APOA1 and APOB polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome: Relationship with lipid-lowering therapy effectiveness

array:23 ["pii" => "S238702061830192X" "issn" => "23870206" "doi" => "10.1016/j.medcle.2018.05.001" "estado" => "S300" "fechaPublicacion" => "2018-07-13" "aid" => "4252" "copyright" => "Elsevier España, S.L.U.. All rights reserved" "copyrightAnyo" => "2017" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Med Clin. 2018;151:1-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0025775317306541" "issn" => "00257753" "doi" => "10.1016/j.medcli.2017.07.026" "estado" => "S300" "fechaPublicacion" => "2018-07-13" "aid" => "4252" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Med Clin. 2018;151:1-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 18 "formatos" => array:2 [ "HTML" => 10 "PDF" => 8 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Polimorfismos de los genes APOA1 y APOB y concentraciones de sus apolipoproteínas como biomarcadores de riesgo en el síndrome coronario agudo: relación con la efectividad del tratamiento hipolipemiante" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "7" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "APOA1 and APOB polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome: Relationship with lipid-lowering therapy effectiveness" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1386 "Ancho" => 1881 "Tamanyo" => 99795 ] ] "descripcion" => array:1 [ "es" => "Comparación de los niveles de ApoA-I entre sexos en los sujetos control (SC) y con síndrome coronario agudo (SCA). M: mujeres; Md: mediana; V: varones." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fidel Casillas-Muñoz, Yeminia Valle, José Francisco Muñoz-Valle, Diana Emilia Martínez-Fernández, Gabriela Lizet Reynoso-Villalpando, Héctor Enrique Flores-Salinas, Mara Anaís Llamas-Covarrubias, Jorge Ramón Padilla-Gutiérrez" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Fidel" "apellidos" => "Casillas-Muñoz" ] 1 => array:2 [ "nombre" => "Yeminia" "apellidos" => "Valle" ] 2 => array:2 [ "nombre" => "José Francisco" "apellidos" => "Muñoz-Valle" ] 3 => array:2 [ "nombre" => "Diana Emilia" "apellidos" => "Martínez-Fernández" ] 4 => array:2 [ "nombre" => "Gabriela Lizet" "apellidos" => "Reynoso-Villalpando" ] 5 => array:2 [ "nombre" => "Héctor Enrique" "apellidos" => "Flores-Salinas" ] 6 => array:2 [ "nombre" => "Mara Anaís" "apellidos" => "Llamas-Covarrubias" ] 7 => array:2 [ "nombre" => "Jorge Ramón" "apellidos" => "Padilla-Gutiérrez" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S238702061830192X" "doi" => "10.1016/j.medcle.2018.05.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S238702061830192X?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0025775317306541?idApp=UINPBA00004N" "url" => "/00257753/0000015100000001/v1_201806230409/S0025775317306541/v1_201806230409/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S2387020618301931" "issn" => "23870206" "doi" => "10.1016/j.medcle.2018.05.002" "estado" => "S300" "fechaPublicacion" => "2018-07-13" "aid" => "4251" "copyright" => "Elsevier España, S.L.U." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Med Clin. 2018;151:8-15" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Adherence to recommendations of the Therapeutic Positioning Report about treatment with oral anticoagulants in elderly patients with atrial fibrillation. The ESPARTA study" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "8" "paginaFinal" => "15" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Seguimiento de las recomendaciones del Informe de Posicionamiento Terapéutico sobre el tratamiento con anticoagulantes orales en pacientes ancianos con fibrilación auricular. Estudio ESPARTA" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Carmen Suárez Fernández, Jose María Mostaza, Luis Castilla Guerra, Jesus Cantero Hinojosa, Josep Maria Suriñach, Fernando Acosta de Bilbao, Juan José Tamarit, José Luis Diaz Diaz, Jose Luis Hernandez, Daniel Cazorla, Carles Ràfols" "autores" => array:12 [ 0 => array:2 [ "nombre" => "Carmen" "apellidos" => "Suárez Fernández" ] 1 => array:2 [ "nombre" => "Jose María" "apellidos" => "Mostaza" ] 2 => array:2 [ "nombre" => "Luis" "apellidos" => "Castilla Guerra" ] 3 => array:2 [ "nombre" => "Jesus" "apellidos" => "Cantero Hinojosa" ] 4 => array:2 [ "nombre" => "Josep Maria" "apellidos" => "Suriñach" ] 5 => array:2 [ "nombre" => "Fernando" "apellidos" => "Acosta de Bilbao" ] 6 => array:2 [ "nombre" => "Juan José" "apellidos" => "Tamarit" ] 7 => array:2 [ "nombre" => "José Luis" "apellidos" => "Diaz Diaz" ] 8 => array:2 [ "nombre" => "Jose Luis" "apellidos" => "Hernandez" ] 9 => array:2 [ "nombre" => "Daniel" "apellidos" => "Cazorla" ] 10 => array:2 [ "nombre" => "Carles" "apellidos" => "Ràfols" ] 11 => array:1 [ "colaborador" => "on behalf of the Researchers of the Estudio ESPARTA" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S002577531730653X" "doi" => "10.1016/j.medcli.2017.07.025" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S002577531730653X?idApp=UINPBA00004N" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2387020618301931?idApp=UINPBA00004N" "url" => "/23870206/0000015100000001/v1_201807170422/S2387020618301931/v1_201807170422/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "APOA1 and APOB polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome: Relationship with lipid-lowering therapy effectiveness" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "7" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Fidel Casillas-Muñoz, Yeminia Valle, José Francisco Muñoz-Valle, Diana Emilia Martínez-Fernández, Gabriela Lizet Reynoso-Villalpando, Héctor Enrique Flores-Salinas, Mara Anaís Llamas-Covarrubias, Jorge Ramón Padilla-Gutiérrez" "autores" => array:8 [ 0 => array:3 [ "nombre" => "Fidel" "apellidos" => "Casillas-Muñoz" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "Yeminia" "apellidos" => "Valle" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "José Francisco" "apellidos" => "Muñoz-Valle" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "Diana Emilia" "apellidos" => "Martínez-Fernández" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "Gabriela Lizet" "apellidos" => "Reynoso-Villalpando" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 5 => array:3 [ "nombre" => "Héctor Enrique" "apellidos" => "Flores-Salinas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 6 => array:3 [ "nombre" => "Mara Anaís" "apellidos" => "Llamas-Covarrubias" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 7 => array:4 [ "nombre" => "Jorge Ramón" "apellidos" => "Padilla-Gutiérrez" "email" => array:1 [ 0 => "imey_99@yahoo.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Doctorado en Genética Humana, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Doctorado en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Unidad Médica de Alta Especialidad, Centro Médico Nacional de Occidente (CMNO), Departamento de Cardiología, Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco, Mexico" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico" "etiqueta" => "e" "identificador" => "aff0025" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Polimorfismos de los genes APOA1 y APOB y concentraciones de sus apolipoproteínas como biomarcadores de riesgo en el síndrome coronario agudo: relación con la efectividad del tratamiento hipolipemiante" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1506 "Ancho" => 1733 "Tamanyo" => 120975 ] ] "descripcion" => array:1 [ "en" => "Comparison of ApoA-I and ApoB serum levels between subgroups in acute coronary syndrome. M: male; F: female. Md: median. UA: unstable angina, NSTEMI: non-ST segment elevation myocardial infarction. STEMI: ST segment elevation myocardial infarction." ] ] ] "textoCompleto" => "IntroductionIn 2012, 17.5 million people died from cardiovascular diseases (CVDs) around the world. Among these deaths, 7.4 million were due to coronary heart disease, a representing 12.4% of the global mortality rate.<a class="elsevierStyleCrossRef" href="#bib0175">1</a> In Mexico, ischemic heart disease is the leading cause of death in the elderly and ranks second in the general population.<a class="elsevierStyleCrossRef" href="#bib0180">2</a> According to the Instituto Nacional de Estadística y Geografía (INEGI), there were 88,144 deaths (13.4% of deaths in the Mexican population) from ischemic heart disease in 2015.<a class="elsevierStyleCrossRef" href="#bib0185">3</a>The time elapsed after an ischemic event such as in Acute Coronary Syndrome (ACS) is critical because patients face a higher risk for recurrent events or even death.<a class="elsevierStyleCrossRef" href="#bib0190">4</a> More specific measures to estimate the status and vulnerability of atherosclerotic plaques as well as the efficacy of drugs and diet in lowering lipids levels are needed. Furthermore, it is urgent to revise the predictive potential of risk biomarkers commonly used in medical practice.Diverse studies of genome-wide association (GWA) have identified candidate loci of susceptibility for cardiovascular diseases including apolipoproteins genes.<a class="elsevierStyleCrossRef" href="#bib0195">5</a> Indeed, it has been found that some polymorphisms in APOA1 and APOB genes modify the risk of cardiovascular events in different populations.<a class="elsevierStyleCrossRefs" href="#bib0200">6,7</a>It is well known that the Apo B/ApoA-I ratio is the main factor influencing the risk of myocardial infarction. This conclusion was reached by INTERHEART case–control study that calculated the odd ratios for the top 9 risk factors after analyzing almost 30,000 individuals from 52 countries.<a class="elsevierStyleCrossRef" href="#bib0210">8</a> A related attempt to predict fatal myocardial infarction is the AMORIS prospective study of >175,000 Swedish individuals, although its database did not contain any information about risk factors, the authors found that apoB serum concentration and ApoB/ApoA-I ratio were the strongest predictors of fatal outcome myocardial infarction.<a class="elsevierStyleCrossRef" href="#bib0215">9</a> Afterwards, Walldius and Jungner took advantage of the usual lower ApoA-I values in men to propose different cut-off values for the ApoB/ApoA-I ratio: <0.9 in women and <0.8 in men. Accordingly, these authors considered that any value greater than the respective cut-off implies a high risk.<a class="elsevierStyleCrossRef" href="#bib0220">10</a> Later, Lima et al. combined the results of the INTERHEART and AMORIS studies and proposed a more simplified risk calculation.<a class="elsevierStyleCrossRef" href="#bib0225">11</a>In this study we evaluated some polymorphisms of APOA1 and APOB genes and apolipoprotein concentrations as biomarkers of risk in Acute Coronary Syndrome and their relationship with lipid-lowering therapy effectiveness. Furthermore, we analyzed the Apo B/ApoA-I ratio as a possible independent predictor of ischemic events in adults with and without ACS from Western Mexico and compared such ratio with range values proposed by INTERHEART and AMORIS studies.Materials and methodsStudy design and participantsWe studied 600 genetically unrelated individuals from Western Mexico. Ethnicity was defined as those having at least two generations of ascendants born in Mexico. These subjects had the following characteristics:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">(1)Three hundred patients older than 45 years with ACS, diagnosed according to the American College of Cardiology (ACC) criteria.<a class="elsevierStyleCrossRef" href="#bib0230">12</a> Result of diagnosis, Biomarkers and routine biochemical test measures were obtained. Samples were collected during the first 24h after admission to satisfy diagnosis with more specificity.<a class="elsevierStyleCrossRef" href="#bib0235">13</a> Classical risk factors, as defined by ACC, were categorized as present or absent.</li><li class="elsevierStyleListItem" id="lsti0010">(2)Three hundred Control subjects (CS) older than 45 years. They responded to a questionnaire on their medical history and lifestyle characteristics with absence of previous cardiovascular diseases as the main exclusion criteria. They denied active infections or receiving any treatment.</li></ul>All subjects were recruited at “Hospital de Especialidades del Centro Médico Nacional de Occidente del Instituto Mexicano del Seguro Social (CMNO-IMSS).” Subjects with overlapping heart disorders or other diseases such as familial hypercholesterolemia, as well as genetically related individuals were excluded.The study was conducted in accordance with the Declaration of Helsinki. An informed written consent was obtained. Ethical approval was granted by the Ethic and Biosafety Committee of the Centro Universitario de Ciencias de la Salud, CUCS, UdeG (C.I. 069-2012).Genetic analysis of polymorphismsGenetic analysis of −75 G>A (rs670) and 83C>T (rs5070) polymorphisms of APOA1 geneThe fragment of DNA containing both rs670 and rs5070 polymorphisms was amplified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique using the following primers sequences: Forward: 5′-AGGGACAGAGCTGATCCTTGAACTCTTAAG-3′; Reverse: 5′-TTAGGGGACACCTAGCCCTCAGGAAGAGCA-3′. PCR amplification was carried out in a total volume of 20μL containing 8ng/μL of gDNA, 0.04U/μL of Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 1× of buffer, 4nM of each primer, 5mM of MgCl2, and 2mM of dNTP. The thermocycling conditions had an initial denaturation step of 5min at 94°C and were followed by 35 cycles at 94°C, 57° C, and 72°C (30s for each stage) and the final extension step of 5min at 72°C. Following PCR, the presence of a 435-bp product was visualized on 6% polyacrylamide gel after electrophoresis silver staining.The 434-bp fragment obtained was digested with the restriction enzyme MspI. 4μL of PCR product was digested with 5 units of MspI restriction enzyme during 1.5h at 37°C. The digested PCR product was rune under electrophoresis on 6% polyacrylamide gel which was visualized with silver staining. There are 3 restriction sites of recognition for MspI in the 434-bp fragment in APOA1 gen, two of which include both polymorphisms and the third is a constitutive site which gives a fragment of 180bp and a fragment of 254bp. When a G to A transition at −75bp takes place, there is no restriction site and it produces a fragment of 180bp instead of 114 and 66bp; similarly, for 83C>T, when a C to T transition takes place, the +83bp restriction site is absent and a fragment of 254bp is produced instead of 209 and 46bp. The genotypes of both polymorphisms were interpreted using this information.Genetic analysis of 2487C>T (rs693) polymorphism of APOB geneSNP Genotyping Assay for rs693 polymorphism was performed using the allelic discrimination method with a VIC® dye-labeled probe, FAM™ dye-labeled probe, and two target-specific primers (context Sequence of primers: ACATTCGGTCTCGTGTATCTTCTAG[A/G]GTCTCTCGGAATTTGGCCTTCATGT). VIC® is the probe to detect Allele 1 (wild type) sequence and FAM™ is the probe to detect Allele 2 sequence. Note: context sequence is noted using the reverse strain.The preparation of the reaction mix was as following: we use 12.5μL of 2× TaqMan® Master Mix, 0.75μL of 40× Assay Working Stock, 8.0μL of Nuclease-free water and 4.0μL of a solution containing 5ng/μL of DNA to accomplish a total volume per well of 25μL.The thermal cycling conditions were set up in a Light Cycler 96® device as following: we use a holding time for enzyme activation during 10min at 95°C and finally 40 cycles for denaturation and annealing/extension (95°C, 15s; 60°C, 60s respectively).SNP genotyping quality controlThe 25% of the samples were double-genotyped for all polymorphisms with a concordance rate of 100%.Apolipoprotein analysisSerum levels of ApoA-I and ApoB were measured in 300 patients and 300 CS by immunoturbidimetry (Biosystems S.A., Costa Brava, Barcelona, Spain) using a computerized Mindray BS 120 device.Other biochemical analysisTotal cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), triglycerides (TGC), glucose and C-reactive protein (CRP) levels were measured in patients and CS using standard enzymatic methods (Biosystems S.A., Costa Brava, Barcelona, Spain).Statistical analysisThe statistical analysis was carried out using SPSS statistical package version 22.0 and Excel 2010. The χ2 test was used to compare discrete variables and to test the Hardy-Weinberg equilibrium. The data for continuous variables were expressed as means±standard deviation (SD) and median comparison were evaluated by Mann–Whitney U test. The odds ratio (OR) was the measure of association for genotype, allele frequencies and for risk factors, cutoff of significance was p<0.05. A binary multivariate logistic regression was performed to determine adjusted risk of independent categoric variables (including ApoB/ApoA-I ratio) over the dependent variable ACS.ResultsClinical variablesDemographic and biochemical parameter information for both groups (300 ACS and 300 CS) is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Men tended to triple the cases of ACS (221 men and 79 women); CS were in a 1/1 ratio (144 men and 156 women). The most common risk factors in ACS were hypertension (64.4%), sedentary lifestyle (50.5%) and diabetes mellitus (50.2%, <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>). All patients were under treatment, 95.9% of them received acetylsalicylic acid; 92.5% statins and 90.8% clopidogrel among others (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>).<elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Genotype and allele frequenciesGenotype distributions of rs670, rs5070 and rs693 polymorphisms were in accordance with Hardy-Weinberg equilibrium (p=0.154, 0.435 and 0.660 respectively). Neither genotype nor allele frequencies showed statistically significant differences between groups, pointing out these polymorphisms are not susceptibility genetic markers for ACS in the Western Mexican population (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>). However, it is important to highlight the power of the study is weak (β=15%) and these findings must be taken carefully.<elsevierMultimedia ident="tbl0015"></elsevierMultimedia>There was no linkage disequilibrium (LD) between the two sites evaluated in APOA1 gene (D′=0.387, r2=0.003, p=0.38), thus these genetic variants must be analyzed individually.ApoA-I and ApoB serum levelsWe analyzed if rs670, rs5070 and rs693 polymorphisms influence serum levels of ApoA-I or ApoB in our population, but we did not find any association (data not shown). However, ApoA levels from patients were decreased when compared with CS (161.4mg/dL vs 195.1mg/dL, p <0.001); the levels of ApoB were decreased as well (136.9mg/dL vs 167.0mg/dL; p<0.001) (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). Atherogenic risk (Apo B/ApoA-I) was calculated by gender in each group (since the ratios are different for each gender as suggested by the INTERHEART study). We found that women had an atherogenic risk ratio of 0.75 and men had a ratio of 0.85 in ACS. In our CS group, women had a risk ratio of 0.83 and men presented a ratio of 0.88. According to INTERHEART and AMORIS recommendation, the range ratio for low cardiovascular risk in males must be between 0.40 and 0.69; moderate risk most be 0.70 to 0.89 and high risk 0.90 to 1.10. In females, the range ratio for low cardiovascular risk is between 0.30 and 0.69; moderate risk is 0.60 to 0.79 and high risk is 0.80 to 1.00.We stratified serum data according gender and groups and we found that ApoA-I serum levels were higher in Females of both groups (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>); afterwards we stratified ACS by diagnosis and we found that male patients with Unstable Angina (UA) had statistically higher serum levels of ApoA-I compared with Non-ST Segment Elevation Myocardial Infarction (NSTEMI, p=0.03) and patients with ST Segment Elevation Myocardial Infarction (STEMI, p=0.03). In females, patients with UA had statistically higher serum levels of ApoA-I than patients with STEMI (p=0.03, <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>). In patients, ApoB levels were similar by gender and diagnostic thus they were not stratified.<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia>A binary multivariate logistic regression was performed to determine if ApoB/ApoA-I ratio is an independent parameter predictor of risk in our population adjusted by risk factors (<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>). For this task, we categorized this ratio and it was divided in quintiles (the bottom quintile being the reference for comparison to the other quintiles). The presence of overweight (OR: 4.208) obesity (OR: 4.938), diabetes mellitus type 2 (OR: 3.43), dyslipidemia (OR: 2.453), high blood pressure (OR: 2.433) and smoking (OR: 5.286) are strong predictors of ACS (p<0.001); ApoB/ApoA-I ratio showed a marginal statistical significance only when the third quintile was compared against the first but in a protection way (OR: 0.233).<elsevierMultimedia ident="tbl0020"></elsevierMultimedia>DiscussionThe crucial role of ancestry in ACS is highlighted by the 3-fold higher risk documented for individuals with family history of coronary atherosclerosis.<a class="elsevierStyleCrossRef" href="#bib0240">14</a> Zdravkovic et al. determined that the heritability of cardiovascular disease was 38% in women and 57% in men. These researchers concluded that the underlying cause of cardiovascular disease was the atherosclerotic process which was the result of an interaction between the aging process and intrinsic or extrinsic factors such as some polymorphisms in genes of lipid metabolism.<a class="elsevierStyleCrossRef" href="#bib0195">5</a>Although the biological mechanism is unknown, the role of −75G>A and 83C>T polymorphisms of APOA1 gene in lipid metabolism and other risk factors related to cardiovascular disease are ineffable. In an Indian population, Dawar et al., found an association of these polymorphisms with myocardial infarction and described associated variations in the values of HDL and ApoA-I.<a class="elsevierStyleCrossRef" href="#bib0245">15</a> Both polymorphisms were significantly associated with coronary artery disease in terms of number of affected vessels.<a class="elsevierStyleCrossRef" href="#bib0250">16</a> In another study, the −75A and 83T alleles showed significant association with hypertension whereas the 83C allele was associated with obesity and hypertension in the presence of cardiovascular disease.<a class="elsevierStyleCrossRef" href="#bib0255">17</a> Likewise, the −75GA genotype conferred an increased risk for atherogenesis and dyslipidemia to adult Turks.<a class="elsevierStyleCrossRef" href="#bib0260">18</a> In contrast, we did not find direct association of −75 G>A (rs670) and 83C>T (rs5070) polymorphisms of APOA1 gene with ACS or with any variation in serum levels of HDL or ApoA-I that conveys to an increased risk for cardiovascular disease.Annotations into HaploRev v.4 allowed us to infer about the clinical impact of these non-coding variants: the rs670 variant overlapped with a motif located in enhancers in 12 different tissues and it also had a correlation with DNase I hypersensitive sites (DHSs) across 18 different cell types; the provided enrichment analyses of these enhancer sequences identified several known cell-type specific bound proteins (FOSL2, FOXA1, FOXA2, HEY1, HNF4A, HNF4G, P300, POL2, RAD21, RFX5, SP1, SREBP1, TBP, TCF12 and TCF4).<a class="elsevierStyleCrossRef" href="#bib0265">19</a> Afterwards, we searched for human chipseq experiments and we found that some of these transcription factors (FOXA1, FOXA2, HNF4A, HNF4G) are liver-specific regulators.<a class="elsevierStyleCrossRef" href="#bib0270">20</a> The rs5070 variant overlapped with a motif located in enhancers in 11 different type of tissues, it has also a correlation with DNase I Hypersensitive Sites (DHSs) on Hepatocellular Carcinoma Cell Lines (HEpG2), although there was not overlapping with binding proteins sites.<a class="elsevierStyleCrossRef" href="#bib0265">19</a> According with these results we can conclude that both genetic variants are under high transcriptional regulation in liver and the different phenotypes observed on other populations (not ours) could be explained by the global effect of these transcription factors over hepatocellular regulation. Unfortunately, at the best of our knowledge, there are not cellular or animal models focusing in the genetic variants we are studying to explain the specific biological function in hepatic regulation.Regarding 2488 C>T polymorphism of APOB gene, a meta-analysis showed that this polymorphism gives a significant risk toward the development of Cardiovascular Hearth Disease (CHD) in Han Chinese population (p=0.013), overall allelic OR (95% CI) was 2.25 (CI 1.40–3.62).<a class="elsevierStyleCrossRef" href="#bib0275">21</a> This polymorphism has also been related with dyslipidemias: heterozygotes 2488 CT have showed twofold increase in the risk of dyslipidemia and the homozygous TT showed 4 times higher risk to develop it.<a class="elsevierStyleCrossRef" href="#bib0280">22</a> The polymorphic site located at 2488 in exon 26 of APOB gene, involves a silent variation at the third nucleotide of codon threonine at amino acid 2488, so there is not amino acid change.<a class="elsevierStyleCrossRef" href="#bib0285">23</a> This silent variation is only 600–900 residues of the two domains of the LDL-C receptor binding site of apolipoprotein B; therefore, this SNP has been proposed to be in linkage disequilibrium with polymorphisms affecting this binding regions; variations in this site may lead to a different affinity to the LDL receptor and therefore it may have a different catabolism for LDL-C.<a class="elsevierStyleCrossRef" href="#bib0290">24</a> To the best of our knowledge there is no database or program that analyze the possible biological function of this polymorphism.Quantification of apolipoproteins in the estimation of coronary riskWe did not find any association between genotypes and serum levels of ApoA-I or Apo-B and other biochemical parameters. Nonetheless, in vitro studies are needed in order to assess the role of such variants over their transcriptional and translational products. However, the sole quantification of apolipoproteins has been applied in the estimation of coronary risk and has served on the characterization of several classes of dyslipidemia.<a class="elsevierStyleCrossRef" href="#bib0295">25</a>In our whole population, men had lower ApoA-I values than women as previously described,<a class="elsevierStyleCrossRef" href="#bib0220">10</a> We corroborated this sex difference with a linear regression analysis adjusted by risk factors (p=0.0008). This sex difference has been attributable to a higher basal synthesis of Apoa-I in women<a class="elsevierStyleCrossRef" href="#bib0300">26</a> and estrogen-progestin replacement therapy in women which increases HDL-C and Apoa-I.<a class="elsevierStyleCrossRef" href="#bib0305">27</a> Unfortunately, we did not register this drug consumption in females, indeed this is one of our study limitations. By diagnosis, we found that males with UA had higher levels of Apoa-I than NSTEMI and STEMI and females with UA had higher levels than STEMI (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>); it is speculated that HDL-C decrease immediately after an infarction due to inflammatory response and utilization of cholesterol for tissue repairing and hormonal synthesis<a class="elsevierStyleCrossRef" href="#bib0310">28</a>; we assume that as Apoa-I is the main apolipoprotein of HDL-C, it decreased by the same compensatory mechanisms, although we have not found the same with HDL-C probably because this measure is more fluctuating due to several medical and environmental factors.<a class="elsevierStyleCrossRef" href="#bib0315">29</a>In our study, patients had levels of HDL-C of 19.7mg/dL below the acceptable lower-level threshold (levels must be over 40), reflecting an eminent risk due to atherosclerosis. The plasma LDL-C is the measure most established as a predictor of Coronary artery disease, however some epidemiological studies have proposed that the quantification of ApoB and ApoA-I are better predictors of coronary events and have shown that the ratio Apo B/ApoA-I is an independent parameter predictor for cardiovascular disease.<a class="elsevierStyleCrossRef" href="#bib0320">30</a> ApoB represents the number of particles that contribute to the accumulation of cholesterol in the plaque and it is present in low density lipoproteins (LDL), intermediate density lipoproteins (IDL) and very low density lipoproteins (VLDL),<a class="elsevierStyleCrossRef" href="#bib0325">31</a> ApoA contributes directly to the clearance of cholesterol of tissues (such as the atherosclerotic plaque)<a class="elsevierStyleCrossRef" href="#bib0330">32</a>; therefore Apo B/ApoA-I ratio has been proposed as an atherogenic risk biomarker.The INTERHEART study also was conducted in Latin American population. This study found that variables associated with an increased risk of myocardial infarction were: stress psychosocial (OR, 2.81; 95% CI, 2.07 to 3.82), history of hypertension (OR, 2.81; 95% CI, 2.39 to 3.31), diabetes mellitus (OR, 2.59; 95% CI, 2.09 to 3.22), current smoking (OR, 2.31; 95% CI, 1.97 to 2.71), increased ratio of waist/hip (OR for the first against third tertile of 2.49; 95% CI, 1.97 to 3.14), and increased ratio of ApoB/ApoA-I (OR for the first against the third tertile of 2.31; 95% CI, 1.83 to 2.94). This study concluded that one of the main factors that contribute to cardiovascular risk in the population were abnormal lipids.<a class="elsevierStyleCrossRef" href="#bib0335">33</a>According to INTERHEART and AMORIS, we can conclude that in our group of patients, women had a moderate atherogenic risk ratio of 0.75 (moderate risk proposed values: 0.60 to 0.79), likewise men who had a ratio of 0.85 (moderate risk proposed values: 0.70 to 0.89). In our CS group, women had an elevated atherogenic risk ratio of 0.83 (high risk values: 0.80–1.00) and men presented a moderate risk with a ratio of 0.88.The present results suggest that underestimation of ApoB/ApoA-I and therefore risk reduction in our ACS group compared to CS group may be primarily related to changes in the balance of the apolipoprotein particles due to lipid lowering drugs as the samples were obtained after hospitalization and medication; even so, the predictive risk given by ApoB/ApoA-I ratio, according with INTERHEART and AMORIS values, is maintained in both groups. These findings are supported by Walldius et al, as they found that statins reduced ApoB and increased ApoA-I levels, which in turn leads to a reduction in apoB/apoA-I ratio by about 20–40%.<a class="elsevierStyleCrossRef" href="#bib0340">34</a>As it is observed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>, LDL-C levels were shown to be reduced in our ACS group most probably because of lipid-lowering therapy, so those levels have lost predictive power; however, the predictive value given by Apo B/Apo A-I is maintained (high risk ratio: CS: 0.9±0.2, ACS: 0.9±0.5).We have extrapolated our results to INTERHEART and AMORIS values, which have been obtained and adapted after a broad prospective study in individuals (our study had a transversal design and furthermore it has been applied to assess the risk after therapy in patients and to assess the risk in control subjects without therapy at only one point time); even so, on the one hand we can say that predictive value for risk given by Apo B/Apo A-I in our ACS group is moderated (in comparison with LDL-C levels which are shown very lowed) and for the other hand, we can say that our CS group maintains a significantly higher ratio and then we can follow up this group until the onset of acute event to estimate the real predictive risk according to INTERHEART and AMORIS. Our results could mean that for our ACS group, lipid-lowering drugs doses are still not enough to reduce the levels of atherogenic particles.In the binary multivariate logistic regression analysis, ApoB/ApoA-I ratio showed statistical significance only when the third quintile was compared against the first quintile but there was no risk calculated (OR: 0.479), although these data could be misrepresented as lipid values in patients are biasing the risk due to lipid-lowering therapy. According to this analysis, this ratio is not a predictor of ACS in our population; furthermore, our analysis has a cross sectional design so we do know the real behavior of Apob and ApoA-I levels during time until the presence of the variable outcome. However, reference values proposed by INTERHEART and AMORIS could be more robust and could be used to determine the atherogenic risk in our population as the risk observed in our population in both genders and in both groups, is maintained even after therapy.Summarizing, this study has shown that the polymorphisms studied in APOA1 and APOB genes have not any contribution to risk in ACS and they have no effect on their apolipoprotein concentrations; furthermore, ApoB/ApoA-I ratio was not a predictor of risk for cardiovascular disease in our population, but we have found that other biochemical parameters such as. ApoA-I, ApoB and HDL-C could be better biomarkers of cardiovascular risk than other measurements commonly accepted in medical practice such as LDL-C and could indicate if doses of statins are adequate to reduce the levels of atherogenic particles.FundingThis study was supported by grant no. PROSNI-2016 to Jorge Ramón Padilla-Gutiérrez.Conflict of interestThe authors declare that there is no conflict of interests regarding the publication of this paper." "textoCompletoSecciones" => array:1 [ "secciones" => array:11 [ 0 => array:3 [ "identificador" => "xres1060902" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background and objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1009606" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1060903" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes y objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1009607" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Study design and participants" ] 1 => array:3 [ "identificador" => "sec0025" "titulo" => "Genetic analysis of polymorphisms" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0030" "titulo" => "Genetic analysis of −75 G>A (rs670) and 83C>T (rs5070) polymorphisms of APOA1 gene" ] 1 => array:2 [ "identificador" => "sec0035" "titulo" => "Genetic analysis of 2487C>T (rs693) polymorphism of APOB gene" ] 2 => array:2 [ "identificador" => "sec0040" "titulo" => "SNP genotyping quality control" ] 3 => array:2 [ "identificador" => "sec0045" "titulo" => "Apolipoprotein analysis" ] 4 => array:2 [ "identificador" => "sec0050" "titulo" => "Other biochemical analysis" ] ] ] 2 => array:2 [ "identificador" => "sec0055" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0060" "titulo" => "Results" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0065" "titulo" => "Clinical variables" ] 1 => array:2 [ "identificador" => "sec0070" "titulo" => "Genotype and allele frequencies" ] 2 => array:2 [ "identificador" => "sec0075" "titulo" => "ApoA-I and ApoB serum levels" ] ] ] 7 => array:3 [ "identificador" => "sec0080" "titulo" => "Discussion" "secciones" => array:1 [ 0 => array:2 [ "identificador" => "sec0085" "titulo" => "Quantification of apolipoproteins in the estimation of coronary risk" ] ] ] 8 => array:2 [ "identificador" => "sec0090" "titulo" => "Funding" ] 9 => array:2 [ "identificador" => "sec0095" "titulo" => "Conflict of interest" ] 10 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2017-04-27" "fechaAceptado" => "2017-07-09" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1009606" "palabras" => array:5 [ 0 => "Acute coronary syndrome" 1 => "Atherogenic risk" 2 => "Apolipoprotein AI" 3 => "Apolipoprotein B" 4 => "Lipid-lowering therapy" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1009607" "palabras" => array:5 [ 0 => "Síndrome coronario agudo" 1 => "Riesgo aterogénico" 2 => "Apolipoproteína AI" 3 => "Apolipoproteína B" 4 => "Tratamiento de reducción de lípidos" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "Background and objectiveLipid metabolism alterations contribute to acute coronary syndrome (ACS). rs670, rs5070 and rs693 polymorphisms have shown to modify the risk of cardiovascular disease. Apolipoprotein A-I (ApoA-I) plays a major role in reverse cholesterol transport; apolipoprotein B (ApoB) contributes to accumulation of cholesterol in the plaque. The aim of this study was to investigate the association of rs670 and rs5070 polymorphisms of APOA1 and rs693 polymorphism of APOB with ACS and circulating levels of its proteins and find if ApoB/ApoA-I could be implemented as an independent parameter of risk for cardiovascular disease and as a biomarker of lipid-lowering therapy effectiveness in Mexican population. MethodsThree hundred patients with ACS and 300 control subjects (CS) were included. ResultsNeither genotype nor allele frequencies of rs670, rs5070 and rs693 polymorphisms showed statistical differences between groups. Serum levels of ApoA-I (195 vs. 161.4mg/dL; p<.001) and ApoB (167 vs. 136.9mg/dL; p<.001) were significantly higher in CS compared with ACS; however, there was no genetic association. Unstable angina patients showed the highest ApoA-I levels (males: 176.3mg/dL; females: 209.1mg/dL). ConclusionThe rs670, rs5070 and rs693 polymorphisms are not genetic susceptibility factors for ACS in Mexican population and had no effect on their apolipoprotein concentrations. In our population, ApoA-I, ApoB and HDL-C could be better biomarkers of cardiovascular risk and could indicate if statins doses reduce atherogenic particles properly." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background and objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "Antecedentes y objetivoLas alteraciones en el metabolismo de los lípidos contribuyen al síndrome coronario agudo (SCA). Se ha demostrado que los polimorfismos rs670, rs5070 y rs693 modifican el riesgo de enfermedad cardiovascular. La apolipoproteína A-I (ApoA-I) desempeña un papel principal en el transporte inverso del colesterol; la apolipoproteína B (ApoB) contribuye a la acumulación de colesterol en la placa. El objetivo de este estudio fue investigar la asociación entre los polimorfismos rs670 y rs5070 de APOA1 y el polimorfismo rs693 de APOB con SCA y los niveles circulantes de estas proteínas, e investigar si ApoB/ApoA-I podría introducirse como parámetro independiente predictor de riesgo de la enfermedad cardiovascular y como biomarcador del tratamiento de reducción de lípidos en la población mexicana. MétodosSe incluyó a 300 pacientes con SCA y 300 sujetos control (SC). ResultadosNi las frecuencias genotípicas ni las alélicas de los polimorfismos rs670, rs5070 y rs693 reflejaron diferencias estadísticamente significativas entre los grupos. Los niveles séricos de ApoA-I (195 frente a 161,4mg/dl; p<0,001) y ApoB (167 frente a 136,9mg/dl; p<0,001) fueron significativamente superiores en los SC en comparación con los SCA; sin embargo, no existió asociación genética. Los pacientes con angina inestable reflejaron los niveles más elevados de ApoA-I (varones: 176,3mg/dl; mujeres: 209,1mg/dl). ConclusiónLos polimorfismos rs670, rs5070 y rs693 no constituyen factores de susceptibilidad genética para SCA en la población de México y no tienen efecto sobre las concentraciones de sus apolipoproteínas. En nuestra población, ApoA-I, ApoB y c-HDL podrían constituir unos mejores biomarcadores del riesgo cardiovascular, y podrían indicar si las dosis de estatinas reducen debidamente las partículas aterogénicas." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes y objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "Please cite this article as: Casillas-Muñoz F, Valle Y, Muñoz-Valle JF, Martínez-Fernández DE, Reynoso-Villalpando GL, Flores-Salinas HE, et al. Polimorfismos de los genes APOA1 y APOB y concentraciones de sus apolipoproteínas como biomarcadores de riesgo en el síndrome coronario agudo: relación con la efectividad del tratamiento hipolipemiante. Med Clin (Barc). 2018;151:1–7." ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1386 "Ancho" => 1881 "Tamanyo" => 99347 ] ] "descripcion" => array:1 [ "en" => "Comparison of ApoA-I levels between gender in control subjects (CS) and acute coronary syndrome (ACS). M: male; F: female. Md: median." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1506 "Ancho" => 1733 "Tamanyo" => 120975 ] ] "descripcion" => array:1 [ "en" => "Comparison of ApoA-I and ApoB serum levels between subgroups in acute coronary syndrome. M: male; F: female. Md: median. UA: unstable angina, NSTEMI: non-ST segment elevation myocardial infarction. STEMI: ST segment elevation myocardial infarction." ] ] 2 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "CS: control subject; ACS: acute coronary syndrome; BMI: body mass index, CK: creatine phosphokinase, CK-MB: creatine phosphokinase isoform MB." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Parameter \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">CS \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">ACS \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">p<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">Reference values \t\t\t\t\t\t\n \t\t\t\t</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Mean (SE) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Mean (SE) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">55.6 (10.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">62.8 (10.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Weight (kg) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">75.0 (16.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">75.5 (14.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Height (cm) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">167 (16.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">165 (15.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">26.9 (5.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">27.4 (4.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Total cholesterol (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">171.2 (95.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">115.3 (34.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">150–199 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Fasting glucose (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">117.8 (89.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">138.7 (57.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">75–105 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Triglycerides (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">116.5 (63.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">89.1 (29.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><200 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">LDL-C (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">73.1 (32.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43.5 (17.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><130 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HDL-C (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">40.0 (20.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">19.7 (10.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>40 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PCR (mg/L) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3.8 (7.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">19.9 (15.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1–10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOA-I (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">195.1 (25.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">161.4 (28.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">94–178 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB (mg/dL) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">167.0 (34.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">136.9 (33.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">63–133 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB/APOA-I \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.9 (0.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.9 (0.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0.347 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1805589.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "*" "nota" => "p=Mann–Whitney U. NS: non significance." ] ] ] "descripcion" => array:1 [ "en" => "Demographic and clinical characteristics in ACS and CS groups." ] ] 3 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "CS: control subjects; ACS: acute coronary syndrome; FHCD: family history of cardiovascular disease; HBP: high blood pressure; NSAID's: nonsteroidal anti-inflammatory drugs." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Risk factors \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">CS</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ACS</th><th class="td" title="table-head " align="left" valign="top" scope="col">Treatment<a class="elsevierStyleCrossRef" href="#tblfn0010">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ACS</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">n \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">% \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">n \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">% \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">n \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">% \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HBP \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">81 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(29.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">190 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(64.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NSAID's with antithrombotic activity (acetylsalicylic acid) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">283 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">95.9% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Sedentarism \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">37 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(13.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">149 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(50.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Statins \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">273 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">92.5% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">DM2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">48 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(17.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">148 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(50.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Antiplaquetary drugs (Clopidogrel) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">268 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">90.8% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Smoking \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(11.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">143 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(48.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Antihypertensives (captopril, enalapril, losartan, valsartan, furosemide and spironolactone) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">227 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">76.9% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">FHCD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">125 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(42.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Anticoagulants (heparin, andenoxaparine) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">200 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">67.8% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Dyslipidemia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">33 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(11.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">123 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(41.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Beta blockers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">170 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">57.6% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Obesity \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(9.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">83 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(28.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Nitrates (Isosorbide) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">63 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">21.4% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Overweight \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">36 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(12.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">114 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(38.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Recurrent infarction \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">41 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">(13.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1805586.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "a" "nota" => "There were no Drugs used by CS." ] ] ] "descripcion" => array:1 [ "en" => "Risk factors and treatments by ACS and CS groups." ] ] 4 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "CS: control subjects; ACS: acute coronary syndrome; OR: odds ratio; n: sample size; CI: confidence interval; p: probability value." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">CS n=300 (%) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">ACS n=300 (%) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR (IC) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">p \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">75 G>A APOA1 (rs670)</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Genotype</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">G/G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">157 (52.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">143 (47.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">G/A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">113 (37.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">125 (41.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.214 (0.864–1.707) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.26 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">A/A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">30 (10.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">32 (10.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.171 (0.678–2.024) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.57 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2n=600 (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">2n=600 (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">427 (71.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">411 (68.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">173 (28.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">189 (31.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.135 (0.887–1.453) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.31 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">+83 C>T APOA1 (rs5070)</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Genotype</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C/C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">275 (91.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">276 (92.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C/T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">25 (8.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">24 (8.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.957 (0.533–1.716) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.88 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">T/T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Allele</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">575 (95.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">576 (96.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">25 (4.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">26 (4.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.958 (0.541–1.698) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.88 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">2488 C>T APOB (rs693)</td></tr><tr title="table-row"><td class="td" title="table-entry " colspan="5" align="left" valign="top">Genotype</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C/C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">110 (36.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">121 (40.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C/T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">142 (47.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">142 (47.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.909 (0.642–1.287) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.59 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">T/T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">48 (16.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">37 (12.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.701 (0.425–1.156) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.16 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">362 (60.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">384 (64.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">238 (39.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">216 (36.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.856 (0.677–1.081) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.19 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1805587.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Allele and genotype distribution of APOA1 and APOB polymorphisms in CS and ACS." ] ] 5 => array:8 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at4" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "Dependent variable: ACS. APOB/APOA-I: ratio Apolipoproteína B/Apolipoprotein A-I; (1 vs 2): first quintile vs second quintile, (1 vs 3): first quintile vs third quintile, (1 vs 4): first quintile vs fourth quintile, (1 vs 5): first quintile vs fifth quintile. ACS: acute coronary syndrome, DM2: diabetes mellitus type 2, HTA: high blood pressure." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Risk factor \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">p \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col">OR \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">95% I.C.</th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Inferior \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Superior \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB/APOA-I (1 vs 2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.784 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.103 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.549 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.217 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB/APOA-I (1 vs 3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.045 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.479 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.233 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.983 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB/APOA-I (1 vs 4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.074 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.525 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.259 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.065 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB/APOA-I (1 vs 5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.345 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.704 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.339 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.460 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Overweight \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">4.208 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.459 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">7.203 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Obesity \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">4.938 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.692 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">9.061 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">DM2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3.430 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.063 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">5.7047 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Dyslipidemia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.010 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.453 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.441 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">4.176 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HBP \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.433 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.511 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3.920 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Smoking \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">5.286 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">3.132 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">8.923 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1805588.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Binary multivariate logistic regression to determine if ApoB/ApoA-I ratio is an independent predictor parameter of risk in our population." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:34 [ 0 => array:3 [ "identificador" => "bib0175" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:3 [ "comentario" => "Available from: <a class="elsevierStyleInterRef" target="_blank" id="intr0010" href="http://www.who.int/mediacentre/factsheets/fs317/en/">http://www.who.int/mediacentre/factsheets/fs317/en/</a> [accessed 17.07.16]" "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cardiovascular diseases (CVDs) [Internet]" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "World Health Organization" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "fecha" => "2017" "editorial" => "WHO" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0180" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Third national registry of acute coronary syndromes (RENASICA III)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C. Jerjes-Sanchez" 1 => "C. Martinez-Sanchez" 2 => "G. Borrayo-Sanchez" 3 => "J. Carrillo-Calvillo" 4 => "U. Juarez-Herrera" 5 => "J. Quintanilla-Gutierrez" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.acmx.2015.04.001" "Revista" => array:6 [ "tituloSerie" => "Arch Cardiol Mex" "fecha" => "2015" "volumen" => "85" "paginaInicial" => "207" "paginaFinal" => "214" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26337914" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0185" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Principales causas de mortalidad por residencia habitual, grupos de edad y sexo del fallecido [Internet]. Available from: <a id="intr0015" class="elsevierStyleInterRef" href="http://www.inegi.org.mx/est/contenidos/proyectos/registros/vitales/mortalidad/tabulados/pc.asp?t=14%26c=11817">http://www.inegi.org.mx/est/contenidos/proyectos/registros/vitales/mortalidad/tabulados/pc.asp?t=14&c=11817</a> [accessed 13.09.17]." ] ] ] 3 => array:3 [ "identificador" => "bib0190" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lipoproteins as biomarkers and therapeutic targets in the setting of acute coronary syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R.S. Rosenson" 1 => "H.B. Brewer" 2 => "D.J. Rader" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCRESAHA.114.302805" "Revista" => array:6 [ "tituloSerie" => "Circ Res" "fecha" => "2014" "volumen" => "114" "paginaInicial" => "1880" "paginaFinal" => "1889" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24902972" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0195" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Heritability of death from coronary heart disease: a 36-year follow-up of 20 966 Swedish twins" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Zdravkovic" 1 => "A. Wienke" 2 => "N.L. Pedersen" 3 => "M.E. Marenberg" 4 => "A.I. Yashin" 5 => "U. de Faire" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Intern Med" "fecha" => "2002" "volumen" => "252" "paginaInicial" => "247" "paginaFinal" => "254" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12270005" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0200" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apolipoprotein A1 gene polymorphisms and risk of early coronary disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.R. Reguero" 1 => "G.I. Cubero" 2 => "A. Batalla" 3 => "V. Alvarez" 4 => "S. Hevia" 5 => "A. Cortina" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1159/000006849" "Revista" => array:6 [ "tituloSerie" => "Cardiology" "fecha" => "1998" "volumen" => "90" "paginaInicial" => "231" "paginaFinal" => "235" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9892774" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0205" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of genetic polymorphisms on responsiveness to dietary fat and cholesterol" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.Q. Ye" 1 => "P.O. Kwiterovich" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/ajcn/72.5.1275s" "Revista" => array:7 [ "tituloSerie" => "Am J Clin Nutr" "fecha" => "2000" "volumen" => "72" "numero" => "Suppl." "paginaInicial" => "1275s" "paginaFinal" => "1284s" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11063469" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0210" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): case–control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Yusuf" 1 => "S. Hawken" 2 => "S. Ounpuu" 3 => "T. Dans" 4 => "A. Avezum" 5 => "F. Lanas" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0140-6736(04)17018-9" "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "2004" "volumen" => "364" "paginaInicial" => "937" "paginaFinal" => "952" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15364185" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0215" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "High apolipoprotein B, low apolipoprotein A-I, and improvement in the prediction of fatal myocardial infarction (AMORIS study): a prospective study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "G. Walldius" 1 => "I. Jungner" 2 => "I. Holme" 3 => "A.H. Aastveit" 4 => "W. Kolar" 5 => "E. Steiner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0140-6736(01)07098-2" "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "2001" "volumen" => "358" "paginaInicial" => "2026" "paginaFinal" => "2033" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11755609" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0220" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The apoB/apoA-I ratio: a strong, new risk factor for cardiovascular disease and a target for lipid-lowering therapy – a review of the evidence" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G. Walldius" 1 => "I. Jungner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2796.2006.01643.x" "Revista" => array:6 [ "tituloSerie" => "J Intern Med" "fecha" => "2006" "volumen" => "259" "paginaInicial" => "493" "paginaFinal" => "519" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16629855" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0225" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apo B/apo A-I ratio and cardiovascular risk prediction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L.M. Lima" 1 => "M. Carvalho" 2 => "M.O. Sousa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Arq Bras Cardiol" "fecha" => "2007" "volumen" => "88" "paginaInicial" => "e187" "paginaFinal" => "e190" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17664987" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0230" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "2014 AHA/ACC guideline for the management of patients with non-ST-elevation acute coronary syndromes: executive summary. A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.A. Amsterdam" 1 => "N.K. Wenger" 2 => "R.G. Brindis" 3 => "D.E. Casey" 4 => "T.G. Ganiats" 5 => "D.R. Holmes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIR.0000000000000133" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2014" "volumen" => "130" "paginaInicial" => "2354" "paginaFinal" => "2394" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25249586" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0235" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Myocardial infarction redefined—a consensus document of The Joint European Society of Cardiology/American College of Cardiology Committee for the redefinition of myocardial infarction" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E. Antman" 1 => "J.-P. Bassand" 2 => "W. Klein" 3 => "M. Ohman" 4 => "J.L. Lopez Sendon" 5 => "L. Rydén" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Am Coll Cardiol" "fecha" => "2000" "volumen" => "36" "paginaInicial" => "959" "paginaFinal" => "969" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10987628" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0240" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Parental cardiovascular disease as a risk factor for cardiovascular disease in middle-aged adults: a prospective study of parents and offspring" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D.M. Lloyd-Jones" 1 => "B.H. Nam" 2 => "R.B. D’Agostino" 3 => "D. Levy" 4 => "J.M. Murabito" 5 => "T.J. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/jama.291.18.2204" "Revista" => array:6 [ "tituloSerie" => "JAMA" "fecha" => "2004" "volumen" => "291" "paginaInicial" => "2204" "paginaFinal" => "2211" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15138242" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0245" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apolipoprotein A1 gene polymorphism (G-75A and C+83T) in patients with myocardial infarction: a pilot study in a north Indian population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Dawar" 1 => "A. Gurtoo" 2 => "R. Singh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1309/AJCPKPTXQ3QN1IFG" "Revista" => array:6 [ "tituloSerie" => "Am J Clin Pathol" "fecha" => "2010" "volumen" => "134" "paginaInicial" => "249" "paginaFinal" => "255" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20660328" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0250" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Variations in the promoter region of the apolipoprotein A-1 gene influence plasma lipoprotein(a) levels in Asian Indian neonates from Singapore" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C.K. Heng" 1 => "P.S. Low" 2 => "N. Saha" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1203/00006450-200104000-00013" "Revista" => array:6 [ "tituloSerie" => "Pediatr Res" "fecha" => "2001" "volumen" => "49" "paginaInicial" => "514" "paginaFinal" => "518" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11264435" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0255" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apolipoprotein A1 gene polymorphisms as risk factors for hypertension and obesity" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.S. Chen" 1 => "D.R. Mazzotti" 2 => "T.K. Furuya" 3 => "M.S. Cendoroglo" 4 => "L.R. Ramos" 5 => "L.Q. Araujo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10238-009-0051-3" "Revista" => array:6 [ "tituloSerie" => "Clin Exp Med" "fecha" => "2009" "volumen" => "9" "paginaInicial" => "319" "paginaFinal" => "325" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19408098" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0260" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gender-specific associations of the APOA1 −75G>A polymorphism with several metabolic syndrome components in Turkish adults" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "N. Coban" 1 => "A. Onat" 2 => "F. Guclu-Geyik" 3 => "E. Komurcu-Bayrak" 4 => "G. Can" 5 => "N. Erginel-Unaltuna" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cca.2014.01.017" "Revista" => array:6 [ "tituloSerie" => "Clin Chim Acta" "fecha" => "2014" "volumen" => "431" "paginaInicial" => "244" "paginaFinal" => "249" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24508624" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0265" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L.D. Ward" 1 => "M. Kellis" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/nar/gkr917" "Revista" => array:6 [ "tituloSerie" => "Nucleic Acids Res" "fecha" => "2012" "volumen" => "40" "paginaInicial" => "D930" "paginaFinal" => "D934" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22064851" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0270" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Wang" 1 => "J. Zhuang" 2 => "S. Iyer" 3 => "X. Lin" 4 => "T.W. Whitfield" 5 => "M.C. Greven" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1101/gr.139105.112" "Revista" => array:6 [ "tituloSerie" => "Genome Res" "fecha" => "2012" "volumen" => "22" "paginaInicial" => "1798" "paginaFinal" => "1812" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22955990" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0275" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between apolipoprotein B XbaI polymorphism and coronary heart disease in Han Chinese population: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Chen" 1 => "M. Lin" 2 => "Y. Liang" 3 => "N. Zhang" 4 => "S. Rao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/gtmb.2015.0126" "Revista" => array:6 [ "tituloSerie" => "Genet Test Mol Biomarkers" "fecha" => "2016" "volumen" => "20" "paginaInicial" => "304" "paginaFinal" => "311" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27172140" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0280" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic variants in genes related to lipid metabolism and atherosclerosis, dyslipidemia and atorvaestatina response" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.C. Rodrigues" 1 => "B. Sobrino" 2 => "F.D. Genvigir" 3 => "M.A. Willrich" 4 => "S.S. Arazi" 5 => "E.L. Dorea" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cca.2012.11.028" "Revista" => array:6 [ "tituloSerie" => "Clin Chim Acta" "fecha" => "2013" "volumen" => "417" "paginaInicial" => "8" "paginaFinal" => "11" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23247049" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0285" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of the apolipoprotein B gene polymorphisms with essential hypertension in Northern Chinese Han population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W.Y. Zhao" 1 => "J.F. Huang" 2 => "L.Y. Wang" 3 => "H.F. Li" 4 => "P.H. Zhang" 5 => "Q. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biomed Environ Sci" "fecha" => "2007" "volumen" => "20" "paginaInicial" => "260" "paginaFinal" => "264" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17672218" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0290" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Further evidence for an association between the Xbal polymorphism at the apolipoprotein B locus and lipoprotein level" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T.P. Leren" 1 => "K. Berg" 2 => "I. Hjermann" 3 => "P. Leren" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Genet" "fecha" => "1988" "volumen" => "34" "paginaInicial" => "347" "paginaFinal" => "351" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2906824" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0295" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Wieland H. The clinical relevance of apolipoprotein determination. In: Rosseneu M, Widhalm K, Jarausch J, editors. Apolipoproteins in lipid disorders [Internet]. Viena: Springer; 1991 [accessed 25.04.15]. p. 63-8. Available from: <a id="intr0020" class="elsevierStyleInterRef" href="http://link.springer.com/chapter/10.1007/978-3-7091-9148-4_6">http://link.springer.com/chapter/10.1007/978-3-7091-9148-4_6</a>." ] ] ] 25 => array:3 [ "identificador" => "bib0300" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human apolipoprotein A-I and A-II metabolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.J. Schaefer" 1 => "L.A. Zech" 2 => "L.L. Jenkins" 3 => "T.J. Bronzert" 4 => "E.A. Rubalcaba" 5 => "F.T. Lindgren" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Lipid Res" "fecha" => "1982" "volumen" => "23" "paginaInicial" => "850" "paginaFinal" => "862" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6813411" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0305" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of estrogen-progestin replacement therapy on plasma lipids and lipoproteins in postmenopausal women" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F. Rodriguez-Alemán" 1 => "J.M. Torres" 2 => "J.L. Cuadros" 3 => "E. Ruiz" 4 => "E. Ortega" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Endocr Res" "fecha" => "2000" "volumen" => "26" "paginaInicial" => "263" "paginaFinal" => "273" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10921452" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0310" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mechanistic insights and clinical relevance of the interaction between acute coronary syndromes and lipid metabolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L.C. Correia" 1 => "M.T. Twickler" 2 => "A.C. Sposito" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1055/s-2004-835378" "Revista" => array:6 [ "tituloSerie" => "Semin Vasc Med" "fecha" => "2004" "volumen" => "4" "paginaInicial" => "197" "paginaFinal" => "202" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15478041" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0315" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HDL and cardiovascular disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.J. Rader" 1 => "G.K. Hovingh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0140-6736(14)61217-4" "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "2014" "volumen" => "384" "paginaInicial" => "618" "paginaFinal" => "625" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25131981" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0320" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Is it time to discard the apo B:apo A-I ratio as a predictor of cardiovascular disease?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Sierra-Johnson" 1 => "R.M. Fisher" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Nat Rev Cardiol" "fecha" => "2008" "volumen" => "5" "paginaInicial" => "18" "paginaFinal" => "19" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0325" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apolipoproteins as markers and managers of coronary risk" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.C. Chan" 1 => "G.F. Watts" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/qjmed/hcl027" "Revista" => array:6 [ "tituloSerie" => "QJM" "fecha" => "2006" "volumen" => "99" "paginaInicial" => "277" "paginaFinal" => "287" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16504986" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0330" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Progress and challenges in translating the biology of atherosclerosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "P. Libby" 1 => "P.M. Ridker" 2 => "G.K. Hansson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nature10146" "Revista" => array:6 [ "tituloSerie" => "Nature" "fecha" => "2011" "volumen" => "473" "paginaInicial" => "317" "paginaFinal" => "325" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21593864" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0335" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors for acute myocardial infarction in Latin America: the INTERHEART Latin American study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Lanas" 1 => "A. Avezum" 2 => "L.E. Bautista" 3 => "R. Diaz" 4 => "M. Luna" 5 => "S. Islam" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.106.633552" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2007" "volumen" => "115" "paginaInicial" => "1067" "paginaFinal" => "1074" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17339564" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0340" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Stroke mortality and the apoB/apoA-I ratio: results of the AMORIS prospective study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "G. Walldius" 1 => "A.H. Aastveit" 2 => "I. Jungner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2796.2005.01610.x" "Revista" => array:6 [ "tituloSerie" => "J Intern Med" "fecha" => "2006" "volumen" => "259" "paginaInicial" => "259" "paginaFinal" => "266" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16476103" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/23870206/0000015100000001/v1_201807170422/S238702061830192X/v1_201807170422/en/main.assets" "Apartado" => array:4 [ "identificador" => "43310" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/23870206/0000015100000001/v1_201807170422/S238702061830192X/v1_201807170422/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S238702061830192X?idApp=UINPBA00004N"]

Statistics

Original article

APOA1 and APOB polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome: Relationship with lipid-lowering therapy effectiveness

Polimorfismos de los genes APOA1 y APOB y concentraciones de sus apolipoproteínas como biomarcadores de riesgo en el síndrome coronario agudo: relación con la efectividad del tratamiento hipolipemiante

Fidel Casillas-Muñoza,b, Yeminia Vallea, José Francisco Muñoz-Vallea, Diana Emilia Martínez-Fernándeza,c, Gabriela Lizet Reynoso-Villalpandoa,b, Héctor Enrique Flores-Salinasd, Mara Anaís Llamas-Covarrubiase, Jorge Ramón Padilla-Gutiérreza,

Corresponding author

imey_99@yahoo.com

Corresponding author.

a Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico

b Doctorado en Genética Humana, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico

c Doctorado en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico

d Unidad Médica de Alta Especialidad, Centro Médico Nacional de Occidente (CMNO), Departamento de Cardiología, Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco, Mexico

e Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico

Read

Times
was read the article

Total PDF

Total HTML

Share statistics

 array:23 [
  "pii" => "S238702061830192X"
  "issn" => "23870206"
  "doi" => "10.1016/j.medcle.2018.05.001"
  "estado" => "S300"
  "fechaPublicacion" => "2018-07-13"
  "aid" => "4252"
  "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;. All rights reserved"
  "copyrightAnyo" => "2017"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Med Clin. 2018;151:1-7"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "es" => array:19 [
      "pii" => "S0025775317306541"
      "issn" => "00257753"
      "doi" => "10.1016/j.medcli.2017.07.026"
      "estado" => "S300"
      "fechaPublicacion" => "2018-07-13"
      "aid" => "4252"
      "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Med Clin. 2018;151:1-7"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:2 [
        "total" => 18
        "formatos" => array:2 [
          "HTML" => 10
          "PDF" => 8
        ]
      ]
      "es" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
        "titulo" => "Polimorfismos de los genes <span class="elsevierStyleItalic">APOA1</span> y <span class="elsevierStyleItalic">APOB</span> y concentraciones de sus apolipoprote&#237;nas como biomarcadores de riesgo en el s&#237;ndrome coronario agudo&#58; relaci&#243;n con la efectividad del tratamiento hipolipemiante"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "tieneResumen" => array:2 [
          0 => "es"
          1 => "en"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "1"
            "paginaFinal" => "7"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "<span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome&#58; Relationship with lipid-lowering therapy effectiveness"
          ]
        ]
        "contieneResumen" => array:2 [
          "es" => true
          "en" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Figura 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 1386
                "Ancho" => 1881
                "Tamanyo" => 99795
              ]
            ]
            "descripcion" => array:1 [
              "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Comparaci&#243;n de los niveles de ApoA-<span class="elsevierStyleSmallCaps">I</span> entre sexos en los sujetos control &#40;SC&#41; y con s&#237;ndrome coronario agudo &#40;SCA&#41;&#46; M&#58; mujeres&#59; Md&#58; mediana&#59; <span class="elsevierStyleSmallCaps">V</span>&#58; varones&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Fidel Casillas-Mu&#241;oz, Yeminia Valle, Jos&#233; Francisco Mu&#241;oz-Valle, Diana Emilia Mart&#237;nez-Fern&#225;ndez, Gabriela Lizet Reynoso-Villalpando, H&#233;ctor Enrique Flores-Salinas, Mara Ana&#237;s Llamas-Covarrubias, Jorge Ram&#243;n Padilla-Guti&#233;rrez"
            "autores" => array:8 [
              0 => array:2 [
                "nombre" => "Fidel"
                "apellidos" => "Casillas-Mu&#241;oz"
              ]
              1 => array:2 [
                "nombre" => "Yeminia"
                "apellidos" => "Valle"
              ]
              2 => array:2 [
                "nombre" => "Jos&#233; Francisco"
                "apellidos" => "Mu&#241;oz-Valle"
              ]
              3 => array:2 [
                "nombre" => "Diana Emilia"
                "apellidos" => "Mart&#237;nez-Fern&#225;ndez"
              ]
              4 => array:2 [
                "nombre" => "Gabriela Lizet"
                "apellidos" => "Reynoso-Villalpando"
              ]
              5 => array:2 [
                "nombre" => "H&#233;ctor Enrique"
                "apellidos" => "Flores-Salinas"
              ]
              6 => array:2 [
                "nombre" => "Mara Ana&#237;s"
                "apellidos" => "Llamas-Covarrubias"
              ]
              7 => array:2 [
                "nombre" => "Jorge Ram&#243;n"
                "apellidos" => "Padilla-Guti&#233;rrez"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S238702061830192X"
          "doi" => "10.1016/j.medcle.2018.05.001"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S238702061830192X?idApp=UINPBA00004N"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0025775317306541?idApp=UINPBA00004N"
      "url" => "/00257753/0000015100000001/v1_201806230409/S0025775317306541/v1_201806230409/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S2387020618301931"
    "issn" => "23870206"
    "doi" => "10.1016/j.medcle.2018.05.002"
    "estado" => "S300"
    "fechaPublicacion" => "2018-07-13"
    "aid" => "4251"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Med Clin. 2018;151:8-15"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Adherence to recommendations of the Therapeutic Positioning Report about treatment with oral anticoagulants in elderly patients with atrial fibrillation&#46; The ESPARTA study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "8"
          "paginaFinal" => "15"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Seguimiento de las recomendaciones del Informe de Posicionamiento Terap&#233;utico sobre el tratamiento con anticoagulantes orales en pacientes ancianos con fibrilaci&#243;n auricular&#46; Estudio ESPARTA"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Carmen Su&#225;rez Fern&#225;ndez, Jose Mar&#237;a Mostaza, Luis Castilla Guerra, Jesus Cantero Hinojosa, Josep Maria Suri&#241;ach, Fernando Acosta de Bilbao, Juan Jos&#233; Tamarit, Jos&#233; Luis Diaz Diaz, Jose Luis Hernandez, Daniel Cazorla, Carles R&#224;fols"
          "autores" => array:12 [
            0 => array:2 [
              "nombre" => "Carmen"
              "apellidos" => "Su&#225;rez Fern&#225;ndez"
            ]
            1 => array:2 [
              "nombre" => "Jose Mar&#237;a"
              "apellidos" => "Mostaza"
            ]
            2 => array:2 [
              "nombre" => "Luis"
              "apellidos" => "Castilla Guerra"
            ]
            3 => array:2 [
              "nombre" => "Jesus"
              "apellidos" => "Cantero Hinojosa"
            ]
            4 => array:2 [
              "nombre" => "Josep Maria"
              "apellidos" => "Suri&#241;ach"
            ]
            5 => array:2 [
              "nombre" => "Fernando"
              "apellidos" => "Acosta de Bilbao"
            ]
            6 => array:2 [
              "nombre" => "Juan Jos&#233;"
              "apellidos" => "Tamarit"
            ]
            7 => array:2 [
              "nombre" => "Jos&#233; Luis"
              "apellidos" => "Diaz Diaz"
            ]
            8 => array:2 [
              "nombre" => "Jose Luis"
              "apellidos" => "Hernandez"
            ]
            9 => array:2 [
              "nombre" => "Daniel"
              "apellidos" => "Cazorla"
            ]
            10 => array:2 [
              "nombre" => "Carles"
              "apellidos" => "R&#224;fols"
            ]
            11 => array:1 [
              "colaborador" => "on behalf of the Researchers of the Estudio ESPARTA"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S002577531730653X"
        "doi" => "10.1016/j.medcli.2017.07.025"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S002577531730653X?idApp=UINPBA00004N"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2387020618301931?idApp=UINPBA00004N"
    "url" => "/23870206/0000015100000001/v1_201807170422/S2387020618301931/v1_201807170422/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "<span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> polymorphisms and apolipoprotein concentrations as biomarkers of risk in acute coronary syndrome&#58; Relationship with lipid-lowering therapy effectiveness"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "1"
        "paginaFinal" => "7"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Fidel Casillas-Mu&#241;oz, Yeminia Valle, Jos&#233; Francisco Mu&#241;oz-Valle, Diana Emilia Mart&#237;nez-Fern&#225;ndez, Gabriela Lizet Reynoso-Villalpando, H&#233;ctor Enrique Flores-Salinas, Mara Ana&#237;s Llamas-Covarrubias, Jorge Ram&#243;n Padilla-Guti&#233;rrez"
        "autores" => array:8 [
          0 => array:3 [
            "nombre" => "Fidel"
            "apellidos" => "Casillas-Mu&#241;oz"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Yeminia"
            "apellidos" => "Valle"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Jos&#233; Francisco"
            "apellidos" => "Mu&#241;oz-Valle"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Diana Emilia"
            "apellidos" => "Mart&#237;nez-Fern&#225;ndez"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Gabriela Lizet"
            "apellidos" => "Reynoso-Villalpando"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "H&#233;ctor Enrique"
            "apellidos" => "Flores-Salinas"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Mara Ana&#237;s"
            "apellidos" => "Llamas-Covarrubias"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          7 => array:4 [
            "nombre" => "Jorge Ram&#243;n"
            "apellidos" => "Padilla-Guti&#233;rrez"
            "email" => array:1 [
              0 => "imey&#95;99&#64;yahoo&#46;com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:5 [
          0 => array:3 [
            "entidad" => "Instituto de Investigaci&#243;n en Ciencias Biom&#233;dicas&#44; Centro Universitario de Ciencias de la Salud &#40;CUCS&#41;&#44; Universidad de Guadalajara &#40;UdeG&#41;&#44; Guadalajara&#44; Jalisco&#44; Mexico"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Doctorado en Gen&#233;tica Humana&#44; Centro Universitario de Ciencias de la Salud &#40;CUCS&#41;&#44; Universidad de Guadalajara &#40;UdeG&#41;&#44; Guadalajara&#44; Jalisco&#44; Mexico"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Doctorado en Ciencias Biom&#233;dicas&#44; Centro Universitario de Ciencias de la Salud &#40;CUCS&#41;&#44; Universidad de Guadalajara &#40;UdeG&#41;&#44; Guadalajara&#44; Jalisco&#44; Mexico"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Unidad M&#233;dica de Alta Especialidad&#44; Centro M&#233;dico Nacional de Occidente &#40;CMNO&#41;&#44; Departamento de Cardiolog&#237;a&#44; Instituto Mexicano del Seguro Social &#40;IMSS&#41;&#44; Guadalajara&#44; Jalisco&#44; Mexico"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Departamento de Biolog&#237;a Molecular y Gen&#243;mica&#44; Centro Universitario de Ciencias de la Salud &#40;CUCS&#41;&#44; Universidad de Guadalajara &#40;UdeG&#41;&#44; Guadalajara&#44; Jalisco&#44; Mexico"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Polimorfismos de los genes <span class="elsevierStyleItalic">APOA1</span> y <span class="elsevierStyleItalic">APOB</span> y concentraciones de sus apolipoprote&#237;nas como biomarcadores de riesgo en el s&#237;ndrome coronario agudo&#58; relaci&#243;n con la efectividad del tratamiento hipolipemiante"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1506
            "Ancho" => 1733
            "Tamanyo" => 120975
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Comparison of ApoA-I and ApoB serum levels between subgroups in acute coronary syndrome&#46; M&#58; male&#59; F&#58; female&#46; Md&#58; median&#46; UA&#58; unstable angina&#44; NSTEMI&#58; non-ST segment elevation myocardial infarction&#46; STEMI&#58; ST segment elevation myocardial infarction&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">In 2012&#44; 17&#46;5 million people died from cardiovascular diseases &#40;CVDs&#41; around the world&#46; Among these deaths&#44; 7&#46;4 million were due to coronary heart disease&#44; a representing 12&#46;4&#37; of the global mortality rate&#46;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">1</span></a> In Mexico&#44; ischemic heart disease is the leading cause of death in the elderly and ranks second in the general population&#46;<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">2</span></a> According to the <span class="elsevierStyleItalic">Instituto Nacional de Estad&#237;stica y Geograf&#237;a &#40;INEGI&#41;</span>&#44; there were 88&#44;144 deaths &#40;13&#46;4&#37; of deaths in the Mexican population&#41; from ischemic heart disease in 2015&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">The time elapsed after an ischemic event such as in Acute Coronary Syndrome &#40;ACS&#41; is critical because patients face a higher risk for recurrent events or even death&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">4</span></a> More specific measures to estimate the status and vulnerability of atherosclerotic plaques as well as the efficacy of drugs and diet in lowering lipids levels are needed&#46; Furthermore&#44; it is urgent to revise the predictive potential of risk biomarkers commonly used in medical practice&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">Diverse studies of genome-wide association &#40;GWA&#41; have identified candidate loci of susceptibility for cardiovascular diseases including apolipoproteins genes&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">5</span></a> Indeed&#44; it has been found that some polymorphisms in <span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> genes modify the risk of cardiovascular events in different populations&#46;<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">6&#44;7</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">It is well known that the Apo B&#47;ApoA-I ratio is the main factor influencing the risk of myocardial infarction&#46; This conclusion was reached by INTERHEART case&#8211;control study that calculated the odd ratios for the top 9 risk factors after analyzing almost 30&#44;000 individuals from 52 countries&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">8</span></a> A related attempt to predict fatal myocardial infarction is the AMORIS prospective study of &#62;175&#44;000 Swedish individuals&#44; although its database did not contain any information about risk factors&#44; the authors found that apoB serum concentration and ApoB&#47;ApoA-I ratio were the strongest predictors of fatal outcome myocardial infarction&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">9</span></a> Afterwards&#44; Walldius and Jungner took advantage of the usual lower ApoA-I values in men to propose different cut-off values for the ApoB&#47;ApoA-I ratio&#58; &#60;0&#46;9 in women and &#60;0&#46;8 in men&#46; Accordingly&#44; these authors considered that any value greater than the respective cut-off implies a high risk&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">10</span></a> Later&#44; Lima et al&#46; combined the results of the INTERHEART and AMORIS studies and proposed a more simplified risk calculation&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">11</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">In this study we evaluated some polymorphisms of <span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> genes and apolipoprotein concentrations as biomarkers of risk in Acute Coronary Syndrome and their relationship with lipid-lowering therapy effectiveness&#46; Furthermore&#44; we analyzed the Apo B&#47;ApoA-I ratio as a possible independent predictor of ischemic events in adults with and without ACS from Western Mexico and compared such ratio with range values proposed by INTERHEART and AMORIS studies&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Study design and participants</span><p id="par0030" class="elsevierStylePara elsevierViewall">We studied 600 genetically unrelated individuals from Western Mexico&#46; Ethnicity was defined as those having at least two generations of ascendants born in Mexico&#46; These subjects had the following characteristics&#58;<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#40;1&#41;</span><p id="par0035" class="elsevierStylePara elsevierViewall">Three hundred patients older than 45 years with ACS&#44; diagnosed according to the American College of Cardiology &#40;ACC&#41; criteria&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">12</span></a> Result of diagnosis&#44; Biomarkers and routine biochemical test measures were obtained&#46; Samples were collected during the first 24<span class="elsevierStyleHsp" style=""></span>h after admission to satisfy diagnosis with more specificity&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">13</span></a> Classical risk factors&#44; as defined by ACC&#44; were categorized as present or absent&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#40;2&#41;</span><p id="par0040" class="elsevierStylePara elsevierViewall">Three hundred Control subjects &#40;CS&#41; older than 45 years&#46; They responded to a questionnaire on their medical history and lifestyle characteristics with absence of previous cardiovascular diseases as the main exclusion criteria&#46; They denied active infections or receiving any treatment&#46;</p></li></ul></p><p id="par0045" class="elsevierStylePara elsevierViewall">All subjects were recruited at &#8220;Hospital de Especialidades del Centro M&#233;dico Nacional de Occidente del Instituto Mexicano del Seguro Social &#40;CMNO-IMSS&#41;&#46;&#8221; Subjects with overlapping heart disorders or other diseases such as familial hypercholesterolemia&#44; as well as genetically related individuals were excluded&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">The study was conducted in accordance with the Declaration of Helsinki&#46; An informed written consent was obtained&#46; Ethical approval was granted by the Ethic and Biosafety Committee of the Centro Universitario de Ciencias de la Salud&#44; CUCS&#44; UdeG &#40;C&#46;I&#46; 069-2012&#41;&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Genetic analysis of polymorphisms</span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Genetic analysis of &#8722;75 G&#62;A &#40;rs670&#41; and 83C&#62;T &#40;rs5070&#41; polymorphisms of APOA1 gene</span><p id="par0055" class="elsevierStylePara elsevierViewall">The fragment of DNA containing both rs670 and rs5070 polymorphisms was amplified by polymerase chain reaction-restriction fragment length polymorphism &#40;PCR-RFLP&#41; technique using the following primers sequences&#58; Forward&#58; 5&#8242;-AGGGACAGAGCTGATCCTTGAACTCTTAAG-3&#8242;&#59; Reverse&#58; 5&#8242;-TTAGGGGACACCTAGCCCTCAGGAAGAGCA-3&#8242;&#46; PCR amplification was carried out in a total volume of 20<span class="elsevierStyleHsp" style=""></span>&#956;L containing 8<span class="elsevierStyleHsp" style=""></span>ng&#47;&#956;L of gDNA&#44; 0&#46;04<span class="elsevierStyleHsp" style=""></span>U&#47;&#956;L of Taq DNA polymerase &#40;Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41;&#44; 1&#215; of buffer&#44; 4<span class="elsevierStyleHsp" style=""></span>nM of each primer&#44; 5<span class="elsevierStyleHsp" style=""></span>mM of MgCl<span class="elsevierStyleInf">2</span>&#44; and 2<span class="elsevierStyleHsp" style=""></span>mM of dNTP&#46; The thermocycling conditions had an initial denaturation step of 5<span class="elsevierStyleHsp" style=""></span>min at 94<span class="elsevierStyleHsp" style=""></span>&#176;C and were followed by 35 cycles at 94<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 57&#176; C&#44; and 72<span class="elsevierStyleHsp" style=""></span>&#176;C &#40;30<span class="elsevierStyleHsp" style=""></span>s for each stage&#41; and the final extension step of 5<span class="elsevierStyleHsp" style=""></span>min at 72<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; Following PCR&#44; the presence of a 435-bp product was visualized on 6&#37; polyacrylamide gel after electrophoresis silver staining&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">The 434-bp fragment obtained was digested with the restriction enzyme <span class="elsevierStyleItalic">MspI</span>&#46; 4<span class="elsevierStyleHsp" style=""></span>&#956;L of PCR product was digested with 5 units of <span class="elsevierStyleItalic">MspI</span> restriction enzyme during 1&#46;5<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The digested PCR product was rune under electrophoresis on 6&#37; polyacrylamide gel which was visualized with silver staining&#46; There are 3 restriction sites of recognition for <span class="elsevierStyleItalic">MspI</span> in the 434-bp fragment in <span class="elsevierStyleItalic">APOA1</span> gen&#44; two of which include both polymorphisms and the third is a constitutive site which gives a fragment of 180<span class="elsevierStyleHsp" style=""></span>bp and a fragment of 254<span class="elsevierStyleHsp" style=""></span>bp&#46; When a G to A transition at &#8722;75<span class="elsevierStyleHsp" style=""></span>bp takes place&#44; there is no restriction site and it produces a fragment of 180<span class="elsevierStyleHsp" style=""></span>bp instead of 114 and 66<span class="elsevierStyleHsp" style=""></span>bp&#59; similarly&#44; for 83C&#62;T&#44; when a C to T transition takes place&#44; the &#43;83<span class="elsevierStyleHsp" style=""></span>bp restriction site is absent and a fragment of 254<span class="elsevierStyleHsp" style=""></span>bp is produced instead of 209 and 46<span class="elsevierStyleHsp" style=""></span>bp&#46; The genotypes of both polymorphisms were interpreted using this information&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Genetic analysis of 2487C&#62;T &#40;rs693&#41; polymorphism of APOB gene</span><p id="par0065" class="elsevierStylePara elsevierViewall">SNP Genotyping Assay for rs693 polymorphism was performed using the allelic discrimination method with a VIC<span class="elsevierStyleSup">&#174;</span> dye-labeled probe&#44; FAM&#8482; dye-labeled probe&#44; and two target-specific primers &#40;context Sequence of primers&#58; ACATTCGGTCTCGTGTATCTTCTAG&#91;A&#47;G&#93;GTCTCTCGGAATTTGGCCTTCATGT&#41;&#46; VIC<span class="elsevierStyleSup">&#174;</span> is the probe to detect Allele 1 &#40;wild type&#41; sequence and FAM&#8482; is the probe to detect Allele 2 sequence&#46; Note&#58; context sequence is noted using the reverse strain&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">The preparation of the reaction mix was as following&#58; we use 12&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;L of 2&#215; TaqMan<span class="elsevierStyleSup">&#174;</span> Master Mix&#44; 0&#46;75<span class="elsevierStyleHsp" style=""></span>&#956;L of 40&#215; Assay Working Stock&#44; 8&#46;0<span class="elsevierStyleHsp" style=""></span>&#956;L of Nuclease-free water and 4&#46;0<span class="elsevierStyleHsp" style=""></span>&#956;L of a solution containing 5<span class="elsevierStyleHsp" style=""></span>ng&#47;&#956;L of DNA to accomplish a total volume per well of 25<span class="elsevierStyleHsp" style=""></span>&#956;L&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">The thermal cycling conditions were set up in a Light Cycler 96<span class="elsevierStyleSup">&#174;</span> device as following&#58; we use a holding time for enzyme activation during 10<span class="elsevierStyleHsp" style=""></span>min at 95<span class="elsevierStyleHsp" style=""></span>&#176;C and finally 40 cycles for denaturation and annealing&#47;extension &#40;95<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 15<span class="elsevierStyleHsp" style=""></span>s&#59; 60<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 60<span class="elsevierStyleHsp" style=""></span>s respectively&#41;&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">SNP genotyping quality control</span><p id="par0080" class="elsevierStylePara elsevierViewall">The 25&#37; of the samples were double-genotyped for all polymorphisms with a concordance rate of 100&#37;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Apolipoprotein analysis</span><p id="par0085" class="elsevierStylePara elsevierViewall">Serum levels of ApoA-I and ApoB were measured in 300 patients and 300 CS by immunoturbidimetry &#40;Biosystems S&#46;A&#46;&#44; Costa Brava&#44; Barcelona&#44; Spain&#41; using a computerized Mindray BS 120 device&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Other biochemical analysis</span><p id="par0090" class="elsevierStylePara elsevierViewall">Total cholesterol &#40;TC&#41;&#44; low density lipoprotein-cholesterol &#40;LDL-C&#41;&#44; high density lipoprotein-cholesterol &#40;HDL-C&#41;&#44; triglycerides &#40;TGC&#41;&#44; glucose and C-reactive protein &#40;CRP&#41; levels were measured in patients and CS using standard enzymatic methods &#40;Biosystems S&#46;A&#46;&#44; Costa Brava&#44; Barcelona&#44; Spain&#41;&#46;</p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Statistical analysis</span><p id="par0095" class="elsevierStylePara elsevierViewall">The statistical analysis was carried out using SPSS statistical package version 22&#46;0 and Excel 2010&#46; The <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span> test was used to compare discrete variables and to test the Hardy-Weinberg equilibrium&#46; The data for continuous variables were expressed as means<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>standard deviation &#40;SD&#41; and median comparison were evaluated by Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test&#46; The odds ratio &#40;OR&#41; was the measure of association for genotype&#44; allele frequencies and for risk factors&#44; cutoff of significance was <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46; A binary multivariate logistic regression was performed to determine adjusted risk of independent categoric variables &#40;including ApoB&#47;ApoA-I ratio&#41; over the dependent variable ACS&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Results</span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Clinical variables</span><p id="par0100" class="elsevierStylePara elsevierViewall">Demographic and biochemical parameter information for both groups &#40;300 ACS and 300 CS&#41; is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; Men tended to triple the cases of ACS &#40;221 men and 79 women&#41;&#59; CS were in a 1&#47;1 ratio &#40;144 men and 156 women&#41;&#46; The most common risk factors in ACS were hypertension &#40;64&#46;4&#37;&#41;&#44; sedentary lifestyle &#40;50&#46;5&#37;&#41; and diabetes mellitus &#40;50&#46;2&#37;&#44; <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; All patients were under treatment&#44; 95&#46;9&#37; of them received acetylsalicylic acid&#59; 92&#46;5&#37; statins and 90&#46;8&#37; clopidogrel among others &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Genotype and allele frequencies</span><p id="par0105" class="elsevierStylePara elsevierViewall">Genotype distributions of rs670&#44; rs5070 and rs693 polymorphisms were in accordance with Hardy-Weinberg equilibrium &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;154&#44; 0&#46;435 and 0&#46;660 respectively&#41;&#46; Neither genotype nor allele frequencies showed statistically significant differences between groups&#44; pointing out these polymorphisms are not susceptibility genetic markers for ACS in the Western Mexican population &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; However&#44; it is important to highlight the power of the study is weak &#40;&#946;<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>15&#37;&#41; and these findings must be taken carefully&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0110" class="elsevierStylePara elsevierViewall">There was no linkage disequilibrium &#40;LD&#41; between the two sites evaluated in <span class="elsevierStyleItalic">APOA1</span> gene &#40;<span class="elsevierStyleItalic">D</span>&#8242;<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;387&#44; <span class="elsevierStyleItalic">r</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;003&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;38&#41;&#44; thus these genetic variants must be analyzed individually&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">ApoA-I and ApoB serum levels</span><p id="par0115" class="elsevierStylePara elsevierViewall">We analyzed if rs670&#44; rs5070 and rs693 polymorphisms influence serum levels of ApoA-I or ApoB in our population&#44; but we did not find any association &#40;data not shown&#41;&#46; However&#44; ApoA levels from patients were decreased when compared with CS &#40;161&#46;4<span class="elsevierStyleHsp" style=""></span>mg&#47;dL vs 195&#46;1<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#44; <span class="elsevierStyleItalic">p</span> &#60;0&#46;001&#41;&#59; the levels of ApoB were decreased as well &#40;136&#46;9<span class="elsevierStyleHsp" style=""></span>mg&#47;dL vs 167&#46;0<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#59; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; Atherogenic risk &#40;Apo B&#47;ApoA-I&#41; was calculated by gender in each group &#40;since the ratios are different for each gender as suggested by the INTERHEART study&#41;&#46; We found that women had an atherogenic risk ratio of 0&#46;75 and men had a ratio of 0&#46;85 in ACS&#46; In our CS group&#44; women had a risk ratio of 0&#46;83 and men presented a ratio of 0&#46;88&#46; According to INTERHEART and AMORIS recommendation&#44; the range ratio for low cardiovascular risk in males must be between 0&#46;40 and 0&#46;69&#59; moderate risk most be 0&#46;70 to 0&#46;89 and high risk 0&#46;90 to 1&#46;10&#46; In females&#44; the range ratio for low cardiovascular risk is between 0&#46;30 and 0&#46;69&#59; moderate risk is 0&#46;60 to 0&#46;79 and high risk is 0&#46;80 to 1&#46;00&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">We stratified serum data according gender and groups and we found that ApoA-I serum levels were higher in Females of both groups &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#59; afterwards we stratified ACS by diagnosis and we found that male patients with Unstable Angina &#40;UA&#41; had statistically higher serum levels of ApoA-I compared with Non-ST Segment Elevation Myocardial Infarction &#40;NSTEMI&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#41; and patients with ST Segment Elevation Myocardial Infarction &#40;STEMI&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#41;&#46; In females&#44; patients with UA had statistically higher serum levels of ApoA-I than patients with STEMI &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03&#44; <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; In patients&#44; ApoB levels were similar by gender and diagnostic thus they were not stratified&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0125" class="elsevierStylePara elsevierViewall">A binary multivariate logistic regression was performed to determine if ApoB&#47;ApoA-I ratio is an independent parameter predictor of risk in our population adjusted by risk factors &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46; For this task&#44; we categorized this ratio and it was divided in quintiles &#40;the bottom quintile being the reference for comparison to the other quintiles&#41;&#46; The presence of overweight &#40;OR&#58; 4&#46;208&#41; obesity &#40;OR&#58; 4&#46;938&#41;&#44; diabetes mellitus type 2 &#40;OR&#58; 3&#46;43&#41;&#44; dyslipidemia &#40;OR&#58; 2&#46;453&#41;&#44; high blood pressure &#40;OR&#58; 2&#46;433&#41; and smoking &#40;OR&#58; 5&#46;286&#41; are strong predictors of ACS &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#59; ApoB&#47;ApoA-I ratio showed a marginal statistical significance only when the third quintile was compared against the first but in a protection way &#40;OR&#58; 0&#46;233&#41;&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Discussion</span><p id="par0130" class="elsevierStylePara elsevierViewall">The crucial role of ancestry in ACS is highlighted by the 3-fold higher risk documented for individuals with family history of coronary atherosclerosis&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">14</span></a> Zdravkovic et al&#46; determined that the heritability of cardiovascular disease was 38&#37; in women and 57&#37; in men&#46; These researchers concluded that the underlying cause of cardiovascular disease was the atherosclerotic process which was the result of an interaction between the aging process and intrinsic or extrinsic factors such as some polymorphisms in genes of lipid metabolism&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">5</span></a></p><p id="par0135" class="elsevierStylePara elsevierViewall">Although the biological mechanism is unknown&#44; the role of &#8722;75G&#62;A and 83C&#62;T polymorphisms of <span class="elsevierStyleItalic">APOA1</span> gene in lipid metabolism and other risk factors related to cardiovascular disease are ineffable&#46; In an Indian population&#44; Dawar et al&#46;&#44; found an association of these polymorphisms with myocardial infarction and described associated variations in the values of HDL and ApoA-I&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">15</span></a> Both polymorphisms were significantly associated with coronary artery disease in terms of number of affected vessels&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">16</span></a> In another study&#44; the &#8722;75A and 83T alleles showed significant association with hypertension whereas the 83C allele was associated with obesity and hypertension in the presence of cardiovascular disease&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">17</span></a> Likewise&#44; the &#8722;75GA genotype conferred an increased risk for atherogenesis and dyslipidemia to adult Turks&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">18</span></a> In contrast&#44; we did not find direct association of &#8722;75 G&#62;A &#40;rs670&#41; and 83C&#62;T &#40;rs5070&#41; polymorphisms of <span class="elsevierStyleItalic">APOA1</span> gene with ACS or with any variation in serum levels of HDL or ApoA-I that conveys to an increased risk for cardiovascular disease&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Annotations into HaploRev v&#46;4 allowed us to infer about the clinical impact of these non-coding variants&#58; the rs670 variant overlapped with a motif located in enhancers in 12 different tissues and it also had a correlation with DNase I hypersensitive sites &#40;DHSs&#41; across 18 different cell types&#59; the provided enrichment analyses of these enhancer sequences identified several known cell-type specific bound proteins &#40;FOSL2&#44; FOXA1&#44; FOXA2&#44; HEY1&#44; HNF4A&#44; HNF4G&#44; P300&#44; POL2&#44; RAD21&#44; RFX5&#44; SP1&#44; SREBP1&#44; TBP&#44; TCF12 and TCF4&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">19</span></a> Afterwards&#44; we searched for human chipseq experiments and we found that some of these transcription factors &#40;FOXA1&#44; FOXA2&#44; HNF4A&#44; HNF4G&#41; are liver-specific regulators&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">20</span></a> The rs5070 variant overlapped with a motif located in enhancers in 11 different type of tissues&#44; it has also a correlation with DNase I Hypersensitive Sites &#40;DHSs&#41; on Hepatocellular Carcinoma Cell Lines &#40;HEpG2&#41;&#44; although there was not overlapping with binding proteins sites&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">19</span></a> According with these results we can conclude that both genetic variants are under high transcriptional regulation in liver and the different phenotypes observed on other populations &#40;not ours&#41; could be explained by the global effect of these transcription factors over hepatocellular regulation&#46; Unfortunately&#44; at the best of our knowledge&#44; there are not cellular or animal models focusing in the genetic variants we are studying to explain the specific biological function in hepatic regulation&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">Regarding 2488 C&#62;T polymorphism of <span class="elsevierStyleItalic">APOB</span> gene&#44; a meta-analysis showed that this polymorphism gives a significant risk toward the development of Cardiovascular Hearth Disease &#40;CHD&#41; in Han Chinese population &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;013&#41;&#44; overall allelic OR &#40;95&#37; CI&#41; was 2&#46;25 &#40;CI 1&#46;40&#8211;3&#46;62&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">21</span></a> This polymorphism has also been related with dyslipidemias&#58; heterozygotes 2488 CT have showed twofold increase in the risk of dyslipidemia and the homozygous TT showed 4 times higher risk to develop it&#46;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">22</span></a> The polymorphic site located at 2488 in exon 26 of <span class="elsevierStyleItalic">APOB</span> gene&#44; involves a silent variation at the third nucleotide of codon threonine at amino acid 2488&#44; so there is not amino acid change&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">23</span></a> This silent variation is only 600&#8211;900 residues of the two domains of the LDL-C receptor binding site of apolipoprotein B&#59; therefore&#44; this SNP has been proposed to be in linkage disequilibrium with polymorphisms affecting this binding regions&#59; variations in this site may lead to a different affinity to the LDL receptor and therefore it may have a different catabolism for LDL-C&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">24</span></a> To the best of our knowledge there is no database or program that analyze the possible biological function of this polymorphism&#46;</p><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Quantification of apolipoproteins in the estimation of coronary risk</span><p id="par0150" class="elsevierStylePara elsevierViewall">We did not find any association between genotypes and serum levels of ApoA-I or Apo-B and other biochemical parameters&#46; Nonetheless&#44; in vitro studies are needed in order to assess the role of such variants over their transcriptional and translational products&#46; However&#44; the sole quantification of apolipoproteins has been applied in the estimation of coronary risk and has served on the characterization of several classes of dyslipidemia&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">25</span></a></p><p id="par0155" class="elsevierStylePara elsevierViewall">In our whole population&#44; men had lower ApoA-I values than women as previously described&#44;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">10</span></a> We corroborated this sex difference with a linear regression analysis adjusted by risk factors &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;0008&#41;&#46; This sex difference has been attributable to a higher basal synthesis of Apoa-I in women<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">26</span></a> and estrogen-progestin replacement therapy in women which increases HDL-C and Apoa-I&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">27</span></a> Unfortunately&#44; we did not register this drug consumption in females&#44; indeed this is one of our study limitations&#46; By diagnosis&#44; we found that males with UA had higher levels of Apoa-I than NSTEMI and STEMI and females with UA had higher levels than STEMI &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#59; it is speculated that HDL-C decrease immediately after an infarction due to inflammatory response and utilization of cholesterol for tissue repairing and hormonal synthesis<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">28</span></a>&#59; we assume that as Apoa-I is the main apolipoprotein of HDL-C&#44; it decreased by the same compensatory mechanisms&#44; although we have not found the same with HDL-C probably because this measure is more fluctuating due to several medical and environmental factors&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">29</span></a></p><p id="par0160" class="elsevierStylePara elsevierViewall">In our study&#44; patients had levels of HDL-C of 19&#46;7<span class="elsevierStyleHsp" style=""></span>mg&#47;dL below the acceptable lower-level threshold &#40;levels must be over 40&#41;&#44; reflecting an eminent risk due to atherosclerosis&#46; The plasma LDL-C is the measure most established as a predictor of Coronary artery disease&#44; however some epidemiological studies have proposed that the quantification of ApoB and ApoA-I are better predictors of coronary events and have shown that the ratio Apo B&#47;ApoA-I is an independent parameter predictor for cardiovascular disease&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">30</span></a> ApoB represents the number of particles that contribute to the accumulation of cholesterol in the plaque and it is present in low density lipoproteins &#40;LDL&#41;&#44; intermediate density lipoproteins &#40;IDL&#41; and very low density lipoproteins &#40;VLDL&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">31</span></a> ApoA contributes directly to the clearance of cholesterol of tissues &#40;such as the atherosclerotic plaque&#41;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">32</span></a>&#59; therefore Apo B&#47;ApoA-I ratio has been proposed as an atherogenic risk biomarker&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">The INTERHEART study also was conducted in Latin American population&#46; This study found that variables associated with an increased risk of myocardial infarction were&#58; stress psychosocial &#40;OR&#44; 2&#46;81&#59; 95&#37; CI&#44; 2&#46;07 to 3&#46;82&#41;&#44; history of hypertension &#40;OR&#44; 2&#46;81&#59; 95&#37; CI&#44; 2&#46;39 to 3&#46;31&#41;&#44; diabetes mellitus &#40;OR&#44; 2&#46;59&#59; 95&#37; CI&#44; 2&#46;09 to 3&#46;22&#41;&#44; current smoking &#40;OR&#44; 2&#46;31&#59; 95&#37; CI&#44; 1&#46;97 to 2&#46;71&#41;&#44; increased ratio of waist&#47;hip &#40;OR for the first against third tertile of 2&#46;49&#59; 95&#37; CI&#44; 1&#46;97 to 3&#46;14&#41;&#44; and increased ratio of ApoB&#47;ApoA-I &#40;OR for the first against the third tertile of 2&#46;31&#59; 95&#37; CI&#44; 1&#46;83 to 2&#46;94&#41;&#46; This study concluded that one of the main factors that contribute to cardiovascular risk in the population were abnormal lipids&#46;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">33</span></a></p><p id="par0170" class="elsevierStylePara elsevierViewall">According to INTERHEART and AMORIS&#44; we can conclude that in our group of patients&#44; women had a moderate atherogenic risk ratio of 0&#46;75 &#40;moderate risk proposed values&#58; 0&#46;60 to 0&#46;79&#41;&#44; likewise men who had a ratio of 0&#46;85 &#40;moderate risk proposed values&#58; 0&#46;70 to 0&#46;89&#41;&#46; In our CS group&#44; women had an elevated atherogenic risk ratio of 0&#46;83 &#40;high risk values&#58; 0&#46;80&#8211;1&#46;00&#41; and men presented a moderate risk with a ratio of 0&#46;88&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">The present results suggest that underestimation of ApoB&#47;ApoA-I and therefore risk reduction in our ACS group compared to CS group may be primarily related to changes in the balance of the apolipoprotein particles due to lipid lowering drugs as the samples were obtained after hospitalization and medication&#59; even so&#44; the predictive risk given by ApoB&#47;ApoA-I ratio&#44; according with INTERHEART and AMORIS values&#44; is maintained in both groups&#46; These findings are supported by Walldius et al&#44; as they found that statins reduced ApoB and increased ApoA-I levels&#44; which in turn leads to a reduction in apoB&#47;apoA-I ratio by about 20&#8211;40&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">34</span></a></p><p id="par0180" class="elsevierStylePara elsevierViewall">As it is observed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#44; LDL-C levels were shown to be reduced in our ACS group most probably because of lipid-lowering therapy&#44; so those levels have lost predictive power&#59; however&#44; the predictive value given by Apo B&#47;Apo A-I is maintained &#40;high risk ratio&#58; CS&#58; 0&#46;9<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;2&#44; ACS&#58; 0&#46;9<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;5&#41;&#46;</p><p id="par0185" class="elsevierStylePara elsevierViewall">We have extrapolated our results to INTERHEART and AMORIS values&#44; which have been obtained and adapted after a broad prospective study in individuals &#40;our study had a transversal design and furthermore it has been applied to assess the risk after therapy in patients and to assess the risk in control subjects without therapy at only one point time&#41;&#59; even so&#44; on the one hand we can say that predictive value for risk given by Apo B&#47;Apo A-I in our ACS group is moderated &#40;in comparison with LDL-C levels which are shown very lowed&#41; and for the other hand&#44; we can say that our CS group maintains a significantly higher ratio and then we can follow up this group until the onset of acute event to estimate the real predictive risk according to INTERHEART and AMORIS&#46; Our results could mean that for our ACS group&#44; lipid-lowering drugs doses are still not enough to reduce the levels of atherogenic particles&#46;</p><p id="par0190" class="elsevierStylePara elsevierViewall">In the binary multivariate logistic regression analysis&#44; ApoB&#47;ApoA-I ratio showed statistical significance only when the third quintile was compared against the first quintile but there was no risk calculated &#40;OR&#58; 0&#46;479&#41;&#44; although these data could be misrepresented as lipid values in patients are biasing the risk due to lipid-lowering therapy&#46; According to this analysis&#44; this ratio is not a predictor of ACS in our population&#59; furthermore&#44; our analysis has a cross sectional design so we do know the real behavior of Apob and ApoA-I levels during time until the presence of the variable outcome&#46; However&#44; reference values proposed by INTERHEART and AMORIS could be more robust and could be used to determine the atherogenic risk in our population as the risk observed in our population in both genders and in both groups&#44; is maintained even after therapy&#46;</p><p id="par0195" class="elsevierStylePara elsevierViewall">Summarizing&#44; this study has shown that the polymorphisms studied in <span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> genes have not any contribution to risk in ACS and they have no effect on their apolipoprotein concentrations&#59; furthermore&#44; ApoB&#47;ApoA-I ratio was not a predictor of risk for cardiovascular disease in our population&#44; but we have found that other biochemical parameters such as&#46; ApoA-I&#44; ApoB and HDL-C could be better biomarkers of cardiovascular risk than other measurements commonly accepted in medical practice such as LDL-C and could indicate if doses of statins are adequate to reduce the levels of atherogenic particles&#46;</p></span></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Funding</span><p id="par0200" class="elsevierStylePara elsevierViewall">This study was supported by grant no&#46; PROSNI-2016 to Jorge Ram&#243;n Padilla-Guti&#233;rrez&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Conflict of interest</span><p id="par0205" class="elsevierStylePara elsevierViewall">The authors declare that there is no conflict of interests regarding the publication of this paper&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1060902"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background and objective"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1009606"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1060903"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes y objetivo"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1009607"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study design and participants"
            ]
            1 => array:3 [
              "identificador" => "sec0025"
              "titulo" => "Genetic analysis of polymorphisms"
              "secciones" => array:5 [
                0 => array:2 [
                  "identificador" => "sec0030"
                  "titulo" => "Genetic analysis of &#8722;75 G&#62;A &#40;rs670&#41; and 83C&#62;T &#40;rs5070&#41; polymorphisms of APOA1 gene"
                ]
                1 => array:2 [
                  "identificador" => "sec0035"
                  "titulo" => "Genetic analysis of 2487C&#62;T &#40;rs693&#41; polymorphism of APOB gene"
                ]
                2 => array:2 [
                  "identificador" => "sec0040"
                  "titulo" => "SNP genotyping quality control"
                ]
                3 => array:2 [
                  "identificador" => "sec0045"
                  "titulo" => "Apolipoprotein analysis"
                ]
                4 => array:2 [
                  "identificador" => "sec0050"
                  "titulo" => "Other biochemical analysis"
                ]
              ]
            ]
            2 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0060"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Clinical variables"
            ]
            1 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Genotype and allele frequencies"
            ]
            2 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "ApoA-I and ApoB serum levels"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0080"
          "titulo" => "Discussion"
          "secciones" => array:1 [
            0 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Quantification of apolipoproteins in the estimation of coronary risk"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Funding"
        ]
        9 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Conflict of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2017-04-27"
    "fechaAceptado" => "2017-07-09"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1009606"
          "palabras" => array:5 [
            0 => "Acute coronary syndrome"
            1 => "Atherogenic risk"
            2 => "Apolipoprotein AI"
            3 => "Apolipoprotein B"
            4 => "Lipid-lowering therapy"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1009607"
          "palabras" => array:5 [
            0 => "S&#237;ndrome coronario agudo"
            1 => "Riesgo aterog&#233;nico"
            2 => "Apolipoprote&#237;na AI"
            3 => "Apolipoprote&#237;na B"
            4 => "Tratamiento de reducci&#243;n de l&#237;pidos"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background and objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Lipid metabolism alterations contribute to acute coronary syndrome &#40;ACS&#41;&#46; rs670&#44; rs5070 and rs693 polymorphisms have shown to modify the risk of cardiovascular disease&#46; Apolipoprotein A-<span class="elsevierStyleSmallCaps">I</span> &#40;ApoA-<span class="elsevierStyleSmallCaps">I</span>&#41; plays a major role in reverse cholesterol transport&#59; apolipoprotein B &#40;ApoB&#41; contributes to accumulation of cholesterol in the plaque&#46; The aim of this study was to investigate the association of rs670 and rs5070 polymorphisms of <span class="elsevierStyleItalic">APOA1</span> and rs693 polymorphism of <span class="elsevierStyleItalic">APOB</span> with ACS and circulating levels of its proteins and find if ApoB&#47;ApoA-<span class="elsevierStyleSmallCaps">I</span> could be implemented as an independent parameter of risk for cardiovascular disease and as a biomarker of lipid-lowering therapy effectiveness in Mexican population&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Three hundred patients with ACS and 300 control subjects &#40;CS&#41; were included&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Neither genotype nor allele frequencies of rs670&#44; rs5070 and rs693 polymorphisms showed statistical differences between groups&#46; Serum levels of ApoA-<span class="elsevierStyleSmallCaps">I</span> &#40;195 vs&#46; 161&#46;4<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#59; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>&#46;001&#41; and ApoB &#40;167 vs&#46; 136&#46;9<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#59; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>&#46;001&#41; were significantly higher in CS compared with ACS&#59; however&#44; there was no genetic association&#46; Unstable angina patients showed the highest ApoA-<span class="elsevierStyleSmallCaps">I</span> levels &#40;males&#58; 176&#46;3<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#59; females&#58; 209&#46;1<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The rs670&#44; rs5070 and rs693 polymorphisms are not genetic susceptibility factors for ACS in Mexican population and had no effect on their apolipoprotein concentrations&#46; In our population&#44; ApoA-<span class="elsevierStyleSmallCaps">I</span>&#44; ApoB and HDL-C could be better biomarkers of cardiovascular risk and could indicate if statins doses reduce atherogenic particles properly&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background and objective"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes y objetivo</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Las alteraciones en el metabolismo de los l&#237;pidos contribuyen al s&#237;ndrome coronario agudo &#40;SCA&#41;&#46; Se ha demostrado que los polimorfismos rs670&#44; rs5070 y rs693 modifican el riesgo de enfermedad cardiovascular&#46; La apolipoprote&#237;na A-<span class="elsevierStyleSmallCaps">I</span> &#40;ApoA-<span class="elsevierStyleSmallCaps">I</span>&#41; desempe&#241;a un papel principal en el transporte inverso del colesterol&#59; la apolipoprote&#237;na B &#40;ApoB&#41; contribuye a la acumulaci&#243;n de colesterol en la placa&#46; El objetivo de este estudio fue investigar la asociaci&#243;n entre los polimorfismos rs670 y rs5070 de <span class="elsevierStyleItalic">APOA1</span> y el polimorfismo rs693 de <span class="elsevierStyleItalic">APOB</span> con SCA y los niveles circulantes de estas prote&#237;nas&#44; e investigar si ApoB&#47;ApoA-<span class="elsevierStyleSmallCaps">I</span> podr&#237;a introducirse como par&#225;metro independiente predictor de riesgo de la enfermedad cardiovascular y como biomarcador del tratamiento de reducci&#243;n de l&#237;pidos en la poblaci&#243;n mexicana&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Se incluy&#243; a 300 pacientes con SCA y 300 sujetos control &#40;SC&#41;&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Ni las frecuencias genot&#237;picas ni las al&#233;licas de los polimorfismos rs670&#44; rs5070 y rs693 reflejaron diferencias estad&#237;sticamente significativas entre los grupos&#46; Los niveles s&#233;ricos de ApoA-<span class="elsevierStyleSmallCaps">I</span> &#40;195 frente a 161&#44;4<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#59; p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#41; y ApoB &#40;167 frente a 136&#44;9<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#59; p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#41; fueron significativamente superiores en los SC en comparaci&#243;n con los SCA&#59; sin embargo&#44; no existi&#243; asociaci&#243;n gen&#233;tica&#46; Los pacientes con angina inestable reflejaron los niveles m&#225;s elevados de ApoA-<span class="elsevierStyleSmallCaps">I</span> &#40;varones&#58; 176&#44;3<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#59; mujeres&#58; 209&#44;1<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41;&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Los polimorfismos rs670&#44; rs5070 y rs693 no constituyen factores de susceptibilidad gen&#233;tica para SCA en la poblaci&#243;n de M&#233;xico y no tienen efecto sobre las concentraciones de sus apolipoprote&#237;nas&#46; En nuestra poblaci&#243;n&#44; ApoA-<span class="elsevierStyleSmallCaps">I</span>&#44; ApoB y c-HDL podr&#237;an constituir unos mejores biomarcadores del riesgo cardiovascular&#44; y podr&#237;an indicar si las dosis de estatinas reducen debidamente las part&#237;culas aterog&#233;nicas&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes y objetivo"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Please cite this article as&#58; Casillas-Mu&#241;oz F&#44; Valle Y&#44; Mu&#241;oz-Valle JF&#44; Mart&#237;nez-Fern&#225;ndez DE&#44; Reynoso-Villalpando GL&#44; Flores-Salinas HE&#44; et al&#46; Polimorfismos de los genes <span class="elsevierStyleItalic">APOA1</span> y <span class="elsevierStyleItalic">APOB</span> y concentraciones de sus apolipoprote&#237;nas como biomarcadores de riesgo en el s&#237;ndrome coronario agudo&#58; relaci&#243;n con la efectividad del tratamiento hipolipemiante&#46; Med Clin &#40;Barc&#41;&#46; 2018&#59;151&#58;1&#8211;7&#46;</p>"
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1386
            "Ancho" => 1881
            "Tamanyo" => 99347
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Comparison of ApoA-I levels between gender in control subjects &#40;CS&#41; and acute coronary syndrome &#40;ACS&#41;&#46; M&#58; male&#59; F&#58; female&#46; Md&#58; median&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1506
            "Ancho" => 1733
            "Tamanyo" => 120975
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Comparison of ApoA-I and ApoB serum levels between subgroups in acute coronary syndrome&#46; M&#58; male&#59; F&#58; female&#46; Md&#58; median&#46; UA&#58; unstable angina&#44; NSTEMI&#58; non-ST segment elevation myocardial infarction&#46; STEMI&#58; ST segment elevation myocardial infarction&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">CS&#58; control subject&#59; ACS&#58; acute coronary syndrome&#59; BMI&#58; body mass index&#44; CK&#58; creatine phosphokinase&#44; CK-MB&#58; creatine phosphokinase isoform MB&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Parameter&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col">CS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col">ACS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col">Reference values&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Mean &#40;SE&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Mean &#40;SE&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">55&#46;6 &#40;10&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">62&#46;8 &#40;10&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Weight &#40;kg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">75&#46;0 &#40;16&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">75&#46;5 &#40;14&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Height &#40;cm&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">167 &#40;16&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">165 &#40;15&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">BMI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">26&#46;9 &#40;5&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">27&#46;4 &#40;4&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Total cholesterol &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">171&#46;2 &#40;95&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">115&#46;3 &#40;34&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">150&#8211;199&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Fasting glucose &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">117&#46;8 &#40;89&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">138&#46;7 &#40;57&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">75&#8211;105&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Triglycerides &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">116&#46;5 &#40;63&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">89&#46;1 &#40;29&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;200&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">LDL-C &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">73&#46;1 &#40;32&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">43&#46;5 &#40;17&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;130&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HDL-C &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">40&#46;0 &#40;20&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">19&#46;7 &#40;10&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;40&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PCR &#40;mg&#47;L&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;8 &#40;7&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">19&#46;9 &#40;15&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#8211;10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOA-I &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">195&#46;1 &#40;25&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">161&#46;4 &#40;28&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">94&#8211;178&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB &#40;mg&#47;dL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">167&#46;0 &#40;34&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">136&#46;9 &#40;33&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">63&#8211;133&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB&#47;APOA-I&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;9 &#40;0&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;9 &#40;0&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&#46;347&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1805589.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005"><span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span>&#46; NS&#58; non significance&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Demographic and clinical characteristics in ACS and CS groups&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">CS&#58; control subjects&#59; ACS&#58; acute coronary syndrome&#59; FHCD&#58; family history of cardiovascular disease&#59; HBP&#58; high blood pressure&#59; NSAID&#39;s&#58; nonsteroidal anti-inflammatory drugs&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Risk factors&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">CS</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ACS</th><th class="td" title="table-head  " align="left" valign="top" scope="col">Treatment<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ACS</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HBP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">81&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;29&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">190&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;64&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">NSAID&#39;s with antithrombotic activity &#40;acetylsalicylic acid&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">283&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">95&#46;9&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Sedentarism&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">37&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;13&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">149&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;50&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Statins&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">273&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">92&#46;5&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">DM2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;17&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;50&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Antiplaquetary drugs &#40;Clopidogrel&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">268&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">90&#46;8&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Smoking&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;11&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">143&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;48&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Antihypertensives &#40;captopril&#44; enalapril&#44; losartan&#44; valsartan&#44; furosemide and spironolactone&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">227&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">76&#46;9&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">FHCD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">125&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;42&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Anticoagulants &#40;heparin&#44; andenoxaparine&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">200&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">67&#46;8&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Dyslipidemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">33&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;11&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">123&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;41&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Beta blockers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">170&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">57&#46;6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Obesity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;9&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;28&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Nitrates &#40;Isosorbide&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">63&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">21&#46;4&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Overweight&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;12&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">114&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;38&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Recurrent infarction&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">41&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#40;13&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1805586.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">There were no Drugs used by CS&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Risk factors and treatments by ACS and CS groups&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">CS&#58; control subjects&#59; ACS&#58; acute coronary syndrome&#59; OR&#58; odds ratio&#59; <span class="elsevierStyleItalic">n</span>&#58; sample size&#59; CI&#58; confidence interval&#59; <span class="elsevierStyleItalic">p</span>&#58; probability value&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">CS<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>300 &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">ACS<br><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>300 &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">OR &#40;IC&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic"><span class="elsevierStyleBold">75 G&#62;A APOA1 &#40;rs670&#41;</span></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Genotype</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">G&#47;G</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">157 &#40;52&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">143 &#40;47&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">G&#47;A</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">113 &#40;37&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">125 &#40;41&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;214 &#40;0&#46;864&#8211;1&#46;707&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">A&#47;A</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">30 &#40;10&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">32 &#40;10&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;171 &#40;0&#46;678&#8211;2&#46;024&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;57&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Allele</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>600 &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">2<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>600 &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">G</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">427 &#40;71&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">411 &#40;68&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">A</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">173 &#40;28&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">189 &#40;31&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;135 &#40;0&#46;887&#8211;1&#46;453&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic"><span class="elsevierStyleBold">&#43;83 C&#62;T APOA1 &#40;rs5070&#41;</span></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Genotype</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C&#47;C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">275 &#40;91&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">276 &#40;92&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C&#47;T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">25 &#40;8&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">24 &#40;8&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;957 &#40;0&#46;533&#8211;1&#46;716&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;88&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">T&#47;T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Allele</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">575 &#40;95&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">576 &#40;96&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">25 &#40;4&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">26 &#40;4&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;958 &#40;0&#46;541&#8211;1&#46;698&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;88&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleItalic"><span class="elsevierStyleBold">2488 C&#62;T APOB &#40;rs693&#41;</span></span></td></tr><tr title="table-row"><td class="td" title="table-entry  " colspan="5" align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Genotype</span></td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C&#47;C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">110 &#40;36&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">121 &#40;40&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C&#47;T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">142 &#40;47&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">142 &#40;47&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;909 &#40;0&#46;642&#8211;1&#46;287&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;59&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">T&#47;T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">48 &#40;16&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">37 &#40;12&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;701 &#40;0&#46;425&#8211;1&#46;156&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Allele</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">362 &#40;60&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">384 &#40;64&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">238 &#40;39&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">216 &#40;36&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;856 &#40;0&#46;677&#8211;1&#46;081&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1805587.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Allele and genotype distribution of <span class="elsevierStyleItalic">APOA1</span> and <span class="elsevierStyleItalic">APOB</span> polymorphisms in CS and ACS&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Dependent variable&#58; ACS&#46; APOB&#47;APOA-I&#58; ratio Apolipoprote&#237;na B&#47;Apolipoprotein A-I&#59; &#40;1 vs 2&#41;&#58; first quintile vs second quintile&#44; &#40;1 vs 3&#41;&#58; first quintile vs third quintile&#44; &#40;1 vs 4&#41;&#58; first quintile vs fourth quintile&#44; &#40;1 vs 5&#41;&#58; first quintile vs fifth quintile&#46; ACS&#58; acute coronary syndrome&#44; DM2&#58; diabetes mellitus type 2&#44; HTA&#58; high blood pressure&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Risk factor&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col"><span class="elsevierStyleItalic">p</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">95&#37; I&#46;C&#46;</th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Inferior&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Superior&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB&#47;APOA-I &#40;1 vs 2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;784&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;103&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;549&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;217&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB&#47;APOA-I &#40;1 vs 3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;045&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;479&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;233&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;983&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB&#47;APOA-I &#40;1 vs 4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;074&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;525&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;259&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;065&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">APOB&#47;APOA-I &#40;1 vs 5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;345&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;704&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;339&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;460&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Overweight&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#46;208&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;459&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">7&#46;203&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Obesity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#46;938&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;692&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">9&#46;061&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">DM2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;430&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;063&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">5&#46;7047&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Dyslipidemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;010&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;453&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;441&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#46;176&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">HBP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;433&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;511&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;920&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Smoking&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#60;0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">5&#46;286&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;132&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#46;923&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1805588.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Binary multivariate logistic regression to determine if ApoB&#47;ApoA-I ratio is an independent predictor parameter of risk in our population&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:34 [
            0 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:3 [
                  "comentario" => "Available from&#58; <a class="elsevierStyleInterRef" target="_blank" id="intr0010" href="http://www.who.int/mediacentre/factsheets/fs317/en/">http&#58;&#47;&#47;www&#46;who&#46;int&#47;mediacentre&#47;factsheets&#47;fs317&#47;en&#47;</a> &#91;accessed 17&#46;07&#46;16&#93;"
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cardiovascular diseases &#40;CVDs&#41; &#91;Internet&#93;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "World Health Organization"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:2 [
                        "fecha" => "2017"
                        "editorial" => "WHO"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Third national registry of acute coronary syndromes &#40;RENASICA III&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46; Jerjes-Sanchez"
                            1 => "C&#46; Martinez-Sanchez"
                            2 => "G&#46; Borrayo-Sanchez"
                            3 => "J&#46; Carrillo-Calvillo"
                            4 => "U&#46; Juarez-Herrera"
                            5 => "J&#46; Quintanilla-Gutierrez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.acmx.2015.04.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Cardiol Mex"
                        "fecha" => "2015"
                        "volumen" => "85"
                        "paginaInicial" => "207"
                        "paginaFinal" => "214"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26337914"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Principales causas de mortalidad por residencia habitual&#44; grupos de edad y sexo del fallecido &#91;Internet&#93;&#46; Available from&#58; <a id="intr0015" class="elsevierStyleInterRef" href="http://www.inegi.org.mx/est/contenidos/proyectos/registros/vitales/mortalidad/tabulados/pc.asp?t=14%26c=11817">http&#58;&#47;&#47;www&#46;inegi&#46;org&#46;mx&#47;est&#47;contenidos&#47;proyectos&#47;registros&#47;vitales&#47;mortalidad&#47;tabulados&#47;pc&#46;asp&#63;t&#61;14&#38;c&#61;11817</a> &#91;accessed 13&#46;09&#46;17&#93;&#46;"
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lipoproteins as biomarkers and therapeutic targets in the setting of acute coronary syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46;S&#46; Rosenson"
                            1 => "H&#46;B&#46; Brewer"
                            2 => "D&#46;J&#46; Rader"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCRESAHA.114.302805"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circ Res"
                        "fecha" => "2014"
                        "volumen" => "114"
                        "paginaInicial" => "1880"
                        "paginaFinal" => "1889"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24902972"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Heritability of death from coronary heart disease&#58; a 36-year follow-up of 20 966 Swedish twins"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46; Zdravkovic"
                            1 => "A&#46; Wienke"
                            2 => "N&#46;L&#46; Pedersen"
                            3 => "M&#46;E&#46; Marenberg"
                            4 => "A&#46;I&#46; Yashin"
                            5 => "U&#46; de Faire"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Intern Med"
                        "fecha" => "2002"
                        "volumen" => "252"
                        "paginaInicial" => "247"
                        "paginaFinal" => "254"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12270005"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A1 gene polymorphisms and risk of early coronary disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;R&#46; Reguero"
                            1 => "G&#46;I&#46; Cubero"
                            2 => "A&#46; Batalla"
                            3 => "V&#46; Alvarez"
                            4 => "S&#46; Hevia"
                            5 => "A&#46; Cortina"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1159/000006849"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cardiology"
                        "fecha" => "1998"
                        "volumen" => "90"
                        "paginaInicial" => "231"
                        "paginaFinal" => "235"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9892774"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Influence of genetic polymorphisms on responsiveness to dietary fat and cholesterol"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46;Q&#46; Ye"
                            1 => "P&#46;O&#46; Kwiterovich"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/ajcn/72.5.1275s"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Clin Nutr"
                        "fecha" => "2000"
                        "volumen" => "72"
                        "numero" => "Suppl&#46;"
                        "paginaInicial" => "1275s"
                        "paginaFinal" => "1284s"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11063469"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries &#40;the INTERHEART study&#41;&#58; case&#8211;control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Yusuf"
                            1 => "S&#46; Hawken"
                            2 => "S&#46; Ounpuu"
                            3 => "T&#46; Dans"
                            4 => "A&#46; Avezum"
                            5 => "F&#46; Lanas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(04)17018-9"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2004"
                        "volumen" => "364"
                        "paginaInicial" => "937"
                        "paginaFinal" => "952"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15364185"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "High apolipoprotein B&#44; low apolipoprotein A-I&#44; and improvement in the prediction of fatal myocardial infarction &#40;AMORIS study&#41;&#58; a prospective study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "G&#46; Walldius"
                            1 => "I&#46; Jungner"
                            2 => "I&#46; Holme"
                            3 => "A&#46;H&#46; Aastveit"
                            4 => "W&#46; Kolar"
                            5 => "E&#46; Steiner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(01)07098-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2001"
                        "volumen" => "358"
                        "paginaInicial" => "2026"
                        "paginaFinal" => "2033"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11755609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The apoB&#47;apoA-I ratio&#58; a strong&#44; new risk factor for cardiovascular disease and a target for lipid-lowering therapy &#8211; a review of the evidence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46; Walldius"
                            1 => "I&#46; Jungner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2796.2006.01643.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Intern Med"
                        "fecha" => "2006"
                        "volumen" => "259"
                        "paginaInicial" => "493"
                        "paginaFinal" => "519"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16629855"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apo B&#47;apo A-I ratio and cardiovascular risk prediction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L&#46;M&#46; Lima"
                            1 => "M&#46; Carvalho"
                            2 => "M&#46;O&#46; Sousa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Arq Bras Cardiol"
                        "fecha" => "2007"
                        "volumen" => "88"
                        "paginaInicial" => "e187"
                        "paginaFinal" => "e190"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17664987"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "2014 AHA&#47;ACC guideline for the management of patients with non-ST-elevation acute coronary syndromes&#58; executive summary&#46; A report of the American College of Cardiology&#47;American Heart Association Task Force on Practice Guidelines"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;A&#46; Amsterdam"
                            1 => "N&#46;K&#46; Wenger"
                            2 => "R&#46;G&#46; Brindis"
                            3 => "D&#46;E&#46; Casey"
                            4 => "T&#46;G&#46; Ganiats"
                            5 => "D&#46;R&#46; Holmes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIR.0000000000000133"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2014"
                        "volumen" => "130"
                        "paginaInicial" => "2354"
                        "paginaFinal" => "2394"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25249586"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Myocardial infarction redefined&#8212;a consensus document of The Joint European Society of Cardiology&#47;American College of Cardiology Committee for the redefinition of myocardial infarction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Antman"
                            1 => "J&#46;-P&#46; Bassand"
                            2 => "W&#46; Klein"
                            3 => "M&#46; Ohman"
                            4 => "J&#46;L&#46; Lopez Sendon"
                            5 => "L&#46; Ryd&#233;n"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Am Coll Cardiol"
                        "fecha" => "2000"
                        "volumen" => "36"
                        "paginaInicial" => "959"
                        "paginaFinal" => "969"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10987628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Parental cardiovascular disease as a risk factor for cardiovascular disease in middle-aged adults&#58; a prospective study of parents and offspring"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;M&#46; Lloyd-Jones"
                            1 => "B&#46;H&#46; Nam"
                            2 => "R&#46;B&#46; D&#8217;Agostino"
                            3 => "D&#46; Levy"
                            4 => "J&#46;M&#46; Murabito"
                            5 => "T&#46;J&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/jama.291.18.2204"
                      "Revista" => array:6 [
                        "tituloSerie" => "JAMA"
                        "fecha" => "2004"
                        "volumen" => "291"
                        "paginaInicial" => "2204"
                        "paginaFinal" => "2211"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15138242"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A1 gene polymorphism &#40;G-75A and C&#43;83T&#41; in patients with myocardial infarction&#58; a pilot study in a north Indian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46; Dawar"
                            1 => "A&#46; Gurtoo"
                            2 => "R&#46; Singh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1309/AJCPKPTXQ3QN1IFG"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Clin Pathol"
                        "fecha" => "2010"
                        "volumen" => "134"
                        "paginaInicial" => "249"
                        "paginaFinal" => "255"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20660328"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Variations in the promoter region of the apolipoprotein A-1 gene influence plasma lipoprotein&#40;a&#41; levels in Asian Indian neonates from Singapore"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46;K&#46; Heng"
                            1 => "P&#46;S&#46; Low"
                            2 => "N&#46; Saha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1203/00006450-200104000-00013"
                      "Revista" => array:6 [
                        "tituloSerie" => "Pediatr Res"
                        "fecha" => "2001"
                        "volumen" => "49"
                        "paginaInicial" => "514"
                        "paginaFinal" => "518"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11264435"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoprotein A1 gene polymorphisms as risk factors for hypertension and obesity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;S&#46; Chen"
                            1 => "D&#46;R&#46; Mazzotti"
                            2 => "T&#46;K&#46; Furuya"
                            3 => "M&#46;S&#46; Cendoroglo"
                            4 => "L&#46;R&#46; Ramos"
                            5 => "L&#46;Q&#46; Araujo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10238-009-0051-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Med"
                        "fecha" => "2009"
                        "volumen" => "9"
                        "paginaInicial" => "319"
                        "paginaFinal" => "325"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19408098"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gender-specific associations of the APOA1 &#8722;75G&#62;A polymorphism with several metabolic syndrome components in Turkish adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Coban"
                            1 => "A&#46; Onat"
                            2 => "F&#46; Guclu-Geyik"
                            3 => "E&#46; Komurcu-Bayrak"
                            4 => "G&#46; Can"
                            5 => "N&#46; Erginel-Unaltuna"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cca.2014.01.017"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta"
                        "fecha" => "2014"
                        "volumen" => "431"
                        "paginaInicial" => "244"
                        "paginaFinal" => "249"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24508624"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HaploReg&#58; a resource for exploring chromatin states&#44; conservation&#44; and regulatory motif alterations within sets of genetically linked variants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46;D&#46; Ward"
                            1 => "M&#46; Kellis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/nar/gkr917"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nucleic Acids Res"
                        "fecha" => "2012"
                        "volumen" => "40"
                        "paginaInicial" => "D930"
                        "paginaFinal" => "D934"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22064851"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Wang"
                            1 => "J&#46; Zhuang"
                            2 => "S&#46; Iyer"
                            3 => "X&#46; Lin"
                            4 => "T&#46;W&#46; Whitfield"
                            5 => "M&#46;C&#46; Greven"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1101/gr.139105.112"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genome Res"
                        "fecha" => "2012"
                        "volumen" => "22"
                        "paginaInicial" => "1798"
                        "paginaFinal" => "1812"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22955990"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between apolipoprotein B XbaI polymorphism and coronary heart disease in Han Chinese population&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Y&#46; Chen"
                            1 => "M&#46; Lin"
                            2 => "Y&#46; Liang"
                            3 => "N&#46; Zhang"
                            4 => "S&#46; Rao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/gtmb.2015.0126"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genet Test Mol Biomarkers"
                        "fecha" => "2016"
                        "volumen" => "20"
                        "paginaInicial" => "304"
                        "paginaFinal" => "311"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27172140"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic variants in genes related to lipid metabolism and atherosclerosis&#44; dyslipidemia and atorvaestatina response"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;C&#46; Rodrigues"
                            1 => "B&#46; Sobrino"
                            2 => "F&#46;D&#46; Genvigir"
                            3 => "M&#46;A&#46; Willrich"
                            4 => "S&#46;S&#46; Arazi"
                            5 => "E&#46;L&#46; Dorea"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cca.2012.11.028"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta"
                        "fecha" => "2013"
                        "volumen" => "417"
                        "paginaInicial" => "8"
                        "paginaFinal" => "11"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23247049"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of the apolipoprotein B gene polymorphisms with essential hypertension in Northern Chinese Han population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46;Y&#46; Zhao"
                            1 => "J&#46;F&#46; Huang"
                            2 => "L&#46;Y&#46; Wang"
                            3 => "H&#46;F&#46; Li"
                            4 => "P&#46;H&#46; Zhang"
                            5 => "Q&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biomed Environ Sci"
                        "fecha" => "2007"
                        "volumen" => "20"
                        "paginaInicial" => "260"
                        "paginaFinal" => "264"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17672218"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Further evidence for an association between the Xbal polymorphism at the apolipoprotein B locus and lipoprotein level"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46;P&#46; Leren"
                            1 => "K&#46; Berg"
                            2 => "I&#46; Hjermann"
                            3 => "P&#46; Leren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Genet"
                        "fecha" => "1988"
                        "volumen" => "34"
                        "paginaInicial" => "347"
                        "paginaFinal" => "351"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2906824"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Wieland H&#46; The clinical relevance of apolipoprotein determination&#46; In&#58; Rosseneu M&#44; Widhalm K&#44; Jarausch J&#44; editors&#46; Apolipoproteins in lipid disorders &#91;Internet&#93;&#46; Viena&#58; Springer&#59; 1991 &#91;accessed 25&#46;04&#46;15&#93;&#46; p&#46; 63-8&#46; Available from&#58; <a id="intr0020" class="elsevierStyleInterRef" href="http://link.springer.com/chapter/10.1007/978-3-7091-9148-4_6">http&#58;&#47;&#47;link&#46;springer&#46;com&#47;chapter&#47;10&#46;1007&#47;978-3-7091-9148-4&#95;6</a>&#46;"
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human apolipoprotein A-I and A-II metabolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;J&#46; Schaefer"
                            1 => "L&#46;A&#46; Zech"
                            2 => "L&#46;L&#46; Jenkins"
                            3 => "T&#46;J&#46; Bronzert"
                            4 => "E&#46;A&#46; Rubalcaba"
                            5 => "F&#46;T&#46; Lindgren"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Lipid Res"
                        "fecha" => "1982"
                        "volumen" => "23"
                        "paginaInicial" => "850"
                        "paginaFinal" => "862"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6813411"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effect of estrogen-progestin replacement therapy on plasma lipids and lipoproteins in postmenopausal women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "F&#46; Rodriguez-Alem&#225;n"
                            1 => "J&#46;M&#46; Torres"
                            2 => "J&#46;L&#46; Cuadros"
                            3 => "E&#46; Ruiz"
                            4 => "E&#46; Ortega"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocr Res"
                        "fecha" => "2000"
                        "volumen" => "26"
                        "paginaInicial" => "263"
                        "paginaFinal" => "273"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10921452"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mechanistic insights and clinical relevance of the interaction between acute coronary syndromes and lipid metabolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L&#46;C&#46; Correia"
                            1 => "M&#46;T&#46; Twickler"
                            2 => "A&#46;C&#46; Sposito"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1055/s-2004-835378"
                      "Revista" => array:6 [
                        "tituloSerie" => "Semin Vasc Med"
                        "fecha" => "2004"
                        "volumen" => "4"
                        "paginaInicial" => "197"
                        "paginaFinal" => "202"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15478041"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HDL and cardiovascular disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;J&#46; Rader"
                            1 => "G&#46;K&#46; Hovingh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(14)61217-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2014"
                        "volumen" => "384"
                        "paginaInicial" => "618"
                        "paginaFinal" => "625"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25131981"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Is it time to discard the apo B&#58;apo A-I ratio as a predictor of cardiovascular disease&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Sierra-Johnson"
                            1 => "R&#46;M&#46; Fisher"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Rev Cardiol"
                        "fecha" => "2008"
                        "volumen" => "5"
                        "paginaInicial" => "18"
                        "paginaFinal" => "19"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apolipoproteins as markers and managers of coronary risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;C&#46; Chan"
                            1 => "G&#46;F&#46; Watts"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/qjmed/hcl027"
                      "Revista" => array:6 [
                        "tituloSerie" => "QJM"
                        "fecha" => "2006"
                        "volumen" => "99"
                        "paginaInicial" => "277"
                        "paginaFinal" => "287"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16504986"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Progress and challenges in translating the biology of atherosclerosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "P&#46; Libby"
                            1 => "P&#46;M&#46; Ridker"
                            2 => "G&#46;K&#46; Hansson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nature10146"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2011"
                        "volumen" => "473"
                        "paginaInicial" => "317"
                        "paginaFinal" => "325"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21593864"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk factors for acute myocardial infarction in Latin America&#58; the INTERHEART Latin American study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Lanas"
                            1 => "A&#46; Avezum"
                            2 => "L&#46;E&#46; Bautista"
                            3 => "R&#46; Diaz"
                            4 => "M&#46; Luna"
                            5 => "S&#46; Islam"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.106.633552"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2007"
                        "volumen" => "115"
                        "paginaInicial" => "1067"
                        "paginaFinal" => "1074"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17339564"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Stroke mortality and the apoB&#47;apoA-I ratio&#58; results of the AMORIS prospective study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "G&#46; Walldius"
                            1 => "A&#46;H&#46; Aastveit"
                            2 => "I&#46; Jungner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2796.2005.01610.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Intern Med"
                        "fecha" => "2006"
                        "volumen" => "259"
                        "paginaInicial" => "259"
                        "paginaFinal" => "266"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16476103"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/23870206/0000015100000001/v1_201807170422/S238702061830192X/v1_201807170422/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "43310"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/23870206/0000015100000001/v1_201807170422/S238702061830192X/v1_201807170422/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S238702061830192X?idApp=UINPBA00004N"
]