen" => "11" "paginaInicial" => "757" "paginaFinal" => "765" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27191711" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0380" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Addition of neuA, the gene encoding N-acylneuraminate cytidylyl transferase, increases the discriminatory ability of the consensus sequence-based scheme for typing Legionella pneumophila serogroup 1 strains" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Ratzow" 1 => "V. Gaia" 2 => "J.H. Helbig" 3 => "N.K. Fry" 4 => "P.C. Luck" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.00261-07" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol." "fecha" => "2007" "volumen" => "45" "paginaInicial" => "1965" "paginaFinal" => "1968" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17409215" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0385" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Environmental surveillance and molecular characterization of Legionella in tropical Singapore" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y.H. Lim" 1 => "Y.L. Relus Kek" 2 => "P.Y. Lim" 3 => "H.M. Yap" 4 => "T.L. Vivien Goh" 5 => "L.C. Ng" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Trop Biomed." "fecha" => "2011" "volumen" => "28" "paginaInicial" => "149" "paginaFinal" => "159" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21602781" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0390" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Distribution of monoclonal antibody subgroups and sequence-based types among Legionella pneumophila serogroup 1 isolates derived from cooling tower water, bathwater, and soil in Japan" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Amemura-Maekawa" 1 => "K. Kikukawa" 2 => "J.H. Helbig" 3 => "S. Kaneko" 4 => "A. Suzuki-Hashimoto" 5 => "K. Furuhata" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AEM.06869-11" "Revista" => array:6 [ "tituloSerie" => "Appl Environ Microbiol." "fecha" => "2012" "volumen" => "78" "paginaInicial" => "4263" "paginaFinal" => "4270" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22492442" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack559119" "titulo" => "Acknowledgements" "texto" => "This study was supported by grants from the National Key R & D Program of China (Grant No. 2017YFC 1309702), The National Natural Science Foundation of China (Grant No. 81170009) and Medical Science and Technology Project of Zhejiang Province (No. 2020372703) and (No. 2020KY400)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X20302433/v1_202110050758/en/main.assets" "Apartado" => array:4 [ "identificador" => "8591" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/0213005X/0000003900000008/v1_202110050758/S0213005X20302433/v1_202110050758/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X20302433?idApp=UINPBA00004N"]

Statistics

Original

Sequence-based typing of clinical and environmental Legionella pneumophila isolates in Shenyang, China

Tipificación mediante secuenciación de aislados clínicos y ambientales de Legionella pneumophila en Shenyang, China

Luxi Jianga,b,1, Sihong Zhaoa,c,1, Xu Caid, Deguang Mub, Xianghua Zhangc, Jian Kangd, Li Zhaoa, Yu Chena,

Corresponding author

chenyusy@hotmail.com

Corresponding author.

a Department of Pulmonary and Critical Care Medicine, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China

b Department of Respiratory Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, Hangzhou, Zhejiang, China

c Department of Respiratory Medicine, the First Hospital of Shijiazhuang, Hebei, China

d Institute of Respiratory Disease, The First Hospital of China Medical University, Shenyang, China

Read

2712

Times
was read the article

968

Total PDF

1744

Total HTML

Share statistics

 array:24 [
  "pii" => "S0213005X20302433"
  "issn" => "0213005X"
  "doi" => "10.1016/j.eimc.2020.06.012"
  "estado" => "S300"
  "fechaPublicacion" => "2021-10-01"
  "aid" => "2244"
  "copyright" => "The Authors"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Enferm Infecc Microbiol Clin. 2021;39:383-9"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0213005X2030255X"
    "issn" => "0213005X"
    "doi" => "10.1016/j.eimc.2020.06.018"
    "estado" => "S300"
    "fechaPublicacion" => "2021-10-01"
    "aid" => "2253"
    "copyright" => "Sociedad Espa&#241;ola de Enfermedades Infecciosas y Microbiolog&#237;a Cl&#237;nica"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Enferm Infecc Microbiol Clin. 2021;39:390-4"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Encuesta de recursos diagn&#243;sticos de las ITS en Espa&#241;a"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "390"
          "paginaFinal" => "394"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Survey of diagnostic resources for STI in Spain"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Luis Otero-Guerra, Leire Gil-Alonso, Josefina L&#243;pez-de Munain, Jorge del Romero-Guerrero, Judit Serra-Pladevall, Fernando Vazquez"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Luis"
              "apellidos" => "Otero-Guerra"
            ]
            1 => array:2 [
              "nombre" => "Leire"
              "apellidos" => "Gil-Alonso"
            ]
            2 => array:2 [
              "nombre" => "Josefina"
              "apellidos" => "L&#243;pez-de Munain"
            ]
            3 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "del Romero-Guerrero"
            ]
            4 => array:2 [
              "nombre" => "Judit"
              "apellidos" => "Serra-Pladevall"
            ]
            5 => array:2 [
              "nombre" => "Fernando"
              "apellidos" => "Vazquez"
            ]
            6 => array:1 [
              "colaborador" => "miembros del Grupo GEITS"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2529993X21001490"
        "doi" => "10.1016/j.eimce.2021.07.002"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529993X21001490?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X2030255X?idApp=UINPBA00004N"
    "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X2030255X/v1_202110050758/es/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0213005X20302202"
    "issn" => "0213005X"
    "doi" => "10.1016/j.eimc.2020.05.021"
    "estado" => "S300"
    "fechaPublicacion" => "2021-10-01"
    "aid" => "2227"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Enfermedades Infecciosas y Microbiolog&#237;a Cl&#237;nica"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Enferm Infecc Microbiol Clin. 2021;39:372-82"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Diferencias epidemiol&#243;gicas y de mortalidad entre hombres y mujeres con infecci&#243;n por VIH en la cohorte CoRIS entre los a&#241;os 2004 y 2014"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "372"
          "paginaFinal" => "382"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Differences in epidemiology and mortality between men and women with HIV infection in the CoRIS cohort from 2004 to 2014"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figura 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1188
              "Ancho" => 2591
              "Tamanyo" => 138337
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Supervivencia seg&#250;n el sexo durante los tres periodos de tiempo&#46; Nota&#58; El eje de abscisas var&#237;a entre los tres gr&#225;ficos y el eje de ordenadas no se inicia en 0&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Constanza Mu&#241;oz Hornero, Alfonso Muriel, Marta Montero, Jos&#233; Antonio Iribarren, Mar Mas&#237;a, Leopoldo Mu&#241;oz, Gloria Samp&#233;riz, Gemma Navarro, Santiago Moreno, Mar&#237;a Jes&#250;s P&#233;rez-El&#237;as"
          "autores" => array:10 [
            0 => array:2 [
              "nombre" => "Constanza"
              "apellidos" => "Mu&#241;oz Hornero"
            ]
            1 => array:2 [
              "nombre" => "Alfonso"
              "apellidos" => "Muriel"
            ]
            2 => array:2 [
              "nombre" => "Marta"
              "apellidos" => "Montero"
            ]
            3 => array:2 [
              "nombre" => "Jos&#233; Antonio"
              "apellidos" => "Iribarren"
            ]
            4 => array:2 [
              "nombre" => "Mar"
              "apellidos" => "Mas&#237;a"
            ]
            5 => array:2 [
              "nombre" => "Leopoldo"
              "apellidos" => "Mu&#241;oz"
            ]
            6 => array:2 [
              "nombre" => "Gloria"
              "apellidos" => "Samp&#233;riz"
            ]
            7 => array:2 [
              "nombre" => "Gemma"
              "apellidos" => "Navarro"
            ]
            8 => array:2 [
              "nombre" => "Santiago"
              "apellidos" => "Moreno"
            ]
            9 => array:2 [
              "nombre" => "Mar&#237;a Jes&#250;s"
              "apellidos" => "P&#233;rez-El&#237;as"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2529993X21001787"
        "doi" => "10.1016/j.eimce.2021.06.001"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2529993X21001787?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X20302202?idApp=UINPBA00004N"
    "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X20302202/v1_202110050758/es/main.assets"
  ]
  "en" => array:21 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
    "titulo" => "Sequence-based typing of clinical and environmental Legionella pneumophila isolates in Shenyang&#44; China"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "383"
        "paginaFinal" => "389"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Luxi Jiang, Sihong Zhao, Xu Cai, Deguang Mu, Xianghua Zhang, Jian Kang, Li Zhao, Yu Chen"
        "autores" => array:8 [
          0 => array:3 [
            "nombre" => "Luxi"
            "apellidos" => "Jiang"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Sihong"
            "apellidos" => "Zhao"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Xu"
            "apellidos" => "Cai"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Deguang"
            "apellidos" => "Mu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Xianghua"
            "apellidos" => "Zhang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Jian"
            "apellidos" => "Kang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Li"
            "apellidos" => "Zhao"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          7 => array:4 [
            "nombre" => "Yu"
            "apellidos" => "Chen"
            "email" => array:1 [
              0 => "chenyusy@hotmail.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Department of Pulmonary and Critical Care Medicine&#44; Shengjing Hospital of China Medical University&#44; Shenyang&#44; Liaoning&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Department of Respiratory Medicine&#44; Zhejiang Provincial People&#39;s Hospital&#44; People&#39;s Hospital of Hangzhou Medical College&#44; Hangzhou&#44; Zhejiang&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Respiratory Medicine&#44; the First Hospital of Shijiazhuang&#44; Hebei&#44; China"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Institute of Respiratory Disease&#44; The First Hospital of China Medical University&#44; Shenyang&#44; China"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Tipificaci&#243;n mediante secuenciaci&#243;n de aislados cl&#237;nicos y ambientales de <span class="elsevierStyleItalic">Legionella pneumophila</span> en Shenyang&#44; China"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1807
            "Ancho" => 2167
            "Tamanyo" => 139474
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Cluster analysis results for 22 <span class="elsevierStyleItalic">L&#46; pneumophila</span> strains&#46; 1-N22&#58; strain1-strain22&#59; LP1&#44; LP7&#44; LP8&#58; <span class="elsevierStyleItalic">L&#46; pneumophila</span> serotypes 1&#44; 7 and 8&#59; SYA-SYN&#58; 14 different PFGE types&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">INTRODUCTION</span><p id="par0005" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Legionella pneumophila</span> &#40;LP&#41; is a Gram-negative organism ubiquitously found in natural rivers&#44; lakes&#44; soils&#44; and man-made water systems that include fountains&#44; cooling towers&#44; and bathing facilities&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">1</span></a> LP withstands temperatures of 50<span class="elsevierStyleHsp" style=""></span>&#176;C for several hours yet does not multiply at temperatures below 20<span class="elsevierStyleHsp" style=""></span>&#176;C&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">2</span></a> These organisms survive as intracellular parasites of amoebae&#44; ciliated protozoa&#44; or slime moulds&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">3</span></a> Infected amoebae are found in naturally occurring microbial communities that form biofilms&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">2</span></a> In humans&#44; the disease can occur as sporadic cases or as epidemics&#46; In the United States&#44; nearly 8&#44;000 people are hospitalized annually due to LP infection&#44; most commonly pneumonia&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">4</span></a> LP is the most or second most frequent community-acquired pneumonia that requires admission in intensive care units&#46; The mortality rate is higher than that due to other organisms&#44; particularly in immunocompromised patients&#44; and can reach 50&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">5</span></a> In China&#44; the proportion of <span class="elsevierStyleItalic">L&#46; pneumonia</span> as a cause of community-acquired pneumonia &#40;CAP&#41; is 5&#46;08&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">6</span></a> LP pneumonia often leads to severe pneumonia&#46; Nearly 50&#37; of hospitalized patients with LP pneumonia need to be admitted to the ICU&#44; with a mortality rate of 5-30&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">7</span></a> Since Legionnaires&#8217; disease is mainly transmitted via inhalation of infectious aerosols&#44;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">1</span></a> it is of great epidemiological significance to perform molecular epidemiology analysis of LP isolates and to trace the source of infection&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">The European Working Group for <span class="elsevierStyleItalic">Legionella</span> Infections &#40;EWGLI&#41; has established a global database of <span class="elsevierStyleItalic">Legionella</span> spp&#46; infections and identified sequence-based typing &#40;SBT&#41; as the &#8220;gold standard&#8221; for investigations of <span class="elsevierStyleItalic">Legionella</span> spp&#46; outbreaks&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">8</span></a> This method amplifies and sequences multiple <span class="elsevierStyleItalic">Legionella</span>-specific gene loci of the target isolate using polymerase chain reaction &#40;PCR&#41;&#46; The sequence obtained is compared with that in the SBT database established by EWGLI in order to obtain the corresponding gene locus type&#46; Finally&#44; the combination of all gene locus types for each isolate is used to obtain the Sequence Type &#40;ST&#41; of the target isolate&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">In the present study&#44; SBT was performed on seven specific gene loci &#40;<span class="elsevierStyleItalic">flaA&#44; pilE&#44; asd&#44; mip&#44; mompS&#44; proA&#44; neuA</span>&#41; in 22 LP isolates&#46; The results were compared with our previous research results&#44; that is&#44; pulsed field gel electrophoresis &#40;PFGE&#41; typing results&#44; and this provides evidence of the epidemiology of LP infection in Shenyang&#44; China&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">METHODS</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Bacterial isolates</span><p id="par0020" class="elsevierStylePara elsevierViewall">From July 2012 to September 2014&#44; 22 LP isolates were obtained&#44; including two respiratory clinical isolates and 20 environmental water isolates&#46; The two clinical isolates were collected from two large hospitals in Shenyang&#46; The hospitals have more than 6&#44;750 operational beds and&#160;they occupy a total land area of 625&#44;800 square meters&#46; The isolates were gathered from different patients&#44; and they corresponded to sporadic cases&#46; Twenty environment isolates were collected from 13 office buildings in different areas of Shenyang&#46; The sources of these isolates were&#58; domestic tap water &#40;one isolate&#41;&#44; shower water &#40;one isolate&#41;&#44; and cooling tower water &#40;18 isolates&#41;&#46; All these isolates were plated and cultured on buffered charcoal yeast extract &#40;BCYE&#41; agar plates &#40;Oxoid&#44; Germany&#41; for 48 h-72<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>&#176;C under a 5&#37; CO<span class="elsevierStyleInf">2</span> atmosphere&#46; The serogroup of the strains was identified by using a serum agglutination kit &#40;Legionella antisera&#44; Tianjin Biochip Corporatio&#44; China&#41;&#46; -</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Experimental methods</span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">DNA extraction</span><p id="par0025" class="elsevierStylePara elsevierViewall">Genomic template extraction kits &#40;QIAamp DNA minikits&#59; Qiagen&#44; Hilden&#44; Germany&#41; were purchased from Qiagen &#40;Beijing&#44; China&#41;&#46; DNA templates were extracted by DNA extraction kit &#40;QIAamp DNA Mini Kits&#44; Hilden&#44; Germany&#41; according to the manufacturer&#39;s instructions &#40;<a href="https://www.qiagen.com/">https&#58;&#47;&#47;www&#46;qiagen&#46;com</a> &#47;us&#47;products&#47;discovery-and-translational-research&#47;dna-rna-purification&#47;dna-purification&#47;genomic-dna&#47;qiaamp-dna-mini-kit&#47;&#63;clear&#61;true&#35;orderinginformation&#41;&#46; Nine hundred microliters of phosphate buffer was added to a 1&#46;5-ml centrifuge tube&#46; One colony of every isolate was picked using an inoculating loop and added to the buffer&#46; The tube was vortexed and centrifuged using a low-temperature high-speed benchtop centrifuge &#40;Kendro Laboratories&#44; USA&#41; at 8000 xp&#47;min for 5<span class="elsevierStyleHsp" style=""></span>min&#46; The supernatant was discarded&#46; ATL tissue lysis buffer &#40;provided by QlAamp DNA Mini Kit&#41; &#40;180<span class="elsevierStyleHsp" style=""></span>&#956;l&#41; was added to the centrifuge tube&#44; followed by 20<span class="elsevierStyleHsp" style=""></span>&#956;l of proteinase K&#46; The content was mixed by repeated resuspension and vortexing&#44; and was subsequently placed in a constant temperature water bath at 56<span class="elsevierStyleHsp" style=""></span>&#176;C for 2<span class="elsevierStyleHsp" style=""></span>h&#46; AL lysis buffer &#40;provided by QlAamp DNA Mini Kit&#41; &#40;200<span class="elsevierStyleHsp" style=""></span>&#956;l&#41; was added to the centrifuge tube and the tube was vortexed&#46; The tube was placed in a constant temperature metal bath at 70<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#44; followed by the addition of 200<span class="elsevierStyleHsp" style=""></span>&#956;l of absolute ethanol and vortexing&#46; The adsorption column &#40;provided by QlAamp DNA Mini Kit&#41; and collection tube &#40;provided by QlAamp DNA Mini Kit&#41; were assembled&#46; All the above liquids were transferred to the tube and centrifuged at 8000 xp&#47;min for 1<span class="elsevierStyleHsp" style=""></span>min&#46; The collection tube and the liquid were discarded and replaced with a new collection tube&#46; Subsequently&#44; 500<span class="elsevierStyleHsp" style=""></span>&#956;l of AW1 &#40;provided by QlAamp DNA Mini Kit&#41; was added to the adsorption column and centrifugation was performed at 8000 xp&#47;min for 1<span class="elsevierStyleHsp" style=""></span>min&#46; The collection tube and the liquid were once again discarded and replaced with a new collection tube&#44; and 500<span class="elsevierStyleHsp" style=""></span>&#956;l of AW2 &#40;provided by QlAamp DNA Mini Kit&#41; was added to the adsorption column&#46; Centrifugation was performed at 13&#44;000 xp&#47;min for 1<span class="elsevierStyleHsp" style=""></span>min&#46; The collection tube and the liquid were once again discarded&#46; Centrifugation was performed at 13000 xp&#47;min for 1<span class="elsevierStyleHsp" style=""></span>min and then 100<span class="elsevierStyleHsp" style=""></span>&#956;l of elution buffer AE &#40;provided by QlAamp DNA Mini Kit&#41; was added&#46; The collection tube and the liquid were discarded&#46; The collection tube was replaced with a 1&#46;5-ml centrifuge tube&#46; The centrifuge tube and adsorption column were left open for 5<span class="elsevierStyleHsp" style=""></span>minutes to reduce DNA damage by ethanol&#46; Centrifugation was performed again at 8000 xp&#47;min for 1<span class="elsevierStyleHsp" style=""></span>min&#46; The liquid after centrifugation was retained and the adsorption column discarded&#46; The resulting liquid contained the DNA of the target isolates&#46;</p></span></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Primer synthesis</span><p id="par0030" class="elsevierStylePara elsevierViewall">Specific upstream and downstream primers targeting the <span class="elsevierStyleItalic">flaA&#44; pilE&#44; asd&#44; mip</span>&#44; <span class="elsevierStyleItalic">mompS&#44; proA</span>&#44; and <span class="elsevierStyleItalic">neuA</span> genes of LP were synthesized by Sangon Biotech &#40;Shanghai&#41; Co&#46;&#44; Ltd&#44; China&#46; The sequences of the <span class="elsevierStyleItalic">Legionella</span>-specific primers are shown in the SBT database on the EWGLI website &#40;<a href="http://www.ewgli.org/">http&#58;&#47;&#47;www&#46;ewgli&#46;org</a>&#41;&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">PCR</span><p id="par0035" class="elsevierStylePara elsevierViewall">Premix Taq reaction system &#40;30<span class="elsevierStyleHsp" style=""></span>&#956;l&#41; comprising 15<span class="elsevierStyleHsp" style=""></span>&#956;l of Premix <span class="elsevierStyleItalic">Taq</span><span class="elsevierStyleSup">TM</span> &#40;TaKaRa Bio&#44; Japan&#41;&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;l of upstream primer&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;l of downstream primer&#44; 8<span class="elsevierStyleHsp" style=""></span>&#956;l of double-distilled water&#44; and 5<span class="elsevierStyleHsp" style=""></span>&#956;l of the extracted DNA samples were added to a 0&#46;2-ml centrifuge tube and vortexed&#46; The PCR reactions were performed in a Thermo Cycler &#40;Thermo Fisher Scientific&#44; USA&#41;&#46; The PCR cycling parameters were as follows&#58; denaturation at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#59; followed by 35 cycles of 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 30 s&#44; 55<span class="elsevierStyleHsp" style=""></span>&#176;C for 30 s&#44; and 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 60 s&#59; and a final extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Sequencing of PCR products</span><p id="par0040" class="elsevierStylePara elsevierViewall">The sequencing primers for <span class="elsevierStyleItalic">flaA&#44; pilE&#44; asd&#44; mip&#44; proA</span>&#44; and <span class="elsevierStyleItalic">neuA</span> were identical to the respective amplification primers&#46; The sequencing primers for <span class="elsevierStyleItalic">mompS</span> were mompS-450F&#58; TTGACCATGAGTGGGATTGG and mompS1015R&#58; CAGAAGCTG CGAAATCAG&#46; The obtained PCR amplicons were sequenced by Sangon Biotech &#40;Shanghai&#41; Co&#46;&#44; Ltd&#46; &#40;China&#41;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Data analysis</span><p id="par0045" class="elsevierStylePara elsevierViewall">The obtained gene sequences were uploaded to the SBT database on the EWGLI website &#40;<a href="http://www.ewgli.org/">http&#58;&#47;&#47;www&#46;ewgli&#46;org</a>&#41; for comparison&#44; and the allele number of each gene locus was obtained&#46; All allele numbers of the target isolates were uploaded&#44; and the STs of the target isolates were obtained&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">PFGE &#40;Pulsed-Field Gel Electrophoresis&#41;</span><p id="par0050" class="elsevierStylePara elsevierViewall">PFGE is based on the separation of macro-restriction fragments of the bacterial chromosome generated by digestion with an infrequent cutting site restriction endonuclease by pulse-field gel electrophoresis&#46; In our previous study&#44; we used the enzyme <span class="elsevierStyleItalic">Asc</span>I as restriction endonuclease&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">9</span></a> Detailed PFGE experimental methods are available at <a href="http://rs.yiigle.com/CN112137201722/992083.htm">http&#58;&#47;&#47;rs&#46;yiigle&#46;com&#47;CN112137201722&#47;992083&#46;htm</a></p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">RESULTS</span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Serogroups of the isolates</span><p id="par0055" class="elsevierStylePara elsevierViewall">Serogroup identification using serum agglutination tests showed that the isolates belonged to LP serogroup 1 &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>20&#41;&#44; serogroup 7 &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#41;&#44; and serogroup 8 &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#41;&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">PCR amplicons of specific gene loci</span><p id="par0060" class="elsevierStylePara elsevierViewall">The sizes of the PCR amplicons of the seven specific loci were&#58; <span class="elsevierStyleItalic">flaA</span>&#44; 414<span class="elsevierStyleHsp" style=""></span>bp&#59; <span class="elsevierStyleItalic">pilE</span>&#44; 460<span class="elsevierStyleHsp" style=""></span>bp&#59; <span class="elsevierStyleItalic">asd</span>&#44; 576<span class="elsevierStyleHsp" style=""></span>bp&#59; <span class="elsevierStyleItalic">mip&#44;</span> 559<span class="elsevierStyleHsp" style=""></span>bp&#59; <span class="elsevierStyleItalic">mompS</span>&#44; 711<span class="elsevierStyleHsp" style=""></span>bp&#59; <span class="elsevierStyleItalic">proA</span>&#44; 481<span class="elsevierStyleHsp" style=""></span>bp&#59; and <span class="elsevierStyleItalic">neuA</span>&#44; 459<span class="elsevierStyleHsp" style=""></span>bp&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">10</span></a> Of the 22 LP isolates&#44; 20 had all 7 target genes amplified&#46; The target genes <span class="elsevierStyleItalic">asd</span> and <span class="elsevierStyleItalic">mip</span> of isolates 10 and 11 were negative after repeated amplification attempts&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">SBT results</span><p id="par0065" class="elsevierStylePara elsevierViewall">The sequences were uploaded to the EWGLI database&#44; and the allele numbers of the various housekeeping genes were obtained &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; The allele numbers of the seven housekeeping genes of each target isolate were uploaded to the database to obtain the ST of the isolate&#46; Of the 20 LP isolates with complete sequences&#44; 14 belonged to ST1&#44; one belonged to ST328&#44; and the remaining five belonged to ST types that have not been reported internationally&#46; The sequences were uploaded to the EWGLI website&#44; with assigned ST numbers of ST2345&#44; ST2344&#44; ST2406&#44; ST2407&#44; and ST2408&#46; The pulsotypes and STs of the 22 LP isolates are summarized in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Results of SBT and PFGE typing</span><p id="par0070" class="elsevierStylePara elsevierViewall">The 22 <span class="elsevierStyleItalic">Legionella</span> isolates in the present study had been previously tested by PFGE&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">11</span></a> The serogroups&#44; PFGE types&#44; SBT types&#44; and sources of the isolates are summarized in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The results of cluster analysis of the 22 isolates are shown in <a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">DISCUSSION</span><p id="par0075" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">L&#46; pneumophila</span> is widely found in the environment&#46; It can cause sporadic outbreaks through contaminated aerosols and can lead to fatal infections&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">12</span></a> Homologous analysis of clinical and environmental LP isolates for the determination of their genetic relationships can facilitate the tracing of the source of infection and can further the understanding of the prevalence of this organism&#46; This knowledge is important for the prevention and control of LP infections&#46; Current molecular typing methods used for bacterial homology analysis include PFGE&#44; amplified fragment length polymorphism &#40;AFLP&#41; analysis&#44; random amplified polymorphic DNA &#40;RAPD&#41; analysis&#44; and restriction fragment length polymorphism &#40;RFLP&#41;&#46; However&#44; even in a laboratory with sophisticated experimental techniques&#44; the results of experiments conducted at different times are not 100&#37; consistent&#46; Disadvantages of AFLP include the imprecision of fragment sizing resulting in difficulty in comparing patterns between laboratories and platforms&#46; For LP this method has largely been replaced by SBT&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">10</span></a> Since LP can cause travel-related infections&#44; it is of considerable epidemiological significance to perform standardized molecular typing of isolates from different countries and to determine their homology&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Multilocus sequence typing was originally proposed by Enright et al&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">13</span></a> for the epidemiological analysis of <span class="elsevierStyleItalic">Streptococcus pneumoniae</span>&#46; Gaia <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">5</span></a> applied this method to establish and evaluate the SBT method for the analysis of LP serogroup 1&#46; The authors subsequently made improvements and performed typing using five virulence genes &#40;<span class="elsevierStyleItalic">flaA&#44; pilE&#44; mip&#44; mompS</span>&#44; and <span class="elsevierStyleItalic">proA</span>&#41; and one housekeeping gene &#40;<span class="elsevierStyleItalic">asd</span>&#41;&#44; and extended the application to non&#8211;serogroup 1 LP isolates&#46; Ratzow <span class="elsevierStyleItalic">et al&#46;</span><a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">8</span></a> added a housekeeping gene &#40;<span class="elsevierStyleItalic">neuA</span>&#41; based on the data of Gaia <span class="elsevierStyleItalic">et al</span>&#46;&#44;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">5</span></a> which further improved the discriminatory ability of SBT&#46; Of the seven gene loci&#44; <span class="elsevierStyleItalic">flaA</span> encodes the flagellar subunit protein&#44; <span class="elsevierStyleItalic">pilE</span> encodes type IV pili&#44; <span class="elsevierStyleItalic">asd</span> encodes aspartate-&#946;-semialdehyde dehydrogenase&#44; <span class="elsevierStyleItalic">mip</span> encodes a protein that enhances macrophage infection&#44; <span class="elsevierStyleItalic">mompS</span> encodes an outer membrane protein&#44; <span class="elsevierStyleItalic">proA</span> encodes a zinc metalloproteinase&#44; and <span class="elsevierStyleItalic">neuA</span> encodes an N-acyl-neuraminic cytidine transferase&#46; EWGLI has established a standard operating procedure for SBT of <span class="elsevierStyleItalic">Legionella</span> spp&#46; with accurate and objective results&#44; and has created an online database&#46; The database is available to the global research community and the results from each laboratory in all regions can be uploaded and compared&#46; The SBT database for LP is constantly expanding and is important in the epidemiology of <span class="elsevierStyleItalic">Legionella</span> spp&#46;<a class="elsevierStyleCrossRefs" href="#bib0220"><span class="elsevierStyleSup">5&#44;8</span></a></p><p id="par0085" class="elsevierStylePara elsevierViewall">Qin <span class="elsevierStyleItalic">et al&#46;</span><a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">14</span></a> conducted SBT typing on 164 LP serogroup 1 isolates from cooling towers&#44; hot springs&#44; and drinking water in the six cities of Shanghai&#44; Beijing&#44; Shenzhen&#44; Wuxi&#44; Jinan&#44; and Shijiazhuang over a 7-year period&#46; Most of the isolates belonged to ST1&#44; accounting for 49&#46;4&#37; of the cases &#40;81 isolates&#41;&#46; ST1 existed in all cities and was the most predominant ST in China&#46; In addition&#44; the STs varied in different water sources and in different cities&#46; The present study is the first to perform SBT typing of LP isolated from Shenyang&#46; ST1 predominated &#40;63&#46;6&#37;&#44; 14 isolates&#41; and was the main epidemic type in this region&#46; Our findings&#44; ST1 was the main epidemic type in this region of China&#44; was consistent with data from other domestic studies&#46;<a class="elsevierStyleCrossRefs" href="#bib0270"><span class="elsevierStyleSup">15&#8211;17</span></a> In addition&#44; LP ST1 isolates of clinical relevance are spread worldwide&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">18</span></a> In a study performed in the United States&#44; of clinical and environmental isolates of LP serotype 1 &#40;LP1&#41; from 1982 to 2012&#44; ST1&#44; ST35&#44; ST36&#44; ST37&#44; and ST222 were responsible for both outbreak-associated and sporadic cases&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">19</span></a> In Germany the most common clinical ST was ST1&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">1</span></a> In this study&#44; we also found ST328 in Shenyang&#39;s cooling tower water environment&#46; This ST328 type was also isolated in hot water circuits in a large Spanish hospital&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">20</span></a> These environmental strains were isolated from taps and showers throughout the whole Spanish hospital&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">20</span></a> Besides&#44; this ST328 environmental strain has been isolated sporadically&#44; among others&#44; in a nursing facility in Italy&#44; where several cases of atypical pneumonia were recorded&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">21</span></a> The climate and water sources of these countries are different&#44; so we consider that ST328 may also be widely spread globally&#46; In addition&#44; there were five STs that have not been previously reported in China or elsewhere&#46; These STs were confirmed using the EWGLI website and were designated ST2345&#44; ST2344&#44; ST2406&#44; ST2407&#44; and ST2408&#46; These results indicate that LP isolates in Shenyang display a unique gene specificity&#46; The two LP isolates from the respiratory clinical specimens from patients belonged to novel STs &#40;ST2345&#44; ST2344&#41; that have not been previously reported&#46; Isolate 1 was collected from a 59-year-old male patient with a history of cirrhosis&#46; Two weeks prior to disease onset&#44; the patient received root canal treatment in a private dental clinic&#46; The suspected route of infection was the inhalation of water contaminated with LP that was present in the tubes of the dental instruments&#46; Isolate 2 was collected from a 45-year-old male plumber who had a history of sewer operations before the onset of the disease&#59; the inhalation of LP present in the sewage could be a possible route of infection&#46; These two new pathogenic STs of LP exist in the environment or in certain medical facilities in Shenyang&#46; Isolates 20&#44; 21&#44; and 22 were from the environment and have not been previously reported in China and elsewhere&#44; indicating the uniqueness of <span class="elsevierStyleItalic">L&#46; pneumoniae</span> in environmental waters of Shenyang&#46; The virulence of these three types of <span class="elsevierStyleItalic">L&#46; pneumoniae</span> remains to be elucidated in future studies&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Legionella</span> spp&#46; can exist for a long period in low-temperature environments and in amoeba in water&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">22</span></a> Oberdorfer <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">23</span></a> demonstrated that this organism can also exist for a long period of time in constructed water supply systems&#46; Therefore&#44; long-term monitoring and genetic analyses should be performed on <span class="elsevierStyleItalic">Legionella</span> spp&#46; isolated from the environment and water supply systems&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Both isolates 9 and 21 were collected from the cooling tower of the central air-conditioning system in the same office building&#46; However&#44; the water samples collected from different parts contained different STs&#44; suggesting that multiple types of genetically unrelated strains could coexist in the same environment&#46; Therefore&#44; if an outbreak occurs&#44; multipoint sampling should be performed in all suspicious environments for molecular analysis&#46; For isolates 10 and 11&#44; not all housekeeping genes could be amplified&#44; with <span class="elsevierStyleItalic">asd</span> and <span class="elsevierStyleItalic">mip</span> genes unable to be amplified&#46; Certain genes may differ from the housekeeping genes in the SBT database because of genetic variations in the bases within the specific primer-binding regions&#46; It has been reported the loss of the <span class="elsevierStyleItalic">neuA&#44; flaA</span>&#44; and <span class="elsevierStyleItalic">proA</span> genes in LP isolates&#46;<a class="elsevierStyleCrossRefs" href="#bib0315"><span class="elsevierStyleSup">24&#8211;26</span></a></p><p id="par0100" class="elsevierStylePara elsevierViewall">PFGE has been widely used as the &#8220;gold standard&#8221; for the molecular typing of pathogenic bacteria&#44;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">26</span></a> such as <span class="elsevierStyleItalic">Salmonella</span> spp&#46;&#44; <span class="elsevierStyleItalic">Escherichia coli</span>&#44; and <span class="elsevierStyleItalic">Staphylococcus aureus</span>&#46; PFGE is important in the study and confirmation of the outbreaks of pathogenic bacteria&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">27</span></a> Zhou <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">28</span></a> optimized PFGE for LP and selected <span class="elsevierStyleItalic">Asc</span>I as the preferred restriction endonuclease to analyze various serogroups of LP&#46; The results indicated that clustering of PFGE patterns demonstrated high discriminatory power in typing&#46; Despite its high discriminatory power&#44; this method suffers some drawbacks&#58; it is time consuming&#44; inter-gel reproducibility is often poor&#44; electrophoresis requires specific equipment and computer-aided imaging analysis is needed&#44; data are difficult to exchange between laboratories making investigations of travel associated <span class="elsevierStyleItalic">Legionella</span> spp&#46; disease cases more difficult&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">29</span></a> Despite international efforts for standardization of PFGE typing protocols &#40;restriction endonuclease&#44; plug preparation and electrophoretic parameters&#41; the obtained data remain difficult to exchange&#46; Our group has previously shown<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">11</span></a> that the predominant PFGE type of LP in Shenyang is SYC&#44; which includes seven molecular types isolated from four different locations and water systems&#44; with 100&#37; homology&#46; Isolates belonging to serogroup LP1 can show different PFGE patterns&#46; As shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#44; the 22 isolates belonged to 14 PFGE types&#44; which also suggests the polymorphism of LP pulsotypes in Shenyang&#46; Isolates 1 and 2 were collected from respiratory samples of two patients with <span class="elsevierStyleItalic">L&#46; pneumoniae</span> pneumonia&#46; The two isolates were genetically unrelated and were also genetically unrelated to isolates 3 and 4 collected from the same hospital environment&#46; In addition&#44; the two patients had symptoms related to LP infection before admission&#44; and both had a suspected history of exposure to a water source contaminated with LP&#46; After admission&#44; the initial antibiotics did not cover legionellosis&#44; and the patients&#8217; condition worsened&#46; Only after adequate treatment&#44; the patients&#8217; condition improved&#46; These findings suggest that the two patients were infected with LP from outside the hospital&#46; Isolates 10 and 11 were collected from different outlets of the cooling tower in company C&#59; their homology was 100&#37;&#46; Isolates 3 and 4 were collected from different outlets of the cooling tower in hospital A&#44; and the bands were identical&#46; These results indicate the presence of a predominant strain in the same cooling tower&#46; Isolates 6&#44; 7&#44; and 8 were collected from the air-conditioning cooling tower water&#44; drinking water&#44; and shower water of hospital B&#46; The three isolates belonged to the same clonal line&#44; indicating the presence of cross-contamination of LP in different water systems of the same location&#46; Blowing devices are often located near the cooling tower of air-conditioning system&#46; Once LP is present in the cooling tower water system&#44; aerosols containing the bacterium are readily formed and spread&#44; leading to cross-contamination in different water systems&#46; A study reported a LP in a Swedish hospital due to contamination of the shower water system&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">30</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">The present study used SBT for the typing for 22 clinical and environmental LP isolates in Shenyang&#46; In addition&#44; we also compared the SBT results with the PFGE results previously obtained&#46; PFGE typing separated 14 types of patterns and SBT discriminated 7 SBT types&#46; Both typing methods showed that predominant clonal lines exist in the region&#44; with high levels of genetic polymorphisms&#46; Meanwhile&#44; five novel SBT types have been identified&#44; indicating that the types of LP strains in this region are unique in genetic composition and differ significantly from others described from environmental water systems elsewhere in the world&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">Twenty of the 22 LP isolates were assigned an ST&#44; of which 14 isolates belonged to ST1&#46; These 14 LP isolates displayed a certain molecular homology&#44; but it was difficult to further analyze them by using SBT&#46; SBT primarily distinguishes the genetic diversity of LP isolates that belong to different STs&#46; By using this technique it is possible to compare LP isolates of different STs with the genetics of LP globally&#46; However&#44; it is difficult to analyze LP isolates that belong to the same ST by using this method&#44; and its discriminatory ability is weak&#46; The present data show that isolates of the same ST belonged to different PFGE types&#44; suggesting that analysis by PFGE is better to SBT in tracking infections&#46; Amemura-Maekawa <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">31</span></a> performed the typing of 31 LP1 by using SBT combined with PFGE&#44; and found that PFGE was able to divide the isolates into 30 different types&#44; whereas SBT could only divide the isolates into 16 types&#46; The authors reported that the efficiency of SBT was lower than the PFGE typing method&#46; A Japanese study divided the LP isolate ST505 into two distinct types using PFGE typing&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">32</span></a> Several studies utilized seven housekeeping genes to perform SBT and could not effectively trace the source of infection in hospital and community outbreaks of Legionnaires&#8217; disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0360"><span class="elsevierStyleSup">33&#8211;35</span></a> Therefore&#44; when SBT is unable to trace the source of infection&#44; other methods&#44; such as PFGE&#44; should be used in combination&#46; Quero <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">36</span></a> conducted an epidemiological study on 25 Legionnaires&#8217; disease outbreaks&#44; and concluded that the concordance between SBT and PFGE in epidemiological investigations was 100&#37;&#44; but their concordance in molecular typing studies was 64&#37;&#46;<a class="elsevierStyleCrossRefs" href="#bib0350"><span class="elsevierStyleSup">31&#8211;36</span></a> Due to the respective advantages and disadvantages of SBT and PFGE&#44; the two methods should be used in combination when conducting epidemiological studies and tracing outbreaks due to LP&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">SBT is based on the sequence comparison of several PCR-amplified DNA fragments&#46; Since 2007&#44; a consensus was defined and SBT is the gold standard method recommended by EWGLI for LP subtyping&#46;<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">37</span></a> Isolation of clinical or environmental LP strains is not an easy task&#46; This impairs the epidemiological investigations&#44; as both clinical and environmental isolates are required for comparisons to find the source of infection&#46; In this respect&#44; SBT as PCR-based methods have an advantage as they can be applied directly to DNA extracted from clinical or environmental samples without the need to isolate the strains&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">29</span></a> Besides&#44; SBT is effective for epidemiological investigations on environmental and clinical isolates&#44;<a class="elsevierStyleCrossRefs" href="#bib0385"><span class="elsevierStyleSup">38&#44;39</span></a> and SBT has considerable advantages in the analysis of the evolutionary relationships and distribution of epidemics of bacterial strains&#46; EWGLI has established a standard operating procedure for SBT and created an online <span class="elsevierStyleItalic">Legionella</span> SBT database &#40;<a href="http://www.ewgli.org/">http&#58;&#47;&#47;www&#46;ewgli&#46;org</a>&#41; that can be shared worldwide&#46; SBT is simple to perform and is rapid&#46; It has standardized procedures&#44; and can provide objective and definitive results&#46; In addition&#44; the obtained isolate sequences can be compared with the data from other laboratories&#46; Currently&#44; SBT is widely used globally for the investigations of <span class="elsevierStyleItalic">Legionella</span> spp&#46; epidemiology&#46; Furthermore&#44; SBT displays good discriminatory power for the typing of LP1&#46;<a class="elsevierStyleCrossRefs" href="#bib0385"><span class="elsevierStyleSup">38&#44;39</span></a> SBT is superior to the PFGE method for epidemiological and evolutionary analysis&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">29</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">In summary&#44; our study indicates that LP is prevalent in public water systems and hospital water systems in Shenyang&#44; China&#46; SBT typing of isolates show that LP in Shenyang displays extensive genetic polymorphisms&#46; Although some variations in SBT types have been identified&#44; the same types of isolates still exist in some water sources&#46; LP colonization of hospitals and public water systems may lead to LP outbreaks&#46; The key to prevention of legionellosis is the proper maintenance of water systems in which <span class="elsevierStyleItalic">Legionella</span> spp&#46; is able to grow&#46; Active surveillance of water systems in hospitals and other facilities is required and regularly disinfection is needed&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Author contributions</span><p id="par0125" class="elsevierStylePara elsevierViewall">Luxi Jiang&#44; Sihong Zhao and Yu Chen designed and conducted the experiments&#44; collected and analyzed the data&#44; and wrote the paper&#46; Deguang Mu&#44; Xianghua Zhang&#44; Jian Kang and Li Zhao designed the experiments and contributed to revising the paper&#46; Luxi Jiang&#44; Xu Cai&#44; Sihong Zhao and Yu Chen conducted the experiments&#44; collected and processed the clinical specimens&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Conflicts of Interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors declare no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1582905"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1424648"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1582906"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1424649"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "INTRODUCTION"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "METHODS"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Bacterial isolates"
            ]
            1 => array:3 [
              "identificador" => "sec0020"
              "titulo" => "Experimental methods"
              "secciones" => array:1 [
                0 => array:2 [
                  "identificador" => "sec0025"
                  "titulo" => "DNA extraction"
                ]
              ]
            ]
            2 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Primer synthesis"
            ]
            3 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "PCR"
            ]
            4 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Sequencing of PCR products"
            ]
            5 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Data analysis"
            ]
            6 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "PFGE &#40;Pulsed-Field Gel Electrophoresis&#41;"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0055"
          "titulo" => "RESULTS"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Serogroups of the isolates"
            ]
            1 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "PCR amplicons of specific gene loci"
            ]
            2 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "SBT results"
            ]
            3 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "Results of SBT and PFGE typing"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "DISCUSSION"
        ]
        8 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Author contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Conflicts of Interest"
        ]
        10 => array:2 [
          "identificador" => "xack559119"
          "titulo" => "Acknowledgements"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-02-17"
    "fechaAceptado" => "2020-06-04"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1424648"
          "palabras" => array:5 [
            0 => "Legionella"
            1 => "Serogroup"
            2 => "SBT"
            3 => "PFGE"
            4 => "Sequence Type"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1424649"
          "palabras" => array:5 [
            0 => "Legionella"
            1 => "Serogrupo"
            2 => "SBT"
            3 => "PFGE"
            4 => "Tipo de secuencia"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">We performed SBT &#40;sequence-based typing&#41; on clinical and environmental <span class="elsevierStyleItalic">Legionella</span><span class="elsevierStyleItalic">pneumophila</span> isolates in Shenyang &#40;China&#41;&#46; We analyzed and compared the results with those obtained by PFGE &#40;pulsed field gel electrophoresis&#41;&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Twenty-two <span class="elsevierStyleItalic">L&#46; pneumophila</span> isolates were collected from two patients with <span class="elsevierStyleItalic">L&#46; pneumophila</span> infection&#44; two&#160;hospitals&#44; and 13 office buildings&#46; There were two clinical isolates&#44; one strain isolated from domestic tap water&#44; another from shower water and 18 strains from cooling tower water&#46; All these isolates were analyzed by SBT and PFGE methods&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The 22 isolates were divided into 7 types by SBT&#46; Five isolates belonged to novel sequence types &#40;ST2345&#44; ST2344&#44; ST2406&#44; ST2407&#44; and ST2408&#41; and one isolate belonged to ST328&#46; The STs were not obtained for two of the isolates&#46; The remaining 14 isolates belonged to ST1&#46; PFGE typing divided the 22 isolates into 14 pulsotypes&#46; The main pulsotype was SYC&#44; which included seven isolates&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Both typing methods showed that predominant clonal lines exist in the Shenyang region&#44; with high levels of genetic polymorphisms&#46; Five novel STs were identified&#44; indicating a unique genetic composition of <span class="elsevierStyleItalic">L&#46; pneumophila</span> strains in this region&#44; which are significantly different from those found in other environmental water systems in the world&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducci&#243;n</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Realizamos una tipificaci&#243;n mediante secuenciaci&#243;n &#40;SBT&#41; de aislados cl&#237;nicos y ambientales de <span class="elsevierStyleItalic">Legionella</span><span class="elsevierStyleItalic">pneumophila</span> en Shenyang&#44; China&#46; Analizamos y comparamos los resultados con los obtenidos por electroforesis en campo pulsado &#40;PFGE&#41;&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Se recogieron 22 aislados de <span class="elsevierStyleItalic">Legionella pneumophila</span> de dos pacientes con infecci&#243;n por <span class="elsevierStyleItalic">Legionella pneumophila</span>&#44; dos hospitales y 13 edificios de oficinas&#46; Hubo dos aislados cl&#237;nicos&#44; una cepa aislada del agua del grifo dom&#233;stico&#44; otra del agua de la ducha y 18 cepas del agua de la torre de refrigeraci&#243;n&#46; Todos estos aislados se analizaron por los m&#233;todos SBT y PFGE&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Los 22 aislados se dividieron en siete tipos de SBT&#59; cinco aislados pertenec&#237;an a nuevos tipos de secuencia &#40;ST2345&#44; ST2344&#44; ST2406&#44; ST2407 y ST2408&#41; y un aislado pertenec&#237;a a ST328&#46; No se obtuvieron secuenciotipos &#40;ST&#41; de dos de los aislados&#46; Los 14 aislados restantes pertenec&#237;an a ST1&#46; La tipificaci&#243;n por PGGE dividi&#243; los 22 aislados en 14 pulsotipos&#46; El pulsotipo principal fue SYC&#44; e incluy&#243; siete aislados&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Ambos m&#233;todos de tipificaci&#243;n mostraron que existen l&#237;neas clonales predominantes en la regi&#243;n de Shenyang&#44; con altos niveles de polimorfismos gen&#233;ticos&#46; Se identificaron cinco nuevos ST&#44; lo que indica una composici&#243;n gen&#233;tica &#250;nica de las cepas de <span class="elsevierStyleItalic">Legionella</span><span class="elsevierStyleItalic">pneumophila</span> en esta regi&#243;n&#44; que difieren significativamente de las que se encuentran en otros sistemas h&#237;dricos ambientales del mundo&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Luxi Jiang and Sihong Zhao&#44; contributed equally to this work&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "multimedia" => array:3 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1807
            "Ancho" => 2167
            "Tamanyo" => 139474
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Cluster analysis results for 22 <span class="elsevierStyleItalic">L&#46; pneumophila</span> strains&#46; 1-N22&#58; strain1-strain22&#59; LP1&#44; LP7&#44; LP8&#58; <span class="elsevierStyleItalic">L&#46; pneumophila</span> serotypes 1&#44; 7 and 8&#59; SYA-SYN&#58; 14 different PFGE types&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="7" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Allele number</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Sequence type&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Number of isolates&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">asd</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">flaA</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">mip</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">mompS</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">neuA</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">pilE</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">proA</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST328&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">57&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST2345<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST2344<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST2406<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">215&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST2407<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">207&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ST2408<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2711472.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Five isolates belonged to novel sequence types &#40;ST2345&#44; ST2344&#44; ST2406&#44; ST2407&#44; and ST2408&#41;&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Description of allele number&#44; sequence type&#44; and number of isolates &#40;analysis of 22 <span class="elsevierStyleItalic">Legionella pneumophila</span> strains&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">LP&#58; <span class="elsevierStyleItalic">Legionella pneumophila</span>&#59; SYA&#8764;SYN&#58;14 PFGE patterns&#59; &#8220;-&#8221;&#58; Don&#8217;t have ST type&#59; P&#58; patient&#59; H&#58; hospital&#59; OB&#58; office building&#59; S&#58; sputum&#59; CT&#58; cooling tower&#59; SW&#58; shower water&#59; PW&#58; pipe water&#59;&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Strain number&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Serotype&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">LP8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PFGE pattern&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYK&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYM&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYM&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYB&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYF&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYJ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYN&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SYI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sequence type &#40;ST&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2345&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2344&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">328&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2406&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2407&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2408&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Source of strain&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">P-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">P-2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H-A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H-A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H-B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H-B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">H-B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-D&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-E&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB- F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB- H&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-I&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-J&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-K&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-L&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">OB-M&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">sample&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2711473.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Serotypes&#44; PFGE patterns&#44; sequence types and source &#40;analysis of 22 <span class="elsevierStyleItalic">Legionella pneumophila</span> strains&#41;&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Legionnaires&#8217; disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46;A&#46; Cunha"
                            1 => "A&#46; Burillo"
                            2 => "E&#46; Bouza"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "The Lancet&#46;"
                        "fecha" => "2016"
                        "volumen" => "387"
                        "numero" => "10016"
                        "paginaInicial" => "376"
                        "paginaFinal" => "385"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Legionella</span> and the prevention of legionellosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Bartram"
                            1 => "C&#46;Y&#46; Lee"
                            2 => "J&#46;V&#46; Pond"
                            3 => "K&#46;S&#46; Surman-Lee"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:3 [
                        "fecha" => "2007"
                        "editorial" => "World Health Organization Press"
                        "editorialLocalizacion" => "Geneva&#44; Switzerland"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Legionella</span> and Legionnaires&#8217;disease&#58; 25 years of investigation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46;S&#46; Fields"
                            1 => "R&#46;F&#46; Benson"
                            2 => "R&#46;E&#46; Besser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/CMR.15.3.506-526.2002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Microbiol Rev&#46;"
                        "fecha" => "2002"
                        "volumen" => "15"
                        "paginaInicial" => "506"
                        "paginaFinal" => "526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12097254"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Are fluoroquinolones or macrolides better for treating <span class="elsevierStyleItalic">Legionella</span> pneumonia&#63;&#46; A systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;S&#46; Jasper"
                            1 => "J&#46;S&#46; Musuuza"
                            2 => "J&#46;S&#46; Tischendorf"
                            3 => "V&#46;W&#46; Stevens"
                            4 => "S&#46;D&#46; Gamage"
                            5 => "F&#46; Osman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Infect Dis&#46;"
                        "fecha" => "2007"
                        "volumen" => "104"
                        "paginaInicial" => "2295"
                        "paginaFinal" => "2300"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequence-based typing of <span class="elsevierStyleItalic">Legionella</span><span class="elsevierStyleItalic">pneumophila</span> serogroup 1 offers the potential for true portability in legionellosis outbreak investigation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "V&#46; Gaia"
                            1 => "N&#46;K&#46; Fry"
                            2 => "T&#46;G&#46; Harrison"
                            3 => "R&#46; Peduzzi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.41.7.2932-2939.2003"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2003"
                        "volumen" => "41"
                        "paginaInicial" => "2932"
                        "paginaFinal" => "2939"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12843023"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A multicentre study on the pathogenic agents in 665 adult patients with community-acquired pneumonia in cities of China"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;N&#46; Liu"
                            1 => "M&#46;J&#46; Chen"
                            2 => "T&#46;M&#46; Zhao"
                            3 => "H&#46; Wang"
                            4 => "R&#46; Wang"
                            5 => "Q&#46;F&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Chin J Tuberc Respir Dis&#46;"
                        "fecha" => "2006"
                        "volumen" => "9"
                        "paginaInicial" => "3"
                        "paginaFinal" => "8"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnostic&#44; therapeutic and economic consequences of a positive urinary antigen test for <span class="elsevierStyleItalic">Legionella</span> spp&#46; in patients admitted with community-acquired pneumonia&#58; A 7-year retrospective evaluation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;F&#46; Engel"
                            1 => "Manen Lv"
                            2 => "A&#46;I&#46; Hoepelman"
                            3 => "S&#46; Thijsen"
                            4 => "J&#46;J&#46; Oosterheert"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/jclinpath-2012-201209"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Pathol&#46;"
                        "fecha" => "2013"
                        "volumen" => "66"
                        "paginaInicial" => "797"
                        "paginaFinal" => "802"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23775436"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Addition of <span class="elsevierStyleItalic">neuA</span>&#44; the gene encoding N-acylneuraminate cytidylyl transferase&#44; increases the discriminatory ability of the consensus sequence-based scheme for typing <span class="elsevierStyleItalic">Legionella pneumophila</span> serogroup 1 strains"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Ratzow"
                            1 => "V&#46; Gaia"
                            2 => "J&#46;H&#46; Helbig"
                            3 => "N&#46;K&#46; Fry"
                            4 => "P&#46;C&#46; Luck"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.00261-07"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2007"
                        "volumen" => "45"
                        "paginaInicial" => "1965"
                        "paginaFinal" => "1968"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17409215"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Homology of Legionella strains isolated from clinical cases and environmental water in Shenyang"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46;H&#46; Zhao"
                            1 => "Y&#46; Chen"
                            2 => "Zhang Ping"
                            3 => "B&#46;Y&#46; Hou"
                            4 => "L&#46;I&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Natl Med J China"
                        "fecha" => "2017"
                        "volumen" => "97"
                        "paginaInicial" => "1745"
                        "paginaFinal" => "1748"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Typing methods for <span class="elsevierStyleItalic">Legionella</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46; L&#252;ck"
                            1 => "N&#46;K&#46; Fry"
                            2 => "J&#46;H&#46; Helbig"
                            3 => "S&#46; Jarraud"
                            4 => "T&#46;G&#46; Harrison"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-62703-161-5_6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol&#46;"
                        "fecha" => "2013"
                        "volumen" => "954"
                        "paginaInicial" => "119"
                        "paginaFinal" => "148"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23150392"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Homology of <span class="elsevierStyleItalic">Legionella</span> strains isolated from clinical cases and environmental water in Shenyang"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Zhao"
                            1 => "Y&#46; Chen"
                            2 => "P&#46; Zhang"
                            3 => "B&#46; Hou"
                            4 => "L&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3760/cma.j.issn.0376-2491.2017.22.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "National Medical Journal of China&#46;"
                        "fecha" => "2017"
                        "volumen" => "97"
                        "paginaInicial" => "1745"
                        "paginaFinal" => "1748"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28606287"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An update on <span class="elsevierStyleItalic">Legionella</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Carratala"
                            1 => "C&#46; Garcia-Vidal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/QCO.0b013e328336835b"
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Opin Infect Dis&#46;"
                        "fecha" => "2010"
                        "volumen" => "23"
                        "paginaInicial" => "152"
                        "paginaFinal" => "157"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20051846"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multilocus sequence typing"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;C&#46; Enright"
                            1 => "B&#46;G&#46; Spratt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0966-842x(99)01609-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Trends Microbiol&#46;"
                        "fecha" => "1999"
                        "volumen" => "7"
                        "paginaInicial" => "482"
                        "paginaFinal" => "487"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10603483"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Distribution of sequence-based types of <span class="elsevierStyleItalic">Legionella pneumophila</span> serogroup 1 strains isolated from cooling towers&#44; hot springs&#44; and potable water systems in China"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Qin"
                            1 => "H&#46;J&#46; Zhou"
                            2 => "H&#46;Y&#46; Ren"
                            3 => "H&#46; Guan"
                            4 => "M&#46;C&#46; Li"
                            5 => "B&#46;Q&#46; Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Appl&#46; Environmen Microbiol&#46;"
                        "fecha" => "2014"
                        "volumen" => "80"
                        "paginaInicial" => "2150"
                        "paginaFinal" => "2157"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequence-based typing of <span class="elsevierStyleItalic">Legionella pneumophila</span> isolates from the public cooling tower water"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Y&#46; Zhang Li"
                            1 => "W&#46;L&#46; Zheng"
                            2 => "X&#46;L&#46; Ma"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin J Zoonoses&#46;"
                        "fecha" => "2013"
                        "volumen" => "29"
                        "paginaInicial" => "262"
                        "paginaFinal" => "266"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison among SBT&#46; PFGE&#46; AFLP molecular typing methods of <span class="elsevierStyleItalic">Legionella pneumophila</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46;M&#46; Guo"
                            1 => "J&#46;K&#46; Zhou"
                            2 => "H&#46;X&#46; Zhang"
                            3 => "L&#46;Y&#46; Qin"
                            4 => "D&#46; Zhao"
                            5 => "H&#46;D&#46; Ju"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Journal of Microbiology&#46;"
                        "fecha" => "2014"
                        "volumen" => "34"
                        "paginaInicial" => "72"
                        "paginaFinal" => "77"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Research for gene typing of <span class="elsevierStyleItalic">Legionella pneumophila</span> in Sichuan province"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46;X&#46; Li"
                            1 => "W&#46; Yao"
                            2 => "H&#46;Y&#46; Liao"
                            3 => "L&#46;Z&#46; Luo"
                            4 => "Z&#46;L&#46; Zeng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Lab Med Clin&#46;"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "3458"
                        "paginaFinal" => "3460"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Air-conditioner cooling towers as complex reservoirs and continuous source of <span class="elsevierStyleItalic">Legionella pneumophila</span> infection evidenced by a genomic analysis study in 2017"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; W&#252;thrich"
                            1 => "S&#46; Gautsch"
                            2 => "R&#46; Spieler-Denz"
                            3 => "O&#46; Dubuis"
                            4 => "V&#46; Gaia"
                            5 => "J&#46; Moran-Gilad"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Switzerland&#46; Euro Surveill&#46;"
                        "fecha" => "2019"
                        "volumen" => "24"
                        "paginaInicial" => "1800192"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of sequence types among clinical and environmental isolates of <span class="elsevierStyleItalic">Legionella pneumophila</span> Serogroup 1 in the United States from 1982 to 2012"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;A&#46; Kozak-Muiznieks"
                            1 => "C&#46;E&#46; Lucas"
                            2 => "E&#46; Brown"
                            3 => "T&#46; Pondo"
                            4 => "T&#46;H&#46; Taylor Jr&#46;"
                            5 => "M&#46; Frace"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.01973-13"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2013"
                        "volumen" => "52"
                        "paginaInicial" => "201"
                        "paginaFinal" => "211"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24197883"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1098301519300373"
                          "estado" => "S300"
                          "issn" => "10983015"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Legionella pneumophila</span> recurrently isolated in a Spanish hospital&#58; Two years of antimicrobial resistance surveillance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "T&#46; Graells"
                            1 => "M&#46; Hern&#225;ndez-Garc&#237;a"
                            2 => "J&#46; P&#233;rez-Jov&#233;"
                            3 => "L&#46; Guy"
                            4 => "E&#46; Padilla"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.envres.2018.06.045"
                      "Revista" => array:6 [
                        "tituloSerie" => "Environ Res&#46;"
                        "fecha" => "2018"
                        "volumen" => "166"
                        "paginaInicial" => "638"
                        "paginaFinal" => "646"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29982152"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genotypic diversity of <span class="elsevierStyleItalic">Legionella pneumophila</span> in environmental and clinical strains assessed by sequence based typing&#44; in association with retrospective clinical surveillance in Northern Italy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46; Bianchi"
                            1 => "F&#46; Pregliasco"
                            2 => "M&#46; Consonni"
                            3 => "M&#46; Tesauro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5604/12321966.1203885"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Agric Environ Med&#46;"
                        "fecha" => "2016"
                        "volumen" => "23"
                        "paginaInicial" => "248"
                        "paginaFinal" => "253"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27294627"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Importance of type II secretion for survival of <span class="elsevierStyleItalic">Legionella pneumophila</span> in tap water and in amoebae at low temperatures"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46;A&#46; Soderberg"
                            1 => "J&#46; Dao"
                            2 => "S&#46;R&#46; Starkenburg"
                            3 => "N&#46;P&#46; Cianciotto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "App Environmen Microbiol&#46;"
                        "fecha" => "2008"
                        "volumen" => "74"
                        "paginaInicial" => "5583"
                        "paginaFinal" => "5588"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic diversity of <span class="elsevierStyleItalic">Legionella pneumophila</span> in hospital water systems"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K&#46; Oberdorfer"
                            1 => "G&#46; Mussigbrodt"
                            2 => "C&#46; Wendt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ijheh.2007.04.003"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Hyg Environ Health&#46;"
                        "fecha" => "2008"
                        "volumen" => "211"
                        "paginaInicial" => "172"
                        "paginaFinal" => "178"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17652025"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequence types diversity of <span class="elsevierStyleItalic">Legionella pneumophila</span> isolates from environmental water sources in Guangzhou and Jiangmen"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Guo"
                            1 => "T&#46; Liang"
                            2 => "C&#46; Hu"
                            3 => "R&#46; Lv"
                            4 => "X&#46; Yang"
                            5 => "Y&#46; Cui"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.meegid.2014.10.023"
                      "Revista" => array:6 [
                        "tituloSerie" => "China&#46; Infect Genet Evol&#46;"
                        "fecha" => "2015"
                        "volumen" => "29"
                        "paginaInicial" => "35"
                        "paginaFinal" => "41"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25445655"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequence-based typing research for <span class="elsevierStyleItalic">Legionella pneumophila</span> isolated from the air-conditioning cooling towers in Shijiazhuang"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Guo"
                            1 => "J&#46; Zhou"
                            2 => "H&#46; Ju"
                            3 => "L&#46; Qin"
                            4 => "X&#46; Wang"
                            5 => "B&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Environ Health&#46;"
                        "fecha" => "2012"
                        "volumen" => "29"
                        "paginaInicial" => "819"
                        "paginaFinal" => "821"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "NPC&#46; Pathogenicity of <span class="elsevierStyleItalic">Legionella pneumophila</span> Int J Med Microbiol&#46; 291 2001&#46; 331-343"
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "PulseNet USA&#58; a five-year update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46; Gerner-Smidt"
                            1 => "K&#46; Hise"
                            2 => "J&#46; Kincaid"
                            3 => "S&#46; Hunter"
                            4 => "S&#46; Rolando"
                            5 => "E&#46; Hyyti&#228;-Trees"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/fpd.2006.3.9"
                      "Revista" => array:6 [
                        "tituloSerie" => "Foodborne Pathog Dis&#46;"
                        "fecha" => "2006"
                        "volumen" => "3"
                        "paginaInicial" => "9"
                        "paginaFinal" => "19"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16602975"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Optimization of pulsed-field gel electrophoresis for <span class="elsevierStyleItalic">Legionella pneumophila</span> subtyping"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Zhou"
                            1 => "H&#46; Ren"
                            2 => "B&#46; Zhu"
                            3 => "B&#46; Kan"
                            4 => "J&#46; Xu"
                            5 => "Z&#46; Shao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/AEM.01455-09"
                      "Revista" => array:6 [
                        "tituloSerie" => "Appl Environ Microbiol&#46;"
                        "fecha" => "2010"
                        "volumen" => "76"
                        "paginaInicial" => "1334"
                        "paginaFinal" => "1340"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20061458"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:1 [
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46;E&#46;K&#46; Khodr"
                            1 => "L&#46; Gomez-Valero"
                            2 => "C&#46; Ginevra"
                            3 => "P&#46; Doublet"
                            4 => "C&#46;S&#46; Buchrieser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Jarraud&#46; Molecular epidemiology&#44; phylogeny and evolution of <span class="elsevierStyleItalic">Legionella</span>&#46; Infect Genet Evol"
                        "fecha" => "2016"
                        "volumen" => "43"
                        "paginaInicial" => "108"
                        "paginaFinal" => "122"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An outbreak of Legionnaires&#8217; disease in a Swedish hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Darelid"
                            1 => "L&#46; Bengtsson"
                            2 => "B&#46; G&#228;strin"
                            3 => "H&#46; Hallander"
                            4 => "S&#46; L&#246;fgren"
                            5 => "B&#46;E&#46; Malmvall"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/00365549409008615"
                      "Revista" => array:6 [
                        "tituloSerie" => "Scand J Infect Dis&#46;"
                        "fecha" => "1994"
                        "volumen" => "26"
                        "paginaInicial" => "417"
                        "paginaFinal" => "425"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7984974"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Legionella pneumophila</span> serogroup 1 isolates from cooling towers in Japan form a distinct genetic cluster"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Amemura-Maekawa"
                            1 => "F&#46; Kura"
                            2 => "B&#46; Chang"
                            3 => "H&#46; Watanabe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1348-0421.2005.tb03699.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microbiol Immunol&#46;"
                        "fecha" => "2005"
                        "volumen" => "49"
                        "paginaInicial" => "1027"
                        "paginaFinal" => "1033"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16365527"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Legionella pneumophila</span> monoclonal antibody subgroups and DNA sequence types isolated in Canada between 1981 and 2009&#58; Laboratory Component of National Surveillance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;R&#46; Reimer"
                            1 => "S&#46; Au"
                            2 => "S&#46; Schindle"
                            3 => "K&#46;A&#46; Bernard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10096-009-0840-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Clin Microbiol Infect Dis&#46;"
                        "fecha" => "2010"
                        "volumen" => "29"
                        "paginaInicial" => "191"
                        "paginaFinal" => "205"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19960359"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiological investigation of a legionellosis outbreak in a Slovenian nursing home"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Trop Skaza"
                            1 => "L&#46; Beskovnik"
                            2 => "A&#46; Storman"
                            3 => "D&#46; Kese"
                            4 => "S&#46; Ursic"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/00365548.2011.635313"
                      "Revista" => array:6 [
                        "tituloSerie" => "August 2010&#46; Scand J Infect Dis&#46;"
                        "fecha" => "2012"
                        "volumen" => "44"
                        "paginaInicial" => "263"
                        "paginaFinal" => "269"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22339541"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An outbreak of Legionnaires disease associated with a decorative water wall fountain in a hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46;E&#46; Haupt"
                            1 => "R&#46;T&#46; Heffernan"
                            2 => "J&#46;J&#46; Kazmierczak"
                            3 => "H&#46; Nehls-Lowe"
                            4 => "B&#46; Rheineck"
                            5 => "C&#46; Powell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Infec Control Hosp Epidemiol&#46;"
                        "fecha" => "2012"
                        "volumen" => "33"
                        "paginaInicial" => "185"
                        "paginaFinal" => "191"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cluster of travel-associated Legionnaires disease in Lazise&#44; Italy July to August 2011"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Rota"
                            1 => "M&#46; Scaturro"
                            2 => "S&#46; Fontana"
                            3 => "M&#46; Foroni"
                            4 => "G&#46; Boschetto"
                            5 => "L&#46; Trentin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2807/ese.16.40.19982-en"
                      "Revista" => array:5 [
                        "tituloSerie" => "Euro Surveill&#46;"
                        "fecha" => "2011"
                        "volumen" => "16"
                        "paginaInicial" => "19982"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21996379"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Discriminatory usefulness of pulsed-field gel electrophoresis and sequence-based typing in <span class="elsevierStyleItalic">Legionella</span> outbreaks"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Quero"
                            1 => "M&#46; Garcia-Nunez"
                            2 => "N&#46; Parraga-Nino"
                            3 => "I&#46; Barrabeig"
                            4 => "M&#46; Pedro-Botet"
                            5 => "M&#46; Simon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2217/fmb-2015-0030"
                      "Revista" => array:6 [
                        "tituloSerie" => "Future Microbiol&#46;"
                        "fecha" => "2016"
                        "volumen" => "11"
                        "paginaInicial" => "757"
                        "paginaFinal" => "765"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27191711"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Addition of <span class="elsevierStyleItalic">neuA</span>&#44; the gene encoding N-acylneuraminate cytidylyl transferase&#44; increases the discriminatory ability of the consensus sequence-based scheme for typing <span class="elsevierStyleItalic">Legionella pneumophila</span> serogroup 1 strains"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Ratzow"
                            1 => "V&#46; Gaia"
                            2 => "J&#46;H&#46; Helbig"
                            3 => "N&#46;K&#46; Fry"
                            4 => "P&#46;C&#46; Luck"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.00261-07"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2007"
                        "volumen" => "45"
                        "paginaInicial" => "1965"
                        "paginaFinal" => "1968"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17409215"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Environmental surveillance and molecular characterization of <span class="elsevierStyleItalic">Legionella</span> in tropical Singapore"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46;H&#46; Lim"
                            1 => "Y&#46;L&#46; Relus Kek"
                            2 => "P&#46;Y&#46; Lim"
                            3 => "H&#46;M&#46; Yap"
                            4 => "T&#46;L&#46; Vivien Goh"
                            5 => "L&#46;C&#46; Ng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Trop Biomed&#46;"
                        "fecha" => "2011"
                        "volumen" => "28"
                        "paginaInicial" => "149"
                        "paginaFinal" => "159"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21602781"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Distribution of monoclonal antibody subgroups and sequence-based types among <span class="elsevierStyleItalic">Legionella pneumophila</span> serogroup 1 isolates derived from cooling tower water&#44; bathwater&#44; and soil in Japan"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Amemura-Maekawa"
                            1 => "K&#46; Kikukawa"
                            2 => "J&#46;H&#46; Helbig"
                            3 => "S&#46; Kaneko"
                            4 => "A&#46; Suzuki-Hashimoto"
                            5 => "K&#46; Furuhata"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/AEM.06869-11"
                      "Revista" => array:6 [
                        "tituloSerie" => "Appl Environ Microbiol&#46;"
                        "fecha" => "2012"
                        "volumen" => "78"
                        "paginaInicial" => "4263"
                        "paginaFinal" => "4270"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22492442"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack559119"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0135" class="elsevierStylePara elsevierViewall">This study was supported by grants from the National Key R &#38; D Program of China &#40;Grant No&#46; 2017YFC 1309702&#41;&#44; The National Natural Science Foundation of China &#40;Grant No&#46; 81170009&#41; and Medical Science and Technology Project of Zhejiang Province &#40;No&#46; 2020372703&#41; and &#40;No&#46; 2020KY400&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/0213005X/0000003900000008/v1_202110050758/S0213005X20302433/v1_202110050758/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "8591"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/0213005X/0000003900000008/v1_202110050758/S0213005X20302433/v1_202110050758/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X20302433?idApp=UINPBA00004N"
]

Article information

ISSN: 0213005X
Original language: English

DOI:10.1016/j.eimc.2020.06.012

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 October	7	4	11
2024 September	26	15	41
2024 August	32	9	41
2024 July	30	16	46
2024 June	24	17	41
2024 May	34	19	53
2024 April	57	35	92
2024 March	76	24	100
2024 February	54	11	65
2024 January	33	26	59
2023 December	37	30	67
2023 November	45	21	66
2023 October	57	56	113
2023 September	36	9	45
2023 August	28	19	47
2023 July	24	57	81
2023 June	49	30	79
2023 May	58	31	89
2023 April	62	30	92
2023 March	69	27	96
2023 February	33	15	48
2023 January	36	16	52
2022 December	28	17	45
2022 November	77	43	120
2022 October	48	29	77
2022 September	28	25	53
2022 August	34	16	50
2022 July	15	18	33
2022 June	21	31	52
2022 May	40	23	63
2022 April	37	23	60
2022 March	29	18	47
2022 February	41	9	50
2022 January	62	8	70
2021 December	36	12	48
2021 November	28	12	40
2021 October	81	46	127
2021 September	30	10	40
2021 August	45	12	57
2021 July	10	6	16
2021 June	15	6	21
2021 May	18	4	22
2021 April	21	17	38
2021 March	17	12	29
2021 February	9	10	19
2021 January	17	9	26
2020 December	9	3	12
2020 November	10	4	14
2020 October	7	8	15
2020 September	12	4	16
2020 August	8	13	21
2020 July	4	3	7

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter