Prevalence and antifungal susceptibility of Candida albicans and its related species Candida dubliniensis and Candida africana isolated from vulvovaginal samples in a hospital of Argentina

array:24 ["pii" => "S0325754115001492" "issn" => "03257541" "doi" => "10.1016/j.ram.2015.10.003" "estado" => "S300" "fechaPublicacion" => "2016-01-01" "aid" => "72" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2015" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:43-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 2732 "formatos" => array:3 [ "EPUB" => 51 "HTML" => 1896 "PDF" => 785 ] ] "itemSiguiente" => array:19 [ "pii" => "S0325754115001662" "issn" => "03257541" "doi" => "10.1016/j.ram.2015.12.001" "estado" => "S300" "fechaPublicacion" => "2016-01-01" "aid" => "81" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:50-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 2030 "formatos" => array:3 [ "EPUB" => 51 "HTML" => 1296 "PDF" => 683 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Prevalence and antibiotic susceptibility of coagulase-negative Staphylococcus species from bovine subclinical mastitis in dairy herds in the central region of Argentina" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "50" "paginaFinal" => "56" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Prevalencia y sensibilidad a antibióticos de especies de estafilococos coagulasa negativos provenientes de mastitis subclínica en bovinos de tambos de la región central de Argentina" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Claudia G. Raspanti, Cesar C. Bonetto, Claudina Vissio, Matías S. Pellegrino, Elina B. Reinoso, Silvana A. Dieser, Cristina I. Bogni, Alejandro J. Larriestra, Liliana M. Odierno" "autores" => array:9 [ 0 => array:2 [ "nombre" => "Claudia G." "apellidos" => "Raspanti" ] 1 => array:2 [ "nombre" => "Cesar C." "apellidos" => "Bonetto" ] 2 => array:2 [ "nombre" => "Claudina" "apellidos" => "Vissio" ] 3 => array:2 [ "nombre" => "Matías S." "apellidos" => "Pellegrino" ] 4 => array:2 [ "nombre" => "Elina B." "apellidos" => "Reinoso" ] 5 => array:2 [ "nombre" => "Silvana A." "apellidos" => "Dieser" ] 6 => array:2 [ "nombre" => "Cristina I." "apellidos" => "Bogni" ] 7 => array:2 [ "nombre" => "Alejandro J." "apellidos" => "Larriestra" ] 8 => array:2 [ "nombre" => "Liliana M." "apellidos" => "Odierno" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001662?idApp=UINPBA00004N" "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001662/v1_201603250025/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754115001625" "issn" => "03257541" "doi" => "10.1016/j.ram.2015.11.003" "estado" => "S300" "fechaPublicacion" => "2016-01-01" "aid" => "77" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2016;48:38-42" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1818 "formatos" => array:3 [ "EPUB" => 41 "HTML" => 1151 "PDF" => 626 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "INFORME BREVE" "titulo" => "Estudio de infestación de caninos con Echinococcus granulosus en la provincia de La Rioja, Argentina" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "38" "paginaFinal" => "42" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Study of infestation of dogs with Echinococcus granulosus in the province of La Rioja, Argentina" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2500 "Ancho" => 1785 "Tamanyo" => 580024 ] ] "descripcion" => array:1 [ "es" => "Mapa de la provincia de La Rioja con las zonas estudiadas." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Juan C. Amaya, Nancy Moreno, Nancy Salmaso, Eduardo Bazan, Gerardo Ricoy, Patricia Córdoba, Graciela I. Santillan" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Juan C." "apellidos" => "Amaya" ] 1 => array:2 [ "nombre" => "Nancy" "apellidos" => "Moreno" ] 2 => array:2 [ "nombre" => "Nancy" "apellidos" => "Salmaso" ] 3 => array:2 [ "nombre" => "Eduardo" "apellidos" => "Bazan" ] 4 => array:2 [ "nombre" => "Gerardo" "apellidos" => "Ricoy" ] 5 => array:2 [ "nombre" => "Patricia" "apellidos" => "Córdoba" ] 6 => array:2 [ "nombre" => "Graciela I." "apellidos" => "Santillan" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001625?idApp=UINPBA00004N" "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001625/v1_201603250025/es/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Prevalence and antifungal susceptibility of Candida albicans and its related species Candida dubliniensis and Candida africana isolated from vulvovaginal samples in a hospital of Argentina" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "43" "paginaFinal" => "49" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Laura Theill, Catiana Dudiuk, Susana Morano, Soledad Gamarra, María Elena Nardin, Emilce Méndez, Guillermo Garcia-Effron" "autores" => array:7 [ 0 => array:3 [ "nombre" => "Laura" "apellidos" => "Theill" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Catiana" "apellidos" => "Dudiuk" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Susana" "apellidos" => "Morano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Soledad" "apellidos" => "Gamarra" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 4 => array:3 [ "nombre" => "María Elena" "apellidos" => "Nardin" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 5 => array:3 [ "nombre" => "Emilce" "apellidos" => "Méndez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 6 => array:4 [ "nombre" => "Guillermo" "apellidos" => "Garcia-Effron" "email" => array:1 [ 0 => "ggarcia@unl.edu.ar" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Laboratorio de Micología y Diagnóstico Molecular – Cátedra de Parasitología y Micología – Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral – CONICET, Santa Fe, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Sección Microbiología, Laboratorio Central, Hospital Dr. José María Cullen, Santa Fe, Argentina" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Prevalencia y sensibilidad a los antifúngicos de Candida albicans y sus especies relacionadas, Candida dubliniensis y Candida africana aisladas de muestras vulvovaginales en un hospital de Argentina" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 810 "Ancho" => 3000 "Tamanyo" => 126675 ] ] "descripcion" => array:1 [ "en" => "(A) Electrophoresis of the hwp1 gene PCR using DNA pools resolved on 1% agarose gel. Lane M, 100bp size marker. Lane 1, C. albicans control strain (ATCC 90028). Lane 2, C. dubliniensis control strain (NCPF 3949). Lanes 3–6, DNA pools showing hwp1 bands. Lane 3: 941bp and 700bp (C. albicans and C. africana). Lanes 4 and 5: 941bp (C. albicans alone). Lane 6: 941 and 569bp (C. albicans and C. dubliniensis). (B) Electrophoresis on 1% agarose gel of the hwp1 PCR using individual DNAs (from the DNA pool displayed in lane 3 – (A)). Lane M, 100bp size marker. Lane 1, C. albicans control strain (ATCC 90028). Lane 2, C. dubliniensis control strain (NCPF 3949). Lane 3, C. africana (Strain LMDM 678). Lane 4, C. albicans (Strain LMDM 679)." ] ] ] "textoCompleto" => "IntroductionMore than twenty different species of Candida have been reported as human pathogens<a class="elsevierStyleCrossRefs" href="#bib0245">14,20</a>. However, Candida albicans is the most common human fungal pathogen and the most studied of all Candida species<a class="elsevierStyleCrossRefs" href="#bib0215">8,10,15,17,20</a>. C. albicans has a great degree of variability and some of the firstly known as “atypical” C. albicans isolates were later considered as related species. That is the case with the well-known Candida dubliniensis<a class="elsevierStyleCrossRef" href="#bib0325">30</a>. Other “atypical” C. albicans considered as separated species are now described as varieties (e.g. C. albicans var. stellatoidea) and included as one of the 173 C. albicans synonyms<a class="elsevierStyleCrossRef" href="#bib0225">10</a>. The most recently described C. albicans related species is Candida africana<a class="elsevierStyleCrossRef" href="#bib0330">31</a>. The first C. africana strain was isolated from African patients suffering from vulvovaginal candidiasis (VVC) and firstly considered “atypical” C. albicans strains<a class="elsevierStyleCrossRef" href="#bib0335">32</a>. Later, it was proposed as a new species based on morphological, biochemical and physiological differences which include its inability to assimilate glucosamine and N-acetylglucosamine and its impossibility to form chlamydospores on corn meal agar<a class="elsevierStyleCrossRefs" href="#bib0295">24,31</a>. Odds et al. in 2007 included C. africana in C. albicans clade 13 and supported a varietal status (C. albicans var. africana)<a class="elsevierStyleCrossRef" href="#bib0255">16</a>. One year later, the same group included several C. africana strains in a group highly distinct from the majority of C. albicans together with Candida stellatoidea type I and other sucrose-negative atypical C. albicans isolates<a class="elsevierStyleCrossRef" href="#bib0220">9</a>. These facts support the controversial taxonomic status of these isolates.The prevalence of these C. albicans related species as agents of VVC is not known in Argentina. Moreover, data on antifungal susceptibility patterns of isolates causing VVC are scarce<a class="elsevierStyleCrossRef" href="#bib0235">12</a>.The aim of this study was to establish the prevalence of C. dubliniensis and C. africana in a collection of yeasts originally identified as C. albicans and isolated from VVC using a molecular-based method coupled with a pooled DNA extraction methodology. Additionally, we evaluated the antifungal susceptibility patterns of these strains.Materials and methodsYeast strainsA total of 287 strains were included in this study. All isolates were obtained from patients having vaginal infection symptoms attending the José María Cullen Hospital (Santa Fe – Argentina) during 2013. All the strains were identified as C. albicans by germ tube formation in human serum and their ability to form green color colonies on CHROMAgar Candida™ (Biomerieux – Medica-Tec SRL, Buenos Aires, Argentina). All yeast isolates were referred to the “Micología y Diagnóstico Molecular” Laboratory (CONICET Universidad Nacional del Litoral) where they were stored and identified in accordance with morphology and carbohydrate assimilation and fermentation<a class="elsevierStyleCrossRef" href="#bib0230">11</a> and by a molecular procedure as described below. C. albicans ATCC 90028 and C. dubliniensis NCPF 3949 were used as control strains.Molecular identification by using hwp1 gene amplicon lengthA PCR method based on hwp1 gene amplification to differentiate C. albicans, C. africana and C. dubliniensis was used. This method identified the three species through the differences in sizes of the obtained PCR fragments: 569bp, 700bp and 941bp, respectively, when the DNA of C. dubliniensis, C. africana and C. albicans DNA was used as template<a class="elsevierStyleCrossRef" href="#bib0290">23</a>. Primers are displayed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Individual and pooled DNA extractionThe isolates were individually grown in 1ml of YPD broth (1% yeast extract, 2% Bacto peptone, 2% dextrose) at 35°C for 24h and constant shaking (200rpm). Then, 200μl of 10 individual cultures were mixed to obtain 2ml yeast cells pools from which the pooled DNA was extracted. The remaining 800μl of yeast cultures were kept at −20°C and used later to obtain individual genomic DNAs if necessary. Yeast DNAs (individual and pooled) were extracted using a phenol-based procedure<a class="elsevierStyleCrossRef" href="#bib0305">26</a>.High-throughput screening to rapidly identify C. africana and C. dubliniensis in a strain collectionOriginally, Romeo et al.<a class="elsevierStyleCrossRef" href="#bib0290">23</a> designed their method to identify strains using individual DNAs. In an effort to establish a high throughput screening method to study fungal collections we decided to use the same PCR technique but using pooled DNAs (containing DNAs isolated from ten different strains). The presence of C. africana or C. dubliniensis DNA was suspected when more than one PCR band was observed. To uncover C. dubliniensis and C. africana, we extracted individual DNA from all the pools showing multiple bands (941bp plus 569bp and/or 700bp) and the hwp1 PCR was repeated using individual DNAs as templates. Additionally, we extracted individual DNA for 10 randomly chosen pools showing one 941bp band (100 DNAs in total) and repeated the hwp1 PCR to confirm the specificity of the technique.Identification confirmationAll the strains identified as C. dubliniensis or C. africana by hwp1 gene amplification were subsequently identified by sequencing the 5.8S RNA gene and adjacent internal transcribed spacer 1 and 2 regions (ITS1 and ITS2) and the hwp1 gene<a class="elsevierStyleCrossRefs" href="#bib0185">2,35</a>. Primers are displayed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.Antifungal susceptibility testingAntifungal drugs tested were fluconazole (FLC), itraconazole (ITC), voriconazole (VRC), clotrimazole (CLT), terbinafine (TRB), anfotericin B (AMB) and nystatin (NYS) (all purchased from Sigma–Aldrich Química – Buenos Aires, Argentina). Drug selection was performed based on the treatment options (topical, vaginal ovules and systemic presentations) available at José María Cullen Hospital (Santa Fe, Argentina). Although AMB is not used to treat vaginal infections, it was added to the list of tested drugs to assess if it was possible to use it as an in vitro surrogate marker for NYS resistance since AMB susceptibility testing is standardized by CLSI and both are polyenes<a class="elsevierStyleCrossRefs" href="#bib0200">5,6</a>. Inoculums of all the isolates were obtained according to CLSI document M27-A3. Result interpretations were performed according to CLSI documents M27-A3 and M27-S4. FLC, ITC and AMB MIC microtitration plates were produced following CLSI M27-A3 guidelines<a class="elsevierStyleCrossRefs" href="#bib0200">5,6</a>. In addition, TRB, CLT and NYS were diluted in dimethyl sulfoxide and the final concentrations ranged from 8 to 0.015μg/ml. Since there are no MIC limit ranges for microdilution tests for these antifungal agents, the quality control strains Candida parapsilosis ATCC 22019 and Candida krusei ATCC 6258 were subjected to twenty MIC repetitions on different days (results are displayed in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>). Afterwards, this MIC data was added to earlier MIC results obtained by our group<a class="elsevierStyleCrossRef" href="#bib0215">8</a> and were used as a control of the produced plates.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Data collection and statistical analysisThe MIC data presented here are expressed as geometric means (GMs) of three experiments performed on different days. The off-scale MICs were converted to the next concentration up or down in order to be included in the analysis. MIC values were approximated to a normal distribution by transforming them into log2 values. GMs were used to statistically compare MIC values and MIC log2 values were used to establish susceptibility differences between strains. To establish significant levels of MIC differences, a one-way ANOVA test with Bonferroni's correction for multiple comparisons was used. A P value ≤0.05 was considered significant. This study was approved by the School of Biochemistry (Universidad Nacional del Litoral) and JM Cullen ethics committees.Nucleotide sequence accession numbersThe C. africana strain hwp1 gene sequence was deposited in GenBank under accession number KR704898.ResultsIdentification and prevalence of C. dubliniensis and C. africanaWith the intention of evaluating the prevalence and potential clinical significance of C. dubliniensis and C. africana in vaginal samples from Santa Fe city, we molecularly identify the 287 isolates received (previously identified by phenotypic methods as C. albicans) by using the amplification of the hwp1 gene using a single primer pair<a class="elsevierStyleCrossRef" href="#bib0290">23</a>. We employed a higher throughput methodology using DNA pools obtained from ten different isolates as templates. When pooled DNAs were used, the presence of non-C. albicans was suspected when two or more bands appeared in the electrophoresis. A 941bp fragment along with a 569bp fragment demonstrated the presence of at least one C. albicans and one C. dubliniensis strain in the DNA pool while the presence of a 700bp fragment proved the existence of at least one C. africana strain in the pool (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). The presence of two PCR bands was observed in five out of the 29 DNA pools. Four showed a 941–569bp-double band and the fifth showed a 941–700bp-band pair representing the presence of at least four C. dubliniensis and one C. africana strains. These five DNA pools were subsequently studied to confirm the results. Individual DNAs were used as PCR template plate to amplify the hwp1 gene. Four C. dubliniensis and one C. africana were identified. Altogether, we obtained the same results using pooled and individual DNA extraction: four C. dubliniensis and one C. africana strains out of 287 studied isolates (1.39% and 0.35% prevalence, respectively). The identification of these strains was confirmed by ITS and hwp1 sequencing. The ITS obtained sequences were compared with the published ITS signature sequences from C. albicans (variants I to IV) (Gene bank aa. numbers: KP675686.1, <a id="intr0020" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=HQ876051.1">HQ876051.1</a>, KP675529.1 and KP675666.1, respectively), C. dubliniensis (variants I and II) (aa. numbers: <a id="intr0025" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AB035589.1">AB035589.1</a> and KP131696.1, respectively), C. albicans var. stellatoidea (aa. numbers: <a id="intr0030" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AJ853768.1">AJ853768.1</a>) and C. africana (aa. numbers: <a id="intr0035" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AY342214.1">AY342214.1</a>)<a class="elsevierStyleCrossRef" href="#bib0185">2</a> (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A). The hwp1 gene sequences of our non-albicans strains showed the characteristic nt. gaps (372bp and 241bp difference for C. dubliniensis and C. africana, respectively) (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B).<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia>Phenotypically, our C. africana strain differed from the C. albicans control strains in its inability to form chlamydospores on corn meal agar, to assimilate trehalose and to grow at 42°C. However, it developed green colonies on CHROMagar and formed germ tubes under regular conditions (2h at 37°C). Our C. africana showed a lower rate of germ tube formation when compared to C. albicans and C. dubliniensis control strains.Antifungal susceptibility testingThe in vitro activities of the tested antifungal drugs are summarized in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>. All non-C. albicans strains included in this study (4 C. dubliniensis and the C. africana) showed very low MIC values for all the tested antifungal agents. Similarly, antifungal drugs showed good in vitro activity against the majority of the remaining 282 isolates (C. albicans). The most potent azole was CLT showing the lowest MIC values (GM=0.02μg/ml, MIC90=0.03μg/ml) and only thirteen strains showed CLT MIC value ≥0.25μg/ml. FLC was the tested drug with the widest range of MIC values (0.06–64.00μg/ml). Reduced susceptibility to FLC was observed in ten C. albicans strains out of the 282 studied (3.55%). Of these ten strains, three were FLC susceptible-dose dependent while seven were resistant to FLC (three strains were exclusively resistant to FLC and four strains were azole-cross-resistant). Concerning the oral triazoles, ITC and VRC showed very good in vitro activity (GM=0.03μg/ml and a MIC90=0.06μg/ml for ITC and GM=0.021μg/ml and a MIC90=0.03μg/ml). There were only four (1.41%) C. albicans strains showing high ITC and VRC MIC values (≥4.00μg/ml). These strains showed FLC cross-resistance (FLC MIC ≥16μg/ml) and high CLT MIC values (≥0.25μg/ml).<elsevierMultimedia ident="tbl0015"></elsevierMultimedia>Both tested polyenes showed a narrow range of MIC values (0.03–0.25μg/ml for both AMB and NYS) and showed no differences in in vitro activity (p=0.43). None of the 287 strains showed high MIC values for NYSor for AMB. Furthermore, TRB was the least active drug against the isolates tested (GM=6.25μg/ml and MIC90=8.00μg/ml). However, the five non-albicans isolates including four C. dubliniensis and one C. africana showed slightly lower TRB MIC values, ranging from 1.00 to 2.00μg/ml (p=0.42).DiscussionIn the present study, we used the amplification of the hwp1 gene to evaluate the presence of C. africana and C. dubliniensis among vaginal isolates identified as C. albicans in accordance with their phenotypic characteristics. We demonstrated that the amplification of the hwp1 gene using pooled DNAs was as efficient as using individual DNAs to differentiate C. dubliniensis and C. africana from C. albicans. Thus, this methodology can be used as a high throughput screening method to study fungal collections.Earlier reports from Europe and Africa demonstrated that C. africana represented more than 5% of the C. albicans species complex isolated from female genital specimens and that it was more prevalent than C. dubliniensis in this type of samples<a class="elsevierStyleCrossRefs" href="#bib0185">2,13,25,31</a>. Conversely, in our patients, C. africana was less prevalent than C. dubliniensis (0.35% and 1.39%, respectively).To the best of our knowledge, the described C. africana strain is the first autochthonous Argentinian isolate reported so far. The strain was identified as C. africana by two different sequencing-based methods (ITS and hwp1 gene sequencing). Phenotypically, our C. africana strain showed characteristics that coincide with previous reports<a class="elsevierStyleCrossRefs" href="#bib0185">2,25,33</a>. We observed a lower filamentation rate in serum for the C. africana isolate. This fact was reported also by Borman et al<a class="elsevierStyleCrossRef" href="#bib0185">2</a>. These authors linked this lower hyphal formation capacity to the reduced virulence of C. africana and its narrow anatomical niche.When antifungal susceptibility was analyzed, our C. africana and C. dubliniensis strains showed low MIC values to all the antifungal tested. Moreover, reduced susceptibility was rare in all the Candida strains studied, reinforcing the idea that C. albicans and its related species isolated from VVC patients are usually susceptible to antifungal agents<a class="elsevierStyleCrossRefs" href="#bib0210">7,8,12,21,22,29</a>. In the case of azoles, CLT and ITC showed the highest potency and FLC MIC GMs values were similar to those obtained in previous reports for yeast causing VVC<a class="elsevierStyleCrossRefs" href="#bib0180">1,3,22</a>. However, 3.55% (10/282) of the C. albicans strains showed FLC reduced susceptibility (three susceptible-dose dependent), three FLC-resistant and four of these strains were azole cross-resistant. This FLC resistance frequency in C. albicans isolated from VVC was higher than that mentioned in other published reports, where there was no FLC resistance<a class="elsevierStyleCrossRefs" href="#bib0235">12,21,29</a>.These susceptibility patterns and the wide range of FLC MIC values observed in our strain collection allow us to infer that in Santa Fe city several molecular mechanism of azole resistance may coexist and antifungal resistance could become a problem in the future<a class="elsevierStyleCrossRefs" href="#bib0195">4,18,19,27,28,34</a>.Here we report the first Argentinian C. africana isolate and a high-throughput screening method to uncover the presence of this newly described species variety in a collection of yeasts isolated from VVC. We also demonstrate that C. albicans related species have low prevalence in our region. Moreover, antifungal resistance seems not to be a serious concern in Santa Fe city region (Argentina). However, VVC treatment should be supported by laboratory results.Ethical disclosuresProtection of people and animals subjectsThe authors declare that no experiments were performed on humans or animals for this study.Confidentiality of dataThe authors declare that this article does not appear patient data.Right to privacy and informed consentThe authors declare that this article does not appear patient data.Conflict of interestThe authors declare that they have no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres620812" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec635096" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres620813" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec635097" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:8 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Yeast strains" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Molecular identification by using hwp1 gene amplicon length" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Individual and pooled DNA extraction" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "High-throughput screening to rapidly identify C. africana and C. dubliniensis in a strain collection" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Identification confirmation" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Antifungal susceptibility testing" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Data collection and statistical analysis" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "Nucleotide sequence accession numbers" ] ] ] 6 => array:3 [ "identificador" => "sec0055" "titulo" => "Results" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0060" "titulo" => "Identification and prevalence of C. dubliniensis and C. africana" ] 1 => array:2 [ "identificador" => "sec0065" "titulo" => "Antifungal susceptibility testing" ] ] ] 7 => array:2 [ "identificador" => "sec0070" "titulo" => "Discussion" ] 8 => array:3 [ "identificador" => "sec0075" "titulo" => "Ethical disclosures" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0080" "titulo" => "Protection of people and animals subjects" ] 1 => array:2 [ "identificador" => "sec0085" "titulo" => "Confidentiality of data" ] 2 => array:2 [ "identificador" => "sec0090" "titulo" => "Right to privacy and informed consent" ] ] ] 9 => array:2 [ "identificador" => "sec0095" "titulo" => "Conflict of interest" ] 10 => array:2 [ "identificador" => "xack209303" "titulo" => "Acknowledgments" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2015-07-30" "fechaAceptado" => "2015-10-13" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec635096" "palabras" => array:5 [ 0 => "Candida Africana" 1 => "Vulvovaginal candidiasis" 2 => "Antifungal resistance" 3 => "Molecular identification" 4 => "Argentina" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec635097" "palabras" => array:5 [ 0 => "Candida africana" 1 => "Candidiasis vulvovaginal" 2 => "Resistencia a los antifúngicos" 3 => "Identificación molecular" 4 => "Argentina" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "Candida africana taxonomical status is controversial. It was proposed as a separate species within the Candida albicans species complex; however, phylogenetic analyses suggested that it is an unusual variety of C. albicans. The prevalence of C. albicans-related species (Candida dubliniensis and C. africana) as vulvovaginal pathogens is not known in Argentina. Moreover, data on antifungal susceptibility of isolates causing vulvovaginal candidiasis is scarce. The aims of this study were to establish the prevalence of C. dubliniensis and C. africana in vaginal samples and to evaluate the antifungal susceptibilities of vaginal C. albicans species complex strains. We used a molecular-based method coupled with a new pooled DNA extraction methodology to differentiate C. dubliniensis and C. africana in a collection of 287 strains originally identified as C. albicans isolated from an Argentinian hospital during 2013. Antifungal susceptibilities to fluconazole, clotrimazole, itraconazole, voriconazole, nystatin, amphotericin B and terbinafine were evaluated by using the CLSI M27-A3 and M27-S4 documents. Of the 287 isolates, 4 C. dubliniensis and one C. africana strains (1.39% and 0.35% prevalence, respectively) were identified. This is the first description of C. africana in Argentina and its identification was confirmed by sequencing the ITS2 region and the hwp1 gene. C. dubliniensis and C. africana strains showed very low MIC values for all the tested antifungals. Fluconazole-reduced-susceptibility and azole cross-resistance were observed in 3.55% and 1.41% of the C. albicans isolates, respectively. These results demonstrate that antifungal resistance is still a rare phenomenon in this kind of isolates." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "La clasificación taxonómica de Candida africana está en discusión, es considerada una nueva especie dentro del complejo C. albicans o una variedad inusual de C. albicans. La prevalencia de las especies relacionadas a C. albicans (C. dubliniensis y C. africana) como agentes de vulvovaginitis en Argentina se desconoce. Los objetivos de este trabajo fueron determinar la prevalencia de C. dubliniensis y C. africana en muestras vaginales y evaluar la sensibilidad a los antifúngicos de aislamientos vaginales de las especies del complejo C. albicans. Para diferenciar C. dubliniensis y C. africana utilizamos un método molecular asociado a un nuevo método de extracción de ADN. Se utilizó una colección de 287 cepas originalmente identificadas como C. albicans aisladas durante 2013 en un hospital de Argentina. Se evaluó la sensibilidad a fluconazol, clotrimazol, itraconazol, voriconazol, nistatina, anfotericina B y terbinafina utilizando los documentos M27-A3 y M27-S4 del CLSI. De los 287 aislamientos, se identificaron 4 C. dubliniensis y 1 C. africana (1,39 y 0,35% de prevalencia, respectivamente). Esta es la primera descripción de C. africana en Argentina. Su identificación fue confirmada por secuenciación de la región ITS2 y del gen hwp1. Las cepas identificadas como C. dubliniensis y C. africana mostraron valores de CIM muy bajos para todos los antifúngicos probados. En los aislamientos de C. albicans, la sensibilidad reducida al fluconazol y la resistencia cruzada a todos los azoles se observó en el 3,55% y el 1,41%, respectivamente. Estos resultados demuestran que la resistencia a los antifúngicos es todavía un fenómeno raro en este tipo de aislamientos." ] ] "multimedia" => array:5 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 810 "Ancho" => 3000 "Tamanyo" => 126675 ] ] "descripcion" => array:1 [ "en" => "(A) Electrophoresis of the hwp1 gene PCR using DNA pools resolved on 1% agarose gel. Lane M, 100bp size marker. Lane 1, C. albicans control strain (ATCC 90028). Lane 2, C. dubliniensis control strain (NCPF 3949). Lanes 3–6, DNA pools showing hwp1 bands. Lane 3: 941bp and 700bp (C. albicans and C. africana). Lanes 4 and 5: 941bp (C. albicans alone). Lane 6: 941 and 569bp (C. albicans and C. dubliniensis). (B) Electrophoresis on 1% agarose gel of the hwp1 PCR using individual DNAs (from the DNA pool displayed in lane 3 – (A)). Lane M, 100bp size marker. Lane 1, C. albicans control strain (ATCC 90028). Lane 2, C. dubliniensis control strain (NCPF 3949). Lane 3, C. africana (Strain LMDM 678). Lane 4, C. albicans (Strain LMDM 679)." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1438 "Ancho" => 3000 "Tamanyo" => 362971 ] ] "descripcion" => array:1 [ "en" => "(A) Sequence alignments of the 35-bp portion of the ITS2 region allowing to differentiate the four C. albicans variants, the two C. dubliniensis types, C. albicans var. stellatoidea and C. africana<a class="elsevierStyleCrossRef" href="#bib0185">2</a>. C. africana strain LMDM 678 showed no differences with the C. africana type strain. Dots indicate conserved nucleotides; gaps are represented as hyphens and nucleotide differences are displayed as letters. (B) Sequence alignments of regions of the hwp1 gene where gaps were encountered. The upper line displays C. albicans hwp1 (GenBank accession number <a class="elsevierStyleInterRef" id="intr0005" href="ncbi-n:U64206.1">U64206.1</a>); second line: C. africana hwp1 (<a class="elsevierStyleInterRef" id="intr0010" href="ncbi-n:EU477610.1">EU477610.1</a>); third line: C. africana LMDM 678 (KR704898) and fourth line: C. dubliniensis (<a class="elsevierStyleInterRef" id="intr0015" href="ncbi-n:AJ632273.1">AJ632273.1</a>)." ] ] 2 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Oligonucleotide \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Target gene \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">5′→3′ sequence \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Primer orientation \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">CR-F<a class="elsevierStyleCrossRef" href="#tblfn0005">a</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HPW1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GCTACCACTTCAGAATCATCATC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Sense \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">CR-R<a class="elsevierStyleCrossRef" href="#tblfn0005">a</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HPW1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GCACCTTCAGTCGTAGAGACG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Antisense \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">ITS1<a class="elsevierStyleCrossRef" href="#tblfn0010">b</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">ITS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">TCCGTAGGTGAACCTGCGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Sense \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">ITS4<a class="elsevierStyleCrossRef" href="#tblfn0010">b</a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">ITS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">TCCTCCGCTTATTGATATGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Antisense \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1017876.png" ] ] ] "notaPie" => array:2 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "Romeo et al.<a class="elsevierStyleCrossRef" href="#bib0290">23</a>." ] 1 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "b" "nota" => "White et al.<a class="elsevierStyleCrossRef" href="#bib0350">35</a>." ] ] ] "descripcion" => array:1 [ "en" => "Oligonucleotide primers used in this study" ] ] 3 => array:7 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " colspan="3" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">MIC range (μg/ml)<a class="elsevierStyleCrossRef" href="#tblfn0015">a</a></th></tr><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Terbinafine \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Clotrimazole \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Nystatin \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C. parapsilosis ATCC 22019 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03–0.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.12–0.25 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C. krusei ATCC 6258 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">>–4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.50–1.00 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1017875.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0015" "etiqueta" => "a" "nota" => "24h-reading. MIC ranges include 20 repetitions performed in this work plus 20 repetitions performed in a previous work conducted by our group<a class="elsevierStyleCrossRef" href="#bib0215">8</a>." ] ] ] "descripcion" => array:1 [ "en" => "Terbinafine, clotrimazole and nystatin MIC ranges for control strains obtained following CLSI M27-A3 and M27-S4 document recommendations" ] ] 4 => array:7 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "AMB: amphotericin B. NYS: nystatin. FLC: fluconazole. ITC: itraconazole. VRC: voriconazole. CLT: clotrimazole. TRB: terbinafine." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Species</th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">N</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">AMB</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">NYS</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">FLC</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ITC</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">VRC</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">CLT</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">TRB</th></tr><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020">a</a> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C. albicans \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">282 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.10 (0.25) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03–0.25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.12 (0.25) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03–0.25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.34 (1.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.06–64.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03 (0.06) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–4.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.021 (0.03) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–4.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.02 (0.03) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–0.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">6.25 (8.00) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">2.00–16.00 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C. dubliniensis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.04 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03–0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.50–1.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.02 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015–0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.50 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">C. africana \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.015 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">1.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1017874.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0020" "etiqueta" => "a" "nota" => "Geometric means expressed in μg/ml. Between parenthesis MIC90 for C. albicans strains." ] ] ] "descripcion" => array:1 [ "en" => "In vitro susceptibilities of the strains included in the study. MIC values are expressed in μg/ml" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:35 [ 0 => array:3 [ "identificador" => "bib0180" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification and susceptibility against fluconazole and albaconazole of 100 yeasts’ strains isolated from vaginal discharge" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A.I. Arechavala" 1 => "M.H. Bianchi" 2 => "A.M. Robles" 3 => "G. Santiso" 4 => "R. Negroni" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "2007" "volumen" => "24" "paginaInicial" => "305" "paginaFinal" => "308" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18095765" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0185" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology, antifungal susceptibility, and pathogenicity of Candida africana isolates from the United Kingdom" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A.M. Borman" 1 => "A. Szekely" 2 => "C.J. Linton" 3 => "M.D. Palmer" 4 => "P. Brown" 5 => "E.M. Johnson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.02816-12" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2013" "volumen" => "51" "paginaInicial" => "967" "paginaFinal" => "972" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23303503" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0190" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Study of acute vulvovaginitis in sexually active adult women, with special reference to candidosis, in patients of the Francisco J. Muniz Infectious Diseases Hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L. Buscemi" 1 => "A. Arechavala" 2 => "R. Negroni" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "2004" "volumen" => "21" "paginaInicial" => "177" "paginaFinal" => "181" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15709796" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0195" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Efflux-mediated antifungal drug resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "R.D. Cannon" 1 => "E. Lamping" 2 => "A.R. Holmes" 3 => "K. Niimi" 4 => "P.V. Baret" 5 => "M.V. Keniya" 6 => "K. Tanabe" 7 => "M. Niimi" 8 => "A. Goffeau" 9 => "B.C. Monk" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.00051-08" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2009" "volumen" => "22" "paginaInicial" => "291" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19366916" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0200" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reference method for broth dilution antifungal susceptibility testing of yeasts" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Clinical and Laboratory Standards Institute" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "edicion" => "3rd ed." "fecha" => "2008" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0205" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reference method for broth dilution antifungal susceptibility testing of yeast – fourth informational supplement – CLSI document M27-S4 – Wayne, PA" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Clinical and Laboratory Standards Institute" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:1 [ "fecha" => "2012" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0210" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cross-resistance of clinical isolates of Candida albicans and Candida glabrata to over-the-counter azoles used in the treatment of vaginitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "E.W. Cross" 1 => "S. Park" 2 => "D.S. Perlin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/107662900419474" "Revista" => array:6 [ "tituloSerie" => "Microb Drug Resist" "fecha" => "2000" "volumen" => "6" "paginaInicial" => "155" "paginaFinal" => "161" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10990271" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0215" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology and antifungal susceptibilities of yeasts causing vulvovaginitis in a teaching hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "S. Gamarra" 1 => "S. Morano" 2 => "C. Dudiuk" 3 => "E. Mancilla" 4 => "M.E. Nardin" 5 => "E. Mendez" 6 => "G. Garcia-Effron" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11046-014-9780-2" "Revista" => array:6 [ "tituloSerie" => "Mycopathologia" "fecha" => "2014" "volumen" => "178" "paginaInicial" => "251" "paginaFinal" => "258" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25005365" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0220" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multilocus sequence typing confirms synonymy but highlights differences between Candida albicans and Candida stellatoidea" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.D. Jacobsen" 1 => "T. Boekhout" 2 => "F.C. Odds" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1567-1364.2008.00392.x" "Revista" => array:6 [ "tituloSerie" => "FEMS Yeast Res" "fecha" => "2008" "volumen" => "8" "paginaInicial" => "764" "paginaFinal" => "770" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18547330" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0225" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Candida Berkhout (1923)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.A. Lachance" 1 => "T. Boekhout" 2 => "G. Scorzetti" 3 => "J.W. Fell" 4 => "C.P. Kurtzman" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:5 [ "titulo" => "The yeasts a taxonomic study" "paginaInicial" => "987" "paginaFinal" => "1278" "edicion" => "5th ed." "serieFecha" => "2013" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0230" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:1 [ "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:3 [ "titulo" => "The yeasts a taxonomic study" "edicion" => "5th ed." "serieFecha" => "2013" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0235" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of vaginal colonization by drug-resistant Candida species in college-age women with previous exposure to over-the-counter azole antifungals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:10 [ 0 => "B. Mathema" 1 => "E. Cross" 2 => "E. Dun" 3 => "S. Park" 4 => "J. Bedell" 5 => "B. Slade" 6 => "M. Williams" 7 => "L. Riley" 8 => "V. Chaturvedi" 9 => "D.S. Perlin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/322600" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2001" "volumen" => "33" "paginaInicial" => "E23" "paginaFinal" => "E27" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11477529" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0240" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Isolation and molecular characterization of Candida africana from Jos, Nigeria" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "N.E. Nnadi" 1 => "G.M. Ayanbimpe" 2 => "F. Scordino" 3 => "M.O. Okolo" 4 => "I.B. Enweani" 5 => "G. Criseo" 6 => "O. Romeo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/13693786.2012.662598" "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2012" "volumen" => "50" "paginaInicial" => "765" "paginaFinal" => "767" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22380533" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0245" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging fungal diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Nucci" 1 => "K.A. Marr" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/432060" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2005" "volumen" => "41" "paginaInicial" => "521" "paginaFinal" => "526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16028162" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0250" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vulvovaginal candidiasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "P. Nyirjesy" 1 => "J.D. Sobel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Obstet Gynecol Clin North Am" "fecha" => "2003" "volumen" => "30" "paginaInicial" => "671" "paginaFinal" => "684" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14719844" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0255" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular phylogenetics of Candida albicans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:13 [ 0 => "F.C. Odds" 1 => "M.E. Bougnoux" 2 => "D.J. Shaw" 3 => "J.M. Bain" 4 => "A.D. Davidson" 5 => "D. Diogo" 6 => "M.D. Jacobsen" 7 => "M. Lecomte" 8 => "S.Y. Li" 9 => "A. Tavanti" 10 => "M.C. Maiden" 11 => "N.A. Gow" 12 => "C. d’Enfert" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/EC.00041-07" "Revista" => array:6 [ "tituloSerie" => "Eukaryot Cell" "fecha" => "2007" "volumen" => "6" "paginaInicial" => "1041" "paginaFinal" => "1052" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17416899" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0260" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A prospective observational study of candidemia: epidemiology, therapy, and influences on mortality in hospitalized adult and pediatric patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:13 [ 0 => "P.G. Pappas" 1 => "J.H. Rex" 2 => "J. Lee" 3 => "R.J. Hamill" 4 => "R.A. Larsen" 5 => "W. Powderly" 6 => "C.A. Kauffman" 7 => "N. Hyslop" 8 => "J.E. Mangino" 9 => "S. Chapman" 10 => "H.W. Horowitz" 11 => "J.E. Edwards" 12 => "W.E. Dismukes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/376906" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2003" "volumen" => "37" "paginaInicial" => "634" "paginaFinal" => "643" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12942393" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0265" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of molecular mechanisms of resistance to azole antifungal agents in Candida albicans strains displaying high-level fluconazole resistance isolated from human immunodeficiency virus-infected patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "S. Perea" 1 => "J.L. Lopez-Ribot" 2 => "W.R. Kirkpatrick" 3 => "R.K. McAtee" 4 => "R.A. Santillan" 5 => "M. Martinez" 6 => "D. Calabrese" 7 => "D. Sanglard" 8 => "T.F. Patterson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AAC.45.10.2676-2684.2001" "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2001" "volumen" => "45" "paginaInicial" => "2676" "paginaFinal" => "2684" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11557454" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0270" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular mechanisms of fluconazole resistance in Candida dubliniensis isolates from human immunodeficiency virus-infected patients with oropharyngeal candidiasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:9 [ 0 => "S. Perea" 1 => "J.L. Lopez-Ribot" 2 => "B.L. Wickes" 3 => "W.R. Kirkpatrick" 4 => "O.P. Dib" 5 => "S.P. Bachmann" 6 => "S.M. Keller" 7 => "M. Martinez" 8 => "T.F. Patterson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2002" "volumen" => "46" "paginaInicial" => "1695" "paginaFinal" => "1703" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12019078" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0275" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology of invasive candidiasis: a persistent public health problem" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.A. Pfaller" 1 => "D.J. Diekema" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.00029-06" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2007" "volumen" => "20" "paginaInicial" => "133" "paginaFinal" => "163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17223626" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0280" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Susceptibility profile of vaginal yeast isolates from Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.A. Ribeiro" 1 => "R. Dietze" 2 => "C.R. Paula" 3 => "D.A. Da Matta" 4 => "A.L. Colombo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mycopathologia" "fecha" => "2001" "volumen" => "151" "paginaInicial" => "5" "paginaFinal" => "10" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11502064" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0285" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antifungal susceptibilities of Candida species causing vulvovaginitis and epidemiology of recurrent cases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S.S. Richter" 1 => "R.P. Galask" 2 => "S.A. Messer" 3 => "R.J. Hollis" 4 => "D.J. Diekema" 5 => "M.A. Pfaller" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.43.5.2155-2162.2005" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2005" "volumen" => "43" "paginaInicial" => "2155" "paginaFinal" => "2162" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15872235" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0290" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "First molecular method for discriminating between Candida africana, Candida albicans, and Candida dubliniensis by using hwp1 gene" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "O. Romeo" 1 => "G. Criseo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.diagmicrobio.2008.05.014" "Revista" => array:6 [ "tituloSerie" => "Diagn Microbiol Infect Dis" "fecha" => "2008" "volumen" => "62" "paginaInicial" => "230" "paginaFinal" => "233" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18640803" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0295" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Morphological, biochemical and molecular characterisation of the first Italian Candida africana isolate" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "O. Romeo" 1 => "G. Criseo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1439-0507.2008.01630.x" "Revista" => array:6 [ "tituloSerie" => "Mycoses" "fecha" => "2009" "volumen" => "52" "paginaInicial" => "454" "paginaFinal" => "457" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18983430" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0300" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Candida africana and its closest relatives" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "O. Romeo" 1 => "G. Criseo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1439-0507.2010.01939.x" "Revista" => array:6 [ "tituloSerie" => "Mycoses" "fecha" => "2011" "volumen" => "54" "paginaInicial" => "475" "paginaFinal" => "486" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20667001" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0305" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular cloning: a laboratory manual" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J. Sambrook" 1 => "E.F. Fritsch" 2 => "T. Maniatis" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "1998" "editorial" => "Cold Spring Harbor Laboratory Press" "editorialLocalizacion" => "Cold Spring Harbor, N.Y." ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0310" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cloning of Candida albicans genes conferring resistance to azole antifungal agents: characterization of CDR2, a new multidrug ABC transporter gene" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "D. Sanglard" 1 => "F. Ischer" 2 => "M. Monod" 3 => "J. Bille" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1099/00221287-143-2-405" "Revista" => array:7 [ "tituloSerie" => "Microbiology" "fecha" => "1997" "volumen" => "143" "numero" => "Pt 2" "paginaInicial" => "405" "paginaFinal" => "416" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9043118" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0315" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A.M. Selmecki" 1 => "K. Dulmage" 2 => "L.E. Cowen" 3 => "J.B. Anderson" 4 => "J. Berman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pgen.1000705" "Revista" => array:5 [ "tituloSerie" => "PLoS Genet" "fecha" => "2009" "volumen" => "5" "paginaInicial" => "e1000705" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19876375" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0320" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Maintenance fluconazole therapy for recurrent vulvovaginal candidiasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:13 [ 0 => "J.D. Sobel" 1 => "H.C. Wiesenfeld" 2 => "M. Martens" 3 => "P. Danna" 4 => "T.M. Hooton" 5 => "A. Rompalo" 6 => "M. Sperling" 7 => "C. Livengood III" 8 => "B. Horowitz" 9 => "T.J. Von" 10 => "L. Edwards" 11 => "H. Panzer" 12 => "T.C. Chu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa033114" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2004" "volumen" => "351" "paginaInicial" => "876" "paginaFinal" => "883" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15329425" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0325" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D.J. Sullivan" 1 => "T.J. Westerneng" 2 => "K.A. Haynes" 3 => "D.E. Bennett" 4 => "D.C. Coleman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1099/13500872-141-7-1507" "Revista" => array:8 [ "tituloSerie" => "Microbiology" "fecha" => "1995" "volumen" => "141" "numero" => "Pt 7" "paginaInicial" => "1507" "paginaFinal" => "1521" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7551019" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1198743X14603074" "estado" => "S300" "issn" => "1198743X" ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0330" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Candida africana sp. nov., a new human pathogen or a variant of Candida albicans?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "H.J. Tietz" 1 => "M. Hopp" 2 => "A. Schmalreck" 3 => "W. Sterry" 4 => "V. Czaika" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mycoses" "fecha" => "2001" "volumen" => "44" "paginaInicial" => "437" "paginaFinal" => "445" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11820255" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0335" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phenotypic and genotypic characterization of unusual vaginal isolates of Candida albicans from Africa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H.J. Tietz" 1 => "A. Kussner" 2 => "M. Thanos" 3 => "M.P. De Andrade" 4 => "W. Presber" 5 => "G. Schonian" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1995" "volumen" => "33" "paginaInicial" => "2462" "paginaFinal" => "2465" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7494047" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0340" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evaluation of phenotypic markers for selection and identification of Candida dubliniensis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "K. Tintelnot" 1 => "G. Haase" 2 => "M. Seibold" 3 => "F. Bergmann" 4 => "M. Staemmler" 5 => "T. Franz" 6 => "D. Naumann" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2000" "volumen" => "38" "paginaInicial" => "1599" "paginaFinal" => "1608" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10747150" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0345" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical, cellular, and molecular factors that contribute to antifungal drug resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T.C. White" 1 => "K.A. Marr" 2 => "R.A. Bowden" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "1998" "volumen" => "11" "paginaInicial" => "382" "paginaFinal" => "402" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9564569" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0350" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T.J. White" 1 => "T.D. Bruns" 2 => "S.B. Lee" 3 => "J.W. Taylor" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:4 [ "titulo" => "PCR protocols: a guide to methods and applications" "paginaInicial" => "315" "paginaFinal" => "322" "serieFecha" => "1998" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack209303" "titulo" => "Acknowledgments" "texto" => "This work was financially supported in part by grants CAI+D prog. RH and PEIS 2011 both from Universidad Nacional del Litoral to G.G.E. and S.G., respectively. C.D. has a predoctoral fellowship from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001492/v1_201603250025/en/main.assets" "Apartado" => array:4 [ "identificador" => "44540" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Agentes antimicrobianos" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004800000001/v1_201603250025/S0325754115001492/v1_201603250025/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001492?idApp=UINPBA00004N"]

Statistics

Original article

Prevalencia y sensibilidad a los antifúngicos de Candida albicans y sus especies relacionadas, Candida dubliniensis y Candida africana aisladas de muestras vulvovaginales en un hospital de Argentina

Laura Theilla, Catiana Dudiuka, Susana Moranob, Soledad Gamarraa, María Elena Nardinb, Emilce Méndezb, Guillermo Garcia-Effrona,

Corresponding author

ggarcia@unl.edu.ar

Corresponding author.

a Laboratorio de Micología y Diagnóstico Molecular – Cátedra de Parasitología y Micología – Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral – CONICET, Santa Fe, Argentina

b Sección Microbiología, Laboratorio Central, Hospital Dr. José María Cullen, Santa Fe, Argentina

Read

6549

Times
was read the article

1561

Total PDF

4988

Total HTML

Share statistics

 array:24 [
  "pii" => "S0325754115001492"
  "issn" => "03257541"
  "doi" => "10.1016/j.ram.2015.10.003"
  "estado" => "S300"
  "fechaPublicacion" => "2016-01-01"
  "aid" => "72"
  "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
  "copyrightAnyo" => "2015"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Rev Argent Microbiol. 2016;48:43-9"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 2732
    "formatos" => array:3 [
      "EPUB" => 51
      "HTML" => 1896
      "PDF" => 785
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0325754115001662"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2015.12.001"
    "estado" => "S300"
    "fechaPublicacion" => "2016-01-01"
    "aid" => "81"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2016;48:50-6"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 2030
      "formatos" => array:3 [
        "EPUB" => 51
        "HTML" => 1296
        "PDF" => 683
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Prevalence and antibiotic susceptibility of coagulase-negative <span class="elsevierStyleItalic">Staphylococcus</span> species from bovine subclinical mastitis in dairy herds in the central region of Argentina"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "50"
          "paginaFinal" => "56"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Prevalencia y sensibilidad a antibi&#243;ticos de especies de estafilococos coagulasa negativos provenientes de mastitis subcl&#237;nica en bovinos de tambos de la regi&#243;n central de Argentina"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Claudia G&#46; Raspanti, Cesar C&#46; Bonetto, Claudina Vissio, Mat&#237;as S&#46; Pellegrino, Elina B&#46; Reinoso, Silvana A&#46; Dieser, Cristina I&#46; Bogni, Alejandro J&#46; Larriestra, Liliana M&#46; Odierno"
          "autores" => array:9 [
            0 => array:2 [
              "nombre" => "Claudia G&#46;"
              "apellidos" => "Raspanti"
            ]
            1 => array:2 [
              "nombre" => "Cesar C&#46;"
              "apellidos" => "Bonetto"
            ]
            2 => array:2 [
              "nombre" => "Claudina"
              "apellidos" => "Vissio"
            ]
            3 => array:2 [
              "nombre" => "Mat&#237;as S&#46;"
              "apellidos" => "Pellegrino"
            ]
            4 => array:2 [
              "nombre" => "Elina B&#46;"
              "apellidos" => "Reinoso"
            ]
            5 => array:2 [
              "nombre" => "Silvana A&#46;"
              "apellidos" => "Dieser"
            ]
            6 => array:2 [
              "nombre" => "Cristina I&#46;"
              "apellidos" => "Bogni"
            ]
            7 => array:2 [
              "nombre" => "Alejandro J&#46;"
              "apellidos" => "Larriestra"
            ]
            8 => array:2 [
              "nombre" => "Liliana M&#46;"
              "apellidos" => "Odierno"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001662?idApp=UINPBA00004N"
    "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001662/v1_201603250025/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0325754115001625"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2015.11.003"
    "estado" => "S300"
    "fechaPublicacion" => "2016-01-01"
    "aid" => "77"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2016;48:38-42"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1818
      "formatos" => array:3 [
        "EPUB" => 41
        "HTML" => 1151
        "PDF" => 626
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">INFORME BREVE</span>"
      "titulo" => "Estudio de infestaci&#243;n de caninos con <span class="elsevierStyleItalic">Echinococcus granulosus</span> en la provincia de La Rioja&#44; Argentina"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "38"
          "paginaFinal" => "42"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Study of infestation of dogs with <span class="elsevierStyleItalic">Echinococcus granulosus</span> in the province of La Rioja&#44; Argentina"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 2500
              "Ancho" => 1785
              "Tamanyo" => 580024
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Mapa de la provincia de La Rioja con las zonas estudiadas&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Juan C&#46; Amaya, Nancy Moreno, Nancy Salmaso, Eduardo Bazan, Gerardo Ricoy, Patricia C&#243;rdoba, Graciela I&#46; Santillan"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Juan C&#46;"
              "apellidos" => "Amaya"
            ]
            1 => array:2 [
              "nombre" => "Nancy"
              "apellidos" => "Moreno"
            ]
            2 => array:2 [
              "nombre" => "Nancy"
              "apellidos" => "Salmaso"
            ]
            3 => array:2 [
              "nombre" => "Eduardo"
              "apellidos" => "Bazan"
            ]
            4 => array:2 [
              "nombre" => "Gerardo"
              "apellidos" => "Ricoy"
            ]
            5 => array:2 [
              "nombre" => "Patricia"
              "apellidos" => "C&#243;rdoba"
            ]
            6 => array:2 [
              "nombre" => "Graciela I&#46;"
              "apellidos" => "Santillan"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001625?idApp=UINPBA00004N"
    "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001625/v1_201603250025/es/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Prevalence and antifungal susceptibility of <span class="elsevierStyleItalic">Candida albicans</span> and its related species <span class="elsevierStyleItalic">Candida dubliniensis</span> and <span class="elsevierStyleItalic">Candida africana</span> isolated from vulvovaginal samples in a hospital of Argentina"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "43"
        "paginaFinal" => "49"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Laura Theill, Catiana Dudiuk, Susana Morano, Soledad Gamarra, Mar&#237;a Elena Nardin, Emilce M&#233;ndez, Guillermo Garcia-Effron"
        "autores" => array:7 [
          0 => array:3 [
            "nombre" => "Laura"
            "apellidos" => "Theill"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Catiana"
            "apellidos" => "Dudiuk"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Susana"
            "apellidos" => "Morano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Soledad"
            "apellidos" => "Gamarra"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Mar&#237;a Elena"
            "apellidos" => "Nardin"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Emilce"
            "apellidos" => "M&#233;ndez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          6 => array:4 [
            "nombre" => "Guillermo"
            "apellidos" => "Garcia-Effron"
            "email" => array:1 [
              0 => "ggarcia&#64;unl&#46;edu&#46;ar"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Laboratorio de Micolog&#237;a y Diagn&#243;stico Molecular &#8211; C&#225;tedra de Parasitolog&#237;a y Micolog&#237;a &#8211; Facultad de Bioqu&#237;mica y Ciencias Biol&#243;gicas&#44; Universidad Nacional del Litoral &#8211; CONICET&#44; Santa Fe&#44; Argentina"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Secci&#243;n Microbiolog&#237;a&#44; Laboratorio Central&#44; Hospital Dr&#46; Jos&#233; Mar&#237;a Cullen&#44; Santa Fe&#44; Argentina"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Prevalencia y sensibilidad a los antif&#250;ngicos de <span class="elsevierStyleItalic">Candida albicans</span> y sus especies relacionadas&#44; <span class="elsevierStyleItalic">Candida dubliniensis</span> y <span class="elsevierStyleItalic">Candida africana</span> aisladas de muestras vulvovaginales en un hospital de Argentina"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 810
            "Ancho" => 3000
            "Tamanyo" => 126675
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Electrophoresis of the <span class="elsevierStyleItalic">hwp1</span> gene PCR using DNA pools resolved on 1&#37; agarose gel&#46; Lane M&#44; 100<span class="elsevierStyleHsp" style=""></span>bp size marker&#46; Lane 1&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> control strain &#40;ATCC 90028&#41;&#46; Lane 2&#44; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> control strain &#40;NCPF 3949&#41;&#46; Lanes 3&#8211;6&#44; DNA pools showing <span class="elsevierStyleItalic">hwp1</span> bands&#46; Lane 3&#58; 941<span class="elsevierStyleHsp" style=""></span>bp and 700<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> and <span class="elsevierStyleItalic">C&#46; africana</span>&#41;&#46; Lanes 4 and 5&#58; 941<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> alone&#41;&#46; Lane 6&#58; 941 and 569<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span>&#41;&#46; &#40;B&#41; Electrophoresis on 1&#37; agarose gel of the <span class="elsevierStyleItalic">hwp1</span> PCR using individual DNAs &#40;from the DNA pool displayed in lane 3 &#8211; &#40;A&#41;&#41;&#46; Lane M&#44; 100<span class="elsevierStyleHsp" style=""></span>bp size marker&#46; Lane 1&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> control strain &#40;ATCC 90028&#41;&#46; Lane 2&#44; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> control strain &#40;NCPF 3949&#41;&#46; Lane 3&#44; <span class="elsevierStyleItalic">C&#46; africana</span> &#40;Strain LMDM 678&#41;&#46; Lane 4&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> &#40;Strain LMDM 679&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">More than twenty different species of <span class="elsevierStyleItalic">Candida</span> have been reported as human pathogens<a class="elsevierStyleCrossRefs" href="#bib0245"><span class="elsevierStyleSup">14&#44;20</span></a>&#46; However&#44; <span class="elsevierStyleItalic">Candida albicans</span> is the most common human fungal pathogen and the most studied of all <span class="elsevierStyleItalic">Candida</span> species<a class="elsevierStyleCrossRefs" href="#bib0215"><span class="elsevierStyleSup">8&#44;10&#44;15&#44;17&#44;20</span></a>&#46; <span class="elsevierStyleItalic">C&#46; albicans</span> has a great degree of variability and some of the firstly known as &#8220;atypical&#8221; <span class="elsevierStyleItalic">C&#46; albicans</span> isolates were later considered as related species&#46; That is the case with the well-known <span class="elsevierStyleItalic">Candida dubliniensis</span><a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">30</span></a>&#46; Other &#8220;atypical&#8221; <span class="elsevierStyleItalic">C&#46; albicans</span> considered as separated species are now described as varieties &#40;<span class="elsevierStyleItalic">e&#46;g&#46; C&#46; albicans var&#46; stellatoidea</span>&#41; and included as one of the 173 <span class="elsevierStyleItalic">C&#46; albicans</span> synonyms<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">10</span></a>&#46; The most recently described <span class="elsevierStyleItalic">C&#46; albicans</span> related species is <span class="elsevierStyleItalic">Candida africana</span><a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">31</span></a>&#46; The first <span class="elsevierStyleItalic">C&#46; africana</span> strain was isolated from African patients suffering from vulvovaginal candidiasis &#40;VVC&#41; and firstly considered &#8220;atypical&#8221; <span class="elsevierStyleItalic">C&#46; albicans</span> strains<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">32</span></a>&#46; Later&#44; it was proposed as a new species based on morphological&#44; biochemical and physiological differences which include its inability to assimilate glucosamine and N-acetylglucosamine and its impossibility to form chlamydospores on corn meal agar<a class="elsevierStyleCrossRefs" href="#bib0295"><span class="elsevierStyleSup">24&#44;31</span></a>&#46; Odds <span class="elsevierStyleItalic">et al&#46;</span> in 2007 included <span class="elsevierStyleItalic">C&#46; africana</span> in <span class="elsevierStyleItalic">C&#46; albicans</span> clade 13 and supported a varietal status &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> var&#46; <span class="elsevierStyleItalic">africana</span>&#41;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">16</span></a>&#46; One year later&#44; the same group included several <span class="elsevierStyleItalic">C&#46; africana</span> strains in a group highly distinct from the majority of <span class="elsevierStyleItalic">C&#46; albicans</span> together with <span class="elsevierStyleItalic">Candida stellatoidea</span> type I and other sucrose-negative atypical <span class="elsevierStyleItalic">C&#46; albicans</span> isolates<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">9</span></a>&#46; These facts support the controversial taxonomic status of these isolates&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">The prevalence of these <span class="elsevierStyleItalic">C&#46; albicans</span> related species as agents of VVC is not known in Argentina&#46; Moreover&#44; data on antifungal susceptibility patterns of isolates causing VVC are scarce<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">12</span></a>&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">The aim of this study was to establish the prevalence of <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> in a collection of yeasts originally identified as <span class="elsevierStyleItalic">C&#46; albicans</span> and isolated from VVC using a molecular-based method coupled with a pooled DNA extraction methodology&#46; Additionally&#44; we evaluated the antifungal susceptibility patterns of these strains&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Yeast strains</span><p id="par0020" class="elsevierStylePara elsevierViewall">A total of 287 strains were included in this study&#46; All isolates were obtained from patients having vaginal infection symptoms attending the <span class="elsevierStyleItalic">Jos&#233; Mar&#237;a Cullen Hospital</span> &#40;Santa Fe &#8211; Argentina&#41; during 2013&#46; All the strains were identified as <span class="elsevierStyleItalic">C&#46; albicans</span> by germ tube formation in human serum and their ability to form green color colonies on CHROMAgar Candida&#8482; &#40;Biomerieux &#8211; Medica-Tec SRL&#44; Buenos Aires&#44; Argentina&#41;&#46; All yeast isolates were referred to the &#8220;<span class="elsevierStyleItalic">Micolog&#237;a y Diagn&#243;stico Molecular</span>&#8221; Laboratory &#40;CONICET Universidad Nacional del Litoral&#41; where they were stored and identified in accordance with morphology and carbohydrate assimilation and fermentation<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">11</span></a> and by a molecular procedure as described below&#46; <span class="elsevierStyleItalic">C&#46; albicans</span> ATCC 90028 and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> NCPF 3949 were used as control strains&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Molecular identification by using <span class="elsevierStyleItalic">hwp1</span> gene amplicon length</span><p id="par0025" class="elsevierStylePara elsevierViewall">A PCR method based on <span class="elsevierStyleItalic">hwp1</span> gene amplification to differentiate <span class="elsevierStyleItalic">C&#46; albicans</span>&#44; <span class="elsevierStyleItalic">C&#46; africana</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> was used&#46; This method identified the three species through the differences in sizes of the obtained PCR fragments&#58; 569<span class="elsevierStyleHsp" style=""></span>bp&#44; 700<span class="elsevierStyleHsp" style=""></span>bp and 941<span class="elsevierStyleHsp" style=""></span>bp&#44; respectively&#44; when the DNA of <span class="elsevierStyleItalic">C&#46; dubliniensis</span>&#44; <span class="elsevierStyleItalic">C&#46; africana</span> and <span class="elsevierStyleItalic">C&#46; albicans</span> DNA was used as template<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">23</span></a>&#46; Primers are displayed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Individual and pooled DNA extraction</span><p id="par0030" class="elsevierStylePara elsevierViewall">The isolates were individually grown in 1<span class="elsevierStyleHsp" style=""></span>ml of YPD broth &#40;1&#37; yeast extract&#44; 2&#37; Bacto peptone&#44; 2&#37; dextrose&#41; at 35<span class="elsevierStyleHsp" style=""></span>&#176;C for 24<span class="elsevierStyleHsp" style=""></span>h and constant shaking &#40;200<span class="elsevierStyleHsp" style=""></span>rpm&#41;&#46; Then&#44; 200<span class="elsevierStyleHsp" style=""></span>&#956;l of 10 individual cultures were mixed to obtain 2<span class="elsevierStyleHsp" style=""></span>ml yeast cells pools from which the pooled DNA was extracted&#46; The remaining 800<span class="elsevierStyleHsp" style=""></span>&#956;l of yeast cultures were kept at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C and used later to obtain individual genomic DNAs if necessary&#46; Yeast DNAs &#40;individual and pooled&#41; were extracted using a phenol-based procedure<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">26</span></a>&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">High-throughput screening to rapidly identify <span class="elsevierStyleItalic">C&#46; africana</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> in a strain collection</span><p id="par0035" class="elsevierStylePara elsevierViewall">Originally&#44; Romeo <span class="elsevierStyleItalic">et al</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">23</span></a> designed their method to identify strains using individual DNAs&#46; In an effort to establish a high throughput screening method to study fungal collections we decided to use the same PCR technique but using pooled DNAs &#40;containing DNAs isolated from ten different strains&#41;&#46; The presence of <span class="elsevierStyleItalic">C&#46; africana</span> or <span class="elsevierStyleItalic">C&#46; dubliniensis</span> DNA was suspected when more than one PCR band was observed&#46; To uncover <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span>&#44; we extracted individual DNA from all the pools showing multiple bands &#40;941<span class="elsevierStyleHsp" style=""></span>bp plus 569<span class="elsevierStyleHsp" style=""></span>bp and&#47;or 700<span class="elsevierStyleHsp" style=""></span>bp&#41; and the <span class="elsevierStyleItalic">hwp1</span> PCR was repeated using individual DNAs as templates&#46; Additionally&#44; we extracted individual DNA for 10 randomly chosen pools showing one 941<span class="elsevierStyleHsp" style=""></span>bp band &#40;100 DNAs in total&#41; and repeated the <span class="elsevierStyleItalic">hwp1</span> PCR to confirm the specificity of the technique&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Identification confirmation</span><p id="par0040" class="elsevierStylePara elsevierViewall">All the strains identified as <span class="elsevierStyleItalic">C&#46; dubliniensis</span> or <span class="elsevierStyleItalic">C&#46; africana</span> by <span class="elsevierStyleItalic">hwp1</span> gene amplification were subsequently identified by sequencing the 5&#46;8S RNA gene and adjacent internal transcribed spacer 1 and 2 regions &#40;ITS1 and ITS2&#41; and the <span class="elsevierStyleItalic">hwp1</span> gene<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">2&#44;35</span></a>&#46; Primers are displayed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Antifungal susceptibility testing</span><p id="par0045" class="elsevierStylePara elsevierViewall">Antifungal drugs tested were fluconazole &#40;FLC&#41;&#44; itraconazole &#40;ITC&#41;&#44; voriconazole &#40;VRC&#41;&#44; clotrimazole &#40;CLT&#41;&#44; terbinafine &#40;TRB&#41;&#44; anfotericin B &#40;AMB&#41; and nystatin &#40;NYS&#41; &#40;all purchased from Sigma&#8211;Aldrich Qu&#237;mica &#8211; Buenos Aires&#44; Argentina&#41;&#46; Drug selection was performed based on the treatment options &#40;topical&#44; vaginal ovules and systemic presentations&#41; available at <span class="elsevierStyleItalic">Jos&#233; Mar&#237;a Cullen Hospital</span> &#40;Santa Fe&#44; Argentina&#41;&#46; Although AMB is not used to treat vaginal infections&#44; it was added to the list of tested drugs to assess if it was possible to use it as an <span class="elsevierStyleItalic">in vitro</span> surrogate marker for NYS resistance since AMB susceptibility testing is standardized by CLSI and both are polyenes<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">5&#44;6</span></a>&#46; Inoculums of all the isolates were obtained according to CLSI document M27-A3&#46; Result interpretations were performed according to CLSI documents M27-A3 and M27-S4&#46; FLC&#44; ITC and AMB MIC microtitration plates were produced following CLSI M27-A3 guidelines<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">5&#44;6</span></a>&#46; In addition&#44; TRB&#44; CLT and NYS were diluted in dimethyl sulfoxide and the final concentrations ranged from 8 to 0&#46;015<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#46; Since there are no MIC limit ranges for microdilution tests for these antifungal agents&#44; the quality control strains <span class="elsevierStyleItalic">Candida parapsilosis</span> ATCC 22019 and <span class="elsevierStyleItalic">Candida krusei</span> ATCC 6258 were subjected to twenty MIC repetitions on different days &#40;results are displayed in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; Afterwards&#44; this MIC data was added to earlier MIC results obtained by our group<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">8</span></a> and were used as a control of the produced plates&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Data collection and statistical analysis</span><p id="par0050" class="elsevierStylePara elsevierViewall">The MIC data presented here are expressed as geometric means &#40;GMs&#41; of three experiments performed on different days&#46; The off-scale MICs were converted to the next concentration up or down in order to be included in the analysis&#46; MIC values were approximated to a normal distribution by transforming them into log<span class="elsevierStyleInf">2</span> values&#46; GMs were used to statistically compare MIC values and MIC log<span class="elsevierStyleInf">2</span> values were used to establish susceptibility differences between strains&#46; To establish significant levels of MIC differences&#44; a one-way ANOVA test with Bonferroni&#39;s correction for multiple comparisons was used&#46; A <span class="elsevierStyleItalic">P</span> value &#8804;0&#46;05 was considered significant&#46; This study was approved by the School of Biochemistry &#40;Universidad Nacional del Litoral&#41; and JM Cullen ethics committees&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Nucleotide sequence accession numbers</span><p id="par0055" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">C&#46; africana</span> strain <span class="elsevierStyleItalic">hwp1</span> gene sequence was deposited in GenBank under accession number KR704898&#46;</p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Identification and prevalence of <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span></span><p id="par0060" class="elsevierStylePara elsevierViewall">With the intention of evaluating the prevalence and potential clinical significance of <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> in vaginal samples from Santa Fe city&#44; we molecularly identify the 287 isolates received &#40;previously identified by phenotypic methods as <span class="elsevierStyleItalic">C&#46; albicans</span>&#41; by using the amplification of the <span class="elsevierStyleItalic">hwp1</span> gene using a single primer pair<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">23</span></a>&#46; We employed a higher throughput methodology using DNA pools obtained from ten different isolates as templates&#46; When pooled DNAs were used&#44; the presence of non-<span class="elsevierStyleItalic">C&#46; albicans</span> was suspected when two or more bands appeared in the electrophoresis&#46; A 941<span class="elsevierStyleHsp" style=""></span>bp fragment along with a 569<span class="elsevierStyleHsp" style=""></span>bp fragment demonstrated the presence of at least one <span class="elsevierStyleItalic">C&#46; albicans</span> and one <span class="elsevierStyleItalic">C&#46; dubliniensis</span> strain in the DNA pool while the presence of a 700<span class="elsevierStyleHsp" style=""></span>bp fragment proved the existence of at least one <span class="elsevierStyleItalic">C&#46; africana</span> strain in the pool &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46; The presence of two PCR bands was observed in five out of the 29 DNA pools&#46; Four showed a 941&#8211;569<span class="elsevierStyleHsp" style=""></span>bp-double band and the fifth showed a 941&#8211;700<span class="elsevierStyleHsp" style=""></span>bp-band pair representing the presence of at least four <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and one <span class="elsevierStyleItalic">C&#46; africana</span> strains&#46; These five DNA pools were subsequently studied to confirm the results&#46; Individual DNAs were used as PCR template plate to amplify the <span class="elsevierStyleItalic">hwp1</span> gene&#46; Four <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and one <span class="elsevierStyleItalic">C&#46; africana</span> were identified&#46; Altogether&#44; we obtained the same results using pooled and individual DNA extraction&#58; four <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and one <span class="elsevierStyleItalic">C&#46; africana</span> strains out of 287 studied isolates &#40;1&#46;39&#37; and 0&#46;35&#37; prevalence&#44; respectively&#41;&#46; The identification of these strains was confirmed by ITS and <span class="elsevierStyleItalic">hwp1</span> sequencing&#46; The ITS obtained sequences were compared with the published ITS signature sequences from <span class="elsevierStyleItalic">C&#46; albicans</span> &#40;variants I to IV&#41; &#40;Gene bank aa&#46; numbers&#58; KP675686&#46;1&#44; <a id="intr0020" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=HQ876051.1">HQ876051&#46;1</a>&#44; KP675529&#46;1 and KP675666&#46;1&#44; respectively&#41;&#44; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> &#40;variants I and II&#41; &#40;aa&#46; numbers&#58; <a id="intr0025" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AB035589.1">AB035589&#46;1</a> and KP131696&#46;1&#44; respectively&#41;&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> var&#46; <span class="elsevierStyleItalic">stellatoidea</span> &#40;aa&#46; numbers&#58; <a id="intr0030" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AJ853768.1">AJ853768&#46;1</a>&#41; and <span class="elsevierStyleItalic">C&#46; africana</span> &#40;aa&#46; numbers&#58; <a id="intr0035" class="elsevierStyleInterRef" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=nucleotide&doptcmdl=genbank&term=AY342214.1">AY342214&#46;1</a>&#41;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">2</span></a> &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A&#41;&#46; The <span class="elsevierStyleItalic">hwp1</span> gene sequences of our non-<span class="elsevierStyleItalic">albicans</span> strains showed the characteristic nt&#46; gaps &#40;372<span class="elsevierStyleHsp" style=""></span>bp and 241<span class="elsevierStyleHsp" style=""></span>bp difference for <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span>&#44; respectively&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0065" class="elsevierStylePara elsevierViewall">Phenotypically&#44; our <span class="elsevierStyleItalic">C&#46; africana</span> strain differed from the <span class="elsevierStyleItalic">C&#46; albicans</span> control strains in its inability to form chlamydospores on corn meal agar&#44; to assimilate trehalose and to grow at 42<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; However&#44; it developed green colonies on CHROMagar and formed germ tubes under regular conditions &#40;2<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>&#176;C&#41;&#46; Our <span class="elsevierStyleItalic">C&#46; africana</span> showed a lower rate of germ tube formation when compared to <span class="elsevierStyleItalic">C&#46; albicans</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> control strains&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Antifungal susceptibility testing</span><p id="par0070" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">in vitro</span> activities of the tested antifungal drugs are summarized in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46; All non-<span class="elsevierStyleItalic">C&#46; albicans</span> strains included in this study &#40;4 <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and the <span class="elsevierStyleItalic">C&#46; africana</span>&#41; showed very low MIC values for all the tested antifungal agents&#46; Similarly&#44; antifungal drugs showed good <span class="elsevierStyleItalic">in vitro</span> activity against the majority of the remaining 282 isolates &#40;<span class="elsevierStyleItalic">C&#46; albicans</span>&#41;&#46; The most potent azole was CLT showing the lowest MIC values &#40;GM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;02<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#44; MIC90<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41; and only thirteen strains showed CLT MIC value &#8805;0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#46; FLC was the tested drug with the widest range of MIC values &#40;0&#46;06&#8211;64&#46;00<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46; Reduced susceptibility to FLC was observed in ten <span class="elsevierStyleItalic">C&#46; albicans</span> strains out of the 282 studied &#40;3&#46;55&#37;&#41;&#46; Of these ten strains&#44; three were FLC susceptible-dose dependent while seven were resistant to FLC &#40;three strains were exclusively resistant to FLC and four strains were azole-cross-resistant&#41;&#46; Concerning the oral triazoles&#44; ITC and VRC showed very good <span class="elsevierStyleItalic">in vitro</span> activity &#40;GM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml and a MIC90<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;06<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml for ITC and GM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;021<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml and a MIC90<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;03<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46; There were only four &#40;1&#46;41&#37;&#41; <span class="elsevierStyleItalic">C&#46; albicans</span> strains showing high ITC and VRC MIC values &#40;&#8805;4&#46;00<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46; These strains showed FLC cross-resistance &#40;FLC MIC &#8805;16<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41; and high CLT MIC values &#40;&#8805;0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0075" class="elsevierStylePara elsevierViewall">Both tested polyenes showed a narrow range of MIC values &#40;0&#46;03&#8211;0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml for both AMB and NYS&#41; and showed no differences in <span class="elsevierStyleItalic">in vitro</span> activity &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;43&#41;&#46; None of the 287 strains showed high MIC values for NYSor for AMB&#46; Furthermore&#44; TRB was the least active drug against the isolates tested &#40;GM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml and MIC90<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>8&#46;00<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml&#41;&#46; However&#44; the five non-albicans isolates including four <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and one <span class="elsevierStyleItalic">C&#46; africana</span> showed slightly lower TRB MIC values&#44; ranging from 1&#46;00 to 2&#46;00<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;ml &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;42&#41;&#46;</p></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Discussion</span><p id="par0080" class="elsevierStylePara elsevierViewall">In the present study&#44; we used the amplification of the <span class="elsevierStyleItalic">hwp1</span> gene to evaluate the presence of <span class="elsevierStyleItalic">C&#46; africana</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> among vaginal isolates identified as <span class="elsevierStyleItalic">C&#46; albicans</span> in accordance with their phenotypic characteristics&#46; We demonstrated that the amplification of the <span class="elsevierStyleItalic">hwp1</span> gene using pooled DNAs was as efficient as using individual DNAs to differentiate <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> from <span class="elsevierStyleItalic">C&#46; albicans</span>&#46; Thus&#44; this methodology can be used as a high throughput screening method to study fungal collections&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">Earlier reports from Europe and Africa demonstrated that <span class="elsevierStyleItalic">C&#46; africana</span> represented more than 5&#37; of the <span class="elsevierStyleItalic">C&#46; albicans</span> species complex isolated from female genital specimens and that it was more prevalent than <span class="elsevierStyleItalic">C&#46; dubliniensis</span> in this type of samples<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">2&#44;13&#44;25&#44;31</span></a>&#46; Conversely&#44; in our patients&#44; <span class="elsevierStyleItalic">C&#46; africana</span> was less prevalent than <span class="elsevierStyleItalic">C&#46; dubliniensis</span> &#40;0&#46;35&#37; and 1&#46;39&#37;&#44; respectively&#41;&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">To the best of our knowledge&#44; the described <span class="elsevierStyleItalic">C&#46; africana</span> strain is the first autochthonous Argentinian isolate reported so far&#46; The strain was identified as <span class="elsevierStyleItalic">C&#46; africana</span> by two different sequencing-based methods &#40;ITS and <span class="elsevierStyleItalic">hwp1</span> gene sequencing&#41;&#46; Phenotypically&#44; our <span class="elsevierStyleItalic">C&#46; africana</span> strain showed characteristics that coincide with previous reports<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">2&#44;25&#44;33</span></a>&#46; We observed a lower filamentation rate in serum for the <span class="elsevierStyleItalic">C&#46; africana</span> isolate&#46; This fact was reported also by Borman <span class="elsevierStyleItalic">et al</span><a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">2</span></a><span class="elsevierStyleItalic">&#46;</span> These authors linked this lower hyphal formation capacity to the reduced virulence of <span class="elsevierStyleItalic">C&#46; africana</span> and its narrow anatomical niche&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">When antifungal susceptibility was analyzed&#44; our <span class="elsevierStyleItalic">C&#46; africana</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span> strains showed low MIC values to all the antifungal tested&#46; Moreover&#44; reduced susceptibility was rare in all the <span class="elsevierStyleItalic">Candida</span> strains studied&#44; reinforcing the idea that <span class="elsevierStyleItalic">C&#46; albicans</span> and its related species isolated from VVC patients are usually susceptible to antifungal agents<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">7&#44;8&#44;12&#44;21&#44;22&#44;29</span></a>&#46; In the case of azoles&#44; CLT and ITC showed the highest potency and FLC MIC GMs values were similar to those obtained in previous reports for yeast causing VVC<a class="elsevierStyleCrossRefs" href="#bib0180"><span class="elsevierStyleSup">1&#44;3&#44;22</span></a>&#46; However&#44; 3&#46;55&#37; &#40;10&#47;282&#41; of the <span class="elsevierStyleItalic">C&#46; albicans</span> strains showed FLC reduced susceptibility &#40;three susceptible-dose dependent&#41;&#44; three FLC-resistant and four of these strains were azole cross-resistant&#46; This FLC resistance frequency in <span class="elsevierStyleItalic">C&#46; albicans</span> isolated from VVC was higher than that mentioned in other published reports&#44; where there was no FLC resistance<a class="elsevierStyleCrossRefs" href="#bib0235"><span class="elsevierStyleSup">12&#44;21&#44;29</span></a>&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">These susceptibility patterns and the wide range of FLC MIC values observed in our strain collection allow us to infer that in Santa Fe city several molecular mechanism of azole resistance may coexist and antifungal resistance could become a problem in the future<a class="elsevierStyleCrossRefs" href="#bib0195"><span class="elsevierStyleSup">4&#44;18&#44;19&#44;27&#44;28&#44;34</span></a>&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">Here we report the first Argentinian <span class="elsevierStyleItalic">C&#46; africana</span> isolate and a high-throughput screening method to uncover the presence of this newly described species variety in a collection of yeasts isolated from VVC&#46; We also demonstrate that <span class="elsevierStyleItalic">C&#46; albicans</span> related species have low prevalence in our region&#46; Moreover&#44; antifungal resistance seems not to be a serious concern in Santa Fe city region &#40;Argentina&#41;&#46; However&#44; VVC treatment should be supported by laboratory results&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Ethical disclosures</span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Protection of people and animals subjects</span><p id="par0110" class="elsevierStylePara elsevierViewall">The authors declare that no experiments were performed on humans or animals for this study&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Confidentiality of data</span><p id="par0115" class="elsevierStylePara elsevierViewall">The authors declare that this article does not appear patient data&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Right to privacy and informed consent</span><p id="par0120" class="elsevierStylePara elsevierViewall">The authors declare that this article does not appear patient data&#46;</p></span></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Conflict of interest</span><p id="par0125" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres620812"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec635096"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres620813"
          "titulo" => "Resumen"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0010"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec635097"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Yeast strains"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Molecular identification by using hwp1 gene amplicon length"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Individual and pooled DNA extraction"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "High-throughput screening to rapidly identify C&#46; africana and C&#46; dubliniensis in a strain collection"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Identification confirmation"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Antifungal susceptibility testing"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Data collection and statistical analysis"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Nucleotide sequence accession numbers"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0055"
          "titulo" => "Results"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Identification and prevalence of C&#46; dubliniensis and C&#46; africana"
            ]
            1 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Antifungal susceptibility testing"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        8 => array:3 [
          "identificador" => "sec0075"
          "titulo" => "Ethical disclosures"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0080"
              "titulo" => "Protection of people and animals subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Confidentiality of data"
            ]
            2 => array:2 [
              "identificador" => "sec0090"
              "titulo" => "Right to privacy and informed consent"
            ]
          ]
        ]
        9 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Conflict of interest"
        ]
        10 => array:2 [
          "identificador" => "xack209303"
          "titulo" => "Acknowledgments"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2015-07-30"
    "fechaAceptado" => "2015-10-13"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec635096"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Candida Africana</span>"
            1 => "Vulvovaginal candidiasis"
            2 => "Antifungal resistance"
            3 => "Molecular identification"
            4 => "Argentina"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec635097"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Candida africana</span>"
            1 => "Candidiasis vulvovaginal"
            2 => "Resistencia a los antif&#250;ngicos"
            3 => "Identificaci&#243;n molecular"
            4 => "Argentina"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Candida africana</span> taxonomical status is controversial&#46; It was proposed as a separate species within the <span class="elsevierStyleItalic">Candida albicans</span> species complex&#59; however&#44; phylogenetic analyses suggested that it is an unusual variety of <span class="elsevierStyleItalic">C&#46; albicans&#46;</span> The prevalence of <span class="elsevierStyleItalic">C&#46; albicans</span>-related species &#40;<span class="elsevierStyleItalic">Candida dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span>&#41; as vulvovaginal pathogens is not known in Argentina&#46; Moreover&#44; data on antifungal susceptibility of isolates causing vulvovaginal candidiasis is scarce&#46; The aims of this study were to establish the prevalence of <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> in vaginal samples and to evaluate the antifungal susceptibilities of vaginal <span class="elsevierStyleItalic">C&#46; albicans</span> species complex strains&#46; We used a molecular-based method coupled with a new pooled DNA extraction methodology to differentiate <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> in a collection of 287 strains originally identified as <span class="elsevierStyleItalic">C&#46; albicans</span> isolated from an Argentinian hospital during 2013&#46; Antifungal susceptibilities to fluconazole&#44; clotrimazole&#44; itraconazole&#44; voriconazole&#44; nystatin&#44; amphotericin B and terbinafine were evaluated by using the CLSI M27-A3 and M27-S4 documents&#46; Of the 287 isolates&#44; 4 <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and one <span class="elsevierStyleItalic">C&#46; africana</span> strains &#40;1&#46;39&#37; and 0&#46;35&#37; prevalence&#44; respectively&#41; were identified&#46; This is the first description of <span class="elsevierStyleItalic">C&#46; africana</span> in Argentina and its identification was confirmed by sequencing the ITS2 region and the <span class="elsevierStyleItalic">hwp1</span> gene&#46; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> and <span class="elsevierStyleItalic">C&#46; africana</span> strains showed very low MIC values for all the tested antifungals&#46; Fluconazole-reduced-susceptibility and azole cross-resistance were observed in 3&#46;55&#37; and 1&#46;41&#37; of the <span class="elsevierStyleItalic">C&#46; albicans</span> isolates&#44; respectively&#46; These results demonstrate that antifungal resistance is still a rare phenomenon in this kind of isolates&#46;</p></span>"
      ]
      "es" => array:2 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La clasificaci&#243;n taxon&#243;mica de <span class="elsevierStyleItalic">Candida africana</span> est&#225; en discusi&#243;n&#44; es considerada una nueva especie dentro del complejo <span class="elsevierStyleItalic">C&#46; albicans</span> o una variedad inusual de <span class="elsevierStyleItalic">C&#46; albicans</span>&#46; La prevalencia de las especies relacionadas a <span class="elsevierStyleItalic">C&#46; albicans</span> &#40;<span class="elsevierStyleItalic">C&#46; dubliniensis</span> y <span class="elsevierStyleItalic">C&#46; africana</span>&#41; como agentes de vulvovaginitis en Argentina se desconoce&#46; Los objetivos de este trabajo fueron determinar la prevalencia de <span class="elsevierStyleItalic">C&#46; dubliniensis</span> y <span class="elsevierStyleItalic">C&#46; africana</span> en muestras vaginales y evaluar la sensibilidad a los antif&#250;ngicos de aislamientos vaginales de las especies del complejo <span class="elsevierStyleItalic">C&#46; albicans</span>&#46; Para diferenciar <span class="elsevierStyleItalic">C&#46; dubliniensis</span> y <span class="elsevierStyleItalic">C&#46; africana</span> utilizamos un m&#233;todo molecular asociado a un nuevo m&#233;todo de extracci&#243;n de ADN&#46; Se utiliz&#243; una colecci&#243;n de 287 cepas originalmente identificadas como <span class="elsevierStyleItalic">C&#46; albicans</span> aisladas durante 2013 en un hospital de Argentina&#46; Se evalu&#243; la sensibilidad a fluconazol&#44; clotrimazol&#44; itraconazol&#44; voriconazol&#44; nistatina&#44; anfotericina B y terbinafina utilizando los documentos M27-A3 y M27-S4 del CLSI&#46; De los 287 aislamientos&#44; se identificaron 4 <span class="elsevierStyleItalic">C&#46; dubliniensis</span> y 1 <span class="elsevierStyleItalic">C&#46; africana</span> &#40;1&#44;39 y 0&#44;35&#37; de prevalencia&#44; respectivamente&#41;&#46; Esta es la primera descripci&#243;n de <span class="elsevierStyleItalic">C&#46; africana</span> en Argentina&#46; Su identificaci&#243;n fue confirmada por secuenciaci&#243;n de la regi&#243;n ITS2 y del gen <span class="elsevierStyleItalic">hwp1</span>&#46; Las cepas identificadas como <span class="elsevierStyleItalic">C&#46; dubliniensis</span> y <span class="elsevierStyleItalic">C&#46; africana</span> mostraron valores de CIM muy bajos para todos los antif&#250;ngicos probados&#46; En los aislamientos de <span class="elsevierStyleItalic">C&#46; albicans</span>&#44; la sensibilidad reducida al fluconazol y la resistencia cruzada a todos los azoles se observ&#243; en el 3&#44;55&#37; y el 1&#44;41&#37;&#44; respectivamente&#46; Estos resultados demuestran que la resistencia a los antif&#250;ngicos es todav&#237;a un fen&#243;meno raro en este tipo de aislamientos&#46;</p></span>"
      ]
    ]
    "multimedia" => array:5 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 810
            "Ancho" => 3000
            "Tamanyo" => 126675
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Electrophoresis of the <span class="elsevierStyleItalic">hwp1</span> gene PCR using DNA pools resolved on 1&#37; agarose gel&#46; Lane M&#44; 100<span class="elsevierStyleHsp" style=""></span>bp size marker&#46; Lane 1&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> control strain &#40;ATCC 90028&#41;&#46; Lane 2&#44; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> control strain &#40;NCPF 3949&#41;&#46; Lanes 3&#8211;6&#44; DNA pools showing <span class="elsevierStyleItalic">hwp1</span> bands&#46; Lane 3&#58; 941<span class="elsevierStyleHsp" style=""></span>bp and 700<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> and <span class="elsevierStyleItalic">C&#46; africana</span>&#41;&#46; Lanes 4 and 5&#58; 941<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> alone&#41;&#46; Lane 6&#58; 941 and 569<span class="elsevierStyleHsp" style=""></span>bp &#40;<span class="elsevierStyleItalic">C&#46; albicans</span> and <span class="elsevierStyleItalic">C&#46; dubliniensis</span>&#41;&#46; &#40;B&#41; Electrophoresis on 1&#37; agarose gel of the <span class="elsevierStyleItalic">hwp1</span> PCR using individual DNAs &#40;from the DNA pool displayed in lane 3 &#8211; &#40;A&#41;&#41;&#46; Lane M&#44; 100<span class="elsevierStyleHsp" style=""></span>bp size marker&#46; Lane 1&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> control strain &#40;ATCC 90028&#41;&#46; Lane 2&#44; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> control strain &#40;NCPF 3949&#41;&#46; Lane 3&#44; <span class="elsevierStyleItalic">C&#46; africana</span> &#40;Strain LMDM 678&#41;&#46; Lane 4&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> &#40;Strain LMDM 679&#41;&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1438
            "Ancho" => 3000
            "Tamanyo" => 362971
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Sequence alignments of the 35-bp portion of the ITS2 region allowing to differentiate the four <span class="elsevierStyleItalic">C&#46; albicans</span> variants&#44; the two <span class="elsevierStyleItalic">C&#46; dubliniensis</span> types&#44; <span class="elsevierStyleItalic">C&#46; albicans</span> var&#46; <span class="elsevierStyleItalic">stellatoidea</span> and <span class="elsevierStyleItalic">C&#46; africana</span><a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">2</span></a>&#46; <span class="elsevierStyleItalic">C&#46; africana</span> strain LMDM 678 showed no differences with the <span class="elsevierStyleItalic">C&#46; africana</span> type strain&#46; Dots indicate conserved nucleotides&#59; gaps are represented as hyphens and nucleotide differences are displayed as letters&#46; &#40;B&#41; Sequence alignments of regions of the <span class="elsevierStyleItalic">hwp1</span> gene where gaps were encountered&#46; The upper line displays <span class="elsevierStyleItalic">C&#46; albicans hwp1</span> &#40;GenBank accession number <a class="elsevierStyleInterRef" id="intr0005" href="ncbi-n:U64206.1">U64206&#46;1</a>&#41;&#59; second line&#58; <span class="elsevierStyleItalic">C&#46; africana hwp1</span> &#40;<a class="elsevierStyleInterRef" id="intr0010" href="ncbi-n:EU477610.1">EU477610&#46;1</a>&#41;&#59; third line&#58; <span class="elsevierStyleItalic">C&#46; africana</span> LMDM 678 &#40;KR704898&#41; and fourth line&#58; <span class="elsevierStyleItalic">C&#46; dubliniensis</span> &#40;<a class="elsevierStyleInterRef" id="intr0015" href="ncbi-n:AJ632273.1">AJ632273&#46;1</a>&#41;&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Oligonucleotide&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Target gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">5&#8242;<span class="elsevierStyleHsp" style=""></span>&#8594;<span class="elsevierStyleHsp" style=""></span>3&#8242; sequence&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Primer orientation&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">CR-F<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">HPW1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">GCTACCACTTCAGAATCATCATC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">CR-R<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">HPW1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">GCACCTTCAGTCGTAGAGACG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Antisense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">ITS1<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">ITS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">TCCGTAGGTGAACCTGCGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Sense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">ITS4<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">ITS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">TCCTCCGCTTATTGATATGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top">Antisense&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1017876.png"
              ]
            ]
          ]
          "notaPie" => array:2 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Romeo et al&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">23</span></a>&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">White et al&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">35</span></a>&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Oligonucleotide primers used in this study</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="3" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">MIC range &#40;&#956;g&#47;ml&#41;<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">a</span></a></th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Terbinafine&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Clotrimazole&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Nystatin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">C&#46; parapsilosis</span> ATCC 22019&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&#8211;0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;12&#8211;0&#46;25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">C&#46; krusei</span> ATCC 6258&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#62;&#8211;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;50&#8211;1&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1017875.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">24<span class="elsevierStyleHsp" style=""></span>h-reading&#46; MIC ranges include 20 repetitions performed in this work plus 20 repetitions performed in a previous work conducted by our group<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">8</span></a>&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Terbinafine&#44; clotrimazole and nystatin MIC ranges for control strains obtained following CLSI M27-A3 and M27-S4 document recommendations</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">AMB&#58; amphotericin B&#46; NYS&#58; nystatin&#46; FLC&#58; fluconazole&#46; ITC&#58; itraconazole&#46; VRC&#58; voriconazole&#46; CLT&#58; clotrimazole&#46; TRB&#58; terbinafine&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Species</th><th class="td" title="table-head  " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">N</span></th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">AMB</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">NYS</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">FLC</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">ITC</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">VRC</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">CLT</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">TRB</th></tr><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">MIC<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">C&#46; albicans</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">282&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;10 &#40;0&#46;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&#8211;0&#46;25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;12 &#40;0&#46;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&#8211;0&#46;25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;34 &#40;1&#46;00&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;06&#8211;64&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03 &#40;0&#46;06&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;021 &#40;0&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;02 &#40;0&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#46;25 &#40;8&#46;00&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#46;00&#8211;16&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">C&#46; dubliniensis</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&#8211;0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;50&#8211;1&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;02&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&#8211;0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleItalic">C&#46; africana</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;015&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1017874.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0020"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Geometric means expressed in &#956;g&#47;ml&#46; Between parenthesis MIC<span class="elsevierStyleInf">90</span> for <span class="elsevierStyleItalic">C&#46; albicans</span> strains&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">In vitro</span> susceptibilities of the strains included in the study&#46; MIC values are expressed in &#956;g&#47;ml</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:35 [
            0 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification and susceptibility against fluconazole and albaconazole of 100 yeasts&#8217; strains isolated from vaginal discharge"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46;I&#46; Arechavala"
                            1 => "M&#46;H&#46; Bianchi"
                            2 => "A&#46;M&#46; Robles"
                            3 => "G&#46; Santiso"
                            4 => "R&#46; Negroni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Iberoam Micol"
                        "fecha" => "2007"
                        "volumen" => "24"
                        "paginaInicial" => "305"
                        "paginaFinal" => "308"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18095765"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology&#44; antifungal susceptibility&#44; and pathogenicity of <span class="elsevierStyleItalic">Candida africana</span> isolates from the United Kingdom"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46;M&#46; Borman"
                            1 => "A&#46; Szekely"
                            2 => "C&#46;J&#46; Linton"
                            3 => "M&#46;D&#46; Palmer"
                            4 => "P&#46; Brown"
                            5 => "E&#46;M&#46; Johnson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.02816-12"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2013"
                        "volumen" => "51"
                        "paginaInicial" => "967"
                        "paginaFinal" => "972"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23303503"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Study of acute vulvovaginitis in sexually active adult women&#44; with special reference to candidosis&#44; in patients of the Francisco J&#46; Muniz Infectious Diseases Hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L&#46; Buscemi"
                            1 => "A&#46; Arechavala"
                            2 => "R&#46; Negroni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Iberoam Micol"
                        "fecha" => "2004"
                        "volumen" => "21"
                        "paginaInicial" => "177"
                        "paginaFinal" => "181"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15709796"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Efflux-mediated antifungal drug resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "R&#46;D&#46; Cannon"
                            1 => "E&#46; Lamping"
                            2 => "A&#46;R&#46; Holmes"
                            3 => "K&#46; Niimi"
                            4 => "P&#46;V&#46; Baret"
                            5 => "M&#46;V&#46; Keniya"
                            6 => "K&#46; Tanabe"
                            7 => "M&#46; Niimi"
                            8 => "A&#46; Goffeau"
                            9 => "B&#46;C&#46; Monk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/CMR.00051-08"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Microbiol Rev"
                        "fecha" => "2009"
                        "volumen" => "22"
                        "paginaInicial" => "291"
                        "paginaFinal" => "321"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19366916"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reference method for broth dilution antifungal susceptibility testing of yeasts"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Clinical and Laboratory Standards Institute"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:2 [
                        "edicion" => "3rd ed&#46;"
                        "fecha" => "2008"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reference method for broth dilution antifungal susceptibility testing of yeast &#8211; fourth informational supplement &#8211; CLSI document M27-S4 &#8211; Wayne&#44; PA"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Clinical and Laboratory Standards Institute"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:1 [
                        "fecha" => "2012"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cross-resistance of clinical isolates of <span class="elsevierStyleItalic">Candida albicans</span> and <span class="elsevierStyleItalic">Candida glabrata</span> to over-the-counter azoles used in the treatment of vaginitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46;W&#46; Cross"
                            1 => "S&#46; Park"
                            2 => "D&#46;S&#46; Perlin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/107662900419474"
                      "Revista" => array:6 [
                        "tituloSerie" => "Microb Drug Resist"
                        "fecha" => "2000"
                        "volumen" => "6"
                        "paginaInicial" => "155"
                        "paginaFinal" => "161"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10990271"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology and antifungal susceptibilities of yeasts causing vulvovaginitis in a teaching hospital"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "S&#46; Gamarra"
                            1 => "S&#46; Morano"
                            2 => "C&#46; Dudiuk"
                            3 => "E&#46; Mancilla"
                            4 => "M&#46;E&#46; Nardin"
                            5 => "E&#46; Mendez"
                            6 => "G&#46; Garcia-Effron"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11046-014-9780-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mycopathologia"
                        "fecha" => "2014"
                        "volumen" => "178"
                        "paginaInicial" => "251"
                        "paginaFinal" => "258"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25005365"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multilocus sequence typing confirms synonymy but highlights differences between <span class="elsevierStyleItalic">Candida albicans</span> and <span class="elsevierStyleItalic">Candida stellatoidea</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;D&#46; Jacobsen"
                            1 => "T&#46; Boekhout"
                            2 => "F&#46;C&#46; Odds"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1567-1364.2008.00392.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "FEMS Yeast Res"
                        "fecha" => "2008"
                        "volumen" => "8"
                        "paginaInicial" => "764"
                        "paginaFinal" => "770"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18547330"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Candida</span> Berkhout &#40;1923&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;A&#46; Lachance"
                            1 => "T&#46; Boekhout"
                            2 => "G&#46; Scorzetti"
                            3 => "J&#46;W&#46; Fell"
                            4 => "C&#46;P&#46; Kurtzman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:5 [
                        "titulo" => "The yeasts a taxonomic study"
                        "paginaInicial" => "987"
                        "paginaFinal" => "1278"
                        "edicion" => "5th ed&#46;"
                        "serieFecha" => "2013"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:1 [
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:3 [
                        "titulo" => "The yeasts a taxonomic study"
                        "edicion" => "5th ed&#46;"
                        "serieFecha" => "2013"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of vaginal colonization by drug-resistant <span class="elsevierStyleItalic">Candida</span> species in college-age women with previous exposure to over-the-counter azole antifungals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:10 [
                            0 => "B&#46; Mathema"
                            1 => "E&#46; Cross"
                            2 => "E&#46; Dun"
                            3 => "S&#46; Park"
                            4 => "J&#46; Bedell"
                            5 => "B&#46; Slade"
                            6 => "M&#46; Williams"
                            7 => "L&#46; Riley"
                            8 => "V&#46; Chaturvedi"
                            9 => "D&#46;S&#46; Perlin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1086/322600"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Infect Dis"
                        "fecha" => "2001"
                        "volumen" => "33"
                        "paginaInicial" => "E23"
                        "paginaFinal" => "E27"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11477529"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Isolation and molecular characterization of <span class="elsevierStyleItalic">Candida africana</span> from Jos&#44; Nigeria"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "N&#46;E&#46; Nnadi"
                            1 => "G&#46;M&#46; Ayanbimpe"
                            2 => "F&#46; Scordino"
                            3 => "M&#46;O&#46; Okolo"
                            4 => "I&#46;B&#46; Enweani"
                            5 => "G&#46; Criseo"
                            6 => "O&#46; Romeo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/13693786.2012.662598"
                      "Revista" => array:6 [
                        "tituloSerie" => "Med Mycol"
                        "fecha" => "2012"
                        "volumen" => "50"
                        "paginaInicial" => "765"
                        "paginaFinal" => "767"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22380533"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Emerging fungal diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Nucci"
                            1 => "K&#46;A&#46; Marr"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1086/432060"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Infect Dis"
                        "fecha" => "2005"
                        "volumen" => "41"
                        "paginaInicial" => "521"
                        "paginaFinal" => "526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16028162"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vulvovaginal candidiasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "P&#46; Nyirjesy"
                            1 => "J&#46;D&#46; Sobel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Obstet Gynecol Clin North Am"
                        "fecha" => "2003"
                        "volumen" => "30"
                        "paginaInicial" => "671"
                        "paginaFinal" => "684"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14719844"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular phylogenetics of <span class="elsevierStyleItalic">Candida albicans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:13 [
                            0 => "F&#46;C&#46; Odds"
                            1 => "M&#46;E&#46; Bougnoux"
                            2 => "D&#46;J&#46; Shaw"
                            3 => "J&#46;M&#46; Bain"
                            4 => "A&#46;D&#46; Davidson"
                            5 => "D&#46; Diogo"
                            6 => "M&#46;D&#46; Jacobsen"
                            7 => "M&#46; Lecomte"
                            8 => "S&#46;Y&#46; Li"
                            9 => "A&#46; Tavanti"
                            10 => "M&#46;C&#46; Maiden"
                            11 => "N&#46;A&#46; Gow"
                            12 => "C&#46; d&#8217;Enfert"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/EC.00041-07"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eukaryot Cell"
                        "fecha" => "2007"
                        "volumen" => "6"
                        "paginaInicial" => "1041"
                        "paginaFinal" => "1052"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17416899"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A prospective observational study of candidemia&#58; epidemiology&#44; therapy&#44; and influences on mortality in hospitalized adult and pediatric patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:13 [
                            0 => "P&#46;G&#46; Pappas"
                            1 => "J&#46;H&#46; Rex"
                            2 => "J&#46; Lee"
                            3 => "R&#46;J&#46; Hamill"
                            4 => "R&#46;A&#46; Larsen"
                            5 => "W&#46; Powderly"
                            6 => "C&#46;A&#46; Kauffman"
                            7 => "N&#46; Hyslop"
                            8 => "J&#46;E&#46; Mangino"
                            9 => "S&#46; Chapman"
                            10 => "H&#46;W&#46; Horowitz"
                            11 => "J&#46;E&#46; Edwards"
                            12 => "W&#46;E&#46; Dismukes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1086/376906"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Infect Dis"
                        "fecha" => "2003"
                        "volumen" => "37"
                        "paginaInicial" => "634"
                        "paginaFinal" => "643"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12942393"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of molecular mechanisms of resistance to azole antifungal agents in <span class="elsevierStyleItalic">Candida albicans</span> strains displaying high-level fluconazole resistance isolated from human immunodeficiency virus-infected patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:9 [
                            0 => "S&#46; Perea"
                            1 => "J&#46;L&#46; Lopez-Ribot"
                            2 => "W&#46;R&#46; Kirkpatrick"
                            3 => "R&#46;K&#46; McAtee"
                            4 => "R&#46;A&#46; Santillan"
                            5 => "M&#46; Martinez"
                            6 => "D&#46; Calabrese"
                            7 => "D&#46; Sanglard"
                            8 => "T&#46;F&#46; Patterson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/AAC.45.10.2676-2684.2001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Antimicrob Agents Chemother"
                        "fecha" => "2001"
                        "volumen" => "45"
                        "paginaInicial" => "2676"
                        "paginaFinal" => "2684"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11557454"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular mechanisms of fluconazole resistance in <span class="elsevierStyleItalic">Candida dubliniensis</span> isolates from human immunodeficiency virus-infected patients with oropharyngeal candidiasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:9 [
                            0 => "S&#46; Perea"
                            1 => "J&#46;L&#46; Lopez-Ribot"
                            2 => "B&#46;L&#46; Wickes"
                            3 => "W&#46;R&#46; Kirkpatrick"
                            4 => "O&#46;P&#46; Dib"
                            5 => "S&#46;P&#46; Bachmann"
                            6 => "S&#46;M&#46; Keller"
                            7 => "M&#46; Martinez"
                            8 => "T&#46;F&#46; Patterson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Antimicrob Agents Chemother"
                        "fecha" => "2002"
                        "volumen" => "46"
                        "paginaInicial" => "1695"
                        "paginaFinal" => "1703"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12019078"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology of invasive candidiasis&#58; a persistent public health problem"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;A&#46; Pfaller"
                            1 => "D&#46;J&#46; Diekema"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/CMR.00029-06"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Microbiol Rev"
                        "fecha" => "2007"
                        "volumen" => "20"
                        "paginaInicial" => "133"
                        "paginaFinal" => "163"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17223626"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Susceptibility profile of vaginal yeast isolates from Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;A&#46; Ribeiro"
                            1 => "R&#46; Dietze"
                            2 => "C&#46;R&#46; Paula"
                            3 => "D&#46;A&#46; Da Matta"
                            4 => "A&#46;L&#46; Colombo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mycopathologia"
                        "fecha" => "2001"
                        "volumen" => "151"
                        "paginaInicial" => "5"
                        "paginaFinal" => "10"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11502064"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antifungal susceptibilities of <span class="elsevierStyleItalic">Candida</span> species causing vulvovaginitis and epidemiology of recurrent cases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46;S&#46; Richter"
                            1 => "R&#46;P&#46; Galask"
                            2 => "S&#46;A&#46; Messer"
                            3 => "R&#46;J&#46; Hollis"
                            4 => "D&#46;J&#46; Diekema"
                            5 => "M&#46;A&#46; Pfaller"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.43.5.2155-2162.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2005"
                        "volumen" => "43"
                        "paginaInicial" => "2155"
                        "paginaFinal" => "2162"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15872235"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "First molecular method for discriminating between <span class="elsevierStyleItalic">Candida africana</span>&#44; <span class="elsevierStyleItalic">Candida albicans</span>&#44; and <span class="elsevierStyleItalic">Candida dubliniensis</span> by using <span class="elsevierStyleItalic">hwp1</span> gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "O&#46; Romeo"
                            1 => "G&#46; Criseo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.diagmicrobio.2008.05.014"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diagn Microbiol Infect Dis"
                        "fecha" => "2008"
                        "volumen" => "62"
                        "paginaInicial" => "230"
                        "paginaFinal" => "233"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18640803"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Morphological&#44; biochemical and molecular characterisation of the first Italian <span class="elsevierStyleItalic">Candida africana</span> isolate"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "O&#46; Romeo"
                            1 => "G&#46; Criseo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1439-0507.2008.01630.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mycoses"
                        "fecha" => "2009"
                        "volumen" => "52"
                        "paginaInicial" => "454"
                        "paginaFinal" => "457"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18983430"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Candida africana and its closest relatives"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "O&#46; Romeo"
                            1 => "G&#46; Criseo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1439-0507.2010.01939.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mycoses"
                        "fecha" => "2011"
                        "volumen" => "54"
                        "paginaInicial" => "475"
                        "paginaFinal" => "486"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20667001"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular cloning&#58; a laboratory manual"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46; Sambrook"
                            1 => "E&#46;F&#46; Fritsch"
                            2 => "T&#46; Maniatis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:3 [
                        "fecha" => "1998"
                        "editorial" => "Cold Spring Harbor Laboratory Press"
                        "editorialLocalizacion" => "Cold Spring Harbor&#44; N&#46;Y&#46;"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cloning of <span class="elsevierStyleItalic">Candida albicans</span> genes conferring resistance to azole antifungal agents&#58; characterization of CDR2&#44; a new multidrug ABC transporter gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D&#46; Sanglard"
                            1 => "F&#46; Ischer"
                            2 => "M&#46; Monod"
                            3 => "J&#46; Bille"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1099/00221287-143-2-405"
                      "Revista" => array:7 [
                        "tituloSerie" => "Microbiology"
                        "fecha" => "1997"
                        "volumen" => "143"
                        "numero" => "Pt 2"
                        "paginaInicial" => "405"
                        "paginaFinal" => "416"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9043118"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46;M&#46; Selmecki"
                            1 => "K&#46; Dulmage"
                            2 => "L&#46;E&#46; Cowen"
                            3 => "J&#46;B&#46; Anderson"
                            4 => "J&#46; Berman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pgen.1000705"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS Genet"
                        "fecha" => "2009"
                        "volumen" => "5"
                        "paginaInicial" => "e1000705"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19876375"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Maintenance fluconazole therapy for recurrent vulvovaginal candidiasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:13 [
                            0 => "J&#46;D&#46; Sobel"
                            1 => "H&#46;C&#46; Wiesenfeld"
                            2 => "M&#46; Martens"
                            3 => "P&#46; Danna"
                            4 => "T&#46;M&#46; Hooton"
                            5 => "A&#46; Rompalo"
                            6 => "M&#46; Sperling"
                            7 => "C&#46; Livengood III"
                            8 => "B&#46; Horowitz"
                            9 => "T&#46;J&#46; Von"
                            10 => "L&#46; Edwards"
                            11 => "H&#46; Panzer"
                            12 => "T&#46;C&#46; Chu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa033114"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2004"
                        "volumen" => "351"
                        "paginaInicial" => "876"
                        "paginaFinal" => "883"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15329425"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Candida dubliniensis</span> sp&#46; nov&#46;&#58; phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "D&#46;J&#46; Sullivan"
                            1 => "T&#46;J&#46; Westerneng"
                            2 => "K&#46;A&#46; Haynes"
                            3 => "D&#46;E&#46; Bennett"
                            4 => "D&#46;C&#46; Coleman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1099/13500872-141-7-1507"
                      "Revista" => array:8 [
                        "tituloSerie" => "Microbiology"
                        "fecha" => "1995"
                        "volumen" => "141"
                        "numero" => "Pt 7"
                        "paginaInicial" => "1507"
                        "paginaFinal" => "1521"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7551019"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1198743X14603074"
                          "estado" => "S300"
                          "issn" => "1198743X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Candida africana sp&#46; nov&#46;&#44; a new human pathogen or a variant of <span class="elsevierStyleItalic">Candida albicans</span>&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46;J&#46; Tietz"
                            1 => "M&#46; Hopp"
                            2 => "A&#46; Schmalreck"
                            3 => "W&#46; Sterry"
                            4 => "V&#46; Czaika"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mycoses"
                        "fecha" => "2001"
                        "volumen" => "44"
                        "paginaInicial" => "437"
                        "paginaFinal" => "445"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11820255"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Phenotypic and genotypic characterization of unusual vaginal isolates of <span class="elsevierStyleItalic">Candida albicans</span> from Africa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46;J&#46; Tietz"
                            1 => "A&#46; Kussner"
                            2 => "M&#46; Thanos"
                            3 => "M&#46;P&#46; De Andrade"
                            4 => "W&#46; Presber"
                            5 => "G&#46; Schonian"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1995"
                        "volumen" => "33"
                        "paginaInicial" => "2462"
                        "paginaFinal" => "2465"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7494047"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of phenotypic markers for selection and identification of <span class="elsevierStyleItalic">Candida dubliniensis</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "K&#46; Tintelnot"
                            1 => "G&#46; Haase"
                            2 => "M&#46; Seibold"
                            3 => "F&#46; Bergmann"
                            4 => "M&#46; Staemmler"
                            5 => "T&#46; Franz"
                            6 => "D&#46; Naumann"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2000"
                        "volumen" => "38"
                        "paginaInicial" => "1599"
                        "paginaFinal" => "1608"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10747150"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical&#44; cellular&#44; and molecular factors that contribute to antifungal drug resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46;C&#46; White"
                            1 => "K&#46;A&#46; Marr"
                            2 => "R&#46;A&#46; Bowden"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Microbiol Rev"
                        "fecha" => "1998"
                        "volumen" => "11"
                        "paginaInicial" => "382"
                        "paginaFinal" => "402"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9564569"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46;J&#46; White"
                            1 => "T&#46;D&#46; Bruns"
                            2 => "S&#46;B&#46; Lee"
                            3 => "J&#46;W&#46; Taylor"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:4 [
                        "titulo" => "PCR protocols&#58; a guide to methods and applications"
                        "paginaInicial" => "315"
                        "paginaFinal" => "322"
                        "serieFecha" => "1998"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack209303"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0130" class="elsevierStylePara elsevierViewall">This work was financially supported in part by grants <span class="elsevierStyleGrantSponsor" id="gs1">CAI&#43;D prog&#46; RH</span> and <span class="elsevierStyleGrantSponsor" id="gs2">PEIS</span> 2011 both from Universidad Nacional del Litoral to G&#46;G&#46;E&#46; and S&#46;G&#46;&#44; respectively&#46; C&#46;D&#46; has a predoctoral fellowship from Consejo Nacional de Investigaciones Cient&#237;ficas y T&#233;cnicas &#40;CONICET&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03257541/0000004800000001/v1_201603250025/S0325754115001492/v1_201603250025/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "44540"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Agentes antimicrobianos"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03257541/0000004800000001/v1_201603250025/S0325754115001492/v1_201603250025/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754115001492?idApp=UINPBA00004N"
]

Article information

ISSN: 03257541
Original language: English

DOI:10.1016/j.ram.2015.10.003

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	5	3	8
2024 October	47	3	50
2024 September	68	16	84
2024 August	55	9	64
2024 July	46	10	56
2024 June	35	13	48
2024 May	23	10	33
2024 April	29	17	46
2024 March	41	17	58
2024 February	37	29	66
2024 January	33	16	49
2023 December	51	10	61
2023 November	68	12	80
2023 October	53	9	62
2023 September	34	3	37
2023 August	29	8	37
2023 July	21	10	31
2023 June	38	8	46
2023 May	46	13	59
2023 April	40	4	44
2023 March	20	8	28
2023 February	29	5	34
2023 January	32	18	50
2022 December	27	22	49
2022 November	42	28	70
2022 October	28	14	42
2022 September	52	10	62
2022 August	77	12	89
2022 July	101	11	112
2022 June	53	16	69
2022 May	80	36	116
2022 April	91	16	107
2022 March	135	23	158
2022 February	127	8	135
2022 January	105	10	115
2021 December	63	14	77
2021 November	78	16	94
2021 October	46	19	65
2021 September	34	20	54
2021 August	46	15	61
2021 July	63	16	79
2021 June	41	16	57
2021 May	40	13	53
2021 April	114	15	129
2021 March	54	14	68
2021 February	69	11	80
2021 January	58	15	73
2020 December	60	16	76
2020 November	53	17	70
2020 October	32	9	41
2020 September	45	11	56
2020 August	80	24	104
2020 July	59	15	74
2020 June	34	14	48
2020 May	62	6	68
2020 April	52	9	61
2020 March	75	9	84
2020 February	77	8	85
2020 January	63	7	70
2019 December	60	16	76
2019 November	91	16	107
2019 October	73	5	78
2019 September	97	17	114
2019 August	63	2	65
2019 July	58	17	75
2019 June	60	9	69
2019 May	88	39	127
2019 April	86	26	112
2019 March	32	9	41
2019 February	28	9	37
2019 January	29	6	35
2018 December	29	15	44
2018 November	36	8	44
2018 October	39	27	66
2018 September	38	15	53
2018 August	26	9	35
2018 July	9	5	14
2018 June	19	7	26
2018 May	27	8	35
2018 April	11	16	27
2018 March	16	5	21
2018 February	10	4	14
2018 January	24	9	33
2017 December	10	5	15
2017 November	31	14	45
2017 October	14	6	20
2017 September	17	17	34
2017 August	25	6	31
2017 July	23	7	30
2017 June	64	30	94
2017 May	25	10	35
2017 April	20	12	32
2017 March	27	56	83
2017 February	22	14	36
2017 January	32	18	50
2016 December	26	11	37
2016 November	34	14	48
2016 October	50	27	77
2016 September	55	31	86
2016 August	51	31	82
2016 July	55	19	74
2016 June	67	48	115
2016 May	48	54	102
2016 April	42	40	82
2016 March	5	6	11

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter