Rapid identification of new isolates of Acidipropionibacterium acidipropionici by fluorescence in situ hybridization (FISH)

array:24 ["pii" => "S0325754122000244" "issn" => "03257541" "doi" => "10.1016/j.ram.2022.02.006" "estado" => "S300" "fechaPublicacion" => "2022-10-01" "aid" => "490" "copyright" => "Asociación Argentina de Microbiología" "copyrightAnyo" => "2022" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2022;54:263-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S0325754122000311" "issn" => "03257541" "doi" => "10.1016/j.ram.2022.05.005" "estado" => "S300" "fechaPublicacion" => "2022-10-01" "aid" => "497" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Rev Argent Microbiol. 2022;54:268-81" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:14 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Human hookworms from Argentina: Differential diagnosis of Necator americanus and Ancylostoma duodenale in endemic populations from Buenos Aires and Misiones" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:3 [ 0 => "en" 1 => "en" 2 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "268" "paginaFinal" => "281" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Ancylostomideos humanos de Argentina: Diagnóstico diferencial de Necator americanus y Ancylostoma duodenale en poblaciones endémicas de Buenos Aires y Misiones" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2505 "Ancho" => 2925 "Tamanyo" => 589855 ] ] "descripcion" => array:1 [ "en" => "Heat-map distance matrix showing percentage (above diagonal) and number (below diagonal) of base differences per site based on pairwise comparison of the partial fragment of the cob gene among the sequences obtained in this study, and 4 sequences of available at the GenBank database. There was a total of 169 positions in the final dataset. Sequences obtained in the present study are in bold." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Andrea Servián, Silvia A. Repetto, María Lorena Zonta, Graciela T. Navone" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Andrea" "apellidos" => "Servián" ] 1 => array:2 [ "nombre" => "Silvia A." "apellidos" => "Repetto" ] 2 => array:2 [ "nombre" => "María" "apellidos" => "Lorena Zonta" ] 3 => array:2 [ "nombre" => "Graciela T." "apellidos" => "Navone" ] ] ] ] "resumen" => array:1 [ 0 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">•Microscopic and PCR methods may be used as complementary tools to diagnose hookworms.</li><li class="elsevierStyleListItem" id="lsti0010">•All hookworm infections in this study were caused by Necator americanus.</li><li class="elsevierStyleListItem" id="lsti0015">•This is the first study to provide molecular data on Necator americanus in Argentina.</li><li class="elsevierStyleListItem" id="lsti0020">•Imported hookworm infections found here highlight the importance of their assessment in non-endemic areas.</li></ul>" ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000311?idApp=UINPBA00004N" "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122000311/v1_202212150521/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0325754122001006" "issn" => "03257541" "doi" => "10.1016/j.ram.2022.11.001" "estado" => "S300" "fechaPublicacion" => "2022-10-01" "aid" => "520" "copyright" => "Asociación Argentina de Microbiología" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "sco" "cita" => "Rev Argent Microbiol. 2022;54:261-2" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "es" => array:10 [ "idiomaDefecto" => true "cabecera" => "Editorial" "titulo" => "Un patógeno fúngico emergente multirresistente en Argentina" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "261" "paginaFinal" => "262" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "An emergent multidrug resistant fungal pathogen in Argentina" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Norma B. Fernandez" "autores" => array:1 [ 0 => array:2 [ "nombre" => "Norma B." "apellidos" => "Fernandez" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122001006?idApp=UINPBA00004N" "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122001006/v1_202212150521/es/main.assets" ] "en" => array:22 [ "idiomaDefecto" => true "cabecera" => "Brief report" "titulo" => "Rapid identification of new isolates of Acidipropionibacterium acidipropionici by fluorescence in situ hybridization (FISH)" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "263" "paginaFinal" => "267" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Jaime Daniel Babot, Eloy Argañaraz-Martínez, María Cristina Apella, Adriana Perez Chaia" "autores" => array:4 [ 0 => array:3 [ "nombre" => "Jaime Daniel" "apellidos" => "Babot" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] ] ] 1 => array:4 [ "nombre" => "Eloy" "apellidos" => "Argañaraz-Martínez" "email" => array:1 [ 0 => "eloy.arganarazmartinez@fbqf.unt.edu.ar" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 2 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] 3 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 2 => array:3 [ "nombre" => "María Cristina" "apellidos" => "Apella" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 3 => array:4 [ "nombre" => "Adriana" "apellidos" => "Perez Chaia" "email" => array:1 [ 0 => "apchaia@cerela.org.ar" ] "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Centro de Referencia para Lactobacilos (CERELA-CCT NOA Sur-CONICET), Chacabuco 145, T4000ILC, San Miguel de Tucumán, Tucumán, Argentina" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Centro Científico Tecnológico NOA Sur – CONICET, Crisóstomo Álvarez 722, T4000ILC, San Miguel de Tucumán, Tucumán, Argentina" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Universidad Nacional de Tucumán, Ayacucho 491, T4000INI, San Miguel de Tucumán, Tucumán, Argentina" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding authors." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Identificación rápida de nuevos aislamientos de Acidipropionibacterium acidipropionici por hibridación fluorescente in situ (FISH)" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 827 "Ancho" => 800 "Tamanyo" => 13451 ] ] "descripcion" => array:1 [ "en" => "Microscopic field showing isolates VI detected with the FITC-labeled probe Pap446." ] ] ] "textoCompleto" => "Acidipropionibacterium acidipropionici is widely used for many applications, such as propionic acid and B12 vitamin production, and probiotics for animals<a class="elsevierStyleCrossRef" href="#bib0080">3</a> and humans<a class="elsevierStyleCrossRef" href="#bib0095">6</a>. Due to this plethora of applications, new isolates of A. acidipropionici with better features are being searched for from various sources. Several techniques can be used for their accurate identification. Nevertheless, when the number of isolates to be identified is high, most approaches become expensive and time-consuming. On the contrary, the fluorescence in situ hybridization (FISH) technique allows the inexpensive, reliable, and rapid identification of microorganisms in pure cultures, environmental and medical samples. FISH is based on the hybridization of fluorescently labeled probes to complementary 16S rRNA sequences in permeabilized microbial cells, allowing their location and identification<a class="elsevierStyleCrossRef" href="#bib0130">13</a>. Therefore, the aim of this work was to apply a fluorescent in situ hybridization probe for the reliable identification of new A. acidipropionici isolates from milk and feces of cowsThe presence of A. acidipropionici was investigated in milk and feces obtained from healthy Holstein dairy cows in a rural area of Tucumán (Argentina). For milk collection, the teat ends were disinfected with 70% ethanol and foremilk samples (n=10) were collected in sterile plastic tubes. Samples of cow manure (n=10) were aseptically transferred from the center of the dung into sterile plastic tubes. The samples were refrigerated and transported to the laboratory for immediate processing. The milk and manure samples were serially diluted in phosphate-buffered saline (130mmol/l NaCl, 10mmol/l sodium phosphate buffer, pH 7.4) (PBS) and plated onto modified Lactate agar [24ml/l sodium lactate (60% v/v), 30g/l casein peptone, 30g/l yeast extract, 125mM lithium chloride and 15g/l agar, pH 6.8]. The plates were incubated for ten days at 37°C in an anaerobic atmosphere provided by Anaerocult A (Merk, Germany) in an anaerobic jar (AnaeroGen system, Oxoid, UK). Convex and punctual colonies with creamy texture were transferred to LAPTg agar and incubated at 37°C for ten days in anaerobic conditions. Gram-positive cultures of short or filamentous rods in arrangements that resemble V, Y, or Chinese characters were selected and stored at −20°C in 10% (w/v) reconstituted non-fat milk supplemented with 15% glycerol. On the other hand, the following strains of dairy and intestinal origin belonging or not to the propionibacterium group were used as reference strains for FISH studies: A. acidipropionici LET 102, LET 103, LET 105, LET 107, LET 109 (intestinal origin), CRL1198, and ATCC 25562, A. jensenii CRL928, TL 219, TL 246, and TL 494, Propionibacterium freudenreichii CRL757, CRL758, TL 215, TL 253, TL 502, and TL 503, Streptococcus termophilus CRL 395 and CRL 396, Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus ATCC 15009 and ATCC 15807, and L. casei subsp. casei ATCC 393 (diary origin). All strains used as reference of A. acidipropionici species were previously identified by 16S rRNA gene sequencing, and their sequences are available in the database. All reference strains were stored in the same way as the selected isolates. Before use, the microorganisms used in this study were activated by three successive transfers in LAPTg broth incubated for 30h at 37°C.Three species-specific oligonucleotide probes were used in this study for FISH: Pap446<a class="elsevierStyleCrossRef" href="#bib0120">11</a>, Pj446<a class="elsevierStyleCrossRef" href="#bib0085">4</a>, and Pfr435<a class="elsevierStyleCrossRef" href="#bib0085">4</a>. The specificity of these probes was confirmed both in silico, using the Probe match function of the Ribosomal Database Project, and in vitro, using the reference strains described above. Probes Eub338 and Non338 were used as positive controls of the permeability of fixed cells for rRNA-targeted oligonucleotides and as a negative control, respectively, as indicated by Babot et al.<a class="elsevierStyleCrossRef" href="#bib0085">4</a>. The 5′ end 6-FAM labeled probes were purchased from Sigma–Aldrich (Argentina). Designations and sequences of all probes are indicated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>For bacterial cell fixation, 5ml of exponentially growing cultures were centrifuged (8000×g, 10min, 4°C), washed with 1ml of PBS, and resuspended in the original volume in the same solution. Cell suspensions were mixed 1:3 with cold paraformaldehyde solution (4% w/v in PBS) and incubated at 4°C for 16h. The cells were finally centrifuged (8000×g, 10min, 4°C), suspended in equal volumes of PBS and cold 96° ethanol, and stored at −20°C until use.Five microliters of fixed cells were spotted onto glass slides precleaned in an ethanolic 10% (w/v) KOH solution and coated with a solution of 0.1% (w/v) gelatine and 0.01% (w/v) KCr(SO4)2 as described by Blasco et al<a class="elsevierStyleCrossRef" href="#bib0090">5</a>. Cells were dried at 37°C for 30min and finally dehydrated for 3min in each 50, 80, and 96% (w/v) ethanol solution, successively. Cell smears were covered with 1mg/l lysozyme (Sigma–Aldrich, Argentina) and incubated for 10min at 25°C. The enzymatic treatment was stopped by rinsing the slides thoroughly with water. The slides were dried and dehydrated by successive immersion for 3min in each 50, 80, and 96% ethanol solution. Then, hybridization buffer (20mmol/l Tris/HCl pH 7.2–7.4, 0.9mol/l NaCl, 0.01% SDS) containing 5ng/μl of probe solution was added to the cell smears on the microscopic slides and incubated overnight at 50 (probe Pj446) or 45°C (probes Pap446 and Pfr435) in a humid chamber. After hybridization, each slide was flooded with preheated washing buffer (20mmol/l Tris/HCl pH 7.2–7.4, 0.9mol/l NaCl) and incubated for 1h at a temperature 5°C higher than that used for hybridization. After rinsing in sterile distilled water, the slides were air-dried and stored in the dark. All the slides were covered with mounting medium (Inova Diagnostics Inc., USA) and coverslips, and observed at 1000× magnification with a fluorescence microscope Carl Zeiss Axio Scope A1 fitted with Filter Sets 01 (excitation: 365nm; emission: 397nm), 09 (excitation: 450–490nm; emission: 515nm; appropriated for 6-FAM), and 15 (excitation: 546nm; emission: 590nm). The absence of autofluorescence of bacteria in all filters, as well as the lack of fluorescence of hybridized cells in Filter Sets 01 and 15, was carefully checked.To confirm the identity of isolates, DNA extraction for the propionibacterium group- and species-specific PCR was carried out according to Argañaraz-Martínez et al<a class="elsevierStyleCrossRef" href="#bib0075">2</a>. Primers PB1, PB2, PA, PJ, and PF<a class="elsevierStyleCrossRef" href="#bib0125">12</a> were used for PCR assays (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The reaction mixture (20μl) consisted of 1.5mmol/l MgCl2, 2μl of 10× reaction buffer, a 100μmol/l concentration of each dNTP, a 0.5μmol/l concentration of each primer, 1μl bacterial DNA, and 1U of recombinant Taq DNA polymerase (Invitrogen, Argentina). The PCR reactions were performed in a MyCycler device (Bio-Rad Laboratories, USA), according to Rossi et al.<a class="elsevierStyleCrossRef" href="#bib0125">12</a> with an annealing temperature of 60°C for the primer set PA-PB2 as the sole modification. The amplification products were separated by electrophoresis at 80V on 1.5% (w/v) agarose gel stained with SYBR® Safe DNA stain (Invitrogen, Argentina).The amplification of the 16S rDNA of isolates presumptively identified as A. acidipropionici was carried out according to Argañaraz-Martínez et al.<a class="elsevierStyleCrossRef" href="#bib0075">2</a> using primers 27F and 1492R (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The reaction mixture (50μl) consisted of 1.5mmol/l MgCl2, 5μl of 10× reaction buffer, 100μmol/l of each dNTP, 0.5μmol/l of each primer (27F and 1492R), 4μl bacterial DNA, and 1.5U of recombinant Taq DNA polymerase (Invitrogen, Argentina). The PCR reaction was performed in a MyCycler device (Bio-Rad Laboratories, USA). The amplification products were separated by electrophoresis at 80V on 0.8% (w/v) agarose stained with SYBR® Safe DNA Gel Stain (Invitrogen, Argentina), purified with 20% (w/v) polyethylene glycol (PEG8000, Sigma–Aldrich, Argentina) in 2.5mol/l NaCl solution, and sequenced at INTA-Castelar (Argentina) using a 3130xl Genetic Analyzer (Applied Biosystems, USA). The sequence fragments were assembled and edited using DNAMAN software (Version 4.03, Lynnon-Biosoft, Canada), and consensus sequences were compared to other 16S rDNA sequences in the EMBL/GenBank/DDBJ database using NCBI BLAST to determine their approximate phylogenetic affiliations. A phylogenetic tree was constructed using 16S rDNA sequences of type strains of Acidipropionibacterium and related genera with the tree builder function of PHYML<a class="elsevierStyleCrossRef" href="#bib0110">9</a> using the maximum likelihood method with 500 bootstrap iterations.Several culture media and strategies have been proposed for the selective isolation of members of the Propionibacterium group from diverse sources<a class="elsevierStyleCrossRef" href="#bib0100">7</a>. In our research group, the modified Lactate medium was successfully used for the isolation of A. acidipropionici and C. avidum strains from the intestinal content of chicks<a class="elsevierStyleCrossRef" href="#bib0075">2</a>. In the present study, eight convex and punctual colonies with a creamy texture resulting from independent samples were transferred from different modified Lactate agar plates to LAPTg agar plates. In this medium, the eight cultures thereby obtained were formed by Gram-positive short rods in arrangements that resemble V, Y, or Chinese characters. Three of these cultures (isolates I, II, and III) derived from milk, while the remaining cultures (isolates IV, V, VI, VII, and VIII) were obtained from feces. Propionibacteria are commonly isolated from cattle rumen and milk<a class="elsevierStyleCrossRef" href="#bib0105">8</a> and they have been detected in cattle feces by meta-genomics<a class="elsevierStyleCrossRef" href="#bib0115">10</a>. However, to our knowledge, there are no reports of A. acidipropionici strains isolated from this niche.With regard to the fluorescent in situ hybridization assay, all the reference strains and isolates hybridized with probe Eub338 and none of them with Non338. Moreover, among the species-specific probes, Pfr435 hybridized only with P. freudenreichii CRL758, CRL757, TL 215, TL 253, TL 502, and TL 503, Pj446 with A. jensenii CRL928, TL 219, TL 246, and TL 494, and Pap446 with A. acidipropionici CRL1198, ATCC 25562, LET 102, LET 103, LET 105, LET 107, and LET 109. These results showed that the hybridization was performed under adequate conditions and that probes Pap446, Pfr435, and Pj446 pair only with their targeted species. Besides Eub338, the isolates III and VI hybridized only with probe Pap446 (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 1</a>), which is specific for A. acidipropionici, while isolates I, II, IV, V, VII, and VIII failed to hybridize with all the species-specific probes used in this study. The FISH technique has been widely used for the in situ detection of different eukaryotic structures and microorganisms. However, this technique could also be applied for the rapid and affordable identification of pure cultures of bacteria, something especially useful when high numbers of isolates are studied<a class="elsevierStyleCrossRef" href="#bib0070">1</a>.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>To confirm the identity of isolates III and VI as A. acidipropionici, DNA from all the isolates and one reference strain for each propionibacterium species was extracted and amplified with propionibacterium group- and species-specific primers. The primer set PB1-PB2 produced 610bp amplicons from DNA of the reference strains and isolates III and VI, indicating that these isolates belong to the propionibacterium group. With regard to species-specific primers, 867 and 864bp amplicons were obtained for P. freudenreichii CRL758 and A. jensenii CRL928 with primer set PF-PB2 and PJ-PB2, respectively, while the primer set PA-PB2 in combination with DNA from A. acidipropionici CRL1198 and isolates III and VI produced 868bp amplicons. The size of the amplification products agreed with that reported by Rossi et al.<a class="elsevierStyleCrossRef" href="#bib0125">12</a> for A. acidipropionici. On the other hand, no amplification products were obtained with DNA from these isolates and the other primer sets studied. Moreover, DNA from isolates I, II, IV, V, VII, and VIII produced no amplification with neither of the primer sets used. Therefore, these isolates cannot be considered propionibacteria. Further studies are needed to identify these isolates, which showed remarkable features such as the ability to grow in the elective modified Lactate agar medium. Nevertheless, they exhibited growth kinetics (Supplementary Fig. 1), organic acid production (Supplementary Table 1), and carbohydrate fermentation patterns (Supplementary Table 2) clearly different from those of propionibacteria; therefore, these isolates could be ruled out as members of this group without the need of sequencing their 16S rDNA. Although useful for the phenotypic characterization of propionibacteria due to some distinctive features of these bacteria, these techniques are time-consuming and inconvenient when working with many isolates.To further confirm the identity of isolates III and VI, PCR amplification and sequencing of their 16S rDNA was performed. Thus, 1300–1500bp nucleotide sequences were obtained for these isolates and deposited in the EMBL Nucleotide Sequence Database (<a href="http://www.ebi.ac.uk/embl/Submission/index.htmL">http://www.ebi.ac.uk/embl/Submission/index.htmL</a>) under accession numbers MW048631 (isolate III, renamed as A. acidipropionici LET 110) and MW048632 (isolate VI, renamed as A. acidipropionici LET 111). The query sequences of A. acidipropionici LET 110 and LET 111 showed the highest BLAST scores (2590-2518; E-value 0.0) and 99% maximum identity with A. acidipropionici strains. Furthermore, the phylogenetic tree constructed including most species of the propionibacterium group (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 2</a>) showed a close relationship between A. acidipropionici LET 110 and LET 111 and the reference strain A. acidipropionici NCFB 570.<elsevierMultimedia ident="fig0015"></elsevierMultimedia>In conclusion, the fluorescence in situ hybridization protocol reported in this work led to the reliable, rapid, and affordable identification of two isolates obtained from cattle milk and feces as A. acidipropionici. The reliability of probe Pap446 was supported by accessory assays such as PCR with species-specific primers and 16S rDNA sequencing. To our knowledge, this is the first report of the isolation of A. acidipropionici from cow feces.FundingThis work was supported by Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) [grants number PIP 2015-0678 and PUE 2017-0035], Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT) [grants number PICT 2015-3714 and PICT 2016-0528], and Universidad Nacional de Tucumán (UNT) [grant number PIUNT D643/4].Conflicts of interestThe authors declare that they have no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:8 [ 0 => array:3 [ "identificador" => "xres1819620" "titulo" => "Highlights" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:3 [ "identificador" => "xres1819621" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 2 => array:2 [ "identificador" => "xpalclavsec1588100" "titulo" => "Keywords" ] 3 => array:3 [ "identificador" => "xres1819619" "titulo" => "Resumen" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0015" ] ] ] 4 => array:2 [ "identificador" => "xpalclavsec1588101" "titulo" => "Palabras clave" ] 5 => array:2 [ "identificador" => "sec0005" "titulo" => "Funding" ] 6 => array:2 [ "identificador" => "sec0010" "titulo" => "Conflicts of interest" ] 7 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-10-14" "fechaAceptado" => "2022-02-28" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1588100" "palabras" => array:3 [ 0 => "Acidipropionibacterium acidipropionici" 1 => "Fluorescence in situ hybridization" 2 => "Identification of bacteria" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1588101" "palabras" => array:3 [ 0 => "Acidipropionibacterium acidipropionici" 1 => "Hibridación fluorescente in situ" 2 => "Identificación de bacterias" ] ] ] ] "tieneResumen" => true "highlights" => array:2 [ "titulo" => "Highlights" "resumen" => "<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">•Two out of eight isolates obtained from cattle milk and feces showed characteristics of propionibacteria.</li><li class="elsevierStyleListItem" id="lsti0010">•Probe Pap446 identified two isolates as Acidipropionibacterium acidipropionici.</li><li class="elsevierStyleListItem" id="lsti0015">•The identity of these isolates was confirmed by molecular techniques.</li></ul>" ] "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "Acidipropionibacterium acidipropionici is widely used for many applications, such as propionic acid production, cereal silage, and also as probiotic. Due to this plethora of applications, new isolates of A. acidipropionici with improved features are being searched for. These new isolates must be accurately identified, however, most approaches become expensive and time-consuming when the number of isolates is high. On the contrary, fluorescence in situ hybridization allows the affordable, reliable, and rapid identification of microorganisms in pure cultures and environmental and medical samples. Therefore, the aim of this work was to apply a fluorescent in situ hybridization probe for the reliable identification of new A. acidipropionici isolates. To this end, probe Pap446, specific for A. acidipropionici, was validated by hybridization assays with strains of this species from different origins, other species of the same genus or family, and unrelated genera. Eight isolates with propionibacterium characteristics were obtained from milk and feces of cows. Probe Pap446, hybridized only with isolates III and VI. The identity of these isolates was further confirmed by PCR using group and species-specific primers for propionibacteria and 16S rDNA sequencing." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "Acidipropionibacterium acidipropionici es ampliamente usada para diversas aplicaciones, como producción de ácido propiónico, ensilado de cereales y probiótico. Debido a esta variedad de aplicaciones, continuamente se buscan nuevos aislamientos de A. acidipropionici con características nuevas. Estos nuevos aislamientos deben ser identificados correctamente, pero la mayoría de las técnicas disponibles resultan costosas e insumen mucho tiempo cuando el número de aislamientos es elevado. Por el contrario, la hibridación fluorescente in situ permite una identificación barata, confiabley rápida de microorganismos en cultivos puros y en muestras ambientales y médicas. Por lo tanto, el objetivo de este trabajo fue la aplicación de una sonda oligonucleotídica en un protocolo de hibridación fluorescente in situ para la identificación confiable de nuevos aislamientos de A. acidipropionici. Con este fin, se validó la sonda Pap446, específica de A. acidipropionici mediante ensayos de hibridación con cepas de esta especie de diferente origen, otras especies del mismo género o familia, y géneros no relacionados. Se obtuvieron ocho aislamientos con características de propionibacterias a partir de leche y heces de vacas. La sonda Pap446, hibridó únicamente con los aislamientos III y VI. La identidad de estos aislamientos fue confirmada a través de PCR con cebadores específicos para propionibacterias y para A. acidipropionici, y mediante secuenciación del ADNr 16S." ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "Both authors contributed equally to this work." "identificador" => "fn0005" ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following are the supplementary data to this article:<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="upi0005"></elsevierMultimedia><elsevierMultimedia ident="upi0010"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0020" ] ] ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 827 "Ancho" => 800 "Tamanyo" => 13451 ] ] "descripcion" => array:1 [ "en" => "Microscopic field showing isolates VI detected with the FITC-labeled probe Pap446." ] ] 1 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1713 "Ancho" => 1667 "Tamanyo" => 250595 ] ] "descripcion" => array:1 [ "en" => "Maximum likelihood tree of Acidipropionibacterium, Cutibacterium, Propionibacterium, and Pseudopropionibacterium species along with isolates A. acidipropionici LET 110 and LET 111. The tree was constructed using PHYML with 500 bootstrap iterations. Branch lengths are proportional to the number of substitutions per site (see scale bars)." ] ] 2 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n \t\t\t\t\ttable-head\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Probe \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Sequence (5′→3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col">Target species \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Temperature (°C)</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">H<a class="elsevierStyleCrossRef" href="#tblfn0005">a</a> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">W \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pap446 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACACCCCAAAACGATGCCTTCGCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A. acidipropionici \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">50 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pj446 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CACCCCGATAGGCACTTCGTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A. jensenii \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">50 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">55 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pfr435 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTGCGCTTCGTCATGGATGAAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">P. freudenreichii \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">50 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Eub338 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCTGCCTCCCGTAGGAGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Eubacteria \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Non338 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACTCCTACGGGAGGCAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">None \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Primer</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PB1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGTGGCGAAGGCGGTTCTCTGGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Acidipropionibacterium, Propionibacteria, and Cutibacterium \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PB2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TGGGGTCGAGTTGCAGACCCCAAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PF \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTTCATCCATGACGAAGCGCAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">P. freudenreichii \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PJ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GACGAAGTGCCTATCGGGGTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A. jensenii \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GACGAAGGCATTCTTTTAGGGTGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A. acidipropionici \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">27F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTGCTGCAGAGAGTTTGATCCTGGCTCAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Universal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1492R \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CACGGATCCTACGGGTACCTTGTTACGACTT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Universal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "Optimal temperature to obtain the highest hybridization signal. H: hybridization. W: washing." ] ] ] "descripcion" => array:1 [ "en" => "Sequence and bacteria targeting of oligonucleotide probes and primers used for FISH and PCR identification/16S RDA amplification, respectively." ] ] 3 => array:5 [ "identificador" => "upi0005" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc2.pdf" "ficheroTamanyo" => 11321 ] ] 4 => array:5 [ "identificador" => "upi0010" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc3.pdf" "ficheroTamanyo" => 123183 ] ] 5 => array:5 [ "identificador" => "fig0005" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => false "mostrarDisplay" => true "figura" => array:1 [ 0 => array:4 [ "imagen" => "mmc1.jpeg" "Alto" => 1691 "Ancho" => 2167 "Tamanyo" => 84486 ] ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:13 [ 0 => array:3 [ "identificador" => "bib0070" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The identification of microorganisms by fluorescence in situ hybridisation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Amann" 1 => "B.M. Fuchs" 2 => "S. Behrens" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0958-1669(00)00204-4" "Revista" => array:6 [ "tituloSerie" => "Curr Opin Biotechnol" "fecha" => "2001" "volumen" => "12" "paginaInicial" => "231" "paginaFinal" => "236" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11404099" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0075" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Physiological and functional characteristics of Propionibacterium strains of the poultry microbiota and relevance for the development of probiotic products" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "E. Argañaraz-Martínez" 1 => "J.D. Babot" 2 => "M.C. Apella" 3 => "A. Perez Chaia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.anaerobe.2013.08.001" "Revista" => array:6 [ "tituloSerie" => "Anaerobe" "fecha" => "2013" "volumen" => "23" "paginaInicial" => "27" "paginaFinal" => "37" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23973927" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0080" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Feed supplementation with avian Propionibacterium acidipropionici contributes to mucosa development in early stages of rearing broiler chickens" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "E. Argañaraz-Martínez" 1 => "J.D. Babot" 2 => "M.J. Lorenzo-Pisarello" 3 => "M.C. Apella" 4 => "A. Perez Chaia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3920/BM2016.0077" "Revista" => array:6 [ "tituloSerie" => "Benef Microbes" "fecha" => "2016" "volumen" => "7" "paginaInicial" => "687" "paginaFinal" => "698" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27680209" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0085" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Fluorescence in situ hybridization for detection of classical propionibacteria with specific 16S rRNA-targeted probes and its application to enumeration in Gruyere cheese" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.D. Babot" 1 => "M. Hidalgo" 2 => "E. Argañaraz-Martínez" 3 => "M.C. Apella" 4 => "A. Perez Chaia" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Int J Food Microbiol" "fecha" => "2011" "volumen" => "145" "paginaInicial" => "221" "paginaFinal" => "228" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0090" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development of specific fluorescent oligonucleotide probes for in situ identification of wine lactic acid bacteria" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L. Blasco" 1 => "S. Ferrer" 2 => "I. Pardo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0378-1097(03)00501-9" "Revista" => array:6 [ "tituloSerie" => "FEMS Microbiol Lett" "fecha" => "2003" "volumen" => "225" "paginaInicial" => "115" "paginaFinal" => "123" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12900029" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0095" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Stress induced biofilm formation in Propionibacterium acidipropionici and use in propionic acid production" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "V.H. Cavero-Olguin" 1 => "R. Hatti-Kaul" 2 => "O.V. Cardenas-Alegria" 3 => "M. Gutierrez-Valverde" 4 => "A. Alfaro-Flores" 5 => "D.X. Romero-Calle" 6 => "M.T. Alvarez-Aliaga" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11274-018-2566-9" "Revista" => array:6 [ "tituloSerie" => "World J Microbiol Biotechnol" "fecha" => "2019" "volumen" => "35" "paginaInicial" => "1" "paginaFinal" => "12" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30535777" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0100" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The genus Propionibacterium" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "C.S. Cummins" 1 => "J.L. Johnson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:5 [ "editores" => "A.Balows, H.G.Trüper, M.Dworkin, W.Harder, K.H.Schleifer" "titulo" => "The prokaryotes: a handbook on the biology of bacteria" "paginaInicial" => "834" "paginaFinal" => "849" "serieFecha" => "2013" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0105" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biodiversity of dairy Propionibacterium isolated from dairy farms in Minas Gerais, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "R. de Freitas" 1 => "V. Chuat" 2 => "M.N. Madec" 3 => "L.A. Nero" 4 => "A. Thierry" 5 => "F. Valence" 6 => "A.F. de Carvalho" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ijfoodmicro.2015.03.006" "Revista" => array:6 [ "tituloSerie" => "Int J Food Microbiol" "fecha" => "2015" "volumen" => "203" "paginaInicial" => "70" "paginaFinal" => "77" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25791252" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0110" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Guindon" 1 => "J.F. Dufayard" 2 => "V. Lefort" 3 => "M. Anisimova" 4 => "W. Hordijk" 5 => "O. Gascuel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/sysbio/syq010" "Revista" => array:6 [ "tituloSerie" => "Syst Biol" "fecha" => "2010" "volumen" => "59" "paginaInicial" => "307" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20525638" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0115" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A meta-analysis of bacterial diversity in the feces of cattle" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Kim" 1 => "J.E. Wells" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Curr Microbiol" "fecha" => "2016" "volumen" => "72" "paginaInicial" => "145" "paginaFinal" => "151" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0120" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Propionibacterium acidipropionici CRL1198 influences the production of acids and the growth of bacterial genera stimulated by inulin in a murine model of cecal slurries" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M.J. Lorenzo-Pisarello" 1 => "M.L. Gultemirian" 2 => "C. Nieto-Peñalver" 3 => "A. Perez Chaia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.anaerobe.2010.04.006" "Revista" => array:6 [ "tituloSerie" => "Anaerobe" "fecha" => "2010" "volumen" => "16" "paginaInicial" => "345" "paginaFinal" => "354" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20451635" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0125" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genus- and species-specific PCR based detection of diary propionibacteria in environmental simples by using primers targeted to the genes encoding 16S rRNA" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F. Rossi" 1 => "S. Torriani" 2 => "F. Dellaglio" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Appl Environ Microbiol" "fecha" => "1999" "volumen" => "65" "paginaInicial" => "4241" "paginaFinal" => "4244" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0130" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "FISH glossary: an overview of the fluorescence in situ hybridization technique" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E.V. Volpi" 1 => "J.M. Bridger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2144/000112811" "Revista" => array:6 [ "tituloSerie" => "Biotechniques" "fecha" => "2008" "volumen" => "45" "paginaInicial" => "385" "paginaFinal" => "409" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18855767" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122000244/v1_202212150521/en/main.assets" "Apartado" => array:4 [ "identificador" => "37863" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Microbiología básica" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/03257541/0000005400000004/v1_202212150521/S0325754122000244/v1_202212150521/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000244?idApp=UINPBA00004N"]

Statistics

Brief report

Identificación rápida de nuevos aislamientos de Acidipropionibacterium acidipropionici por hibridación fluorescente in situ (FISH)

Jaime Daniel Babota,b,1, Eloy Argañaraz-Martínezb,c,1,

Corresponding author

eloy.arganarazmartinez@fbqf.unt.edu.ar

Corresponding authors.

, María Cristina Apellaa,b,c, Adriana Perez Chaiaa,b,c,

Corresponding author

apchaia@cerela.org.ar

Corresponding authors.

a Centro de Referencia para Lactobacilos (CERELA-CCT NOA Sur-CONICET), Chacabuco 145, T4000ILC, San Miguel de Tucumán, Tucumán, Argentina

b Centro Científico Tecnológico NOA Sur – CONICET, Crisóstomo Álvarez 722, T4000ILC, San Miguel de Tucumán, Tucumán, Argentina

c Universidad Nacional de Tucumán, Ayacucho 491, T4000INI, San Miguel de Tucumán, Tucumán, Argentina

Read

1071

Times
was read the article

217

Total PDF

854

Total HTML

Share statistics

 array:24 [
  "pii" => "S0325754122000244"
  "issn" => "03257541"
  "doi" => "10.1016/j.ram.2022.02.006"
  "estado" => "S300"
  "fechaPublicacion" => "2022-10-01"
  "aid" => "490"
  "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Rev Argent Microbiol. 2022;54:263-7"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0325754122000311"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2022.05.005"
    "estado" => "S300"
    "fechaPublicacion" => "2022-10-01"
    "aid" => "497"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Rev Argent Microbiol. 2022;54:268-81"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:14 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Human hookworms from Argentina&#58; Differential diagnosis of <span class="elsevierStyleItalic">Necator americanus</span> and <span class="elsevierStyleItalic">Ancylostoma duodenale</span> in endemic populations from Buenos Aires and Misiones"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:3 [
        0 => "en"
        1 => "en"
        2 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "268"
          "paginaFinal" => "281"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Ancylostomideos humanos de Argentina&#58; Diagn&#243;stico diferencial de <span class="elsevierStyleItalic">Necator americanus</span> y <span class="elsevierStyleItalic">Ancylostoma duodenale</span> en poblaciones end&#233;micas de Buenos Aires y Misiones"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 2505
              "Ancho" => 2925
              "Tamanyo" => 589855
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Heat-map distance matrix showing percentage &#40;above diagonal&#41; and number &#40;below diagonal&#41; of base differences per site based on pairwise comparison of the partial fragment of the <span class="elsevierStyleItalic">cob</span> gene among the sequences obtained in this study&#44; and 4 sequences of available at the GenBank database&#46; There was a total of 169 positions in the final dataset&#46; Sequences obtained in the present study are in bold&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Andrea Servi&#225;n, Silvia A&#46; Repetto, Mar&#237;a Lorena Zonta, Graciela T&#46; Navone"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Andrea"
              "apellidos" => "Servi&#225;n"
            ]
            1 => array:2 [
              "nombre" => "Silvia A&#46;"
              "apellidos" => "Repetto"
            ]
            2 => array:2 [
              "nombre" => "Mar&#237;a"
              "apellidos" => "Lorena Zonta"
            ]
            3 => array:2 [
              "nombre" => "Graciela T&#46;"
              "apellidos" => "Navone"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8226;</span><p id="par0005" class="elsevierStylePara elsevierViewall">Microscopic and PCR methods may be used as complementary tools to diagnose hookworms&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#8226;</span><p id="par0010" class="elsevierStylePara elsevierViewall">All hookworm infections in this study were caused by <span class="elsevierStyleItalic">Necator americanus</span>&#46;</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#8226;</span><p id="par0015" class="elsevierStylePara elsevierViewall">This is the first study to provide molecular data on <span class="elsevierStyleItalic">Necator americanus</span> in Argentina&#46;</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">&#8226;</span><p id="par0020" class="elsevierStylePara elsevierViewall">Imported hookworm infections found here highlight the importance of their assessment in non-endemic areas&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000311?idApp=UINPBA00004N"
    "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122000311/v1_202212150521/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0325754122001006"
    "issn" => "03257541"
    "doi" => "10.1016/j.ram.2022.11.001"
    "estado" => "S300"
    "fechaPublicacion" => "2022-10-01"
    "aid" => "520"
    "copyright" => "Asociaci&#243;n Argentina de Microbiolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "sco"
    "cita" => "Rev Argent Microbiol. 2022;54:261-2"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:10 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Editorial</span>"
      "titulo" => "Un pat&#243;geno f&#250;ngico emergente multirresistente en Argentina"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "261"
          "paginaFinal" => "262"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "An emergent multidrug resistant fungal pathogen in Argentina"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Norma B&#46; Fernandez"
          "autores" => array:1 [
            0 => array:2 [
              "nombre" => "Norma B&#46;"
              "apellidos" => "Fernandez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122001006?idApp=UINPBA00004N"
    "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122001006/v1_202212150521/es/main.assets"
  ]
  "en" => array:22 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Brief report</span>"
    "titulo" => "Rapid identification of new isolates of <span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span> by fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization &#40;FISH&#41;"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "263"
        "paginaFinal" => "267"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Jaime Daniel Babot, Eloy Arga&#241;araz-Mart&#237;nez, Mar&#237;a Cristina Apella, Adriana Perez Chaia"
        "autores" => array:4 [
          0 => array:3 [
            "nombre" => "Jaime Daniel"
            "apellidos" => "Babot"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          1 => array:4 [
            "nombre" => "Eloy"
            "apellidos" => "Arga&#241;araz-Mart&#237;nez"
            "email" => array:1 [
              0 => "eloy.arganarazmartinez@fbqf.unt.edu.ar"
            ]
            "referencia" => array:4 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
              3 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Mar&#237;a Cristina"
            "apellidos" => "Apella"
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:4 [
            "nombre" => "Adriana"
            "apellidos" => "Perez Chaia"
            "email" => array:1 [
              0 => "apchaia@cerela.org.ar"
            ]
            "referencia" => array:4 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              3 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Centro de Referencia para Lactobacilos &#40;CERELA-CCT NOA Sur-CONICET&#41;&#44; Chacabuco 145&#44; T4000ILC&#44; San Miguel de Tucum&#225;n&#44; Tucum&#225;n&#44; Argentina"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Centro Cient&#237;fico Tecnol&#243;gico NOA Sur &#8211; CONICET&#44; Cris&#243;stomo &#193;lvarez 722&#44; T4000ILC&#44; San Miguel de Tucum&#225;n&#44; Tucum&#225;n&#44; Argentina"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Universidad Nacional de Tucum&#225;n&#44; Ayacucho 491&#44; T4000INI&#44; San Miguel de Tucum&#225;n&#44; Tucum&#225;n&#44; Argentina"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding authors&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Identificaci&#243;n r&#225;pida de nuevos aislamientos de <span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span> por hibridaci&#243;n fluorescente <span class="elsevierStyleItalic">in situ</span> &#40;FISH&#41;"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 827
            "Ancho" => 800
            "Tamanyo" => 13451
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Microscopic field showing isolates VI detected with the FITC-labeled probe Pap446&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0020" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span> is widely used for many applications&#44; such as propionic acid and B12 vitamin production&#44; and probiotics for animals<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">3</span></a> and humans<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">6</span></a>&#46; Due to this plethora of applications&#44; new isolates of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> with better features are being searched for from various sources&#46; Several techniques can be used for their accurate identification&#46; Nevertheless&#44; when the number of isolates to be identified is high&#44; most approaches become expensive and time-consuming&#46; On the contrary&#44; the fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization &#40;FISH&#41; technique allows the inexpensive&#44; reliable&#44; and rapid identification of microorganisms in pure cultures&#44; environmental and medical samples&#46; FISH is based on the hybridization of fluorescently labeled probes to complementary 16S rRNA sequences in permeabilized microbial cells&#44; allowing their location and identification<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">13</span></a>&#46; Therefore&#44; the aim of this work was to apply a fluorescent <span class="elsevierStyleItalic">in situ</span> hybridization probe for the reliable identification of new <span class="elsevierStyleItalic">A&#46; acidipropionici</span> isolates from milk and feces of cows</p><p id="par0025" class="elsevierStylePara elsevierViewall">The presence of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> was investigated in milk and feces obtained from healthy Holstein dairy cows in a rural area of Tucum&#225;n &#40;Argentina&#41;&#46; For milk collection&#44; the teat ends were disinfected with 70&#37; ethanol and foremilk samples &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#41; were collected in sterile plastic tubes&#46; Samples of cow manure &#40;n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#41; were aseptically transferred from the center of the dung into sterile plastic tubes&#46; The samples were refrigerated and transported to the laboratory for immediate processing&#46; The milk and manure samples were serially diluted in phosphate-buffered saline &#40;130<span class="elsevierStyleHsp" style=""></span>mmol&#47;l NaCl&#44; 10<span class="elsevierStyleHsp" style=""></span>mmol&#47;l sodium phosphate buffer&#44; pH 7&#46;4&#41; &#40;PBS&#41; and plated onto modified Lactate agar &#91;24<span class="elsevierStyleHsp" style=""></span>ml&#47;l sodium lactate &#40;60&#37; v&#47;v&#41;&#44; 30<span class="elsevierStyleHsp" style=""></span>g&#47;l casein peptone&#44; 30<span class="elsevierStyleHsp" style=""></span>g&#47;l yeast extract&#44; 125<span class="elsevierStyleHsp" style=""></span>mM lithium chloride and 15<span class="elsevierStyleHsp" style=""></span>g&#47;l agar&#44; pH 6&#46;8&#93;&#46; The plates were incubated for ten days at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in an anaerobic atmosphere provided by Anaerocult A &#40;Merk&#44; Germany&#41; in an anaerobic jar &#40;AnaeroGen system&#44; Oxoid&#44; UK&#41;&#46; Convex and punctual colonies with creamy texture were transferred to LAPTg agar and incubated at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for ten days in anaerobic conditions&#46; Gram-positive cultures of short or filamentous rods in arrangements that resemble V&#44; Y&#44; or Chinese characters were selected and stored at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C in 10&#37; &#40;w&#47;v&#41; reconstituted non-fat milk supplemented with 15&#37; glycerol&#46; On the other hand&#44; the following strains of dairy and intestinal origin belonging or not to the propionibacterium group were used as reference strains for FISH studies&#58; <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 102&#44; LET 103&#44; LET 105&#44; LET 107&#44; LET 109 &#40;intestinal origin&#41;&#44; CRL1198&#44; and ATCC 25562&#44; <span class="elsevierStyleItalic">A&#46; jensenii</span> CRL928&#44; TL 219&#44; TL 246&#44; and TL 494&#44; <span class="elsevierStyleItalic">Propionibacterium freudenreichii</span> CRL757&#44; CRL758&#44; TL 215&#44; TL 253&#44; TL 502&#44; and TL 503&#44; <span class="elsevierStyleItalic">Streptococcus termophilus</span> CRL 395 and CRL 396&#44; <span class="elsevierStyleItalic">Lactobacillus delbrueckii</span> subsp&#46; <span class="elsevierStyleItalic">bulgaricus</span> ATCC 11842&#44; <span class="elsevierStyleItalic">L&#46; helveticus</span> ATCC 15009 and ATCC 15807&#44; and <span class="elsevierStyleItalic">L&#46; casei</span> subsp&#46; <span class="elsevierStyleItalic">casei</span> ATCC 393 &#40;diary origin&#41;&#46; All strains used as reference of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> species were previously identified by 16S rRNA gene sequencing&#44; and their sequences are available in the database&#46; All reference strains were stored in the same way as the selected isolates&#46; Before use&#44; the microorganisms used in this study were activated by three successive transfers in LAPTg broth incubated for 30<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>&#176;C&#46;</p><p id="par0030" class="elsevierStylePara elsevierViewall">Three species-specific oligonucleotide probes were used in this study for FISH&#58; Pap446<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">11</span></a>&#44; Pj446<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">4</span></a>&#44; and Pfr435<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">4</span></a>&#46; The specificity of these probes was confirmed both <span class="elsevierStyleItalic">in silico</span>&#44; using the Probe match function of the Ribosomal Database Project&#44; and <span class="elsevierStyleItalic">in vitro</span>&#44; using the reference strains described above&#46; Probes Eub338 and Non338 were used as positive controls of the permeability of fixed cells for rRNA-targeted oligonucleotides and as a negative control&#44; respectively&#44; as indicated by Babot et al&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">4</span></a>&#46; The 5&#8242; end 6-FAM labeled probes were purchased from Sigma&#8211;Aldrich &#40;Argentina&#41;&#46; Designations and sequences of all probes are indicated in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">For bacterial cell fixation&#44; 5<span class="elsevierStyleHsp" style=""></span>ml of exponentially growing cultures were centrifuged &#40;8000<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span>&#44; 10<span class="elsevierStyleHsp" style=""></span>min&#44; 4<span class="elsevierStyleHsp" style=""></span>&#176;C&#41;&#44; washed with 1<span class="elsevierStyleHsp" style=""></span>ml of PBS&#44; and resuspended in the original volume in the same solution&#46; Cell suspensions were mixed 1&#58;3 with cold paraformaldehyde solution &#40;4&#37; w&#47;v in PBS&#41; and incubated at 4<span class="elsevierStyleHsp" style=""></span>&#176;C for 16<span class="elsevierStyleHsp" style=""></span>h&#46; The cells were finally centrifuged &#40;8000<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">g</span>&#44; 10<span class="elsevierStyleHsp" style=""></span>min&#44; 4<span class="elsevierStyleHsp" style=""></span>&#176;C&#41;&#44; suspended in equal volumes of PBS and cold 96&#176; ethanol&#44; and stored at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C until use&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">Five microliters of fixed cells were spotted onto glass slides precleaned in an ethanolic 10&#37; &#40;w&#47;v&#41; KOH solution and coated with a solution of 0&#46;1&#37; &#40;w&#47;v&#41; gelatine and 0&#46;01&#37; &#40;w&#47;v&#41; KCr&#40;SO<span class="elsevierStyleInf">4</span>&#41;<span class="elsevierStyleInf">2</span> as described by Blasco et al<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">5</span></a>&#46; Cells were dried at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>min and finally dehydrated for 3<span class="elsevierStyleHsp" style=""></span>min in each 50&#44; 80&#44; and 96&#37; &#40;w&#47;v&#41; ethanol solution&#44; successively&#46; Cell smears were covered with 1<span class="elsevierStyleHsp" style=""></span>mg&#47;l lysozyme &#40;Sigma&#8211;Aldrich&#44; Argentina&#41; and incubated for 10<span class="elsevierStyleHsp" style=""></span>min at 25<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The enzymatic treatment was stopped by rinsing the slides thoroughly with water&#46; The slides were dried and dehydrated by successive immersion for 3<span class="elsevierStyleHsp" style=""></span>min in each 50&#44; 80&#44; and 96&#37; ethanol solution&#46; Then&#44; hybridization buffer &#40;20<span class="elsevierStyleHsp" style=""></span>mmol&#47;l Tris&#47;HCl pH 7&#46;2&#8211;7&#46;4&#44; 0&#46;9<span class="elsevierStyleHsp" style=""></span>mol&#47;l NaCl&#44; 0&#46;01&#37; SDS&#41; containing 5<span class="elsevierStyleHsp" style=""></span>ng&#47;&#956;l of probe solution was added to the cell smears on the microscopic slides and incubated overnight at 50 &#40;probe Pj446&#41; or 45<span class="elsevierStyleHsp" style=""></span>&#176;C &#40;probes Pap446 and Pfr435&#41; in a humid chamber&#46; After hybridization&#44; each slide was flooded with preheated washing buffer &#40;20<span class="elsevierStyleHsp" style=""></span>mmol&#47;l Tris&#47;HCl pH 7&#46;2&#8211;7&#46;4&#44; 0&#46;9<span class="elsevierStyleHsp" style=""></span>mol&#47;l NaCl&#41; and incubated for 1<span class="elsevierStyleHsp" style=""></span>h at a temperature 5<span class="elsevierStyleHsp" style=""></span>&#176;C higher than that used for hybridization&#46; After rinsing in sterile distilled water&#44; the slides were air-dried and stored in the dark&#46; All the slides were covered with mounting medium &#40;Inova Diagnostics Inc&#46;&#44; USA&#41; and coverslips&#44; and observed at 1000&#215; magnification with a fluorescence microscope Carl Zeiss Axio Scope A1 fitted with Filter Sets 01 &#40;excitation&#58; 365<span class="elsevierStyleHsp" style=""></span>nm&#59; emission&#58; 397<span class="elsevierStyleHsp" style=""></span>nm&#41;&#44; 09 &#40;excitation&#58; 450&#8211;490<span class="elsevierStyleHsp" style=""></span>nm&#59; emission&#58; 515<span class="elsevierStyleHsp" style=""></span>nm&#59; appropriated for 6-FAM&#41;&#44; and 15 &#40;excitation&#58; 546<span class="elsevierStyleHsp" style=""></span>nm&#59; emission&#58; 590<span class="elsevierStyleHsp" style=""></span>nm&#41;&#46; The absence of autofluorescence of bacteria in all filters&#44; as well as the lack of fluorescence of hybridized cells in Filter Sets 01 and 15&#44; was carefully checked&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall">To confirm the identity of isolates&#44; DNA extraction for the propionibacterium group- and species-specific PCR was carried out according to Arga&#241;araz-Mart&#237;nez et al<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">2</span></a>&#46; Primers PB1&#44; PB2&#44; PA&#44; PJ&#44; and PF<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">12</span></a> were used for PCR assays &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; The reaction mixture &#40;20<span class="elsevierStyleHsp" style=""></span>&#956;l&#41; consisted of 1&#46;5<span class="elsevierStyleHsp" style=""></span>mmol&#47;l MgCl<span class="elsevierStyleInf">2</span>&#44; 2<span class="elsevierStyleHsp" style=""></span>&#956;l of 10&#215; reaction buffer&#44; a 100<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;l concentration of each dNTP&#44; a 0&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;l concentration of each primer&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;l bacterial DNA&#44; and 1<span class="elsevierStyleHsp" style=""></span>U of recombinant <span class="elsevierStyleItalic">Taq</span> DNA polymerase &#40;Invitrogen&#44; Argentina&#41;&#46; The PCR reactions were performed in a MyCycler device &#40;Bio-Rad Laboratories&#44; USA&#41;&#44; according to Rossi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">12</span></a> with an annealing temperature of 60<span class="elsevierStyleHsp" style=""></span>&#176;C for the primer set PA-PB2 as the sole modification&#46; The amplification products were separated by electrophoresis at 80<span class="elsevierStyleHsp" style=""></span>V on 1&#46;5&#37; &#40;w&#47;v&#41; agarose gel stained with SYBR&#174; Safe DNA stain &#40;Invitrogen&#44; Argentina&#41;&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">The amplification of the 16S rDNA of isolates presumptively identified as <span class="elsevierStyleItalic">A&#46; acidipropionici</span> was carried out according to Arga&#241;araz-Mart&#237;nez et al&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">2</span></a> using primers 27F and 1492R &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; The reaction mixture &#40;50<span class="elsevierStyleHsp" style=""></span>&#956;l&#41; consisted of 1&#46;5<span class="elsevierStyleHsp" style=""></span>mmol&#47;l MgCl<span class="elsevierStyleInf">2</span>&#44; 5<span class="elsevierStyleHsp" style=""></span>&#956;l of 10&#215; reaction buffer&#44; 100<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;l of each dNTP&#44; 0&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;l of each primer &#40;27F and 1492R&#41;&#44; 4<span class="elsevierStyleHsp" style=""></span>&#956;l bacterial DNA&#44; and 1&#46;5<span class="elsevierStyleHsp" style=""></span>U of recombinant Taq DNA polymerase &#40;Invitrogen&#44; Argentina&#41;&#46; The PCR reaction was performed in a MyCycler device &#40;Bio-Rad Laboratories&#44; USA&#41;&#46; The amplification products were separated by electrophoresis at 80<span class="elsevierStyleHsp" style=""></span>V on 0&#46;8&#37; &#40;w&#47;v&#41; agarose stained with SYBR&#174; Safe DNA Gel Stain &#40;Invitrogen&#44; Argentina&#41;&#44; purified with 20&#37; &#40;w&#47;v&#41; polyethylene glycol &#40;PEG8000&#44; Sigma&#8211;Aldrich&#44; Argentina&#41; in 2&#46;5<span class="elsevierStyleHsp" style=""></span>mol&#47;l NaCl solution&#44; and sequenced at INTA-Castelar &#40;Argentina&#41; using a 3130xl Genetic Analyzer &#40;Applied Biosystems&#44; USA&#41;&#46; The sequence fragments were assembled and edited using DNAMAN software &#40;Version 4&#46;03&#44; Lynnon-Biosoft&#44; Canada&#41;&#44; and consensus sequences were compared to other 16S rDNA sequences in the EMBL&#47;GenBank&#47;DDBJ database using NCBI BLAST to determine their approximate phylogenetic affiliations&#46; A phylogenetic tree was constructed using 16S rDNA sequences of type strains of <span class="elsevierStyleItalic">Acidipropionibacterium</span> and related genera with the tree builder function of PHYML<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">9</span></a> using the maximum likelihood method with 500 bootstrap iterations&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">Several culture media and strategies have been proposed for the selective isolation of members of the <span class="elsevierStyleItalic">Propionibacterium</span> group from diverse sources<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">7</span></a>&#46; In our research group&#44; the modified Lactate medium was successfully used for the isolation of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> and <span class="elsevierStyleItalic">C&#46; avidum</span> strains from the intestinal content of chicks<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">2</span></a>&#46; In the present study&#44; eight convex and punctual colonies with a creamy texture resulting from independent samples were transferred from different modified Lactate agar plates to LAPTg agar plates&#46; In this medium&#44; the eight cultures thereby obtained were formed by Gram-positive short rods in arrangements that resemble V&#44; Y&#44; or Chinese characters&#46; Three of these cultures &#40;isolates I&#44; II&#44; and III&#41; derived from milk&#44; while the remaining cultures &#40;isolates IV&#44; V&#44; VI&#44; VII&#44; and VIII&#41; were obtained from feces&#46; Propionibacteria are commonly isolated from cattle rumen and milk<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">8</span></a> and they have been detected in cattle feces by meta-genomics<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">10</span></a>&#46; However&#44; to our knowledge&#44; there are no reports of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> strains isolated from this niche&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">With regard to the fluorescent <span class="elsevierStyleItalic">in situ</span> hybridization assay&#44; all the reference strains and isolates hybridized with probe Eub338 and none of them with Non338&#46; Moreover&#44; among the species-specific probes&#44; Pfr435 hybridized only with <span class="elsevierStyleItalic">P&#46; freudenreichii</span> CRL758&#44; CRL757&#44; TL 215&#44; TL 253&#44; TL 502&#44; and TL 503&#44; Pj446 with <span class="elsevierStyleItalic">A&#46; jensenii</span> CRL928&#44; TL 219&#44; TL 246&#44; and TL 494&#44; and Pap446 with <span class="elsevierStyleItalic">A&#46; acidipropionici</span> CRL1198&#44; ATCC 25562&#44; LET 102&#44; LET 103&#44; LET 105&#44; LET 107&#44; and LET 109&#46; These results showed that the hybridization was performed under adequate conditions and that probes Pap446&#44; Pfr435&#44; and Pj446 pair only with their targeted species&#46; Besides Eub338&#44; the isolates III and VI hybridized only with probe Pap446 &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 1</a>&#41;&#44; which is specific for <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#44; while isolates I&#44; II&#44; IV&#44; V&#44; VII&#44; and VIII failed to hybridize with all the species-specific probes used in this study&#46; The FISH technique has been widely used for the <span class="elsevierStyleItalic">in situ</span> detection of different eukaryotic structures and microorganisms&#46; However&#44; this technique could also be applied for the rapid and affordable identification of pure cultures of bacteria&#44; something especially useful when high numbers of isolates are studied<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">1</span></a>&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0065" class="elsevierStylePara elsevierViewall">To confirm the identity of isolates III and VI as <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#44; DNA from all the isolates and one reference strain for each propionibacterium species was extracted and amplified with propionibacterium group- and species-specific primers&#46; The primer set PB1-PB2 produced 610<span class="elsevierStyleHsp" style=""></span>bp amplicons from DNA of the reference strains and isolates III and VI&#44; indicating that these isolates belong to the propionibacterium group&#46; With regard to species-specific primers&#44; 867 and 864<span class="elsevierStyleHsp" style=""></span>bp amplicons were obtained for <span class="elsevierStyleItalic">P&#46; freudenreichii</span> CRL758 and <span class="elsevierStyleItalic">A&#46; jensenii</span> CRL928 with primer set PF-PB2 and PJ-PB2&#44; respectively&#44; while the primer set PA-PB2 in combination with DNA from <span class="elsevierStyleItalic">A&#46; acidipropionici</span> CRL1198 and isolates III and VI produced 868<span class="elsevierStyleHsp" style=""></span>bp amplicons&#46; The size of the amplification products agreed with that reported by Rossi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">12</span></a> for <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#46; On the other hand&#44; no amplification products were obtained with DNA from these isolates and the other primer sets studied&#46; Moreover&#44; DNA from isolates I&#44; II&#44; IV&#44; V&#44; VII&#44; and VIII produced no amplification with neither of the primer sets used&#46; Therefore&#44; these isolates cannot be considered propionibacteria&#46; Further studies are needed to identify these isolates&#44; which showed remarkable features such as the ability to grow in the elective modified Lactate agar medium&#46; Nevertheless&#44; they exhibited growth kinetics &#40;Supplementary Fig&#46; 1&#41;&#44; organic acid production &#40;Supplementary Table 1&#41;&#44; and carbohydrate fermentation patterns &#40;Supplementary Table 2&#41; clearly different from those of propionibacteria&#59; therefore&#44; these isolates could be ruled out as members of this group without the need of sequencing their 16S rDNA&#46; Although useful for the phenotypic characterization of propionibacteria due to some distinctive features of these bacteria&#44; these techniques are time-consuming and inconvenient when working with many isolates&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">To further confirm the identity of isolates III and VI&#44; PCR amplification and sequencing of their 16S rDNA was performed&#46; Thus&#44; 1300&#8211;1500<span class="elsevierStyleHsp" style=""></span>bp nucleotide sequences were obtained for these isolates and deposited in the EMBL Nucleotide Sequence Database &#40;<a href="http://www.ebi.ac.uk/embl/Submission/index.htmL"><span class="elsevierStyleUnderline">http&#58;&#47;&#47;www&#46;ebi&#46;ac&#46;uk&#47;embl&#47;Submission&#47;index&#46;htmL</span></a>&#41; under accession numbers MW048631 &#40;isolate III&#44; renamed as <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 110&#41; and MW048632 &#40;isolate VI&#44; renamed as <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 111&#41;&#46; The query sequences of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 110 and LET 111 showed the highest BLAST scores &#40;2590-2518&#59; E-value 0&#46;0&#41; and 99&#37; maximum identity with <span class="elsevierStyleItalic">A&#46; acidipropionici</span> strains&#46; Furthermore&#44; the phylogenetic tree constructed including most species of the propionibacterium group &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 2</a>&#41; showed a close relationship between <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 110 and LET 111 and the reference strain <span class="elsevierStyleItalic">A&#46; acidipropionici</span> NCFB 570&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0075" class="elsevierStylePara elsevierViewall">In conclusion&#44; the fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization protocol reported in this work led to the reliable&#44; rapid&#44; and affordable identification of two isolates obtained from cattle milk and feces as <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#46; The reliability of probe Pap446 was supported by accessory assays such as PCR with species-specific primers and 16S rDNA sequencing&#46; To our knowledge&#44; this is the first report of the isolation of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> from cow feces&#46;</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Funding</span><p id="par0080" class="elsevierStylePara elsevierViewall">This work was supported by <span class="elsevierStyleGrantSponsor" id="gs1">Consejo Nacional de Investigaciones Cient&#237;ficas y T&#233;cnicas</span> &#40;CONICET&#41; &#91;grants number <span class="elsevierStyleGrantNumber" refid="gs1">PIP 2015-0678</span> and <span class="elsevierStyleGrantNumber" refid="gs1">PUE 2017-0035</span>&#93;&#44; <span class="elsevierStyleGrantSponsor" id="gs2">Agencia Nacional de Promoci&#243;n Cient&#237;fica y Tecnol&#243;gica</span> &#40;ANPCyT&#41; &#91;grants number <span class="elsevierStyleGrantNumber" refid="gs2">PICT 2015-3714</span> and <span class="elsevierStyleGrantNumber" refid="gs2">PICT 2016-0528</span>&#93;&#44; and <span class="elsevierStyleGrantSponsor" id="gs3">Universidad Nacional de Tucum&#225;n</span> &#40;UNT&#41; &#91;grant number <span class="elsevierStyleGrantNumber" refid="gs3">PIUNT D643&#47;4</span>&#93;&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conflicts of interest</span><p id="par0085" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:8 [
        0 => array:3 [
          "identificador" => "xres1819620"
          "titulo" => "Highlights"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:3 [
          "identificador" => "xres1819621"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0010"
            ]
          ]
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1588100"
          "titulo" => "Keywords"
        ]
        3 => array:3 [
          "identificador" => "xres1819619"
          "titulo" => "Resumen"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0015"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1588101"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Funding"
        ]
        6 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Conflicts of interest"
        ]
        7 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-10-14"
    "fechaAceptado" => "2022-02-28"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1588100"
          "palabras" => array:3 [
            0 => "<span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span>"
            1 => "Fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization"
            2 => "Identification of bacteria"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1588101"
          "palabras" => array:3 [
            0 => "<span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span>"
            1 => "Hibridaci&#243;n fluorescente <span class="elsevierStyleItalic">in situ</span>"
            2 => "Identificaci&#243;n de bacterias"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "highlights" => array:2 [
      "titulo" => "Highlights"
      "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8226;</span><p id="par0005" class="elsevierStylePara elsevierViewall">Two out of eight isolates obtained from cattle milk and feces showed characteristics of propionibacteria&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#8226;</span><p id="par0010" class="elsevierStylePara elsevierViewall">Probe Pap446 identified two isolates as <span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#8226;</span><p id="par0015" class="elsevierStylePara elsevierViewall">The identity of these isolates was confirmed by molecular techniques&#46;</p></li></ul></p></span>"
    ]
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span> is widely used for many applications&#44; such as propionic acid production&#44; cereal silage&#44; and also as probiotic&#46; Due to this plethora of applications&#44; new isolates of <span class="elsevierStyleItalic">A&#46; acidipropionici</span> with improved features are being searched for&#46; These new isolates must be accurately identified&#44; however&#44; most approaches become expensive and time-consuming when the number of isolates is high&#46; On the contrary&#44; fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization allows the affordable&#44; reliable&#44; and rapid identification of microorganisms in pure cultures and environmental and medical samples&#46; Therefore&#44; the aim of this work was to apply a fluorescent <span class="elsevierStyleItalic">in situ</span> hybridization probe for the reliable identification of new <span class="elsevierStyleItalic">A&#46; acidipropionici</span> isolates&#46; To this end&#44; probe Pap446&#44; specific for <span class="elsevierStyleItalic">A&#46; acidipropionici&#44;</span> was validated by hybridization assays with strains of this species from different origins&#44; other species of the same genus or family&#44; and unrelated genera&#46; Eight isolates with propionibacterium characteristics were obtained from milk and feces of cows&#46; Probe Pap446&#44; hybridized only with isolates III and VI&#46; The identity of these isolates was further confirmed by PCR using group and species-specific primers for propionibacteria and 16S rDNA sequencing&#46;</p></span>"
      ]
      "es" => array:2 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0015" class="elsevierStyleSection elsevierViewall"><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Acidipropionibacterium acidipropionici</span> es ampliamente usada para diversas aplicaciones&#44; como producci&#243;n de &#225;cido propi&#243;nico&#44; ensilado de cereales y probi&#243;tico&#46; Debido a esta variedad de aplicaciones&#44; continuamente se buscan nuevos aislamientos de <span class="elsevierStyleItalic">A&#46; acidipropionici</span> con caracter&#237;sticas nuevas&#46; Estos nuevos aislamientos deben ser identificados correctamente&#44; pero la mayor&#237;a de las t&#233;cnicas disponibles resultan costosas e insumen mucho tiempo cuando el n&#250;mero de aislamientos es elevado&#46; Por el contrario&#44; la hibridaci&#243;n fluorescente <span class="elsevierStyleItalic">in situ</span> permite una identificaci&#243;n barata&#44; confiable</p><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">y r&#225;pida de microorganismos en cultivos puros y en muestras ambientales y m&#233;dicas&#46; Por lo tanto&#44; el objetivo de este trabajo fue la aplicaci&#243;n de una sonda oligonucleot&#237;dica en un protocolo de hibridaci&#243;n fluorescente <span class="elsevierStyleItalic">in situ</span> para la identificaci&#243;n confiable de nuevos aislamientos de <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#46; Con este fin&#44; se valid&#243; la sonda Pap446&#44; espec&#237;fica de <span class="elsevierStyleItalic">A&#46; acidipropionici</span> mediante ensayos de hibridaci&#243;n con cepas de esta especie de diferente origen&#44; otras especies del mismo g&#233;nero o familia&#44; y g&#233;neros no relacionados&#46; Se obtuvieron ocho aislamientos con caracter&#237;sticas de propionibacterias a partir de leche y heces de vacas&#46; La sonda Pap446&#44; hibrid&#243; &#250;nicamente con los aislamientos III y VI&#46; La identidad de estos aislamientos fue confirmada a trav&#233;s de PCR con cebadores espec&#237;ficos para propionibacterias y para <span class="elsevierStyleItalic">A&#46; acidipropionici</span>&#44; y mediante secuenciaci&#243;n del ADNr 16S&#46;</p></span>"
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Both authors contributed equally to this work&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0095" class="elsevierStylePara elsevierViewall">The following are the supplementary data to this article&#58;<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="upi0005"></elsevierMultimedia><elsevierMultimedia ident="upi0010"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0020"
          ]
        ]
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 827
            "Ancho" => 800
            "Tamanyo" => 13451
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Microscopic field showing isolates VI detected with the FITC-labeled probe Pap446&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1713
            "Ancho" => 1667
            "Tamanyo" => 250595
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Maximum likelihood tree of <span class="elsevierStyleItalic">Acidipropionibacterium</span>&#44; <span class="elsevierStyleItalic">Cutibacterium</span>&#44; <span class="elsevierStyleItalic">Propionibacterium</span>&#44; and <span class="elsevierStyleItalic">Pseudopropionibacterium</span> species along with isolates <span class="elsevierStyleItalic">A&#46; acidipropionici</span> LET 110 and LET 111&#46; The tree was constructed using PHYML with 500 bootstrap iterations&#46; Branch lengths are proportional to the number of substitutions per site &#40;see scale bars&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Probe&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Sequence &#40;5&#8242;<span class="elsevierStyleHsp" style=""></span>&#8594;<span class="elsevierStyleHsp" style=""></span>3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Target species&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Temperature &#40;&#176;C&#41;</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">H<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">W&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Pap446</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACACCCCAAAACGATGCCTTCGCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">A&#46; acidipropionici</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Pj446</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CACCCCGATAGGCACTTCGTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">A&#46; jensenii</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Pfr435</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTGCGCTTCGTCATGGATGAAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">P&#46; freudenreichii</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Eub338</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCTGCCTCCCGTAGGAGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Eubacteria&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Non338</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACTCCTACGGGAGGCAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">None&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="5" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="5" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Primer</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>PB1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGTGGCGAAGGCGGTTCTCTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Acidipropionibacterium</span>&#44; Propionibacteria&#44; and <span class="elsevierStyleItalic">Cutibacterium</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>PB2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGGGTCGAGTTGCAGACCCCAAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>PF&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTTCATCCATGACGAAGCGCAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">P&#46; freudenreichii</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>PJ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GACGAAGTGCCTATCGGGGTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">A&#46; jensenii</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>PA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GACGAAGGCATTCTTTTAGGGTGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">A&#46; acidipropionici</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>27F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTGCTGCAGAGAGTTTGATCCTGGCTCAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Universal&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>1492R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CACGGATCCTACGGGTACCTTGTTACGACTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Universal&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Optimal temperature to obtain the highest hybridization signal&#46; H&#58; hybridization&#46; W&#58; washing&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Sequence and bacteria targeting of oligonucleotide probes and primers used for FISH and PCR identification&#47;16S RDA amplification&#44; respectively&#46;</p>"
        ]
      ]
      3 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc2.pdf"
          "ficheroTamanyo" => 11321
        ]
      ]
      4 => array:5 [
        "identificador" => "upi0010"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc3.pdf"
          "ficheroTamanyo" => 123183
        ]
      ]
      5 => array:5 [
        "identificador" => "fig0005"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "mmc1.jpeg"
            "Alto" => 1691
            "Ancho" => 2167
            "Tamanyo" => 84486
          ]
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:13 [
            0 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The identification of microorganisms by fluorescence <span class="elsevierStyleItalic">in situ</span> hybridisation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46; Amann"
                            1 => "B&#46;M&#46; Fuchs"
                            2 => "S&#46; Behrens"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0958-1669(00)00204-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Opin Biotechnol"
                        "fecha" => "2001"
                        "volumen" => "12"
                        "paginaInicial" => "231"
                        "paginaFinal" => "236"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11404099"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Physiological and functional characteristics of <span class="elsevierStyleItalic">Propionibacterium</span> strains of the poultry microbiota and relevance for the development of probiotic products"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "E&#46; Arga&#241;araz-Mart&#237;nez"
                            1 => "J&#46;D&#46; Babot"
                            2 => "M&#46;C&#46; Apella"
                            3 => "A&#46; Perez Chaia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.anaerobe.2013.08.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Anaerobe"
                        "fecha" => "2013"
                        "volumen" => "23"
                        "paginaInicial" => "27"
                        "paginaFinal" => "37"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23973927"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Feed supplementation with avian <span class="elsevierStyleItalic">Propionibacterium acidipropionici</span> contributes to mucosa development in early stages of rearing broiler chickens"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "E&#46; Arga&#241;araz-Mart&#237;nez"
                            1 => "J&#46;D&#46; Babot"
                            2 => "M&#46;J&#46; Lorenzo-Pisarello"
                            3 => "M&#46;C&#46; Apella"
                            4 => "A&#46; Perez Chaia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3920/BM2016.0077"
                      "Revista" => array:6 [
                        "tituloSerie" => "Benef Microbes"
                        "fecha" => "2016"
                        "volumen" => "7"
                        "paginaInicial" => "687"
                        "paginaFinal" => "698"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27680209"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization for detection of classical propionibacteria with specific 16S rRNA-targeted probes and its application to enumeration in Gruyere cheese"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;D&#46; Babot"
                            1 => "M&#46; Hidalgo"
                            2 => "E&#46; Arga&#241;araz-Mart&#237;nez"
                            3 => "M&#46;C&#46; Apella"
                            4 => "A&#46; Perez Chaia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Int J Food Microbiol"
                        "fecha" => "2011"
                        "volumen" => "145"
                        "paginaInicial" => "221"
                        "paginaFinal" => "228"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Development of specific fluorescent oligonucleotide probes for <span class="elsevierStyleItalic">in situ</span> identification of wine lactic acid bacteria"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L&#46; Blasco"
                            1 => "S&#46; Ferrer"
                            2 => "I&#46; Pardo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0378-1097(03)00501-9"
                      "Revista" => array:6 [
                        "tituloSerie" => "FEMS Microbiol Lett"
                        "fecha" => "2003"
                        "volumen" => "225"
                        "paginaInicial" => "115"
                        "paginaFinal" => "123"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12900029"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Stress induced biofilm formation in <span class="elsevierStyleItalic">Propionibacterium acidipropionici</span> and use in propionic acid production"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "V&#46;H&#46; Cavero-Olguin"
                            1 => "R&#46; Hatti-Kaul"
                            2 => "O&#46;V&#46; Cardenas-Alegria"
                            3 => "M&#46; Gutierrez-Valverde"
                            4 => "A&#46; Alfaro-Flores"
                            5 => "D&#46;X&#46; Romero-Calle"
                            6 => "M&#46;T&#46; Alvarez-Aliaga"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11274-018-2566-9"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Microbiol Biotechnol"
                        "fecha" => "2019"
                        "volumen" => "35"
                        "paginaInicial" => "1"
                        "paginaFinal" => "12"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30535777"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The genus Propionibacterium"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46;S&#46; Cummins"
                            1 => "J&#46;L&#46; Johnson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:5 [
                        "editores" => "A&#46;Balows, H&#46;G&#46;Tr&#252;per, M&#46;Dworkin, W&#46;Harder, K&#46;H&#46;Schleifer"
                        "titulo" => "The prokaryotes&#58; a handbook on the biology of bacteria"
                        "paginaInicial" => "834"
                        "paginaFinal" => "849"
                        "serieFecha" => "2013"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biodiversity of dairy <span class="elsevierStyleItalic">Propionibacterium</span> isolated from dairy farms in Minas Gerais&#44; Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "R&#46; de Freitas"
                            1 => "V&#46; Chuat"
                            2 => "M&#46;N&#46; Madec"
                            3 => "L&#46;A&#46; Nero"
                            4 => "A&#46; Thierry"
                            5 => "F&#46; Valence"
                            6 => "A&#46;F&#46; de Carvalho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ijfoodmicro.2015.03.006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Food Microbiol"
                        "fecha" => "2015"
                        "volumen" => "203"
                        "paginaInicial" => "70"
                        "paginaFinal" => "77"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25791252"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New algorithms and methods to estimate maximum-likelihood phylogenies&#58; assessing the performance of PhyML 3&#46;0"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46; Guindon"
                            1 => "J&#46;F&#46; Dufayard"
                            2 => "V&#46; Lefort"
                            3 => "M&#46; Anisimova"
                            4 => "W&#46; Hordijk"
                            5 => "O&#46; Gascuel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/sysbio/syq010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Syst Biol"
                        "fecha" => "2010"
                        "volumen" => "59"
                        "paginaInicial" => "307"
                        "paginaFinal" => "321"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20525638"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A meta-analysis of bacterial diversity in the feces of cattle"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Kim"
                            1 => "J&#46;E&#46; Wells"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Curr Microbiol"
                        "fecha" => "2016"
                        "volumen" => "72"
                        "paginaInicial" => "145"
                        "paginaFinal" => "151"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Propionibacterium acidipropionici</span> CRL1198 influences the production of acids and the growth of bacterial genera stimulated by inulin in a murine model of cecal slurries"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46;J&#46; Lorenzo-Pisarello"
                            1 => "M&#46;L&#46; Gultemirian"
                            2 => "C&#46; Nieto-Pe&#241;alver"
                            3 => "A&#46; Perez Chaia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.anaerobe.2010.04.006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Anaerobe"
                        "fecha" => "2010"
                        "volumen" => "16"
                        "paginaInicial" => "345"
                        "paginaFinal" => "354"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20451635"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genus- and species-specific PCR based detection of diary propionibacteria in environmental simples by using primers targeted to the genes encoding 16S rRNA"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "F&#46; Rossi"
                            1 => "S&#46; Torriani"
                            2 => "F&#46; Dellaglio"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Appl Environ Microbiol"
                        "fecha" => "1999"
                        "volumen" => "65"
                        "paginaInicial" => "4241"
                        "paginaFinal" => "4244"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "FISH glossary&#58; an overview of the fluorescence <span class="elsevierStyleItalic">in situ</span> hybridization technique"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "E&#46;V&#46; Volpi"
                            1 => "J&#46;M&#46; Bridger"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2144/000112811"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biotechniques"
                        "fecha" => "2008"
                        "volumen" => "45"
                        "paginaInicial" => "385"
                        "paginaFinal" => "409"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18855767"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03257541/0000005400000004/v1_202212150521/S0325754122000244/v1_202212150521/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "37863"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Microbiolog&#237;a b&#225;sica"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03257541/0000005400000004/v1_202212150521/S0325754122000244/v1_202212150521/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0325754122000244?idApp=UINPBA00004N"
]

Article information

ISSN: 03257541
Original language: English

DOI:10.1016/j.ram.2022.02.006

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	2	2	4
2024 October	55	5	60
2024 September	46	9	55
2024 August	54	5	59
2024 July	50	1	51
2024 June	31	3	34
2024 May	35	2	37
2024 April	42	7	49
2024 March	41	3	44
2024 February	59	5	64
2024 January	86	10	96
2023 December	37	5	42
2023 November	34	6	40
2023 October	61	11	72
2023 September	33	3	36
2023 August	37	13	50
2023 July	27	8	35
2023 June	21	5	26
2023 May	18	6	24
2023 April	14	1	15
2023 March	12	12	24
2023 February	16	13	29
2023 January	19	8	27
2022 December	24	9	33
2022 November	0	9	9
2022 October	0	4	4
2022 September	0	22	22
2022 August	0	20	20
2022 July	0	5	5
2022 June	0	5	5

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter