Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress | Gastroenterología y Hepatología (English Edition)

array:22 ["pii" => "S2444382421000183" "issn" => "24443824" "doi" => "10.1016/j.gastre.2020.05.011" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "1589" "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Gastroenterol Hepatol. 2021;44:1-12" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "Traduccion" => array:1 [ "en" => array:18 [ "pii" => "S0210570520302491" "issn" => "02105705" "doi" => "10.1016/j.gastrohep.2020.05.017" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "1589" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Gastroenterol Hepatol. 2021;44:1-12" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "12" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "El topotecán induce una lesión hepatocelular a través del estrés oxidativo mediado por el ASCT2" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2090 "Ancho" => 2504 "Tamanyo" => 231961 ] ] "descripcion" => array:1 [ "en" => "Topotecan increased ROS level and decreased GSH level in L02 and HepG2 cells. (A) and (B) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. ROS level was detected using ROS detection kit. (C) and (D) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. GSH level was detected using a GSH detection kit. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Guoliang Zhou, Meisong Qin, Xiaolin Zhang, Jianting Yang, Hao Yu" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Guoliang" "apellidos" => "Zhou" ] 1 => array:2 [ "nombre" => "Meisong" "apellidos" => "Qin" ] 2 => array:2 [ "nombre" => "Xiaolin" "apellidos" => "Zhang" ] 3 => array:2 [ "nombre" => "Jianting" "apellidos" => "Yang" ] 4 => array:2 [ "nombre" => "Hao" "apellidos" => "Yu" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2444382421000183" "doi" => "10.1016/j.gastre.2020.05.011" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000183?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570520302491?idApp=UINPBA00004N" "url" => "/02105705/0000004400000001/v1_202101130647/S0210570520302491/v1_202101130647/en/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S2444382421000171" "issn" => "24443824" "doi" => "10.1016/j.gastre.2020.05.010" "estado" => "S300" "fechaPublicacion" => "2021-01-01" "aid" => "1587" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Gastroenterol Hepatol. 2021;44:13-9" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "Vitamin D in dysphagic patients who have undergone endoscopic gastrostomy for long-term enteral feeding" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "13" "paginaFinal" => "19" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Vitamina D en pacientes con disfagia sometidos a gastrostomía endoscópica percutánea para una nutrición enteral de larga duración" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Carla Adriana Santos, Gonçalo Nunes, Ana Teresa Barata, Jorge Fonseca" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Carla Adriana" "apellidos" => "Santos" ] 1 => array:2 [ "nombre" => "Gonçalo" "apellidos" => "Nunes" ] 2 => array:2 [ "nombre" => "Ana Teresa" "apellidos" => "Barata" ] 3 => array:2 [ "nombre" => "Jorge" "apellidos" => "Fonseca" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S0210570520302478" "doi" => "10.1016/j.gastrohep.2020.05.016" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570520302478?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000171?idApp=UINPBA00004N" "url" => "/24443824/0000004400000001/v2_202102250807/S2444382421000171/v2_202102250807/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "12" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Guoliang Zhou, Meisong Qin, Xiaolin Zhang, Jianting Yang, Hao Yu" "autores" => array:5 [ 0 => array:3 [ "nombre" => "Guoliang" "apellidos" => "Zhou" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Meisong" "apellidos" => "Qin" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Xiaolin" "apellidos" => "Zhang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "Jianting" "apellidos" => "Yang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 4 => array:4 [ "nombre" => "Hao" "apellidos" => "Yu" "email" => array:1 [ 0 => "hz_1230@163.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Department of Pharmacy, School of Life and Health Sciences, Anhui Science and Technology University, Fengyang, Anhui, China" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "College of Food Engineering, Anhui Science and Technology University, Fengyang, Anhui, China" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "El topotecán induce una lesión hepatocelular a través del estrés oxidativo mediado por el ASCT2" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 4064 "Ancho" => 2920 "Tamanyo" => 593583 ] ] "descripcion" => array:1 [ "en" => "Topotecan inhibited glutamine uptake via suppressing ASCT2 expression in L02 and HepG2 cells. L02 and HepG2 cells were treated with topotecan with different concentration for 24h. RNA and protein samples were harvested. mRNA expression of ASCT2 was detected by quantitative real-time PCR in L02 (A) and HepG2 (B) cells. Protein expression of ASCT2 was detected by western blot (C) and (D). (E) and (F) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. Glutamine concentration in medium was detected using glutamine detection kit. Then glutamine uptake was calculated according to original concentration of glutamine in medium. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. **P<0.01; ***P<0.001; ****P<0.0001." ] ] ] "textoCompleto" => "IntroductionTopotecan is a DNA topoisomerase I (Topo I) inhibitor as a camptothecin derivative. It can prevent DNA replication and RNA synthesis via binding with Topo I-DNA complex and finally induces the death of cancer cells.<a class="elsevierStyleCrossRef" href="#bib0105">1</a> However, as a widely used broad anti-cancer medicine, topotecan could bring hepatotoxicity when treats several tumor types in clinical use.<a class="elsevierStyleCrossRef" href="#bib0110">2</a> In a phase I/II study of cyclophosphamide and topotecan in patients with high-risk malignancies undergoing autologous hematopoietic cell transplantation, two patients experienced reversible hepatotoxicity.<a class="elsevierStyleCrossRef" href="#bib0115">3</a> In a study reported on a three-drug (topotecan, thiotepa, and carboplatin) myeloablative regimen designed to consolidate remission and to prevent central nervous system (CNS) relapse of high-risk neuroblastoma (NB) in 66 patients, Grade 2 hepatotoxicity led to truncating cytoreduction in two patients.<a class="elsevierStyleCrossRef" href="#bib0120">4</a> Moreover, in another Phase I and pharmacokinetic study of topotecan performed in patient with refractory solid tumors, elevated AST and ALT was observed.<a class="elsevierStyleCrossRef" href="#bib0125">5</a>Living cells need increased antioxidant to keep redox equilibrium when faces danger signaling caused excessive reactive oxygen species (ROS).<a class="elsevierStyleCrossRef" href="#bib0130">6</a> Glutathione (GSH) is the most important antioxidant and plays the most important role in preventing ROS induced cell death.<a class="elsevierStyleCrossRef" href="#bib0135">7</a> Glutamine is one of the three amino forming GSH. Thus, the glutamine level must influence GSH production in living cells. Alanine, serine, cysteine-preferring transporter 2 (ASCT2; SLC1A5) is a cell surface solute-carrying transporter that mediates uptake of neutral amino acids including glutamine. In recent years, ASCT2 has been demonstrated as the most important glutamine transporter in cancer cells.<a class="elsevierStyleCrossRefs" href="#bib0140">8–10</a> Inhibition ASCT2 could kill cancer cells and ASCT2 has already been raised as a drugable target of cancer treatment. Recently, topotecan was demonstrated to inhibit gastric cancer cell proliferation via suppressing ASCT2 expression.<a class="elsevierStyleCrossRef" href="#bib0155">11</a> However, whether ASCT2 involves in topotecan-induced hepatocellular injury is still unclear. In our study, we aimed to investigate the role of ASCT2 in topotecan-induced hepatocellular injury.Materials and methodsTested drugTopotecan was purchased from Dalian Meilun Biotechnology Co., LTD. CAS: 119413-54-6.Cell linesThe human normal hepatocytes L02 cells and HepG2 hepatocellular carcinoma cells were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). All cells were cultured in Dulbecco's modified Eagle's medium (Gibco, Grand Island, USA) with 10% fetal bovine serum (FBS; Gibco, Grand Island, USA), 1% penicillin-streptomycin and maintained at 37°C in a humidified incubator with 5% CO2.ReagentsAnnexin V-FITC/PI Apoptosis Detection Kit (Containing 250μl Annexin V-FITC, 250μl PI Staining Solution and 25ml 1× Binding Buffer) was purchased from Vazyme Biotech (Nanjing, China). p-mTOR (Ser473), mTOR, p-p70S6k (Thr389), p70S6k primary antibodies were purchased from Cell Signaling Technol (USA), β-Actin, Caspase 3, Caspase 9, PARP primary antibodies were purchased from Proteintech Group (Wuhan, China). MTT was purchased from Beyotime (Nanjing, China).Quantitative real-time PCR (qRT-PCR)L02 and HepG2 cells were treated with topotecan with different concentrations (0.01μM, 0.1μM, 1μM) for 24h. Total cellular RNA was isolated with the TRIzol Reagent (Vazyme, Nanjing, China) and reverse transcribed with the Revert Aid TM First Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The mRNA level was measured with the SYBR Green master mix (Vazyme, Nanjing, China). The amount of mRNA for each gene was standardized with the internal control (18s rRNA). Each treatment group was compared with the control group to show the relative mRNA level. The primer sequences for qRT-PCR are provided in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Western blot analysisL02 and HepG2 cells were treated with topotecan with different concentrations (0.01μM, 0.1μM, 1μM) for 24h, cellular proteins were extracted. The BCA method was used to detect the protein concentration. SDS-PAGE was used to separate proteins and then transfer the protein to the NC membrane. After blocked by 5% non-fat milk for 1 hour, the membrane was incubated with indicated primary antibodies overnight at 4°C (All primary antibodies were diluted with 5% BSA with a ratio of 1:1000). After then the NC membrane was washed with TBST three times (10min each time). The membrane was incubated in HRP labeled secondary antibodies for 2h at room temperature (Secondary antibodies were diluted with 5% BSA with a ratio of 1:5000). After washing with TBST three times (10min each time), the NC membrane was visualized by using ECL coloring solution for 5min. The photos were captured by Image Lab 5.0 (Bio-Rad Laboratories, USA) and the density values were calculated by Image J (National Institutes of Health, USA).Annexin V/PI double stainingAfter treatment with 0.01μM, 0.1μM, 1μM topotecan for 24h, L02 and HepG2 cells were digested with 0.25% trypsin without EDTA and were collected via centrifugation at a rotate speed of 500rpm/min. Apoptotic cells were identified by the Annexin V-FITC Apoptosis Detection kit (Vazyme, Nanjing, China) in accordance with the manufacturer's instructions. Cells were washed with fresh PBS buffer for 3 times. Took out around 5×105cells into another tube, then centrifuged it at a rotate speed of 500rpm/min for 5min. Then remove the supernatant carefully. Add 100μl 1× Binding Buffer and gently blow into the single-cell suspension. Then add 5μl Annexin V-FITC solution and 5μl PI Staining Solution for staining for 10min in dark. Flow cytometric analysis was performed immediately after supravital staining. Data acquisition and analysis were performed in a Becton Dickinson FACS-Calibur flow cytometer using the Cell Quest software (Franklin Lakes). For blocking reactive oxygen species (ROS), cells were treated with 5mM N-acetylcysteine (Beyotime, Nanjing, China).Establishment of ASCT2 overexpression cellsL02 and HepG2 cells were seeded into small dishes at a confluence around 40–50%. Cells were treated with 100μl adenovirus suspension and 4μl polybrene solution for 48h, then changed fresh DMEM medium with 10% FBS. Fluorescence was observed under a microscope. ASCT2 expression efficiency was checked by Quantitative real-time PCR and Western Blot.Cell proliferation assayControl and ASCT2 overexpression L02 cells or HepG2 cells were plated in 12-well culture plates. After the adherence of the cells, 3 wells of control and 3 wells of ASCT2 overexpression cells were treated with 0.1μM topotecan. Cell number was counted using automatic counter (Countstar) every 24h, which lasted for 72h.Detection of glutamine uptakeL02 and HepG2 cells were seeded into 6-wells plates. After adherence, medium was replaced with 1.8ml fresh medium containing 10% FBS. Topotecan DMSO solution with high concentration was diluted into 0.1μM, 1μM, 10μM topotecan working solution with fresh medium containing 10% FBS. 200μl topotecan working solution (0.1μM, 1μM, 10μM) was added into wells to make topotecan concentration 0.01μM, 0.1μM, 1μM respectively. After 24h treatment, medium in each well was collected for glutamine detection and cells was digested for counting. Glutamine was detected with Glutamine and Glutamate Determination Kit (GLN1, Sigma Aldrich, St. Louis, MO). Total glutamine uptake was calculated according to glutamine concentration in DMEM medium. Total glutamine uptake dividing cell number was the glutamine uptake of every single cell.GSH detectionGSH was detected using a GSH and GSSG Assay Kit (Beyotime, Nanjing, China). In brief, L02 and HepG2 cells were seeded into 6-wells plates. After adherence, L02 and HepG2 cells were treated with topotecan with various concentrations (0.01μM, 0.1μM, 1μM) for 24h. Then, cells were washed with PBS to remove medium. Cells were digested and collected. Then the samples were freeze-thawed rapidly twice by liquid nitrogen and 37°C water bath. Samples were placed at 4°C or in an ice bath for 5min. Centrifuged at 10,000×g at 4°C for 10min. Supernatant was used for the determination of GSH according to the manufacturer's protocol.Determination of cellular reactive oxygen species (ROS)ROS was detected using Reactive Oxygen Species Assay Kit (Beyotime, Nanjing, China). In brief, L02 and HepG2 cells were seeded into 6-wells plates. After adherence, L02 and HepG2 cells were treated with topotecan with various concentrations (0.01μM, 0.1μM, 1μM) for 24h. DCFH-DA was diluted in serum-free medium at 1:1000 to a final concentration of 10mM. Removed the cell culture medium and added the DCFH-DA diluted in the appropriate volume. The added volume should be sufficient to cover the cells, and the diluted DCFH-DA should be no less than 1ml for one hole of the 6-wells plate. The cells were incubated in a 37°C cell incubator for 20min. Then, cells were washed with serum-free cell culture medium three times to fully remove the DCFH-DA that did not enter the cells. The ROS level was detected at 488nm excitation wavelength and 525nm emission wavelength with Varioskan LUX Multimode Microplate Reader (Thermo Scientific).Statistical analysisAll results are expressed as the mean±SD. Student's t-test was performed to compare and detect significance differences between paired groups. Values of P<0.05 were accepted as statistically significant. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. All experiments were repeated at least 3 times.ResultsTopotecan inhibited proliferation of L02 and HepG2 cells.To investigate the toxic effect of topotecan, we treated L02 hepatocytes and HepG2 hepatocellular carcinoma cells with topotecan for 24h. As showed in <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A and C, topotecan suppressed the proliferation of L02 and HepG2 cells in a dose-dependent manner. The relative cell viabilities of 0.01μM, 0.1μM and 1μM topotecan in L02 cells were 0.9133±0.04509, 0.5167±0.1102, 0.2500±0.06245 respectively. The relative cell viabilities of 0.01μM, 0.1μM and 1μM topotecan in HepG2 cells were 0.9423±0.03859, 0.6597±0.1150, 0.3367±0.09067 respectively. Besides, topotecan also inhibited the growth of L02 and HepG2 cells in a time-dependent manner. When L02 and HepG2 cells were treated with 0.1μM topotecan for 12h, 24h, 48h, the relative cell viabilities of 0.1μM topotecan treatment for 12h, 24h and 48h were 0.9767±0.07506, 0.5167±0.03512, 0.2333±0.05859 in L02 cells (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>B) and 1.040±0.06557, 0.5533±0.08386, 0.2800±0.03606 in HepG2 cells (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>D). mTOR regulates the proliferation of eukaryotic cell.<a class="elsevierStyleCrossRef" href="#bib0160">12</a> We next checked whether topotecan inhibited mTOR signaling pathway. As shown in <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>E and F, topotecan inhibited the phosphorylation of mTOR and its downstream target p70S6k in both L02 and HepG2 cells, which indicated that topotecan inhibited mTOR signaling pathway. Taken together, these results show that topotecan indeed possess a powerful capacity to inhibit cell growth.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Topotecan induced cell injury via inducing apoptosisIn order to investigate how topotecan inhibited cell growth of L02 and HepG2 cells, we performed flow cytometry to detect the influence of topotecan on apoptosis of L02 and HepG2 cells. As showed in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A and B, topotecan induced apoptosis in both L02 and HepG2 cells, which indicated that topotecan could cause serious injury not only in hepatocellular carcinoma cells but also in normal hepatocytes. topotecan induced apoptosis was also verified at molecular level as the apoptotic markers Cleaved-caspase 3, Cleaved-caspase 9 and Cleaved-PARP were all up-regulated in L02 and HepG2 cells (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>C and D). Taken together, these results suggest that topotecan causes hepatocellular injury via inducing apoptosis.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>Topotecan induced oxidative stress in L02 and HepG2 cellsNext, we sought to study the mechanism of how topotecan induced apoptosis in L02 and HepG2 cells. It was reported that topotecan caused increased ROS level alone or combined with other medicines in various cell type.<a class="elsevierStyleCrossRefs" href="#bib0155">11,13</a> Thus, we detected ROS level in L02 and HepG2 cells upon topotecan treatment for 24h. As expected, topotecan caused increased ROS level in both L02 and HepG2 cells (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A and B). In addition, the intracellular level of the most important antioxidant GSH was decreased in a dose-dependent manner (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C and 3D). In summary, these results indicate that topotecan causes oxidative stress in L02 and HepG2 cells.<elsevierMultimedia ident="fig0015"></elsevierMultimedia>Topotecan inhibited ASCT2 expression in L02 and HepG2 cellsAs glutamine is one of the three amino constituting GSH, dysfunction of glutamine uptake must cause decreased GSH production without doubt. So we checked whether topotecan caused a decrease of the expression of ASCT2, one of the most important glutamine transporters has been reported in hepatoma carcinoma cells which is also responsible for part of glutamine uptake in non-tumorigenic hepatocytes.<a class="elsevierStyleCrossRefs" href="#bib0170">14,15</a> As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A and B, topotecan inhibited ASCT2 expression at mRNA level in both L02 and HepG2 cells. The protein level of ASCT2 was also suppressed by topotecan in a dose-dependent manner (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>C and D). Besides, topotecan inhibited the uptake of glutamine as expected in both L02 and HepG2 cells. Taken together, these results suggest that topotecan inhibits ASCT2 expression in both L02 normal hepatocytes and HepG2 hepatocellular carcinoma cells.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>Overexpression of ASCT2 increased GSH production and reduced topotecan induced ROSIn order to study the role of ASCT2 played in topotecan-caused hepatocellular injury, we established ASCT2-overexpression cell model in both L02 and HepG2 cells using adenovirus vector. Both mRNA and protein level of ASCT2 were increased post adenovirus transfection (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>A–D). Overexpression of ASCT2 increased the uptake of glutamine in both L02 and HepG2 cells (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>E and F). The GSH level was also increased as expected in L02 and HepG2 cells. When treated with topotecan, ASCT2 overexpression inhibited ROS production in both L02 and HepG2 cells. Taken together, these results indicate that overexpression of ASCT2 increases GSH production and reduces topotecan-caused ROS production.<elsevierMultimedia ident="fig0025"></elsevierMultimedia>Overexpression of ASCT2 reversed topotecan induced apoptosis of L02 and HepG2 cellsAs ROS is an inducer of apoptosis, overexpression of ASCT2 inhibited ROS production upon topotecan treatment, we next explored whether overexpression of ASCT2 could protect against topotecan-caused apoptosis. As showed in <a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A and B, overexpression attenuated topotecan-induced apoptosis of L02 and HepG2 cells. In control L02 cells, topotecan caused apoptosis rate up to around 30%, however, the apoptosis rate caused by topotecan was just around 15% (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>A). The protective function of ASCT2 overexpression was more obvious in HepG2 cells. Overexpression of ASCT2 almost absolutely protected against topotecan induced HepG2 apoptosis (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>B). At molecular level, topotecan-induced increase of Cleaved-caspase 3, Cleaved-caspase 9, Cleaved-PARP expression was reversed by ASCT2 overexpression (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>C and D). Taken together, these results demonstrate that overexpression of ASCT2 attenuates apoptosis caused by topotecan in both L02 and HepG2 cells.<elsevierMultimedia ident="fig0030"></elsevierMultimedia>Overexpression of ASCT2 attenuated the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cellsNext, whether overexpression of ASCT2 could reverse topotecan-caused growth inhibition was still unknown. Using a growth assay, we found that overexpression of ASCT2 sustained cell growth upon topotecan treatment. Although cells cannot grow rapidly upon topotecan treatment after ASCT2 overexpression, cells treated with topotecan still kept alive (<a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>A and B). Mechanistically, overexpression of ASCT2 sustained activated protein synthesis pathway as shown in <a class="elsevierStyleCrossRef" href="#fig0035">Fig. 7</a>C and D. Overexpression of ASCT2 kept phosphorylation of mTOR and p70S6k still at a high level. In summary, overexpression of ASCT2 attenuates the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cells.<elsevierMultimedia ident="fig0035"></elsevierMultimedia>DiscussionIn our present study, we demonstrated that topotecan could cause hepatocellular injury via inducing cell death of hepatocytes and hepatocellular carcinoma cells mediated by ASCT2 down-regulation induced apoptosis.There are two forms of apoptosis in cells, including death receptor pathway mediated by TNF-α and mitochondrial pathway. ROS is the most common apoptosis stimulating factor in cells. Most of absorbed oxygen is reduced back to water by electron from oxidation respiratory chain, but there is still a small number of oxygen undergo monovalent reduction by electron leaked out from oxidation respiratory chain to form the super oxygen anion. Then the super oxygen anion transforms to hydrogen peroxide (H2O2) by disproportionation, which is the major source of ROS.<a class="elsevierStyleCrossRef" href="#bib0180">16</a> When treated with cytotoxic medicines, more ROS will be produced and induces cell apoptosis. GSH is the most important ROS scavenger inside living cells. Block of GSH production makes cells more sensitive to ROS-induced death. ASCT2 plays an important role in transporting glutamine no matter in normal cells or in cancer cells.<a class="elsevierStyleCrossRefs" href="#bib0150">10,17,18</a> Function damage of ASCT2 sensitizes cancer cell to ROS-induced apoptosis.<a class="elsevierStyleCrossRef" href="#bib0195">19</a> Given the predominant role of hepatocytes in biotransformation and metabolism of xenobiotics, ROS production constitutes an important burden in liver physiology and pathophysiology and hence in the progression of liver diseases.<a class="elsevierStyleCrossRef" href="#bib0200">20</a> Inhibition of ASCT2 will makes liver have no ability to face ROS damage. Topotecan-induced ASCT2 down-regulation puts liver cells in a more dangerous situation. Here, topotecan caused increased ROS level inside L02 and HepG2 cells, which leading to apoptosis. In order to elucidate the role of ASCT2 mediated glutamine uptake in topotecan-induced liver cells death, overexpression of ASCT2 was addressed. Overexpression of ASCT2 significantly reversed topotecan-induced liver cells death in both L02 and HepG2 cells. Given the oxidative stress topotecan may cause in liver, an ASCT2 agonist which could increase glutamine uptake will be useful for clinical patients. But up to now, there is no ASCT2 agonist has been developed. So, developing ASCT2 agonists is a meaningful thing for future study. Despite there is no ASCT2 agonist, topotecan combined antioxidants could also be effective for alleviating topotecan-induced liver injury. But this hypothesis still needs preclinical study and clinical study for verification. There are still some limitations in our study. The mechanism through which topotecan regulates ASCT2 expression in liver cells was not investigated in our study and this will be an interesting subject in our future study.This study illustrates an unreported mechanism of topotecan-induced hepatocellular injury, which is that topotecan induces apoptosis via ASCT2 down-regulation mediated oxidative stress. These findings further our knowledge about the hepatotoxicity of topotecan and provide strategies for prevention or alleviation.ConclusionTopotecan induces hepatocellular injury via ASCT2 mediated oxidative stress. This is the first time we demonstrate that topotecan can inhibit ASCT2 expression in hepatocytes and hepatocellular carcinoma cells.Conflict of interestThe authors declared they do not have anything to disclose regarding conflict of interest with respect to this manuscript." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1471280" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1339944" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1471281" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1339945" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:12 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Tested drug" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Cell lines" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Reagents" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Quantitative real-time PCR (qRT-PCR)" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Western blot analysis" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Annexin V/PI double staining" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Establishment of ASCT2 overexpression cells" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "Cell proliferation assay" ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "Detection of glutamine uptake" ] 9 => array:2 [ "identificador" => "sec0060" "titulo" => "GSH detection" ] 10 => array:2 [ "identificador" => "sec0065" "titulo" => "Determination of cellular reactive oxygen species (ROS)" ] 11 => array:2 [ "identificador" => "sec0070" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0075" "titulo" => "Results" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0080" "titulo" => "Topotecan inhibited proliferation of L02 and HepG2 cells." ] 1 => array:2 [ "identificador" => "sec0085" "titulo" => "Topotecan induced cell injury via inducing apoptosis" ] 2 => array:2 [ "identificador" => "sec0090" "titulo" => "Topotecan induced oxidative stress in L02 and HepG2 cells" ] 3 => array:2 [ "identificador" => "sec0095" "titulo" => "Topotecan inhibited ASCT2 expression in L02 and HepG2 cells" ] 4 => array:2 [ "identificador" => "sec0100" "titulo" => "Overexpression of ASCT2 increased GSH production and reduced topotecan induced ROS" ] 5 => array:2 [ "identificador" => "sec0105" "titulo" => "Overexpression of ASCT2 reversed topotecan induced apoptosis of L02 and HepG2 cells" ] 6 => array:2 [ "identificador" => "sec0110" "titulo" => "Overexpression of ASCT2 attenuated the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cells" ] ] ] 7 => array:2 [ "identificador" => "sec0115" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0120" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0125" "titulo" => "Conflict of interest" ] 10 => array:2 [ "identificador" => "xack515534" "titulo" => "Acknowledgements" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-02-03" "fechaAceptado" => "2020-05-18" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1339944" "palabras" => array:6 [ 0 => "Topotecan" 1 => "ASCT2" 2 => "GSH" 3 => "Apoptosis" 4 => "ROS" 5 => "Hepatocellular injury" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1339945" "palabras" => array:6 [ 0 => "Topotecán" 1 => "ASCT2" 2 => "GSH" 3 => "Apoptosis" 4 => "ERO" 5 => "Lesión hepatocelular" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundTopotecan is an anti-cancer chemotherapy drug with common side effects, including hepatotoxicity. In this study, we aim to investigate the mechanisms of topotecan-induced hepatocellular injury beyond conventional DNA damage. Materials and methodsMethyl Thiazolyl Tetrazolium (MTT) assay was used to detect the inhibitory effect of topotecan on cell proliferation. Western blot was used to detect protein expression. Flow cytometry assay was performed to determine apoptosis rate under topotecan treatment. ASCT2 overexpression was addressed using adenovirus vector. qRT-PCR and western blot assay were used to detect the expression of ASCT2. Glutamine uptake, intracellular glutathione (GSH) and reactive oxygen species (ROS) level were detected by glutamine detection kit, GSH detection kit and ROS detection kit respectively. ResultsMTT results showed that topotecan had an inhibitory effect on cell proliferation and induced apoptosis in both L02 and HepG2 cell lines. Topotecan inhibited the expression of glutamine transporter ASCT2 and the uptake of glutamine in both L02 and HepG2 cell lines. The uptake of glutamine and the GSH level was increased in both L02 and HepG2 cell lines after ASCT2 overexpression. The ROS level was inhibited by ASCT2 overexpression upon topotecan treatment in both L02 and HepG2 cell lines. Topotecan-induced hepatocellular apoptosis and proliferation inhibition were attenuated by ASCT2 overexpression in both L02 and HepG2 cell lines. ConclusionTopotecan-induced hepatocytes death is dependent on ASCT2 down-regulation, which causes oxidative stress via inhibiting GSH production." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "AntecedentesEl topotecán es un fármaco quimioterapéutico antineoplásico con efectos secundarios frecuentes, incluida la hepatotoxicidad. En este estudio nos proponemos investigar los mecanismos de la lesión hepatocelular inducida por el topotecán más allá del daño convencional del ADN. Materiales y métodosSe utilizó el ensayo de metil tiazolil tetrazolio (MTT) para detectar el efecto inhibitorio del topotecán sobre la proliferación celular. Se utilizó inmunoelectrotransferencia para detectar la expresión de las proteínas. Se realizó un ensayo de citometría de flujo para determinar la tasa de apoptosis con el tratamiento con topotecán. La sobreexpresión del ASCT2 se abordó utilizando un vector adenoviral. Se utilizaron la qRT-PCR y el ensayo de inmunoelectrotransferencia para detectar la expresión del ASCT2. La absorción de glutamina, el nivel de glutatión intracelular (GSH) y el nivel de especies reactivas del oxígeno (ERO) se detectaron mediante un equipo de detección de glutamina, un equipo de detección de GSH y un equipo de detección de ERO, respectivamente. ResultadosLos resultados del ensayo de MTT mostraron que el topotecán tenía un efecto inhibitorio sobre la proliferación celular y que inducía la apoptosis en las estirpes celulares L02 y HepG2. El topotecán inhibió la expresión del transportador de glutamina ASCT2 y la absorción de glutamina en las estirpes celulares L02 y HepG2. La absorción de glutamina y el nivel de GSH aumentaron en las estirpes celulares L02 y HepG2 después de la sobreexpresión del ASCT2. El nivel de ERO fue inhibido por la sobreexpresión del ASCT2 tras el tratamiento con topotecán en las estirpes celulares L02 y HepG2. La apoptosis hepatocelular y la inhibición de la proliferación inducidas por el topotecán fueron atenuadas por la sobreexpresión del ASCT2 en las estirpes celulares L02 y HepG2. ConclusiónLa muerte de hepatocitos inducida por el topotecán depende de la regulación descendente del ASCT2, que causa estrés oxidativo al inhibir la producción de GSH." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Materiales y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] ] "multimedia" => array:8 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3607 "Ancho" => 2921 "Tamanyo" => 573642 ] ] "descripcion" => array:1 [ "en" => "Topotecan inhibited proliferation of L02 and HepG2 cells. (A) and (C) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. MTT assay was performed to detect the viability of L02 (A) and HepG2 (C) cells. (B) and (D) L02 and HepG2 cells were treated with topotecan (0.1μM) for 12h, 24h and 48h, MTT assay was performed to detected the viability of L02 (B) and HepG2 (D) cells. (E) and (F) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. Protein samples were harvested and the expression of p-p70S6k, p70S6k, p-mTOR and mTOR in L02 (E) and HepG2 (F) cells was detected by western blot. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2604 "Ancho" => 2508 "Tamanyo" => 518424 ] ] "descripcion" => array:1 [ "en" => "Topotecan induced apoptosis in L02 and HepG2 cells. (A) and (B) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. Apoptosis of cells was detected by flow cytometry. (C) and (D) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. Apoptotic markers Cleaved-caspase 9, Cleaved-caspase 3 and Cleaved-PARP were detected by western blot. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2090 "Ancho" => 2504 "Tamanyo" => 231961 ] ] "descripcion" => array:1 [ "en" => "Topotecan increased ROS level and decreased GSH level in L02 and HepG2 cells. (A) and (B) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. ROS level was detected using ROS detection kit. (C) and (D) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. GSH level was detected using a GSH detection kit. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 4064 "Ancho" => 2920 "Tamanyo" => 593583 ] ] "descripcion" => array:1 [ "en" => "Topotecan inhibited glutamine uptake via suppressing ASCT2 expression in L02 and HepG2 cells. L02 and HepG2 cells were treated with topotecan with different concentration for 24h. RNA and protein samples were harvested. mRNA expression of ASCT2 was detected by quantitative real-time PCR in L02 (A) and HepG2 (B) cells. Protein expression of ASCT2 was detected by western blot (C) and (D). (E) and (F) L02 and HepG2 cells were treated with topotecan with different concentration for 24h. Glutamine concentration in medium was detected using glutamine detection kit. Then glutamine uptake was calculated according to original concentration of glutamine in medium. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. **P<0.01; ***P<0.001; ****P<0.0001." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2355 "Ancho" => 2925 "Tamanyo" => 370210 ] ] "descripcion" => array:1 [ "en" => "Overexpression of ASCT2 increased GSH production and reduced topotecan-induced ROS in L02 and HepG2 cells. L02 and HepG2 cells were treated with adenoviral expression vector for 48h, then changed fresh DMEM medium with 10% FBS for growth until 90% confluence. Protein and RNA samples were harvested for western blot and quantitative real-time PCR respectively. (A) and (B) ASCT2 expression post transfection was detected by western blot. (C) and (D) mRNA expression of ASCT2 post transfection was detected by quantitative real-time PCR. (E) and (F) Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 60–70% confluence. Cells were supplemented with fresh complete DMEM medium and cultured for 24h. Glutamine in medium was detected using glutamine detection kit. Glutamine uptake was calculated according to original glutamine concentration in DMEM medium, then averaged to single cell. (G) and (H) Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 80–90% confluence. Cells were lysed and GSH level was detected using GSH detection kit. (I) and (J) Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 80–90% confluence. Cells were lysed and ROS level was detected using ROS detection kit. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001." ] ] 5 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 3452 "Ancho" => 3079 "Tamanyo" => 598523 ] ] "descripcion" => array:1 [ "en" => "Overexpression of ASCT2 reversed topotecan-induced apoptosis of L02 and HepG2 cells. (A) and (B) Control and ASCT2 overexpression cells were treated with or without topotecan (0.1μM) for 24h, cell apoptosis was detected by flow cytometry. (C) and (D) Control and ASCT2 overexpression cells were treated with or without topotecan (0.1μM) for 24h, cell samples were harvested for analysis of Cleaved-caspase 3, Cleaved-caspase 9 and Cleaved-PARP expression by western blot. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01; ***P<0.001." ] ] 6 => array:7 [ "identificador" => "fig0035" "etiqueta" => "Figure 7" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr7.jpeg" "Alto" => 2526 "Ancho" => 2994 "Tamanyo" => 412411 ] ] "descripcion" => array:1 [ "en" => "Overexpression of ASCT2 partly reversed topotecan-caused growth inhibition. (A) and (B) Control and ASCT2 overexpression cells were seeded into 12-well plates. After 24h, cells were treated with topotecan (0.1μM) for 72h. Cell number was counted every 24h post topotecan treatment. (C) and (D) Control and ASCT2 overexpression cells were treated with or without topotecan (0.1μM) for 24h, cell samples were harvested. The expression of p-p70S6k, p70S6k, p-mTOR and mTOR was detected by western blot. β-Actin was used as a loading control. Protein amount was quantified using Image J. Data represent the mean±SD of three independent experiments. *P<0.05; **P<0.01." ] ] 7 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequences \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18s \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Forward sequence: ACCCGTTGAACCCCATTCGTGAReverse sequence: GCCTCACTAAACCATCCAATCGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SLC1A5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Forward sequence: TCCTCTTCACCCGCAAAAACCCReverse sequence: CCACGCCATTATTCTCCTCCAC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2531894.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Primer sequences in qRT-PCR." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:20 [ 0 => array:3 [ "identificador" => "bib0105" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Topoisomerase I inhibitors: camptothecins and beyond" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Y. Pommier" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrc1977" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Cancer" "fecha" => "2006" "volumen" => "6" "paginaInicial" => "789" "paginaFinal" => "802" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16990856" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0110" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Topotecan in combination with cisplatin for the treatment of stage IVB, recurrent, or persistent cervical cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Brave" 1 => "R. Dagher" 2 => "A. Farrell" 3 => "S. Abraham" 4 => "R. Ramchandani" 5 => "J. Gobburu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Oncology (Williston Park, NY)" "fecha" => "2006" "volumen" => "20" "paginaInicial" => "1401" "paginaFinal" => "1404" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0115" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A phase I/II study of CY and topotecan in patients with high-risk malignancies undergoing autologous hematopoietic cell transplantation: the St Jude long-term follow-up" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K.A. Kasow" 1 => "C.F. Stewart" 2 => "R.C. Barfield" 3 => "N.L. Wright" 4 => "C. Li" 5 => "D.K. Srivastava" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/bmt.2012.51" "Revista" => array:6 [ "tituloSerie" => "Bone Marrow Transplant" "fecha" => "2012" "volumen" => "47" "paginaInicial" => "1448" "paginaFinal" => "1454" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22426752" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0120" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Topotecan, thiotepa, and carboplatin for neuroblastoma: failure to prevent relapse in the central nervous system" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B.H. Kushner" 1 => "K. Kramer" 2 => "S. Modak" 3 => "N.A. Kernan" 4 => "L.M. Reich" 5 => "K. Danis" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bmt.1705253" "Revista" => array:6 [ "tituloSerie" => "Bone Marrow Transplant" "fecha" => "2006" "volumen" => "37" "paginaInicial" => "271" "paginaFinal" => "276" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16400336" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0125" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phase I and pharmacokinetic study of topotecan administered orally once daily for 5 days for 2 consecutive weeks to pediatric patients with refractory solid tumors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N.C. Daw" 1 => "V.M. Santana" 2 => "L.C. Iacono" 3 => "W.L. Furman" 4 => "D.R. Hawkins" 5 => "P.J. Houghton" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1200/JCO.2004.07.110" "Revista" => array:6 [ "tituloSerie" => "J Clin Oncol" "fecha" => "2004" "volumen" => "22" "paginaInicial" => "829" "paginaFinal" => "837" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14990638" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0130" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Achieving the balance between ROS and antioxidants: when to use the synthetic antioxidants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B. Poljsak" 1 => "D. Suput" 2 => "I. Milisav" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1155/2013/956792" "Revista" => array:5 [ "tituloSerie" => "Oxid Med Cell Longev" "fecha" => "2013" "volumen" => "2013" "paginaInicial" => "956792" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23738047" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0135" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Unraveling the potential role of glutathione in multiple forms of cell death in cancer therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Lv" 1 => "C. Zhen" 2 => "J. Liu" 3 => "P. Yang" 4 => "L. Hu" 5 => "P. Shang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Oxid Med Cell Longev" "fecha" => "2019" "volumen" => "2019" "paginaInicial" => "3150145" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0140" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ASC amino-acid transporter 2 (ASCT2) as a novel prognostic marker in non-small cell lung cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Shimizu" 1 => "K. Kaira" 2 => "Y. Tomizawa" 3 => "N. Sunaga" 4 => "O. Kawashima" 5 => "N. Oriuchi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/bjc.2014.88" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer" "fecha" => "2014" "volumen" => "110" "paginaInicial" => "2030" "paginaFinal" => "2039" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24603303" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0145" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ASCT2 silencing regulates mammalian target-of-rapamycin growth and survival signaling in human hepatoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B.C. Fuchs" 1 => "R.E. Finger" 2 => "M.C. Onan" 3 => "B.P. Bode" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpcell.00330.2006" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Cell Physiol" "fecha" => "2007" "volumen" => "293" "paginaInicial" => "C55" "paginaFinal" => "C63" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17329400" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0150" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ASCT2/SLC1A5 controls glutamine uptake and tumour growth in triple-negative basal-like breast cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. van Geldermalsen" 1 => "Q. Wang" 2 => "R. Nagarajah" 3 => "A.D. Marshall" 4 => "A. Thoeng" 5 => "D. Gao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/onc.2015.381" "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "2016" "volumen" => "35" "paginaInicial" => "3201" "paginaFinal" => "3208" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26455325" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0155" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Topotecan induces apoptosis via ASCT2 mediated oxidative stress in gastric cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Wang" 1 => "Y. Liu" 2 => "T.L. Zhao" 3 => "Z.Z. Li" 4 => "J.Y. He" 5 => "B.J. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.phymed.2018.12.011" "Revista" => array:6 [ "tituloSerie" => "Phytomedicine" "fecha" => "2019" "volumen" => "57" "paginaInicial" => "117" "paginaFinal" => "128" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30668314" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0160" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "mTOR signaling in growth metabolism, and disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R.A. Saxton" 1 => "D.M. Sabatini" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cell.2017.02.004" "Revista" => array:6 [ "tituloSerie" => "Cell" "fecha" => "2017" "volumen" => "168" "paginaInicial" => "960" "paginaFinal" => "976" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28283069" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0165" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anticancer activities of genistein-topotecan combination in prostate cancer cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "V. Hormann" 1 => "J. Kumi-Diaka" 2 => "M. Durity" 3 => "A. Rathinavelu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1582-4934.2012.01576.x" "Revista" => array:6 [ "tituloSerie" => "J Cell Mol Med" "fecha" => "2012" "volumen" => "16" "paginaInicial" => "2631" "paginaFinal" => "2636" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22452992" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0170" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular and functional analysis of glutamine uptake in human hepatoma and liver-derived cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B.P. Bode" 1 => "B.C. Fuchs" 2 => "B.P. Hurley" 3 => "J.L. Conroy" 4 => "J.E. Suetterlin" 5 => "K.K. Tanabe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpgi.00031.2002" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Gastrointest Liver Physiol" "fecha" => "2002" "volumen" => "283" "paginaInicial" => "G1062" "paginaFinal" => "G1073" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12381519" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0175" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inducible antisense RNA targeting amino acid transporter ATB0/ASCT2 elicits apoptosis in human hepatoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "B.C. Fuchs" 1 => "J.C. Perez" 2 => "J.E. Suetterlin" 3 => "S.B. Chaudhry" 4 => "B.P. Bode" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajpgi.00344.2003" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Gastrointest Liver Physiol" "fecha" => "2004" "volumen" => "286" "paginaInicial" => "G467" "paginaFinal" => "G478" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14563674" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0180" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mitochondrial ROS regulation of proliferating cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L. Diebold" 1 => "N.S. Chandel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.freeradbiomed.2016.04.198" "Revista" => array:6 [ "tituloSerie" => "Free Radic Biol Med" "fecha" => "2016" "volumen" => "100" "paginaInicial" => "86" "paginaFinal" => "93" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27154978" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0185" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Glutamine transporter ASCT2 was down-regulated in ischemic injured human intestinal epithelial cells and reversed by epidermal growth factor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Q. Huang" 1 => "N. Li" 2 => "W. Zhu" 3 => "Q. Li" 4 => "J. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "JPEN" "fecha" => "2007" "volumen" => "31" "paginaInicial" => "86" "paginaFinal" => "93" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0190" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ASCT2 regulates glutamine uptake and cell growth in endometrial carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.D. Marshall" 1 => "M. van Geldermalsen" 2 => "N.J. Otte" 3 => "T. Lum" 4 => "M. Vellozzi" 5 => "A. Thoeng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/oncsis.2017.70" "Revista" => array:5 [ "tituloSerie" => "Oncogenesis" "fecha" => "2017" "volumen" => "6" "paginaInicial" => "e367" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28759021" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0195" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ASCT2 (SLC1A5) is an EGFR-associated protein that can be co-targeted by cetuximab to sensitize cancer cells to ROS-induced apoptosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "H. Lu" 1 => "X. Li" 2 => "Y. Lu" 3 => "S. Qiu" 4 => "Z. Fan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.canlet.2016.07.020" "Revista" => array:6 [ "tituloSerie" => "Cancer Lett" "fecha" => "2016" "volumen" => "381" "paginaInicial" => "23" "paginaFinal" => "30" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27450723" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0200" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Redox control of liver function in health and disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Mari" 1 => "A. Colell" 2 => "A. Morales" 3 => "C. von Montfort" 4 => "C. Garcia-Ruiz" 5 => "J.C. Fernandez-Checa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/ars.2009.2634" "Revista" => array:6 [ "tituloSerie" => "Antioxid Redox Signal" "fecha" => "2010" "volumen" => "12" "paginaInicial" => "1295" "paginaFinal" => "1331" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19803748" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack515534" "titulo" => "Acknowledgements" "texto" => "This research project was financially supported by the National Natural Science Foundation of China (No. 31870080), Natural Science Research Subject from Education Department of Anhui Province (No. KJ2017A516) and Undergraduate innovation project in Anhui Province (Nos. S201910879201, S201910879216)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/24443824/0000004400000001/v2_202102250807/S2444382421000183/v2_202102250807/en/main.assets" "Apartado" => array:4 [ "identificador" => "58329" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original article" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/24443824/0000004400000001/v2_202102250807/S2444382421000183/v2_202102250807/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000183?idApp=UINPBA00004N"]

Statistics

Original

Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress

El topotecán induce una lesión hepatocelular a través del estrés oxidativo mediado por el ASCT2

Guoliang Zhoua, Meisong Qina, Xiaolin Zhanga, Jianting Yangb, Hao Yua,

Corresponding author

hz_1230@163.com

Corresponding author.

a Department of Pharmacy, School of Life and Health Sciences, Anhui Science and Technology University, Fengyang, Anhui, China

b College of Food Engineering, Anhui Science and Technology University, Fengyang, Anhui, China

Read

594

Times
was read the article

Total PDF

505

Total HTML

Share statistics

 array:22 [
  "pii" => "S2444382421000183"
  "issn" => "24443824"
  "doi" => "10.1016/j.gastre.2020.05.011"
  "estado" => "S300"
  "fechaPublicacion" => "2021-01-01"
  "aid" => "1589"
  "copyrightAnyo" => "2021"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Gastroenterol Hepatol. 2021;44:1-12"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "en" => array:18 [
      "pii" => "S0210570520302491"
      "issn" => "02105705"
      "doi" => "10.1016/j.gastrohep.2020.05.017"
      "estado" => "S300"
      "fechaPublicacion" => "2021-01-01"
      "aid" => "1589"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Gastroenterol Hepatol. 2021;44:1-12"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "en" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
        "titulo" => "Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress"
        "tienePdf" => "en"
        "tieneTextoCompleto" => "en"
        "tieneResumen" => array:2 [
          0 => "en"
          1 => "es"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "1"
            "paginaFinal" => "12"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "es" => array:1 [
            "titulo" => "El topotec&#225;n induce una lesi&#243;n hepatocelular a trav&#233;s del estr&#233;s oxidativo mediado por el ASCT2"
          ]
        ]
        "contieneResumen" => array:2 [
          "en" => true
          "es" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "en" => true
        ]
        "contienePdf" => array:1 [
          "en" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figure 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 2090
                "Ancho" => 2504
                "Tamanyo" => 231961
              ]
            ]
            "descripcion" => array:1 [
              "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Topotecan increased ROS level and decreased GSH level in L02 and HepG2 cells&#46; &#40;A&#41; and &#40;B&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; ROS level was detected using ROS detection kit&#46; &#40;C&#41; and &#40;D&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; GSH level was detected using a GSH detection kit&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Guoliang Zhou, Meisong Qin, Xiaolin Zhang, Jianting Yang, Hao Yu"
            "autores" => array:5 [
              0 => array:2 [
                "nombre" => "Guoliang"
                "apellidos" => "Zhou"
              ]
              1 => array:2 [
                "nombre" => "Meisong"
                "apellidos" => "Qin"
              ]
              2 => array:2 [
                "nombre" => "Xiaolin"
                "apellidos" => "Zhang"
              ]
              3 => array:2 [
                "nombre" => "Jianting"
                "apellidos" => "Yang"
              ]
              4 => array:2 [
                "nombre" => "Hao"
                "apellidos" => "Yu"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "en"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S2444382421000183"
          "doi" => "10.1016/j.gastre.2020.05.011"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000183?idApp=UINPBA00004N"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570520302491?idApp=UINPBA00004N"
      "url" => "/02105705/0000004400000001/v1_202101130647/S0210570520302491/v1_202101130647/en/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S2444382421000171"
    "issn" => "24443824"
    "doi" => "10.1016/j.gastre.2020.05.010"
    "estado" => "S300"
    "fechaPublicacion" => "2021-01-01"
    "aid" => "1587"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Gastroenterol Hepatol. 2021;44:13-9"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Vitamin D in dysphagic patients who have undergone endoscopic gastrostomy for long-term enteral feeding"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "13"
          "paginaFinal" => "19"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Vitamina D en pacientes con disfagia sometidos a gastrostom&#237;a endosc&#243;pica percut&#225;nea para una nutrici&#243;n enteral de larga duraci&#243;n"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Carla Adriana Santos, Gon&#231;alo Nunes, Ana Teresa Barata, Jorge Fonseca"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Carla Adriana"
              "apellidos" => "Santos"
            ]
            1 => array:2 [
              "nombre" => "Gon&#231;alo"
              "apellidos" => "Nunes"
            ]
            2 => array:2 [
              "nombre" => "Ana Teresa"
              "apellidos" => "Barata"
            ]
            3 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "Fonseca"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S0210570520302478"
        "doi" => "10.1016/j.gastrohep.2020.05.016"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0210570520302478?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000171?idApp=UINPBA00004N"
    "url" => "/24443824/0000004400000001/v2_202102250807/S2444382421000171/v2_202102250807/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
    "titulo" => "Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "1"
        "paginaFinal" => "12"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Guoliang Zhou, Meisong Qin, Xiaolin Zhang, Jianting Yang, Hao Yu"
        "autores" => array:5 [
          0 => array:3 [
            "nombre" => "Guoliang"
            "apellidos" => "Zhou"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Meisong"
            "apellidos" => "Qin"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Xiaolin"
            "apellidos" => "Zhang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Jianting"
            "apellidos" => "Yang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:4 [
            "nombre" => "Hao"
            "apellidos" => "Yu"
            "email" => array:1 [
              0 => "hz_1230@163.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Department of Pharmacy&#44; School of Life and Health Sciences&#44; Anhui Science and Technology University&#44; Fengyang&#44; Anhui&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "College of Food Engineering&#44; Anhui Science and Technology University&#44; Fengyang&#44; Anhui&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "El topotec&#225;n induce una lesi&#243;n hepatocelular a trav&#233;s del estr&#233;s oxidativo mediado por el ASCT2"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 4064
            "Ancho" => 2920
            "Tamanyo" => 593583
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Topotecan inhibited glutamine uptake via suppressing ASCT2 expression in L02 and HepG2 cells&#46; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; RNA and protein samples were harvested&#46; mRNA expression of ASCT2 was detected by quantitative real-time PCR in L02 &#40;A&#41; and HepG2 &#40;B&#41; cells&#46; Protein expression of ASCT2 was detected by western blot &#40;C&#41; and &#40;D&#41;&#46; &#40;E&#41; and &#40;F&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Glutamine concentration in medium was detected using glutamine detection kit&#46; Then glutamine uptake was calculated according to original concentration of glutamine in medium&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Topotecan is a DNA topoisomerase I &#40;Topo I&#41; inhibitor as a camptothecin derivative&#46; It can prevent DNA replication and RNA synthesis via binding with Topo I-DNA complex and finally induces the death of cancer cells&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">1</span></a> However&#44; as a widely used broad anti-cancer medicine&#44; topotecan could bring hepatotoxicity when treats several tumor types in clinical use&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">2</span></a> In a phase I&#47;II study of cyclophosphamide and topotecan in patients with high-risk malignancies undergoing autologous hematopoietic cell transplantation&#44; two patients experienced reversible hepatotoxicity&#46;<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">3</span></a> In a study reported on a three-drug &#40;topotecan&#44; thiotepa&#44; and carboplatin&#41; myeloablative regimen designed to consolidate remission and to prevent central nervous system &#40;CNS&#41; relapse of high-risk neuroblastoma &#40;NB&#41; in 66 patients&#44; Grade 2 hepatotoxicity led to truncating cytoreduction in two patients&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">4</span></a> Moreover&#44; in another Phase I and pharmacokinetic study of topotecan performed in patient with refractory solid tumors&#44; elevated AST and ALT was observed&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">5</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Living cells need increased antioxidant to keep redox equilibrium when faces danger signaling caused excessive reactive oxygen species &#40;ROS&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">6</span></a> Glutathione &#40;GSH&#41; is the most important antioxidant and plays the most important role in preventing ROS induced cell death&#46;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">7</span></a> Glutamine is one of the three amino forming GSH&#46; Thus&#44; the glutamine level must influence GSH production in living cells&#46; Alanine&#44; serine&#44; cysteine-preferring transporter 2 &#40;ASCT2&#59; SLC1A5&#41; is a cell surface solute-carrying transporter that mediates uptake of neutral amino acids including glutamine&#46; In recent years&#44; ASCT2 has been demonstrated as the most important glutamine transporter in cancer cells&#46;<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">8&#8211;10</span></a> Inhibition ASCT2 could kill cancer cells and ASCT2 has already been raised as a drugable target of cancer treatment&#46; Recently&#44; topotecan was demonstrated to inhibit gastric cancer cell proliferation via suppressing ASCT2 expression&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">11</span></a> However&#44; whether ASCT2 involves in topotecan-induced hepatocellular injury is still unclear&#46; In our study&#44; we aimed to investigate the role of ASCT2 in topotecan-induced hepatocellular injury&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Tested drug</span><p id="par0015" class="elsevierStylePara elsevierViewall">Topotecan was purchased from Dalian Meilun Biotechnology Co&#46;&#44; LTD&#46; CAS&#58; 119413-54-6&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Cell lines</span><p id="par0020" class="elsevierStylePara elsevierViewall">The human normal hepatocytes L02 cells and HepG2 hepatocellular carcinoma cells were purchased from the Cell Bank of Chinese Academy of Sciences &#40;Shanghai&#44; China&#41;&#46; All cells were cultured in Dulbecco&#39;s modified Eagle&#39;s medium &#40;Gibco&#44; Grand Island&#44; USA&#41; with 10&#37; fetal bovine serum &#40;FBS&#59; Gibco&#44; Grand Island&#44; USA&#41;&#44; 1&#37; penicillin-streptomycin and maintained at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in a humidified incubator with 5&#37; CO<span class="elsevierStyleInf">2</span>&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Reagents</span><p id="par0025" class="elsevierStylePara elsevierViewall">Annexin V-FITC&#47;PI Apoptosis Detection Kit &#40;Containing 250<span class="elsevierStyleHsp" style=""></span>&#956;l Annexin V-FITC&#44; 250<span class="elsevierStyleHsp" style=""></span>&#956;l PI Staining Solution and 25<span class="elsevierStyleHsp" style=""></span>ml 1&#215; Binding Buffer&#41; was purchased from Vazyme Biotech &#40;Nanjing&#44; China&#41;&#46; p-mTOR &#40;Ser473&#41;&#44; mTOR&#44; p-p70S6k &#40;Thr389&#41;&#44; p70S6k primary antibodies were purchased from Cell Signaling Technol &#40;USA&#41;&#44; &#946;-Actin&#44; Caspase 3&#44; Caspase 9&#44; PARP primary antibodies were purchased from Proteintech Group &#40;Wuhan&#44; China&#41;&#46; MTT was purchased from Beyotime &#40;Nanjing&#44; China&#41;&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Quantitative real-time PCR &#40;qRT-PCR&#41;</span><p id="par0030" class="elsevierStylePara elsevierViewall">L02 and HepG2 cells were treated with topotecan with different concentrations &#40;0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Total cellular RNA was isolated with the TRIzol Reagent &#40;Vazyme&#44; Nanjing&#44; China&#41; and reverse transcribed with the Revert Aid TM First Strand cDNA Synthesis Kit &#40;Vazyme&#44; Nanjing&#44; China&#41;&#46; The mRNA level was measured with the SYBR Green master mix &#40;Vazyme&#44; Nanjing&#44; China&#41;&#46; The amount of mRNA for each gene was standardized with the internal control &#40;18s rRNA&#41;&#46; Each treatment group was compared with the control group to show the relative mRNA level&#46; The primer sequences for qRT-PCR are provided in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Western blot analysis</span><p id="par0035" class="elsevierStylePara elsevierViewall">L02 and HepG2 cells were treated with topotecan with different concentrations &#40;0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#44; cellular proteins were extracted&#46; The BCA method was used to detect the protein concentration&#46; SDS-PAGE was used to separate proteins and then transfer the protein to the NC membrane&#46; After blocked by 5&#37; non-fat milk for 1 hour&#44; the membrane was incubated with indicated primary antibodies overnight at 4<span class="elsevierStyleHsp" style=""></span>&#176;C &#40;All primary antibodies were diluted with 5&#37; BSA with a ratio of 1&#58;1000&#41;&#46; After then the NC membrane was washed with TBST three times &#40;10<span class="elsevierStyleHsp" style=""></span>min each time&#41;&#46; The membrane was incubated in HRP labeled secondary antibodies for 2<span class="elsevierStyleHsp" style=""></span>h at room temperature &#40;Secondary antibodies were diluted with 5&#37; BSA with a ratio of 1&#58;5000&#41;&#46; After washing with TBST three times &#40;10<span class="elsevierStyleHsp" style=""></span>min each time&#41;&#44; the NC membrane was visualized by using ECL coloring solution for 5<span class="elsevierStyleHsp" style=""></span>min&#46; The photos were captured by Image Lab 5&#46;0 &#40;Bio-Rad Laboratories&#44; USA&#41; and the density values were calculated by Image J &#40;National Institutes of Health&#44; USA&#41;&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Annexin V&#47;PI double staining</span><p id="par0040" class="elsevierStylePara elsevierViewall">After treatment with 0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan for 24<span class="elsevierStyleHsp" style=""></span>h&#44; L02 and HepG2 cells were digested with 0&#46;25&#37; trypsin without EDTA and were collected via centrifugation at a rotate speed of 500<span class="elsevierStyleHsp" style=""></span>rpm&#47;min&#46; Apoptotic cells were identified by the Annexin V-FITC Apoptosis Detection kit &#40;Vazyme&#44; Nanjing&#44; China&#41; in accordance with the manufacturer&#39;s instructions&#46; Cells were washed with fresh PBS buffer for 3 times&#46; Took out around 5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">5</span><span class="elsevierStyleHsp" style=""></span>cells into another tube&#44; then centrifuged it at a rotate speed of 500<span class="elsevierStyleHsp" style=""></span>rpm&#47;min for 5<span class="elsevierStyleHsp" style=""></span>min&#46; Then remove the supernatant carefully&#46; Add 100<span class="elsevierStyleHsp" style=""></span>&#956;l 1&#215; Binding Buffer and gently blow into the single-cell suspension&#46; Then add 5<span class="elsevierStyleHsp" style=""></span>&#956;l Annexin V-FITC solution and 5<span class="elsevierStyleHsp" style=""></span>&#956;l PI Staining Solution for staining for 10<span class="elsevierStyleHsp" style=""></span>min in dark&#46; Flow cytometric analysis was performed immediately after supravital staining&#46; Data acquisition and analysis were performed in a Becton Dickinson FACS-Calibur flow cytometer using the Cell Quest software &#40;Franklin Lakes&#41;&#46; For blocking reactive oxygen species &#40;ROS&#41;&#44; cells were treated with 5<span class="elsevierStyleHsp" style=""></span>mM N-acetylcysteine &#40;Beyotime&#44; Nanjing&#44; China&#41;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Establishment of ASCT2 overexpression cells</span><p id="par0045" class="elsevierStylePara elsevierViewall">L02 and HepG2 cells were seeded into small dishes at a confluence around 40&#8211;50&#37;&#46; Cells were treated with 100<span class="elsevierStyleHsp" style=""></span>&#956;l adenovirus suspension and 4<span class="elsevierStyleHsp" style=""></span>&#956;l polybrene solution for 48<span class="elsevierStyleHsp" style=""></span>h&#44; then changed fresh DMEM medium with 10&#37; FBS&#46; Fluorescence was observed under a microscope&#46; ASCT2 expression efficiency was checked by Quantitative real-time PCR and Western Blot&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Cell proliferation assay</span><p id="par0050" class="elsevierStylePara elsevierViewall">Control and ASCT2 overexpression L02 cells or HepG2 cells were plated in 12-well culture plates&#46; After the adherence of the cells&#44; 3 wells of control and 3 wells of ASCT2 overexpression cells were treated with 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan&#46; Cell number was counted using automatic counter &#40;Countstar&#41; every 24<span class="elsevierStyleHsp" style=""></span>h&#44; which lasted for 72<span class="elsevierStyleHsp" style=""></span>h&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Detection of glutamine uptake</span><p id="par0055" class="elsevierStylePara elsevierViewall">L02 and HepG2 cells were seeded into 6-wells plates&#46; After adherence&#44; medium was replaced with 1&#46;8<span class="elsevierStyleHsp" style=""></span>ml fresh medium containing 10&#37; FBS&#46; Topotecan DMSO solution with high concentration was diluted into 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 10<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan working solution with fresh medium containing 10&#37; FBS&#46; 200<span class="elsevierStyleHsp" style=""></span>&#956;l topotecan working solution &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 10<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; was added into wells to make topotecan concentration 0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M respectively&#46; After 24<span class="elsevierStyleHsp" style=""></span>h treatment&#44; medium in each well was collected for glutamine detection and cells was digested for counting&#46; Glutamine was detected with Glutamine and Glutamate Determination Kit &#40;GLN1&#44; Sigma Aldrich&#44; St&#46; Louis&#44; MO&#41;&#46; Total glutamine uptake was calculated according to glutamine concentration in DMEM medium&#46; Total glutamine uptake dividing cell number was the glutamine uptake of every single cell&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">GSH detection</span><p id="par0060" class="elsevierStylePara elsevierViewall">GSH was detected using a GSH and GSSG Assay Kit &#40;Beyotime&#44; Nanjing&#44; China&#41;&#46; In brief&#44; L02 and HepG2 cells were seeded into 6-wells plates&#46; After adherence&#44; L02 and HepG2 cells were treated with topotecan with various concentrations &#40;0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Then&#44; cells were washed with PBS to remove medium&#46; Cells were digested and collected&#46; Then the samples were freeze-thawed rapidly twice by liquid nitrogen and 37<span class="elsevierStyleHsp" style=""></span>&#176;C water bath&#46; Samples were placed at 4<span class="elsevierStyleHsp" style=""></span>&#176;C or in an ice bath for 5<span class="elsevierStyleHsp" style=""></span>min&#46; Centrifuged at 10&#44;000<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span> at 4<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#46; Supernatant was used for the determination of GSH according to the manufacturer&#39;s protocol&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Determination of cellular reactive oxygen species &#40;ROS&#41;</span><p id="par0065" class="elsevierStylePara elsevierViewall">ROS was detected using Reactive Oxygen Species Assay Kit &#40;Beyotime&#44; Nanjing&#44; China&#41;&#46; In brief&#44; L02 and HepG2 cells were seeded into 6-wells plates&#46; After adherence&#44; L02 and HepG2 cells were treated with topotecan with various concentrations &#40;0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#46; DCFH-DA was diluted in serum-free medium at 1&#58;1000 to a final concentration of 10<span class="elsevierStyleHsp" style=""></span>mM&#46; Removed the cell culture medium and added the DCFH-DA diluted in the appropriate volume&#46; The added volume should be sufficient to cover the cells&#44; and the diluted DCFH-DA should be no less than 1<span class="elsevierStyleHsp" style=""></span>ml for one hole of the 6-wells plate&#46; The cells were incubated in a 37<span class="elsevierStyleHsp" style=""></span>&#176;C cell incubator for 20<span class="elsevierStyleHsp" style=""></span>min&#46; Then&#44; cells were washed with serum-free cell culture medium three times to fully remove the DCFH-DA that did not enter the cells&#46; The ROS level was detected at 488<span class="elsevierStyleHsp" style=""></span>nm excitation wavelength and 525<span class="elsevierStyleHsp" style=""></span>nm emission wavelength with Varioskan LUX Multimode Microplate Reader &#40;Thermo Scientific&#41;&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Statistical analysis</span><p id="par0070" class="elsevierStylePara elsevierViewall">All results are expressed as the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; Student&#39;s <span class="elsevierStyleItalic">t</span>-test was performed to compare and detect significance differences between paired groups&#46; Values of <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 were accepted as statistically significant&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46; All experiments were repeated at least 3 times&#46;</p></span></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Results</span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Topotecan inhibited proliferation of L02 and HepG2 cells&#46;</span><p id="par0075" class="elsevierStylePara elsevierViewall">To investigate the toxic effect of topotecan&#44; we treated L02 hepatocytes and HepG2 hepatocellular carcinoma cells with topotecan for 24<span class="elsevierStyleHsp" style=""></span>h&#46; As showed in <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A and C&#44; topotecan suppressed the proliferation of L02 and HepG2 cells in a dose-dependent manner&#46; The relative cell viabilities of 0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M and 1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan in L02 cells were 0&#46;9133<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;04509&#44; 0&#46;5167<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1102&#44; 0&#46;2500<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06245 respectively&#46; The relative cell viabilities of 0&#46;01<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M and 1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan in HepG2 cells were 0&#46;9423<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;03859&#44; 0&#46;6597<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1150&#44; 0&#46;3367<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09067 respectively&#46; Besides&#44; topotecan also inhibited the growth of L02 and HepG2 cells in a time-dependent manner&#46; When L02 and HepG2 cells were treated with 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan for 12<span class="elsevierStyleHsp" style=""></span>h&#44; 24<span class="elsevierStyleHsp" style=""></span>h&#44; 48<span class="elsevierStyleHsp" style=""></span>h&#44; the relative cell viabilities of 0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M topotecan treatment for 12<span class="elsevierStyleHsp" style=""></span>h&#44; 24<span class="elsevierStyleHsp" style=""></span>h and 48<span class="elsevierStyleHsp" style=""></span>h were 0&#46;9767<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07506&#44; 0&#46;5167<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;03512&#44; 0&#46;2333<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;05859 in L02 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>B&#41; and 1&#46;040<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06557&#44; 0&#46;5533<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08386&#44; 0&#46;2800<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;03606 in HepG2 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>D&#41;&#46; mTOR regulates the proliferation of eukaryotic cell&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">12</span></a> We next checked whether topotecan inhibited mTOR signaling pathway&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>E and F&#44; topotecan inhibited the phosphorylation of mTOR and its downstream target p70S6k in both L02 and HepG2 cells&#44; which indicated that topotecan inhibited mTOR signaling pathway&#46; Taken together&#44; these results show that topotecan indeed possess a powerful capacity to inhibit cell growth&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Topotecan induced cell injury via inducing apoptosis</span><p id="par0080" class="elsevierStylePara elsevierViewall">In order to investigate how topotecan inhibited cell growth of L02 and HepG2 cells&#44; we performed flow cytometry to detect the influence of topotecan on apoptosis of L02 and HepG2 cells&#46; As showed in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A and B&#44; topotecan induced apoptosis in both L02 and HepG2 cells&#44; which indicated that topotecan could cause serious injury not only in hepatocellular carcinoma cells but also in normal hepatocytes&#46; topotecan induced apoptosis was also verified at molecular level as the apoptotic markers Cleaved-caspase 3&#44; Cleaved-caspase 9 and Cleaved-PARP were all up-regulated in L02 and HepG2 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C and D&#41;&#46; Taken together&#44; these results suggest that topotecan causes hepatocellular injury via inducing apoptosis&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Topotecan induced oxidative stress in L02 and HepG2 cells</span><p id="par0085" class="elsevierStylePara elsevierViewall">Next&#44; we sought to study the mechanism of how topotecan induced apoptosis in L02 and HepG2 cells&#46; It was reported that topotecan caused increased ROS level alone or combined with other medicines in various cell type&#46;<a class="elsevierStyleCrossRefs" href="#bib0155"><span class="elsevierStyleSup">11&#44;13</span></a> Thus&#44; we detected ROS level in L02 and HepG2 cells upon topotecan treatment for 24<span class="elsevierStyleHsp" style=""></span>h&#46; As expected&#44; topotecan caused increased ROS level in both L02 and HepG2 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A and B&#41;&#46; In addition&#44; the intracellular level of the most important antioxidant GSH was decreased in a dose-dependent manner &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>C and 3D&#41;&#46; In summary&#44; these results indicate that topotecan causes oxidative stress in L02 and HepG2 cells&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Topotecan inhibited ASCT2 expression in L02 and HepG2 cells</span><p id="par0090" class="elsevierStylePara elsevierViewall">As glutamine is one of the three amino constituting GSH&#44; dysfunction of glutamine uptake must cause decreased GSH production without doubt&#46; So we checked whether topotecan caused a decrease of the expression of ASCT2&#44; one of the most important glutamine transporters has been reported in hepatoma carcinoma cells which is also responsible for part of glutamine uptake in non-tumorigenic hepatocytes&#46;<a class="elsevierStyleCrossRefs" href="#bib0170"><span class="elsevierStyleSup">14&#44;15</span></a> As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>A and B&#44; topotecan inhibited ASCT2 expression at mRNA level in both L02 and HepG2 cells&#46; The protein level of ASCT2 was also suppressed by topotecan in a dose-dependent manner &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>C and D&#41;&#46; Besides&#44; topotecan inhibited the uptake of glutamine as expected in both L02 and HepG2 cells&#46; Taken together&#44; these results suggest that topotecan inhibits ASCT2 expression in both L02 normal hepatocytes and HepG2 hepatocellular carcinoma cells&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Overexpression of ASCT2 increased GSH production and reduced topotecan induced ROS</span><p id="par0095" class="elsevierStylePara elsevierViewall">In order to study the role of ASCT2 played in topotecan-caused hepatocellular injury&#44; we established ASCT2-overexpression cell model in both L02 and HepG2 cells using adenovirus vector&#46; Both mRNA and protein level of ASCT2 were increased post adenovirus transfection &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>A&#8211;D&#41;&#46; Overexpression of ASCT2 increased the uptake of glutamine in both L02 and HepG2 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>E and F&#41;&#46; The GSH level was also increased as expected in L02 and HepG2 cells&#46; When treated with topotecan&#44; ASCT2 overexpression inhibited ROS production in both L02 and HepG2 cells&#46; Taken together&#44; these results indicate that overexpression of ASCT2 increases GSH production and reduces topotecan-caused ROS production&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Overexpression of ASCT2 reversed topotecan induced apoptosis of L02 and HepG2 cells</span><p id="par0100" class="elsevierStylePara elsevierViewall">As ROS is an inducer of apoptosis&#44; overexpression of ASCT2 inhibited ROS production upon topotecan treatment&#44; we next explored whether overexpression of ASCT2 could protect against topotecan-caused apoptosis&#46; As showed in <a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>A and B&#44; overexpression attenuated topotecan-induced apoptosis of L02 and HepG2 cells&#46; In control L02 cells&#44; topotecan caused apoptosis rate up to around 30&#37;&#44; however&#44; the apoptosis rate caused by topotecan was just around 15&#37; &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>A&#41;&#46; The protective function of ASCT2 overexpression was more obvious in HepG2 cells&#46; Overexpression of ASCT2 almost absolutely protected against topotecan induced HepG2 apoptosis &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>B&#41;&#46; At molecular level&#44; topotecan-induced increase of Cleaved-caspase 3&#44; Cleaved-caspase 9&#44; Cleaved-PARP expression was reversed by ASCT2 overexpression &#40;<a class="elsevierStyleCrossRef" href="#fig0030">Fig&#46; 6</a>C and D&#41;&#46; Taken together&#44; these results demonstrate that overexpression of ASCT2 attenuates apoptosis caused by topotecan in both L02 and HepG2 cells&#46;</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span><span id="sec0110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Overexpression of ASCT2 attenuated the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cells</span><p id="par0105" class="elsevierStylePara elsevierViewall">Next&#44; whether overexpression of ASCT2 could reverse topotecan-caused growth inhibition was still unknown&#46; Using a growth assay&#44; we found that overexpression of ASCT2 sustained cell growth upon topotecan treatment&#46; Although cells cannot grow rapidly upon topotecan treatment after ASCT2 overexpression&#44; cells treated with topotecan still kept alive &#40;<a class="elsevierStyleCrossRef" href="#fig0035">Fig&#46; 7</a>A and B&#41;&#46; Mechanistically&#44; overexpression of ASCT2 sustained activated protein synthesis pathway as shown in <a class="elsevierStyleCrossRef" href="#fig0035">Fig&#46; 7</a>C and D&#46; Overexpression of ASCT2 kept phosphorylation of mTOR and p70S6k still at a high level&#46; In summary&#44; overexpression of ASCT2 attenuates the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cells&#46;</p><elsevierMultimedia ident="fig0035"></elsevierMultimedia></span></span><span id="sec0115" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Discussion</span><p id="par0110" class="elsevierStylePara elsevierViewall">In our present study&#44; we demonstrated that topotecan could cause hepatocellular injury via inducing cell death of hepatocytes and hepatocellular carcinoma cells mediated by ASCT2 down-regulation induced apoptosis&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">There are two forms of apoptosis in cells&#44; including death receptor pathway mediated by TNF-&#945; and mitochondrial pathway&#46; ROS is the most common apoptosis stimulating factor in cells&#46; Most of absorbed oxygen is reduced back to water by electron from oxidation respiratory chain&#44; but there is still a small number of oxygen undergo monovalent reduction by electron leaked out from oxidation respiratory chain to form the super oxygen anion&#46; Then the super oxygen anion transforms to hydrogen peroxide &#40;H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#41; by disproportionation&#44; which is the major source of ROS&#46;<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">16</span></a> When treated with cytotoxic medicines&#44; more ROS will be produced and induces cell apoptosis&#46; GSH is the most important ROS scavenger inside living cells&#46; Block of GSH production makes cells more sensitive to ROS-induced death&#46; ASCT2 plays an important role in transporting glutamine no matter in normal cells or in cancer cells&#46;<a class="elsevierStyleCrossRefs" href="#bib0150"><span class="elsevierStyleSup">10&#44;17&#44;18</span></a> Function damage of ASCT2 sensitizes cancer cell to ROS-induced apoptosis&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">19</span></a> Given the predominant role of hepatocytes in biotransformation and metabolism of xenobiotics&#44; ROS production constitutes an important burden in liver physiology and pathophysiology and hence in the progression of liver diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">20</span></a> Inhibition of ASCT2 will makes liver have no ability to face ROS damage&#46; Topotecan-induced ASCT2 down-regulation puts liver cells in a more dangerous situation&#46; Here&#44; topotecan caused increased ROS level inside L02 and HepG2 cells&#44; which leading to apoptosis&#46; In order to elucidate the role of ASCT2 mediated glutamine uptake in topotecan-induced liver cells death&#44; overexpression of ASCT2 was addressed&#46; Overexpression of ASCT2 significantly reversed topotecan-induced liver cells death in both L02 and HepG2 cells&#46; Given the oxidative stress topotecan may cause in liver&#44; an ASCT2 agonist which could increase glutamine uptake will be useful for clinical patients&#46; But up to now&#44; there is no ASCT2 agonist has been developed&#46; So&#44; developing ASCT2 agonists is a meaningful thing for future study&#46; Despite there is no ASCT2 agonist&#44; topotecan combined antioxidants could also be effective for alleviating topotecan-induced liver injury&#46; But this hypothesis still needs preclinical study and clinical study for verification&#46; There are still some limitations in our study&#46; The mechanism through which topotecan regulates ASCT2 expression in liver cells was not investigated in our study and this will be an interesting subject in our future study&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">This study illustrates an unreported mechanism of topotecan-induced hepatocellular injury&#44; which is that topotecan induces apoptosis via ASCT2 down-regulation mediated oxidative stress&#46; These findings further our knowledge about the hepatotoxicity of topotecan and provide strategies for prevention or alleviation&#46;</p></span><span id="sec0120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0180">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress&#46; This is the first time we demonstrate that topotecan can inhibit ASCT2 expression in hepatocytes and hepatocellular carcinoma cells&#46;</p></span><span id="sec0125" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0185">Conflict of interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors declared they do not have anything to disclose regarding conflict of interest with respect to this manuscript&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1471280"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1339944"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1471281"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Materiales y m&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1339945"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:12 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Tested drug"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Cell lines"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Reagents"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Quantitative real-time PCR &#40;qRT-PCR&#41;"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Western blot analysis"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Annexin V&#47;PI double staining"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Establishment of ASCT2 overexpression cells"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Cell proliferation assay"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Detection of glutamine uptake"
            ]
            9 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "GSH detection"
            ]
            10 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Determination of cellular reactive oxygen species &#40;ROS&#41;"
            ]
            11 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0075"
          "titulo" => "Results"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0080"
              "titulo" => "Topotecan inhibited proliferation of L02 and HepG2 cells&#46;"
            ]
            1 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Topotecan induced cell injury via inducing apoptosis"
            ]
            2 => array:2 [
              "identificador" => "sec0090"
              "titulo" => "Topotecan induced oxidative stress in L02 and HepG2 cells"
            ]
            3 => array:2 [
              "identificador" => "sec0095"
              "titulo" => "Topotecan inhibited ASCT2 expression in L02 and HepG2 cells"
            ]
            4 => array:2 [
              "identificador" => "sec0100"
              "titulo" => "Overexpression of ASCT2 increased GSH production and reduced topotecan induced ROS"
            ]
            5 => array:2 [
              "identificador" => "sec0105"
              "titulo" => "Overexpression of ASCT2 reversed topotecan induced apoptosis of L02 and HepG2 cells"
            ]
            6 => array:2 [
              "identificador" => "sec0110"
              "titulo" => "Overexpression of ASCT2 attenuated the inhibitory effect of topotecan on the proliferation of L02 and HepG2 cells"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0115"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0120"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0125"
          "titulo" => "Conflict of interest"
        ]
        10 => array:2 [
          "identificador" => "xack515534"
          "titulo" => "Acknowledgements"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-02-03"
    "fechaAceptado" => "2020-05-18"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1339944"
          "palabras" => array:6 [
            0 => "Topotecan"
            1 => "ASCT2"
            2 => "GSH"
            3 => "Apoptosis"
            4 => "ROS"
            5 => "Hepatocellular injury"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1339945"
          "palabras" => array:6 [
            0 => "Topotec&#225;n"
            1 => "ASCT2"
            2 => "GSH"
            3 => "Apoptosis"
            4 => "ERO"
            5 => "Lesi&#243;n hepatocelular"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Topotecan is an anti-cancer chemotherapy drug with common side effects&#44; including hepatotoxicity&#46; In this study&#44; we aim to investigate the mechanisms of topotecan-induced hepatocellular injury beyond conventional DNA damage&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Methyl Thiazolyl Tetrazolium &#40;MTT&#41; assay was used to detect the inhibitory effect of topotecan on cell proliferation&#46; Western blot was used to detect protein expression&#46; Flow cytometry assay was performed to determine apoptosis rate under topotecan treatment&#46; ASCT2 overexpression was addressed using adenovirus vector&#46; qRT-PCR and western blot assay were used to detect the expression of ASCT2&#46; Glutamine uptake&#44; intracellular glutathione &#40;GSH&#41; and reactive oxygen species &#40;ROS&#41; level were detected by glutamine detection kit&#44; GSH detection kit and ROS detection kit respectively&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">MTT results showed that topotecan had an inhibitory effect on cell proliferation and induced apoptosis in both L02 and HepG2 cell lines&#46; Topotecan inhibited the expression of glutamine transporter ASCT2 and the uptake of glutamine in both L02 and HepG2 cell lines&#46; The uptake of glutamine and the GSH level was increased in both L02 and HepG2 cell lines after ASCT2 overexpression&#46; The ROS level was inhibited by ASCT2 overexpression upon topotecan treatment in both L02 and HepG2 cell lines&#46; Topotecan-induced hepatocellular apoptosis and proliferation inhibition were attenuated by ASCT2 overexpression in both L02 and HepG2 cell lines&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Topotecan-induced hepatocytes death is dependent on ASCT2 down-regulation&#44; which causes oxidative stress via inhibiting GSH production&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">El topotec&#225;n es un f&#225;rmaco quimioterap&#233;utico antineopl&#225;sico con efectos secundarios frecuentes&#44; incluida la hepatotoxicidad&#46; En este estudio nos proponemos investigar los mecanismos de la lesi&#243;n hepatocelular inducida por el topotec&#225;n m&#225;s all&#225; del da&#241;o convencional del ADN&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Materiales y m&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Se utiliz&#243; el ensayo de metil tiazolil tetrazolio &#40;MTT&#41; para detectar el efecto inhibitorio del topotec&#225;n sobre la proliferaci&#243;n celular&#46; Se utiliz&#243; inmunoelectrotransferencia para detectar la expresi&#243;n de las prote&#237;nas&#46; Se realiz&#243; un ensayo de citometr&#237;a de flujo para determinar la tasa de apoptosis con el tratamiento con topotec&#225;n&#46; La sobreexpresi&#243;n del ASCT2 se abord&#243; utilizando un vector adenoviral&#46; Se utilizaron la qRT-PCR y el ensayo de inmunoelectrotransferencia para detectar la expresi&#243;n del ASCT2&#46; La absorci&#243;n de glutamina&#44; el nivel de glutati&#243;n intracelular &#40;GSH&#41; y el nivel de especies reactivas del ox&#237;geno &#40;ERO&#41; se detectaron mediante un equipo de detecci&#243;n de glutamina&#44; un equipo de detecci&#243;n de GSH y un equipo de detecci&#243;n de ERO&#44; respectivamente&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Los resultados del ensayo de MTT mostraron que el topotec&#225;n ten&#237;a un efecto inhibitorio sobre la proliferaci&#243;n celular y que induc&#237;a la apoptosis en las estirpes celulares L02 y HepG2&#46; El topotec&#225;n inhibi&#243; la expresi&#243;n del transportador de glutamina ASCT2 y la absorci&#243;n de glutamina en las estirpes celulares L02 y HepG2&#46; La absorci&#243;n de glutamina y el nivel de GSH aumentaron en las estirpes celulares L02 y HepG2 despu&#233;s de la sobreexpresi&#243;n del ASCT2&#46; El nivel de ERO fue inhibido por la sobreexpresi&#243;n del ASCT2 tras el tratamiento con topotec&#225;n en las estirpes celulares L02 y HepG2&#46; La apoptosis hepatocelular y la inhibici&#243;n de la proliferaci&#243;n inducidas por el topotec&#225;n fueron atenuadas por la sobreexpresi&#243;n del ASCT2 en las estirpes celulares L02 y HepG2&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La muerte de hepatocitos inducida por el topotec&#225;n depende de la regulaci&#243;n descendente del ASCT2&#44; que causa estr&#233;s oxidativo al inhibir la producci&#243;n de GSH&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Materiales y m&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:8 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 3607
            "Ancho" => 2921
            "Tamanyo" => 573642
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Topotecan inhibited proliferation of L02 and HepG2 cells&#46; &#40;A&#41; and &#40;C&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; MTT assay was performed to detect the viability of L02 &#40;A&#41; and HepG2 &#40;C&#41; cells&#46; &#40;B&#41; and &#40;D&#41; L02 and HepG2 cells were treated with topotecan &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 12<span class="elsevierStyleHsp" style=""></span>h&#44; 24<span class="elsevierStyleHsp" style=""></span>h and 48<span class="elsevierStyleHsp" style=""></span>h&#44; MTT assay was performed to detected the viability of L02 &#40;B&#41; and HepG2 &#40;D&#41; cells&#46; &#40;E&#41; and &#40;F&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Protein samples were harvested and the expression of p-p70S6k&#44; p70S6k&#44; p-mTOR and mTOR in L02 &#40;E&#41; and HepG2 &#40;F&#41; cells was detected by western blot&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2604
            "Ancho" => 2508
            "Tamanyo" => 518424
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Topotecan induced apoptosis in L02 and HepG2 cells&#46; &#40;A&#41; and &#40;B&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Apoptosis of cells was detected by flow cytometry&#46; &#40;C&#41; and &#40;D&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Apoptotic markers Cleaved-caspase 9&#44; Cleaved-caspase 3 and Cleaved-PARP were detected by western blot&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2090
            "Ancho" => 2504
            "Tamanyo" => 231961
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Topotecan increased ROS level and decreased GSH level in L02 and HepG2 cells&#46; &#40;A&#41; and &#40;B&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; ROS level was detected using ROS detection kit&#46; &#40;C&#41; and &#40;D&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; GSH level was detected using a GSH detection kit&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 4064
            "Ancho" => 2920
            "Tamanyo" => 593583
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Topotecan inhibited glutamine uptake via suppressing ASCT2 expression in L02 and HepG2 cells&#46; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; RNA and protein samples were harvested&#46; mRNA expression of ASCT2 was detected by quantitative real-time PCR in L02 &#40;A&#41; and HepG2 &#40;B&#41; cells&#46; Protein expression of ASCT2 was detected by western blot &#40;C&#41; and &#40;D&#41;&#46; &#40;E&#41; and &#40;F&#41; L02 and HepG2 cells were treated with topotecan with different concentration for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Glutamine concentration in medium was detected using glutamine detection kit&#46; Then glutamine uptake was calculated according to original concentration of glutamine in medium&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 2355
            "Ancho" => 2925
            "Tamanyo" => 370210
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Overexpression of ASCT2 increased GSH production and reduced topotecan-induced ROS in L02 and HepG2 cells&#46; L02 and HepG2 cells were treated with adenoviral expression vector for 48<span class="elsevierStyleHsp" style=""></span>h&#44; then changed fresh DMEM medium with 10&#37; FBS for growth until 90&#37; confluence&#46; Protein and RNA samples were harvested for western blot and quantitative real-time PCR respectively&#46; &#40;A&#41; and &#40;B&#41; ASCT2 expression post transfection was detected by western blot&#46; &#40;C&#41; and &#40;D&#41; mRNA expression of ASCT2 post transfection was detected by quantitative real-time PCR&#46; &#40;E&#41; and &#40;F&#41; Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 60&#8211;70&#37; confluence&#46; Cells were supplemented with fresh complete DMEM medium and cultured for 24<span class="elsevierStyleHsp" style=""></span>h&#46; Glutamine in medium was detected using glutamine detection kit&#46; Glutamine uptake was calculated according to original glutamine concentration in DMEM medium&#44; then averaged to single cell&#46; &#40;G&#41; and &#40;H&#41; Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 80&#8211;90&#37; confluence&#46; Cells were lysed and GSH level was detected using GSH detection kit&#46; &#40;I&#41; and &#40;J&#41; Control cells and ASCT2 overexpression cells were seeded into 6-well plates until 80&#8211;90&#37; confluence&#46; Cells were lysed and ROS level was detected using ROS detection kit&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#59; &#42;&#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "fig0030"
        "etiqueta" => "Figure 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 3452
            "Ancho" => 3079
            "Tamanyo" => 598523
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Overexpression of ASCT2 reversed topotecan-induced apoptosis of L02 and HepG2 cells&#46; &#40;A&#41; and &#40;B&#41; Control and ASCT2 overexpression cells were treated with or without topotecan &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#44; cell apoptosis was detected by flow cytometry&#46; &#40;C&#41; and &#40;D&#41; Control and ASCT2 overexpression cells were treated with or without topotecan &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#44; cell samples were harvested for analysis of Cleaved-caspase 3&#44; Cleaved-caspase 9 and Cleaved-PARP expression by western blot&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#46;</p>"
        ]
      ]
      6 => array:7 [
        "identificador" => "fig0035"
        "etiqueta" => "Figure 7"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr7.jpeg"
            "Alto" => 2526
            "Ancho" => 2994
            "Tamanyo" => 412411
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Overexpression of ASCT2 partly reversed topotecan-caused growth inhibition&#46; &#40;A&#41; and &#40;B&#41; Control and ASCT2 overexpression cells were seeded into 12-well plates&#46; After 24<span class="elsevierStyleHsp" style=""></span>h&#44; cells were treated with topotecan &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 72<span class="elsevierStyleHsp" style=""></span>h&#46; Cell number was counted every 24<span class="elsevierStyleHsp" style=""></span>h post topotecan treatment&#46; &#40;C&#41; and &#40;D&#41; Control and ASCT2 overexpression cells were treated with or without topotecan &#40;0&#46;1<span class="elsevierStyleHsp" style=""></span>&#956;M&#41; for 24<span class="elsevierStyleHsp" style=""></span>h&#44; cell samples were harvested&#46; The expression of p-p70S6k&#44; p70S6k&#44; p-mTOR and mTOR was detected by western blot&#46; &#946;-Actin was used as a loading control&#46; Protein amount was quantified using Image J&#46; Data represent the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of three independent experiments&#46; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequences&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18s&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward sequence&#58; ACCCGTTGAACCCCATTCGTGAReverse sequence&#58; GCCTCACTAAACCATCCAATCGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SLC1A5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Forward sequence&#58; TCCTCTTCACCCGCAAAAACCCReverse sequence&#58; CCACGCCATTATTCTCCTCCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2531894.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Primer sequences in qRT-PCR&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:20 [
            0 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Topoisomerase I inhibitors&#58; camptothecins and beyond"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Y&#46; Pommier"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrc1977"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Cancer"
                        "fecha" => "2006"
                        "volumen" => "6"
                        "paginaInicial" => "789"
                        "paginaFinal" => "802"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16990856"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Topotecan in combination with cisplatin for the treatment of stage IVB&#44; recurrent&#44; or persistent cervical cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Brave"
                            1 => "R&#46; Dagher"
                            2 => "A&#46; Farrell"
                            3 => "S&#46; Abraham"
                            4 => "R&#46; Ramchandani"
                            5 => "J&#46; Gobburu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Oncology &#40;Williston Park&#44; NY&#41;"
                        "fecha" => "2006"
                        "volumen" => "20"
                        "paginaInicial" => "1401"
                        "paginaFinal" => "1404"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A phase I&#47;II study of CY and topotecan in patients with high-risk malignancies undergoing autologous hematopoietic cell transplantation&#58; the St Jude long-term follow-up"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46;A&#46; Kasow"
                            1 => "C&#46;F&#46; Stewart"
                            2 => "R&#46;C&#46; Barfield"
                            3 => "N&#46;L&#46; Wright"
                            4 => "C&#46; Li"
                            5 => "D&#46;K&#46; Srivastava"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/bmt.2012.51"
                      "Revista" => array:6 [
                        "tituloSerie" => "Bone Marrow Transplant"
                        "fecha" => "2012"
                        "volumen" => "47"
                        "paginaInicial" => "1448"
                        "paginaFinal" => "1454"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22426752"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Topotecan&#44; thiotepa&#44; and carboplatin for neuroblastoma&#58; failure to prevent relapse in the central nervous system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46;H&#46; Kushner"
                            1 => "K&#46; Kramer"
                            2 => "S&#46; Modak"
                            3 => "N&#46;A&#46; Kernan"
                            4 => "L&#46;M&#46; Reich"
                            5 => "K&#46; Danis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bmt.1705253"
                      "Revista" => array:6 [
                        "tituloSerie" => "Bone Marrow Transplant"
                        "fecha" => "2006"
                        "volumen" => "37"
                        "paginaInicial" => "271"
                        "paginaFinal" => "276"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16400336"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Phase I and pharmacokinetic study of topotecan administered orally once daily for 5 days for 2 consecutive weeks to pediatric patients with refractory solid tumors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;C&#46; Daw"
                            1 => "V&#46;M&#46; Santana"
                            2 => "L&#46;C&#46; Iacono"
                            3 => "W&#46;L&#46; Furman"
                            4 => "D&#46;R&#46; Hawkins"
                            5 => "P&#46;J&#46; Houghton"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1200/JCO.2004.07.110"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Oncol"
                        "fecha" => "2004"
                        "volumen" => "22"
                        "paginaInicial" => "829"
                        "paginaFinal" => "837"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14990638"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Achieving the balance between ROS and antioxidants&#58; when to use the synthetic antioxidants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46; Poljsak"
                            1 => "D&#46; Suput"
                            2 => "I&#46; Milisav"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2013/956792"
                      "Revista" => array:5 [
                        "tituloSerie" => "Oxid Med Cell Longev"
                        "fecha" => "2013"
                        "volumen" => "2013"
                        "paginaInicial" => "956792"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23738047"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Unraveling the potential role of glutathione in multiple forms of cell death in cancer therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Lv"
                            1 => "C&#46; Zhen"
                            2 => "J&#46; Liu"
                            3 => "P&#46; Yang"
                            4 => "L&#46; Hu"
                            5 => "P&#46; Shang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Oxid Med Cell Longev"
                        "fecha" => "2019"
                        "volumen" => "2019"
                        "paginaInicial" => "3150145"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ASC amino-acid transporter 2 &#40;ASCT2&#41; as a novel prognostic marker in non-small cell lung cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Shimizu"
                            1 => "K&#46; Kaira"
                            2 => "Y&#46; Tomizawa"
                            3 => "N&#46; Sunaga"
                            4 => "O&#46; Kawashima"
                            5 => "N&#46; Oriuchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/bjc.2014.88"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Cancer"
                        "fecha" => "2014"
                        "volumen" => "110"
                        "paginaInicial" => "2030"
                        "paginaFinal" => "2039"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24603303"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ASCT2 silencing regulates mammalian target-of-rapamycin growth and survival signaling in human hepatoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46;C&#46; Fuchs"
                            1 => "R&#46;E&#46; Finger"
                            2 => "M&#46;C&#46; Onan"
                            3 => "B&#46;P&#46; Bode"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpcell.00330.2006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Cell Physiol"
                        "fecha" => "2007"
                        "volumen" => "293"
                        "paginaInicial" => "C55"
                        "paginaFinal" => "C63"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17329400"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ASCT2&#47;SLC1A5 controls glutamine uptake and tumour growth in triple-negative basal-like breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; van Geldermalsen"
                            1 => "Q&#46; Wang"
                            2 => "R&#46; Nagarajah"
                            3 => "A&#46;D&#46; Marshall"
                            4 => "A&#46; Thoeng"
                            5 => "D&#46; Gao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/onc.2015.381"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "2016"
                        "volumen" => "35"
                        "paginaInicial" => "3201"
                        "paginaFinal" => "3208"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26455325"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Topotecan induces apoptosis via ASCT2 mediated oxidative stress in gastric cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Wang"
                            1 => "Y&#46; Liu"
                            2 => "T&#46;L&#46; Zhao"
                            3 => "Z&#46;Z&#46; Li"
                            4 => "J&#46;Y&#46; He"
                            5 => "B&#46;J&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.phymed.2018.12.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Phytomedicine"
                        "fecha" => "2019"
                        "volumen" => "57"
                        "paginaInicial" => "117"
                        "paginaFinal" => "128"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30668314"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "mTOR signaling in growth metabolism&#44; and disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46;A&#46; Saxton"
                            1 => "D&#46;M&#46; Sabatini"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cell.2017.02.004"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell"
                        "fecha" => "2017"
                        "volumen" => "168"
                        "paginaInicial" => "960"
                        "paginaFinal" => "976"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28283069"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anticancer activities of genistein-topotecan combination in prostate cancer cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "V&#46; Hormann"
                            1 => "J&#46; Kumi-Diaka"
                            2 => "M&#46; Durity"
                            3 => "A&#46; Rathinavelu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1582-4934.2012.01576.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Cell Mol Med"
                        "fecha" => "2012"
                        "volumen" => "16"
                        "paginaInicial" => "2631"
                        "paginaFinal" => "2636"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22452992"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular and functional analysis of glutamine uptake in human hepatoma and liver-derived cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46;P&#46; Bode"
                            1 => "B&#46;C&#46; Fuchs"
                            2 => "B&#46;P&#46; Hurley"
                            3 => "J&#46;L&#46; Conroy"
                            4 => "J&#46;E&#46; Suetterlin"
                            5 => "K&#46;K&#46; Tanabe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpgi.00031.2002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Gastrointest Liver Physiol"
                        "fecha" => "2002"
                        "volumen" => "283"
                        "paginaInicial" => "G1062"
                        "paginaFinal" => "G1073"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12381519"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inducible antisense RNA targeting amino acid transporter ATB0&#47;ASCT2 elicits apoptosis in human hepatoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "B&#46;C&#46; Fuchs"
                            1 => "J&#46;C&#46; Perez"
                            2 => "J&#46;E&#46; Suetterlin"
                            3 => "S&#46;B&#46; Chaudhry"
                            4 => "B&#46;P&#46; Bode"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpgi.00344.2003"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Gastrointest Liver Physiol"
                        "fecha" => "2004"
                        "volumen" => "286"
                        "paginaInicial" => "G467"
                        "paginaFinal" => "G478"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14563674"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mitochondrial ROS regulation of proliferating cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46; Diebold"
                            1 => "N&#46;S&#46; Chandel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.freeradbiomed.2016.04.198"
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Radic Biol Med"
                        "fecha" => "2016"
                        "volumen" => "100"
                        "paginaInicial" => "86"
                        "paginaFinal" => "93"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27154978"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Glutamine transporter ASCT2 was down-regulated in ischemic injured human intestinal epithelial cells and reversed by epidermal growth factor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Q&#46; Huang"
                            1 => "N&#46; Li"
                            2 => "W&#46; Zhu"
                            3 => "Q&#46; Li"
                            4 => "J&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "JPEN"
                        "fecha" => "2007"
                        "volumen" => "31"
                        "paginaInicial" => "86"
                        "paginaFinal" => "93"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ASCT2 regulates glutamine uptake and cell growth in endometrial carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;D&#46; Marshall"
                            1 => "M&#46; van Geldermalsen"
                            2 => "N&#46;J&#46; Otte"
                            3 => "T&#46; Lum"
                            4 => "M&#46; Vellozzi"
                            5 => "A&#46; Thoeng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/oncsis.2017.70"
                      "Revista" => array:5 [
                        "tituloSerie" => "Oncogenesis"
                        "fecha" => "2017"
                        "volumen" => "6"
                        "paginaInicial" => "e367"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28759021"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ASCT2 &#40;SLC1A5&#41; is an EGFR-associated protein that can be co-targeted by cetuximab to sensitize cancer cells to ROS-induced apoptosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46; Lu"
                            1 => "X&#46; Li"
                            2 => "Y&#46; Lu"
                            3 => "S&#46; Qiu"
                            4 => "Z&#46; Fan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.canlet.2016.07.020"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Lett"
                        "fecha" => "2016"
                        "volumen" => "381"
                        "paginaInicial" => "23"
                        "paginaFinal" => "30"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27450723"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Redox control of liver function in health and disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Mari"
                            1 => "A&#46; Colell"
                            2 => "A&#46; Morales"
                            3 => "C&#46; von Montfort"
                            4 => "C&#46; Garcia-Ruiz"
                            5 => "J&#46;C&#46; Fernandez-Checa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/ars.2009.2634"
                      "Revista" => array:6 [
                        "tituloSerie" => "Antioxid Redox Signal"
                        "fecha" => "2010"
                        "volumen" => "12"
                        "paginaInicial" => "1295"
                        "paginaFinal" => "1331"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19803748"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack515534"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0135" class="elsevierStylePara elsevierViewall">This research project was financially supported by the <span class="elsevierStyleGrantSponsor" id="gs1">National Natural Science Foundation of China</span> &#40;No&#46; <span class="elsevierStyleGrantNumber" refid="gs1">31870080</span>&#41;&#44; <span class="elsevierStyleGrantSponsor" id="gs2">Natural Science Research Subject from Education Department of Anhui Province</span> &#40;No&#46; <span class="elsevierStyleGrantNumber" refid="gs2">KJ2017A516</span>&#41; and <span class="elsevierStyleGrantSponsor" id="gs3">Undergraduate innovation project in Anhui Province</span> &#40;Nos&#46; <span class="elsevierStyleGrantNumber" refid="gs3">S201910879201</span>&#44; <span class="elsevierStyleGrantNumber" refid="gs3">S201910879216</span>&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/24443824/0000004400000001/v2_202102250807/S2444382421000183/v2_202102250807/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "58329"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/24443824/0000004400000001/v2_202102250807/S2444382421000183/v2_202102250807/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2444382421000183?idApp=UINPBA00004N"
]

Article information

ISSN: 24443824
Original language: English

DOI:10.1016/j.gastre.2020.05.011

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	1	0	1
2024 October	18	2	20
2024 September	29	5	34
2024 August	23	5	28
2024 July	30	2	32
2024 June	11	3	14
2024 May	17	4	21
2024 April	14	4	18
2024 March	18	3	21
2024 February	24	4	28
2024 January	19	3	22
2023 December	42	4	46
2023 November	30	13	43
2023 October	21	2	23
2023 September	26	5	31
2023 August	17	1	18
2023 July	13	2	15
2023 June	14	1	15
2023 May	53	3	56
2023 April	35	1	36
2023 March	30	7	37
2023 February	8	9	17
2023 January	9	6	15
2022 April	1	0	1
2021 June	1	0	1
2021 March	1	0	1

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter