Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil

array:23 ["pii" => "S1130140611000611" "issn" => "11301406" "doi" => "10.1016/j.riam.2011.05.003" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "136" "copyright" => "Revista Iberoamericana de Micología" "copyrightAnyo" => "2010" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Rev Iberoam Micol. 2012;29:40-3" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3127 "formatos" => array:3 [ "EPUB" => 49 "HTML" => 2501 "PDF" => 577 ] ] "itemSiguiente" => array:18 [ "pii" => "S1130140611000805" "issn" => "11301406" "doi" => "10.1016/j.riam.2011.06.010" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "146" "copyright" => "Revista Iberoamericana de Micología" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Rev Iberoam Micol. 2012;29:44-6" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 6057 "formatos" => array:3 [ "EPUB" => 48 "HTML" => 5504 "PDF" => 505 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Note" "titulo" => "Phaeohyphomycosis caused by Alternaria infectoria presenting as multiple vegetating lesions in a renal transplant patient" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "44" "paginaFinal" => "46" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Feohifomicosis producida por Alternaria infectoria con presentación clínica de múltiples lesiones vegetantes en un paciente sometido a un trasplante renal" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 713 "Ancho" => 950 "Tamanyo" => 207707 ] ] "descripcion" => array:1 [ "en" => "Microscopic examination following lactophenol blue staining (magnification ×1500)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Daniela Cunha, Cristina Amaro, María Raquel Vieira, María da Luz Martins, Ana Paula Maduro, João Inácio, Ana Afonso, Gabriela Marques Pinto, Jorge Cardoso" "autores" => array:9 [ 0 => array:2 [ "nombre" => "Daniela" "apellidos" => "Cunha" ] 1 => array:2 [ "nombre" => "Cristina" "apellidos" => "Amaro" ] 2 => array:2 [ "nombre" => "María Raquel" "apellidos" => "Vieira" ] 3 => array:2 [ "nombre" => "María da Luz" "apellidos" => "Martins" ] 4 => array:2 [ "nombre" => "Ana Paula" "apellidos" => "Maduro" ] 5 => array:2 [ "nombre" => "João" "apellidos" => "Inácio" ] 6 => array:2 [ "nombre" => "Ana" "apellidos" => "Afonso" ] 7 => array:2 [ "nombre" => "Gabriela Marques" "apellidos" => "Pinto" ] 8 => array:2 [ "nombre" => "Jorge" "apellidos" => "Cardoso" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000805?idApp=UINPBA00004N" "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000805/v1_201305061404/en/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S1130140611000428" "issn" => "11301406" "doi" => "10.1016/j.riam.2011.03.008" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "129" "copyright" => "Revista Iberoamericana de Micología" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Rev Iberoam Micol. 2012;29:34-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3567 "formatos" => array:3 [ "EPUB" => 49 "HTML" => 2963 "PDF" => 555 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Selection and optimization of PCR-based methods for the detection of Histoplasma capsulatum var. capsulatum" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "34" "paginaFinal" => "39" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Selección y optimización de los métodos basados en PCR para la detección de Histoplasma capsulatum var. capsulatum" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1727 "Ancho" => 1417 "Tamanyo" => 213033 ] ] "descripcion" => array:1 [ "en" => "Influence of the reagents’ concentrations in the PCR products obtained in optimization experiments." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ivanete De Lima Sampaio, Ana Karla Lima Freire, Mauricio Morishi Ogusko, Júlia Ignez Salem, João Vicente Braga De Souza" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Ivanete" "apellidos" => "De Lima Sampaio" ] 1 => array:2 [ "nombre" => "Ana Karla" "apellidos" => "Lima Freire" ] 2 => array:2 [ "nombre" => "Mauricio" "apellidos" => "Morishi Ogusko" ] 3 => array:2 [ "nombre" => "Júlia" "apellidos" => "Ignez Salem" ] 4 => array:2 [ "nombre" => "João Vicente" "apellidos" => "Braga De Souza" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000428?idApp=UINPBA00004N" "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000428/v1_201305061404/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "40" "paginaFinal" => "43" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Babbyngttonn Khell Da Silva, Ana Karla Freire, Amaury Dos Santos Bentes, Ivanete De Lima Sampaio, Lucilaide Oliveira Santos, Mirlane Silva Dos Santos, João Vicente De Souza" "autores" => array:7 [ 0 => array:3 [ "nombre" => "Babbyngttonn" "apellidos" => "Khell Da Silva" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Ana Karla" "apellidos" => "Freire" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Amaury" "apellidos" => "Dos Santos Bentes" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Ivanete" "apellidos" => "De Lima Sampaio" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 4 => array:3 [ "nombre" => "Lucilaide" "apellidos" => "Oliveira Santos" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 5 => array:3 [ "nombre" => "Mirlane" "apellidos" => "Silva Dos Santos" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 6 => array:4 [ "nombre" => "João Vicente" "apellidos" => "De Souza" "email" => array:1 [ 0 => "joaovicentebragasouza@yahoo.com.br" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "¿" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Fundação de Medicina Tropical do Amazonas, Manaus, AM, Brazil" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Instituto Nacional de Pesquisas da Amazônia, Manaus, AM, Brazil" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Caracterización de aislamientos clínicos del complejo Cryptococcus neoformans-Cryptococcus gattii, del Estado Amazonas - Brasil" ] ] "textoCompleto" => "Cryptococcosis is an opportunistic fungal disease caused by the encapsulated yeast species Cryptococcus neoformans and Cryptococcus gattii.<a class="elsevierStyleCrossRef" href="#bib0085">17</a> The infection is acquired by the inhalation of desiccated yeasts or spores and can develop to the brain or other systemic organs.<a class="elsevierStyleCrossRef" href="#bib0090">18</a> Infection with Cryptococcus spp. is the major cause of fungal meningitis in immunocompromised patients, resulting in elevated morbidity and mortality rates.<a class="elsevierStyleCrossRef" href="#bib0105">21</a> Furthermore, immunocompromised status is the most common risk factor for infection with C. neoformans. Additionally, there are increasing numbers of immunocompetent patients with fungal meningitis who are infected with C. gattii.<a class="elsevierStyleCrossRefs" href="#bib0105">21,32</a> The preferred treatment for cryptococcal meningitis is amphotericin B, but a side effect of the drug manifested by nephrotoxicity limits its clinical use and increases the importance of antifungal susceptibility testing.<a class="elsevierStyleCrossRefs" href="#bib0050">10,12</a>Based on serological studies, using antibodies against the fungal capsule, seven serotypes of Cryptococcus have been identified: A, B, C, D, AB, AD and BD.<a class="elsevierStyleCrossRefs" href="#bib0015">3,5,20</a>C. neoformans serotypes A, D and AD are found in cities, whereas the C. gattii serotypes B and C are predominately localised in tropical and subtropical regions.<a class="elsevierStyleCrossRefs" href="#bib0005">1,13,19</a> In 1999 an outbreak of C. gattii occurred in Canada, raising the possibility that this species could be localised in both tropical and temperate climates.<a class="elsevierStyleCrossRef" href="#bib0055">11</a>In addition to the serotypes of C. neoformans and C. gatti, molecular analyses, including M13 fingerprinting, URA5-RFLP (Restriction Fragment Length Polymorphism) and AFLP (Amplified Fragment Length Polymorphism), have identified 8 molecular genotypes: VNI and VNII (Serotype A); VNIII (Hybrid AD); VNIV (Serotype D); and VGI, VGII, VGIII and VGIV (Serotypes B and C).<a class="elsevierStyleCrossRef" href="#bib0085">17</a> Molecular genotyping contributes to better and more accurate clinical diagnoses and characterizes genetic diversity for global epidemiological studies.<a class="elsevierStyleCrossRef" href="#bib0120">24</a>The aim of this work was to characterize forty Cryptococcus isolates from patients at the Tropical Medicine Foundation of Amazonas (FMTAM) during 2006–2008 by using phenotypic and molecular biological experiments.1Materials and methods1.1Isolates and strainsForty isolates were obtained from patients with cryptococcal infection who were hospitalized in FMTAM between March 2006 and February 2008. A single sample was collected from each patient and stored at 4°C in the FMTAM fungal collection. They were grown on Sabouraud agar at 30°C for 48h. For molecular genotyping, the following standard strains were used: WM 148 (serotype A,VNI), WM 626 (serotype A, VNII), WM 628 (serotype AD, VNIII), WM 629 (serotype D, VNIV), WM 179 (serotype B, VGI), WM 178 (serotype B, VGII), WM 161 (serotype B, VGIII) and WM 779 (serotype C, VGIV). These reference strains were kindly provided by the fungal collection at FIOCRUZ-Rio de Janeiro-Brazil. Also, the reference strains WM 148 and WM 178 were used as reference strains for l-canavanine glycine bromothymol blue (CGB) species determination, enzyme production and susceptibility assays using antifungal agents.1.2Patient informationThe epidemiological profile of the patients (age, sex, immunological status and residence) was obtained by analysis of the examination requisition.1.3Identification of the speciesCGB agar was utilized to differentiate the species C. neoformans and C. gattii as previously described.<a class="elsevierStyleCrossRef" href="#bib0065">13</a>C. gattii strains use the glycine in the media as a source of carbon and nitrogen, are resistant to canavanine and produce a blue cobalt colour during incubation, whereas C. neoformans do not exhibit any colour change in the media.1.4Enzyme quantificationThe production of proteinases and phospholipases were measured as previously described.<a class="elsevierStyleCrossRefs" href="#bib0115">23,25,33</a> The fungal isolates were inoculated at equidistant points on plates of proteinase agar and phospholipase agar, and the enzyme activity (Pz) was calculated using the relation between the diameter of the colony (dc) and the diameter of the colony and precipitation zone (dcp). The results were classified as negative (Pz=1), positive (0.64≥Pz<1) or strongly positive (Pz<0.64).1.5Susceptibility to antifungal agentsSusceptibility tests were performed according to the Clinical and Laboratory Standards Institute (CLSI) document M44-A.<a class="elsevierStyleCrossRef" href="#bib0020">4</a> Disks impregnated with fluconazole (25μg), itraconazole (10μg) or amphotericin B (100μg) (Cecon-Sensifungidisc, São Paulo, Brazil) were used in the assays. The diameter of the inhibition haloes was used to determine the susceptibility of the yeast to the antifungal compounds. Cut-off values were as follows: Amphotericin B>10mm – susceptible (S), <10mm –resistant (R); itraconazol >20mm – S, 19–12mm – intermediate (I), <1mm – R and fluconazole >19mm – S; 19–14mm – I; <14mm – R. The determination of the MIC for amphotericin B was performed using the E-test-AB BIODISK method as described previously.<a class="elsevierStyleCrossRef" href="#bib0070">14</a>1.6Characterization of molecular genotypesThe genotypic characterization was carried out as described previously.<a class="elsevierStyleCrossRef" href="#bib0085">17</a> Fungal DNA was extracted with the QIAamp tissue kit (Qiagen, Germany) according to the manufacturer's protocol for DNA extraction from yeast, including digestion with lyticase and RNAase. PCR of the URA5 gene was conducted in a final volume of 50μL, and each reaction contained 50ng of DNA, 1× PCR buffer (10mM Tris–HCl, pH 8.3, 50mM KCl and 1.5mM MgCl2); 0.2mM each of dATP, dCTP, dGTP and dTTP; 3mM magnesium acetate; 1.5U AmpliTaq DNA polymerase (Invitrogen, Carlsbad, California) and 50ng of each primer URA5 (5′ATGTCCTCCCAAGCCCTCGACTCCG3′) and SJ01 (5′TTAAGACCTCTGAACACCGTACTC3′). The PCR was performed in a PerkinElmer thermal cycler (model 480) for 35 cycles of a 2min initial denaturation at 94°C, 45s denaturation at 94°C, 1min annealing at 61°C and 2min extension at 72°C, followed by a final extension cycle for 10min at 72°C. The PCR products were double digested with Sau96I (10U/μL) and HhaI (20U/μL) for 3h or overnight and separated by 3% agarose gel electrophoresis at 100V for 5h.2ResultsThe epidemiological characteristics of the patients with cryptococcosis were evaluated. Males were more commonly infected (70%) than females, and the age group most affected was between 16 and 30 years (53%; median=28.5 years) (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The majority of patients with cryptococcosis were also infected with HIV (72%) and resided in the east zone of the city of Manaus (25%) (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). Cerebrospinal fluid (CSF) was collected for the isolation of the fungal agents from most patients (93%). Isolates were inoculated on a CGB medium; 9 were positive for the presence of C. gattii, and 31 were positive for C. neoformans.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>All of the isolates had high protease production (Pz<0.64) and an average Pz=0.3 for both Cryptococcus species. All but 1 isolate was positive for the production of phospholipase (average Pz=0.53). Twenty-six C. neoformans isolates (83.8%) presented strong positive results (Pz<0.64), and 4 isolates (12.9%) presented positive results (Pz≥0.64 and < 1.0), whereas all 9 isolates of C. gattii were classified as strong-positive producers of phospholipase.Using the disk diffusion test (CLSI M44-A), 81, 35 and 100% of the isolates of C. neoformans were identified as susceptible to fluconazole, itraconazole and amphotericin B, respectively, and 78%, 56% and 100% of the isolates of C. gattii were susceptible to these antifungal compounds (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>). The average MIC for amphotericin B, evaluated by E-test methodology, was 0.26±0.22μg/mL for C. neoformans and 0.58±0.53μg/mL for C. gattii.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>DNA was extracted from all clinical isolates and was used to identify the molecular genotypes by URA5-RFLP. All 9 isolates of C. gattii possessed a fingerprint pattern consistent with the VGII molecular genotype, and all 31 isolates of C. neoformans had the profile of the VNI molecular type.3DiscussionThe total number of the inhabitants in the state of Amazonas is approximately 3.5×106 and according to the Mycology Service of the Foundation of Tropical Medicine of Manaus, 20–25 new cases of cryptococcosis occur annually in the region. Manaus, the capital of Amazonas State, is located near the centre of the Amazon Basin on the left bank of the Rio Negro, consisting of Tertiary sediments on sandy-clay land. The region has an average rainfall of 2300mm/year and is thus associated with a hot and humid climate and lush vegetation.<a class="elsevierStyleCrossRef" href="#bib0155">31</a> In this study, the incidence of cryptococcosis was not related to these weather patterns, as the number of isolates was similar throughout the year. The identification of potential environmental sources of C. neoformans and C. gatii that are introduced into the human population requires further investigation. It is hypothesise that the sources of contamination are similar to those described in other countries: human infection with the Cryptoccocus type VNI primarily occurs from contact with bird faeces, and infection with the VGII type usually occurs following contact with decomposing vegetal biomass.This is one of the first studies to characterise cryptococcosis in the Amazonas State in Brazil. This study determined that the patients most affected by cryptococcosis were male, young (16–30 years old), HIV-positive and inhabitants of the east zone of the city of Manaus.The number of cases of HIV/AIDS reported annually in the Amazonas State is approximately 700, half of them receive HAART treatment.<a class="elsevierStyleCrossRef" href="#bib0150">30</a> AIDS is the most important risk factor for cryptococcosis, due to the suppression of immune responses by the HIV virus.<a class="elsevierStyleCrossRefs" href="#bib0045">9,13,26</a>C. neoformans was the species most frequently isolated (n=31; 77.5%), which is consistent with the 82.3% reported in the literature.<a class="elsevierStyleCrossRefs" href="#bib0085">17,19</a>C. neoformans almost exclusively causes disease in immunocompromised patients, and the majority of the isolates that we obtained came from patients with AIDS.<a class="elsevierStyleCrossRefs" href="#bib0085">17,19</a> Among the nine C. gattii isolates, three were obtained from immunocompetent patients, four from AIDS patients and two from patients without documented immune status.In this study, we obtained three isolates from children aged 0–15 years. C. gattii was the primary causative agent of meningitis in these patients. In a previous study in the Amazonas State from 1988 to 1998, Martins<a class="elsevierStyleCrossRef" href="#bib0075">15</a> reported that the frequency of cryptococcosis in children represented 33% of the total cases. In the Pará state, neighbouring the Amazonas State, 19–24% of cryptococcosis cases were reported in children over the last 10 years.<a class="elsevierStyleCrossRefs" href="#bib0140">28,29</a> These studies demonstrate that in the Amazon Rainforest, the prevalence of cryptococcosis in children is high and is also associated with the molecular type VGII. Further epidemiological studies and environmental sampling are necessary to define the importance of the environmental conditions in the incidence of cryptococcosis cases in children.The production of lipases and proteases is related to the virulence of Cryptococcus pathogenic species.<a class="elsevierStyleCrossRefs" href="#bib0035">7,8</a> These enzymes are involved in the destruction of cellular structures to both obtain nutrients for the fungal pathogens and to facilitate spread throughout tissues. Both C. neoformans and C. gattii produced proteases and lipases in similar quantities, and no difference was observed between molecular types.Antifungal cryptococcosis testing showed 80% and 77% susceptibility to fluconazole in C. neoformans and C. gattii, respectively. This maintenance drug is commonly used in patients with AIDS to prevent opportunistic fungal diseases, and the emergence of resistant strains has been described.<a class="elsevierStyleCrossRefs" href="#bib0030">6,9</a>C. neoformans and C. gattii had 35% and 55% susceptibility to itraconozole, respectively, and all of the clinical isolates were susceptible to amphotericin B. These results are consistent with previous studies.<a class="elsevierStyleCrossRefs" href="#bib0070">14,22,27</a> Amphotericin B is considered to be the gold standard for cryptococcosis treatment.<a class="elsevierStyleCrossRef" href="#bib0010">2</a> In one study, amphotericin B resistance was reported in 10% of clinical isolates,<a class="elsevierStyleCrossRef" href="#bib0025">5</a> but other studies demonstrate low in vitro resistance to this compound.<a class="elsevierStyleCrossRefs" href="#bib0070">14,27</a> Although all isolates were considered to be susceptible to amphotericin B (MIC<2μg/mL), the average MIC of the C. gattii isolates (0.56μg/mL) was greater than that of C. neoformans isolates (0.26μg/mL). This result has been previously reported<a class="elsevierStyleCrossRef" href="#bib0070">14</a> and highlights the potential for differential efficacy of therapeutics in the treatment of C. neoformans and C. gattii.The identification of pathogenic Cryptococcus species and sub-species are important for both clinical guiding and as well as for epidemiology. Recently, false-positive C. gattii results have been reported using the conventional CGB differentiation method due to the existence of C. neoformans isolates that are resistant to canavanine.<a class="elsevierStyleCrossRef" href="#bib0065">13</a> Meanwhile, PCR fingerprinting and PCR-RFLP are being utilized more frequently.<a class="elsevierStyleCrossRefs" href="#bib0045">9,20,24</a> In the current study, PCR-RFLP was used to characterize the Cryptococcus isolates as the molecular types VNI and VGII. Furthermore, these results are consistent with previous studies that identified C. neoformans VNI as the primary agent of cryptococcosis.<a class="elsevierStyleCrossRefs" href="#bib0065">13,16,19</a> A study that characterized 63 Brazilian isolates described the prevalence of the molecular types VNI (82.3%), VGII (13.6%) and VNII (3.0%),<a class="elsevierStyleCrossRef" href="#bib0085">17</a> and more recent studies in the Pará state reinforce the prevalence of VNI and VGII as being the principal molecular types of C. neoformans and C. gattii, respectively, in the northern region of Brazil.<a class="elsevierStyleCrossRef" href="#bib0085">17</a>Data from this study can assist with current and future management of cryptococcosis in Northern Brazil by identifying the frequency of C. neoformans and C. gattii in patients as well as their susceptibility to commonly used antifungal drugs. These data also contribute to epidemiological studies of the distribution of different molecular types of Cryptococcus species in the Brazilian Amazon.Conflict of interestThe authors have no conflict of interest to declare." "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:2 [ "identificador" => "xres121165" "titulo" => array:6 [ 0 => "Abstract" 1 => "Background" 2 => "Aims" 3 => "Methods" 4 => "Results" 5 => "Conclusions" ] ] 1 => array:2 [ "identificador" => "xpalclavsec108451" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres121166" "titulo" => array:6 [ 0 => "Resumen" 1 => "Antecedentes" 2 => "Objetivos" 3 => "Métodos" 4 => "Resultados" 5 => "Conclusiones" ] ] 3 => array:2 [ "identificador" => "xpalclavsec108452" "titulo" => "Palabras clave" ] 4 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Isolates and strains" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Patient information" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Identification of the species" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Enzyme quantification" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Susceptibility to antifungal agents" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Characterization of molecular genotypes" ] ] ] 5 => array:2 [ "identificador" => "sec0045" "titulo" => "Results" ] 6 => array:2 [ "identificador" => "sec0050" "titulo" => "Discussion" ] 7 => array:2 [ "identificador" => "sec0055" "titulo" => "Conflict of interest" ] 8 => array:2 [ "identificador" => "xack37740" "titulo" => "Acknowledgement" ] 9 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2010-08-09" "fechaAceptado" => "2011-05-13" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec108451" "palabras" => array:4 [ 0 => "Cryptococcus neoformans" 1 => "Cryptococcus gattii" 2 => "Epidemiology" 3 => "Phenotyping and genotyping" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec108452" "palabras" => array:4 [ 0 => "Cryptococcus neoformans" 1 => "Cryptococcus gattii" 2 => "Epidemiología" 3 => "Fenotipo y genotipo" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "BackgroundThe differentiation and classification of pathogenic Cryptococcus species provides useful data for epidemiological studies and for the clinical diagnosis and treatment of patients. AimsThe aim of this study was to characterise 40 clinical Cryptococcus isolates obtained from patients at the Tropical Medicine Foundation of Amazonas (FMTAM) from 2006 to 2008. MethodsIt was used phenotypic (i.e., enzyme production and antifungal resistance) and molecular biological (URA5-RFLP) experiments. ResultsPatients with HIV/AIDS were most affected with cryptococcosis. Thirty-one (75.5%) of the clinical isolates were classified as Cryptococcus neoformans and 9 (22.5%) as Cryptococcus gattii. High amounts of protease and phospholipase enzymes were produced by most of the isolates. Using the disk diffusion test (CLSI M44-A), 81, 35 and 100% of the C. neoformans isolates were characterized as susceptible to fluconazole, itraconazole and amphotericin B, respectively, whereas 78, 56 and 100% of the C. gattii isolates were susceptible to these antimicrobial agents. The average of Minimal Inhibitory Concentration (MIC) for C. neoformans and C. gattii isolates was 0.26 and 0.58μg/mL, respectively. The 9 isolates of C. gattii had a fingerprint pattern comparable with the VGII molecular type, while all 31 isolates of C. neoformans presented with a pattern consistent with the VNI type. ConclusionsThis study confirms the importance of HIV/AIDS for the cryptococcosis epidemiology, the susceptibility of the isolates to amphotericin B and the high prevalence of the molecular genotypes VNI and VGII in the north of Brazil." ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "AntecedentesLa diferenciación y clasificación de las especies patógenas del género Cryptococcus aporta datos importantes para la asistencia clínica y para estudios epidemiológicos. ObjetivosEl objetivo de este trabajo fue caracterizar 40 aislamientos clínicos del complejo Cryptococcus neoformans de pacientes que fueron atendidos en la Fundación de Medicina Tropical de Amazonas desde 2006 hasta 2008. MétodosSe utilizaron métodos fenotípicos (producción de enzimas y pruebas de sensibilidad a los antifúngicos) y moleculares (URA5-RFLP). ResultadosLos pacientes con VIH/sida fueron los más afectados de criptococosis. Se observó que 31 (75,5%) y 9 (22,5%) de los aislamientos fueron Cryptococcus neoformans y Cryptococcus gattii, respectivamente. La producción de proteasa y fosfolipasa fue alta en la mayoría de las cepas. Utilizando la prueba de difusión en disco (CLSI M44-A) se observó que el 81, 35 y 100% de los aislamientos de C. neoformans fueron sensibles al fluconazol, itraconazol y amphotericin B, respectivamente, mientras que 78, 56 y 100% de los aislamientos de C. gattii fueron sensibles a estas sustancias. El valor promedio de la concentración mínima inhibitoria (CMI) para C. neoformans y C. gattii fue de 0,26 y 0,58mg/ml, respectivamente. Todos los aislamientos (9) de C. gattii presentaron un patrón de electroforesis compatible con el genotipo VGII, y todos los aislamientos (31) de C. neoformans presentaron el genotipo VNI. ConclusionesEste estudio confirma la importancia del HIV/sida para la epidemiología de la criptococosis, la sensibilidad de los aislamientos a la anfotericina B y la alta prevalencia de los genotipos moleculares VNI y VGII en el norte de Brasil." ] ] "multimedia" => array:2 [ 0 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">C. neoformans \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">C. gattii \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Total (%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sex \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (30) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (70) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age (Years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0– 5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (8) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16–30 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">21 (53) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31–45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 (25) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46–60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (10) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">>60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (5) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HIV Infection \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (10) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">24 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 (73) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Unknown \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (18) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Area of the residence in Manaus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">North \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (12) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">South \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (8) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">East \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 (24) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">West \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (2) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">South Central \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (8) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Midwest \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (12) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Unknown \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 (33) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Biological sample \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cerebrospinal fluid \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">37 (92) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Blood culture \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (5) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sputum \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (3) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab209030.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Epidemiological characteristics of patients with cryptococcosis." ] ] 1 => array:7 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Antifungal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Susceptible \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Intermediate \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Resistant \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">N (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">N (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">N (%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C. neoformans</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fluconazole \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">25 (80.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (16.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (3.3) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Itraconazole \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11 (35.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 (64.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Amphotericin B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 (100) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C. gattii</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fluconazole \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (77.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (22.3) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Itraconazole \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (55.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (44.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Amphotericin B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (100) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab209029.png" ] ] ] ] "descripcion" => array:1 [ "en" => "- Susceptibility of C. neoformans and C. gattii to antifungal compounds, as measured by disk diffusion." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:33 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Urban sources of Cryptococcus spp – Lisbon" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F.M. Bernardo" 1 => "H.M. Martins" 2 => "M.L. Martins" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Ver Port Clin" "fecha" => "2001" "volumen" => "96" "paginaInicial" => "157" "paginaFinal" => "160" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Brasil, Ministério da Saúde. Documentos e publicações em DST e AIDS. Coordenação do programa nacional de DTS/AIDS. Epidemiol Vigilance. 2004:1. Available at: <a class="elsevierStyleInterRef" href="http://www.aids.gov.br/">http://www.aids.gov.br</a> [consulted on 03-22-2009]." ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diversity of the Cryptococcus neoformans–Cryptococcus gattii species complex" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Bovers" 1 => "F. Hagen" 2 => "T. Boekhout" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "2008" "volumen" => "25" "paginaInicial" => "4" "paginaFinal" => "12" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reference method for antifungal disk diffusion susceptibility testing of yeasts; Approved guideline" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Clinical Laboratory Standards Institute (CLSI)" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "titulo" => "NCCLS document M44-A" "fecha" => "2004" "editorial" => "National Committee for Clinical Laboratory Standards" "editorialLocalizacion" => "Wayne, PA" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In vitro antifungal susceptibility of clinical isolates of Cryptococcus neoformans var. neoformans and C. neoformans var. gattii" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. De Bedout" 1 => "N. Ordóñez" 2 => "B.L. Gómez" 3 => "M.C. Rodríguez" 4 => "M. Arango" 5 => "A. Restrepo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "1999" "volumen" => "16" "paginaInicial" => "36" "paginaFinal" => "39" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18473590" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of three commercial assays and a modified disk diffusion assay with two broth microdilution reference assays for testing zygomycetes, Aspergillus spp., Candida spp., and Cryptococcus neoformans with posaconazole and amphotericin B" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. Espinel-Ingroff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.01187-06" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2006" "volumen" => "44" "paginaInicial" => "3616" "paginaFinal" => "3622" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16943356" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of inositol phospho-sphingolipid-phospholipase C1 (Isc1) in Cryptococcus neoformans reveals unique biochemical features" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Henry" 1 => "A. Guillotte" 2 => "C. Luberto" 3 => "M. Del Poeta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.febslet.2011.01.015" "Revista" => array:6 [ "tituloSerie" => "FEBS Lett" "fecha" => "2011" "volumen" => "585" "paginaInicial" => "635" "paginaFinal" => "640" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21256847" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role and mechanism of diacylglycerol-protein kinase C1 signaling in melanogenesis by Cryptococcus neoformans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.J. Heung" 1 => "A.C. Kaiser" 2 => "C. Luberto" 3 => "M.D. Poeta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M503404200" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2005" "volumen" => "280" "paginaInicial" => "28547" "paginaFinal" => "28555" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15946943" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of clinical Cryptococcus neoformans strains from India" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Jain" 1 => "B.L. Wickes" 2 => "S.M. Keller" 3 => "J. Fu" 4 => "A. Casadevall" 5 => "P. Jain" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.43.11.5733-5742.2005" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2005" "volumen" => "43" "paginaInicial" => "5733" "paginaFinal" => "5742" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16272511" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Drug resistance in Cryptococcus neoformans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R.P. John" 1 => "M.C. Gary" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1999" "volumen" => "2" "paginaInicial" => "259" "paginaFinal" => "269" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.E. Kidd" 1 => "F. Hagen" 2 => "R.L. Tscharke" 3 => "M. Huynh" 4 => "K.H. Bartlett" 5 => "M. Fyfe" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2004" "volumen" => "172" "paginaInicial" => "58" "paginaFinal" => "63" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Safety and efficacy of liposomal amphotericin B in patients with cryptococcal meningitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R.N. Kotwani" 1 => "P.C. Gokhale" 2 => "P.V. Bodhe" 3 => "B.G. Kirodian" 4 => "N.A. Kshirsagar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Assoc Physicians India" "fecha" => "2001" "volumen" => "49" "paginaInicial" => "1086" "paginaFinal" => "1090" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11868862" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cryptococcosis: clinical and biological aspects" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "K.J. Kwon-Chung" 1 => "T.C. Sorrell" 2 => "F. Dromer" 3 => "E. Fung" 4 => "S.M. Levitz" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2000" "volumen" => "38" "paginaInicial" => "205" "paginaFinal" => "213" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11204147" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of resistance to amphotericin B among Cryptococcus neoformans clinical isolates: performances of three different media assessed by using E-test and National Committee for Clinical Laboratory Standards M27-A methodologies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Lozano-Chiu" 1 => "V.L. Paetznick" 2 => "M.A. Ghannoum" 3 => "J.H. Rex" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1998" "volumen" => "36" "paginaInicial" => "2817" "paginaFinal" => "2822" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9738026" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Martins LMS. Epidemiologia da criptococose em crianças e adultos jovens e diversidade de Cryptococcus neoformans no meio Norte do Brasil. MSc thesis. Fiocruz, Rio de Janeiro: Instituto Oswaldo Cruz; 2003." ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotipagem, sorotipagem e determinação de mating-type de isolados clínicos de Cryptococcus neoformans do Estado de São Paulo, Brasil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.T. Matsumoto" 1 => "A.M. Fusco-Almeida" 2 => "L.C. Baeza" 3 => "M.S.C. Melhem" 4 => "M.J.S. Medes-Giannini" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop S Paulo" "fecha" => "2007" "volumen" => "39" "paginaInicial" => "3" "paginaFinal" => "6" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular typing of Ibero American Cryptococcus neoformans isolates" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "W.E. Meyer" 1 => "S. Kidd" 2 => "A. Castañeda" 3 => "S. Jackson" 4 => "M. Huynh" 5 => "G.N. Latouche" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3201/eid0902.020246" "Revista" => array:6 [ "tituloSerie" => "Emerg Infect Dis" "fecha" => "2003" "volumen" => "9" "paginaInicial" => "189" "paginaFinal" => "195" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12603989" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Criptococose: estudo clínico-epidemiológico, laboratorial e das variedades do fungo em 96 pacientes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T.A. Moreira" 1 => "M.S. Ferreira" 2 => "R.M. Ribas" 3 => "A.S. Borges" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Soc Bras Med Trop" "fecha" => "2006" "volumen" => "39" "paginaInicial" => "255" "paginaFinal" => "258" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16906248" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serotyping of 467 Cryptococcus neoformans isolates from clinical and environmental sources in Brazil: analysis of host and regional patterns" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.M. Nishikawa" 1 => "S.M. Lazera" 2 => "G.G. Barbosa" 3 => "L. Trilles" 4 => "B.R. Balassiano" 5 => "R.C.L. Macedo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2003" "volumen" => "41" "paginaInicial" => "73" "paginaFinal" => "77" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12517828" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serotype, mating type and ploidy of Cryptococcus neoformans strains isolated from patients in Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Ohkusu" 1 => "K. Hata" 2 => "K. Takeo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Inst Med Trop S Paulo" "fecha" => "2002" "volumen" => "44" "paginaInicial" => "299" "paginaFinal" => "302" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12532211" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Criptococose: revisão sobre a experiência brasileira sobre a doença" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.C.S.M. Pappalardo" 1 => "M.S.C. Melhem" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop S Paulo" "fecha" => "2003" "volumen" => "45" "paginaInicial" => "73" "paginaFinal" => "78" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In vitro susceptibilities of clinical isolates of Candida species, Cryptococcus neoformans, and Aspergillus species to itraconazole: global survey of 9359 isolates tested by clinical and laboratory standards institute broth microdilution methods" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.A. Pfaller" 1 => "L. Boyken" 2 => "R.J. Hollis" 3 => "S.A. Messer" 4 => "S. Tendolkar" 5 => "D.J. Diekema" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.43.8.3807-3810.2005" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2005" "volumen" => "43" "paginaInicial" => "3807" "paginaFinal" => "3810" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16081915" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Plate method for detection of phospholipase activity in Candida albicans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.F. Price" 1 => "I.D. Wilkinson" 2 => "I.O. Gentry" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Sabouraudia" "fecha" => "1982" "volumen" => "20" "paginaInicial" => "15" "paginaFinal" => "20" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7064045" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterization of environmental Cryptococcus neoformans isolated in Vitoria, ES, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.A. Ribeiro" 1 => "P. Ngamskulrungroj" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Inst Med Trop S Paulo" "fecha" => "2008" "volumen" => "50" "paginaInicial" => "25" "paginaFinal" => "28" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18383630" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A comparison of secretory proteinases from different strains of Candida albicans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R. Ruchel" 1 => "K. Uhlemann" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Sabouraudia" "fecha" => "1982" "volumen" => "20" "paginaInicial" => "233" "paginaFinal" => "244" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6753190" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Relationship of the glyoxylate pathway to the pathogenesis of Cryptococcus neoformans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T.H. Rude" 1 => "D.L. Toffaletti" 2 => "G.M. Cox" 3 => "J.R. Perfect" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Infect Immun" "fecha" => "2002" "volumen" => "70" "paginaInicial" => "5684" "paginaFinal" => "5694" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12228298" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Unusual presentation of central nervous system Cryptococcal infection in an immunocompetent patient" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "G. Salgal" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am J Neuroradiol" "fecha" => "2005" "volumen" => "26" "paginaInicial" => "2522" "paginaFinal" => "2526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16286394" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Primary endemic Cryptococcosis gattii by molecular type VGII in the state of Pará, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W.R. Santos" 1 => "W. Meyer" 2 => "B. Wanke" 3 => "S.P.S.C. Costa" 4 => "T. Luciana" 5 => "J.L.M. Nascimento" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2008" "volumen" => "103" "paginaInicial" => "813" "paginaFinal" => "818" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19148422" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Caracterização dos isolados clínicos de espécies do complexo Cryptococcus neoformans em Belém do Pará" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "W.R. Santos" 1 => "W. Meyer" 2 => "B. Wanke" 3 => "S.P.S.C. Costa" 4 => "T. Luciana" 5 => "J.L.M. Nascimento" 6 => "Medeiros R" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "titulo" => "Norte do Brasil" "fecha" => "2007" "editorial" => "Congresso Brasileiro de Micologia" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Padrão da infecção pelo HIV/AIDS em Manaus, Estado do Amazonas, no período de 1986 a 2000" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L.C.F. Silva" 1 => "E.M. Santos" 2 => "N.A.L. Silva" 3 => "A.E. Miranda" 4 => "S. Talhari" 5 => "L.M. Toledo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Soc Bras Med Trop" "fecha" => "2009" "volumen" => "42" "paginaInicial" => "543" "paginaFinal" => "550" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19967237" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Silva MSR Perfil da qualidade das águas subterrâneas de Manaus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M.L. Silva" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Holos Environ" "fecha" => "2007" "volumen" => "1" "paginaInicial" => "1" "paginaFinal" => "13" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cryptococcus neoformans variety gattii" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "T.C. Sorrell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2001" "volumen" => "39" "paginaInicial" => "155" "paginaFinal" => "168" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11346263" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Extracellular enzymatic activity and serotype of Cryptococcus neoformans strains isolated from AIDS patients in Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "V. Vidotto" 1 => "M. Melhem" 2 => "S. Pukinskas" 3 => "S. Aoki" 4 => "C. Carrara" 5 => "A. Pugliese" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "2005" "volumen" => "22" "paginaInicial" => "29" "paginaFinal" => "33" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15813680" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "identificador" => "xack37740" "titulo" => "Acknowledgement" "texto" => "The authors are grateful to Fundação de Amparo a Pesquisa do Estado do Amazonas (FAPEAM) for the financial support." ] ] ] "idiomaDefecto" => "en" "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000611/v1_201305061404/en/main.assets" "Apartado" => array:4 [ "identificador" => "7997" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/11301406/0000002900000001/v1_201305061404/S1130140611000611/v1_201305061404/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000611?idApp=UINPBA00004N"]

Statistics

Original article

Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil

Caracterización de aislamientos clínicos del complejo Cryptococcus neoformans-Cryptococcus gattii, del Estado Amazonas - Brasil

Babbyngttonn Khell Da Silvaa, Ana Karla Freirea, Amaury Dos Santos Bentesb, Ivanete De Lima Sampaioa, Lucilaide Oliveira Santosa, Mirlane Silva Dos Santosa, João Vicente De Souzab,

Corresponding author

joaovicentebragasouza@yahoo.com.br

Corresponding author.

a Fundação de Medicina Tropical do Amazonas, Manaus, AM, Brazil

b Instituto Nacional de Pesquisas da Amazônia, Manaus, AM, Brazil

Read

4270

Times
was read the article

1117

Total PDF

3153

Total HTML

Share statistics

 array:23 [
  "pii" => "S1130140611000611"
  "issn" => "11301406"
  "doi" => "10.1016/j.riam.2011.05.003"
  "estado" => "S300"
  "fechaPublicacion" => "2012-01-01"
  "aid" => "136"
  "copyright" => "Revista Iberoamericana de Micolog&#237;a"
  "copyrightAnyo" => "2010"
  "documento" => "article"
  "crossmark" => 0
  "subdocumento" => "fla"
  "cita" => "Rev Iberoam Micol. 2012;29:40-3"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 3127
    "formatos" => array:3 [
      "EPUB" => 49
      "HTML" => 2501
      "PDF" => 577
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1130140611000805"
    "issn" => "11301406"
    "doi" => "10.1016/j.riam.2011.06.010"
    "estado" => "S300"
    "fechaPublicacion" => "2012-01-01"
    "aid" => "146"
    "copyright" => "Revista Iberoamericana de Micolog&#237;a"
    "documento" => "article"
    "crossmark" => 0
    "subdocumento" => "sco"
    "cita" => "Rev Iberoam Micol. 2012;29:44-6"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 6057
      "formatos" => array:3 [
        "EPUB" => 48
        "HTML" => 5504
        "PDF" => 505
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Note</span>"
      "titulo" => "Phaeohyphomycosis caused by <span class="elsevierStyleItalic">Alternaria infectoria</span> presenting as multiple vegetating lesions in a renal transplant patient"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "44"
          "paginaFinal" => "46"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Feohifomicosis producida por <span class="elsevierStyleItalic">Alternaria infectoria</span> con presentaci&#243;n cl&#237;nica de m&#250;ltiples lesiones vegetantes en un paciente sometido a un trasplante renal"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 713
              "Ancho" => 950
              "Tamanyo" => 207707
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Microscopic examination following lactophenol blue staining &#40;magnification &#215;1500&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Daniela Cunha, Cristina Amaro, Mar&#237;a Raquel Vieira, Mar&#237;a da Luz Martins, Ana Paula Maduro, Jo&#227;o In&#225;cio, Ana Afonso, Gabriela Marques Pinto, Jorge Cardoso"
          "autores" => array:9 [
            0 => array:2 [
              "nombre" => "Daniela"
              "apellidos" => "Cunha"
            ]
            1 => array:2 [
              "nombre" => "Cristina"
              "apellidos" => "Amaro"
            ]
            2 => array:2 [
              "nombre" => "Mar&#237;a Raquel"
              "apellidos" => "Vieira"
            ]
            3 => array:2 [
              "nombre" => "Mar&#237;a da Luz"
              "apellidos" => "Martins"
            ]
            4 => array:2 [
              "nombre" => "Ana Paula"
              "apellidos" => "Maduro"
            ]
            5 => array:2 [
              "nombre" => "Jo&#227;o"
              "apellidos" => "In&#225;cio"
            ]
            6 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Afonso"
            ]
            7 => array:2 [
              "nombre" => "Gabriela Marques"
              "apellidos" => "Pinto"
            ]
            8 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "Cardoso"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000805?idApp=UINPBA00004N"
    "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000805/v1_201305061404/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S1130140611000428"
    "issn" => "11301406"
    "doi" => "10.1016/j.riam.2011.03.008"
    "estado" => "S300"
    "fechaPublicacion" => "2012-01-01"
    "aid" => "129"
    "copyright" => "Revista Iberoamericana de Micolog&#237;a"
    "documento" => "article"
    "crossmark" => 0
    "subdocumento" => "fla"
    "cita" => "Rev Iberoam Micol. 2012;29:34-9"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 3567
      "formatos" => array:3 [
        "EPUB" => 49
        "HTML" => 2963
        "PDF" => 555
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Selection and optimization of PCR-based methods for the detection of <span class="elsevierStyleItalic">Histoplasma capsulatum</span> var&#46; <span class="elsevierStyleItalic">capsulatum</span>"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "34"
          "paginaFinal" => "39"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Selecci&#243;n y optimizaci&#243;n de los m&#233;todos basados en PCR para la detecci&#243;n de <span class="elsevierStyleItalic">Histoplasma capsulatum</span> var&#46; <span class="elsevierStyleItalic">capsulatum</span>"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1727
              "Ancho" => 1417
              "Tamanyo" => 213033
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Influence of the reagents&#8217; concentrations in the PCR products obtained in optimization experiments&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ivanete De Lima Sampaio, Ana Karla Lima Freire, Mauricio Morishi Ogusko, J&#250;lia Ignez Salem, Jo&#227;o Vicente Braga De Souza"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Ivanete"
              "apellidos" => "De Lima Sampaio"
            ]
            1 => array:2 [
              "nombre" => "Ana Karla"
              "apellidos" => "Lima Freire"
            ]
            2 => array:2 [
              "nombre" => "Mauricio"
              "apellidos" => "Morishi Ogusko"
            ]
            3 => array:2 [
              "nombre" => "J&#250;lia"
              "apellidos" => "Ignez Salem"
            ]
            4 => array:2 [
              "nombre" => "Jo&#227;o Vicente"
              "apellidos" => "Braga De Souza"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000428?idApp=UINPBA00004N"
    "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000428/v1_201305061404/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Characterization of clinical isolates of the <span class="elsevierStyleItalic">Cryptococcus neoformans-Cryptococcus gattii</span> species complex from the Amazonas State in Brazil"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "40"
        "paginaFinal" => "43"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Babbyngttonn Khell Da Silva, Ana Karla Freire, Amaury Dos Santos Bentes, Ivanete De Lima Sampaio, Lucilaide Oliveira Santos, Mirlane Silva Dos Santos, Jo&#227;o Vicente De Souza"
        "autores" => array:7 [
          0 => array:3 [
            "nombre" => "Babbyngttonn"
            "apellidos" => "Khell Da Silva"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Ana Karla"
            "apellidos" => "Freire"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Amaury"
            "apellidos" => "Dos Santos Bentes"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Ivanete"
            "apellidos" => "De Lima Sampaio"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Lucilaide"
            "apellidos" => "Oliveira Santos"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Mirlane"
            "apellidos" => "Silva Dos Santos"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:4 [
            "nombre" => "Jo&#227;o Vicente"
            "apellidos" => "De Souza"
            "email" => array:1 [
              0 => "joaovicentebragasouza&#64;yahoo&#46;com&#46;br"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">¿</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Funda&#231;&#227;o de Medicina Tropical do Amazonas&#44; Manaus&#44; AM&#44; Brazil"
            "etiqueta" => "<span class="elsevierStyleSup">a</span>"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Instituto Nacional de Pesquisas da Amaz&#244;nia&#44; Manaus&#44; AM&#44; Brazil"
            "etiqueta" => "<span class="elsevierStyleSup">b</span>"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Caracterizaci&#243;n de aislamientos cl&#237;nicos del complejo <span class="elsevierStyleItalic">Cryptococcus neoformans-Cryptococcus gattii</span>&#44; del Estado Amazonas - Brasil"
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">Cryptococcosis is an opportunistic fungal disease caused by the encapsulated yeast species <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">Cryptococcus gattii</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> The infection is acquired by the inhalation of desiccated yeasts or spores and can develop to the brain or other systemic organs&#46;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> Infection with <span class="elsevierStyleItalic">Cryptococcus</span> spp&#46; is the major cause of fungal meningitis in immunocompromised patients&#44; resulting in elevated morbidity and mortality rates&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> Furthermore&#44; immunocompromised status is the most common risk factor for infection with <span class="elsevierStyleItalic">C&#46; neoformans</span>&#46; Additionally&#44; there are increasing numbers of immunocompetent patients with fungal meningitis who are infected with <span class="elsevierStyleItalic">C&#46; gattii</span>&#46;<a class="elsevierStyleCrossRefs" href="#bib0105"><span class="elsevierStyleSup">21&#44;32</span></a> The preferred treatment for cryptococcal meningitis is amphotericin B&#44; but a side effect of the drug manifested by nephrotoxicity limits its clinical use and increases the importance of antifungal susceptibility testing&#46;<a class="elsevierStyleCrossRefs" href="#bib0050"><span class="elsevierStyleSup">10&#44;12</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Based on serological studies&#44; using antibodies against the fungal capsule&#44; seven serotypes of <span class="elsevierStyleItalic">Cryptococcus</span> have been identified&#58; A&#44; B&#44; C&#44; D&#44; AB&#44; AD and BD&#46;<a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3&#44;5&#44;20</span></a><span class="elsevierStyleItalic">C&#46; neoformans</span> serotypes A&#44; D and AD are found in cities&#44; whereas the <span class="elsevierStyleItalic">C&#46; gattii</span> serotypes B and C are predominately localised in tropical and subtropical regions&#46;<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1&#44;13&#44;19</span></a> In 1999 an outbreak of <span class="elsevierStyleItalic">C&#46; gattii</span> occurred in Canada&#44; raising the possibility that this species could be localised in both tropical and temperate climates&#46;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">In addition to the serotypes of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gatti</span>&#44; molecular analyses&#44; including M13 fingerprinting&#44; <span class="elsevierStyleItalic">URA5</span>-RFLP &#40;Restriction Fragment Length Polymorphism&#41; and AFLP &#40;Amplified Fragment Length Polymorphism&#41;&#44; have identified 8 molecular genotypes&#58; VNI and VNII &#40;Serotype A&#41;&#59; VNIII &#40;Hybrid AD&#41;&#59; VNIV &#40;Serotype D&#41;&#59; and VGI&#44; VGII&#44; VGIII and VGIV &#40;Serotypes B and C&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Molecular genotyping contributes to better and more accurate clinical diagnoses and characterizes genetic diversity for global epidemiological studies&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">The aim of this work was to characterize forty <span class="elsevierStyleItalic">Cryptococcus</span> isolates from patients at the Tropical Medicine Foundation of Amazonas &#40;FMTAM&#41; during 2006&#8211;2008 by using phenotypic and molecular biological experiments&#46;</p><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1</span><span class="elsevierStyleSectionTitle">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;1</span><span class="elsevierStyleSectionTitle">Isolates and strains</span><p id="par0025" class="elsevierStylePara elsevierViewall">Forty isolates were obtained from patients with cryptococcal infection who were hospitalized in FMTAM between March 2006 and February 2008&#46; A single sample was collected from each patient and stored at 4<span class="elsevierStyleHsp" style=""></span>&#176;C in the FMTAM fungal collection&#46; They were grown on Sabouraud agar at 30<span class="elsevierStyleHsp" style=""></span>&#176;C for 48<span class="elsevierStyleHsp" style=""></span>h&#46; For molecular genotyping&#44; the following standard strains were used&#58; WM 148 &#40;serotype A&#44;VNI&#41;&#44; WM 626 &#40;serotype A&#44; VNII&#41;&#44; WM 628 &#40;serotype AD&#44; VNIII&#41;&#44; WM 629 &#40;serotype D&#44; VNIV&#41;&#44; WM 179 &#40;serotype B&#44; VGI&#41;&#44; WM 178 &#40;serotype B&#44; VGII&#41;&#44; WM 161 &#40;serotype B&#44; VGIII&#41; and WM 779 &#40;serotype C&#44; VGIV&#41;&#46; These reference strains were kindly provided by the fungal collection at FIOCRUZ-Rio de Janeiro-Brazil&#46; Also&#44; the reference strains WM 148 and WM 178 were used as reference strains for <span class="elsevierStyleSmallCaps">l</span>-canavanine glycine bromothymol blue &#40;CGB&#41; species determination&#44; enzyme production and susceptibility assays using antifungal agents&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;2</span><span class="elsevierStyleSectionTitle">Patient information</span><p id="par0030" class="elsevierStylePara elsevierViewall">The epidemiological profile of the patients &#40;age&#44; sex&#44; immunological status and residence&#41; was obtained by analysis of the examination requisition&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;3</span><span class="elsevierStyleSectionTitle">Identification of the species</span><p id="par0035" class="elsevierStylePara elsevierViewall">CGB agar was utilized to differentiate the species <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> as previously described&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a><span class="elsevierStyleItalic">C&#46; gattii</span> strains use the glycine in the media as a source of carbon and nitrogen&#44; are resistant to canavanine and produce a blue cobalt colour during incubation&#44; whereas <span class="elsevierStyleItalic">C&#46; neoformans</span> do not exhibit any colour change in the media&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;4</span><span class="elsevierStyleSectionTitle">Enzyme quantification</span><p id="par0040" class="elsevierStylePara elsevierViewall">The production of proteinases and phospholipases were measured as previously described&#46;<a class="elsevierStyleCrossRefs" href="#bib0115"><span class="elsevierStyleSup">23&#44;25&#44;33</span></a> The fungal isolates were inoculated at equidistant points on plates of proteinase agar and phospholipase agar&#44; and the enzyme activity &#40;Pz&#41; was calculated using the relation between the diameter of the colony &#40;dc&#41; and the diameter of the colony and precipitation zone &#40;dcp&#41;&#46; The results were classified as negative &#40;Pz<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#41;&#44; positive &#40;0&#46;64<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>Pz<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>1&#41; or strongly positive &#40;Pz<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;64&#41;&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;5</span><span class="elsevierStyleSectionTitle">Susceptibility to antifungal agents</span><p id="par0045" class="elsevierStylePara elsevierViewall">Susceptibility tests were performed according to the Clinical and Laboratory Standards Institute &#40;CLSI&#41; document M44-A&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> Disks impregnated with fluconazole &#40;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#41;&#44; itraconazole &#40;10<span class="elsevierStyleHsp" style=""></span>&#956;g&#41; or amphotericin B &#40;100<span class="elsevierStyleHsp" style=""></span>&#956;g&#41; &#40;Cecon-Sensifungidisc&#44; S&#227;o Paulo&#44; Brazil&#41; were used in the assays&#46; The diameter of the inhibition haloes was used to determine the susceptibility of the yeast to the antifungal compounds&#46; Cut-off values were as follows&#58; Amphotericin B<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleHsp" style=""></span>mm &#8211; susceptible &#40;S&#41;&#44; &#60;10<span class="elsevierStyleHsp" style=""></span>mm &#8211;resistant &#40;R&#41;&#59; itraconazol &#62;20<span class="elsevierStyleHsp" style=""></span>mm &#8211; S&#44; 19&#8211;12<span class="elsevierStyleHsp" style=""></span>mm &#8211; intermediate &#40;I&#41;&#44; &#60;1<span class="elsevierStyleHsp" style=""></span>mm &#8211; R and fluconazole &#62;19<span class="elsevierStyleHsp" style=""></span>mm &#8211; S&#59; 19&#8211;14<span class="elsevierStyleHsp" style=""></span>mm &#8211; I&#59; &#60;14<span class="elsevierStyleHsp" style=""></span>mm &#8211; R&#46; The determination of the MIC for amphotericin B was performed using the <span class="elsevierStyleItalic">E</span>-test-AB BIODISK method as described previously&#46;<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a></p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1&#46;6</span><span class="elsevierStyleSectionTitle">Characterization of molecular genotypes</span><p id="par0050" class="elsevierStylePara elsevierViewall">The genotypic characterization was carried out as described previously&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Fungal DNA was extracted with the QIAamp tissue kit &#40;Qiagen&#44; Germany&#41; according to the manufacturer&#39;s protocol for DNA extraction from yeast&#44; including digestion with lyticase and RNAase&#46; PCR of the <span class="elsevierStyleItalic">URA5</span> gene was conducted in a final volume of 50<span class="elsevierStyleHsp" style=""></span>&#956;L&#44; and each reaction contained 50<span class="elsevierStyleHsp" style=""></span>ng of DNA&#44; 1&#215; PCR buffer &#40;10<span class="elsevierStyleHsp" style=""></span>mM Tris&#8211;HCl&#44; pH 8&#46;3&#44; 50<span class="elsevierStyleHsp" style=""></span>mM KCl and 1&#46;5<span class="elsevierStyleHsp" style=""></span>mM MgCl<span class="elsevierStyleInf">2</span>&#41;&#59; 0&#46;2<span class="elsevierStyleHsp" style=""></span>mM each of dATP&#44; dCTP&#44; dGTP and dTTP&#59; 3<span class="elsevierStyleHsp" style=""></span>mM magnesium acetate&#59; 1&#46;5<span class="elsevierStyleHsp" style=""></span>U AmpliTaq DNA polymerase &#40;Invitrogen&#44; Carlsbad&#44; California&#41; and 50<span class="elsevierStyleHsp" style=""></span>ng of each primer <span class="elsevierStyleItalic">URA5</span> &#40;5&#8242;ATGTCCTCCCAAGCCCTCGACTCCG3&#8242;&#41; and SJ01 &#40;5&#8242;TTAAGACCTCTGAACACCGTACTC3&#8242;&#41;&#46; The PCR was performed in a PerkinElmer thermal cycler &#40;model 480&#41; for 35 cycles of a 2<span class="elsevierStyleHsp" style=""></span>min initial denaturation at 94<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 45<span class="elsevierStyleHsp" style=""></span>s denaturation at 94<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 1<span class="elsevierStyleHsp" style=""></span>min annealing at 61<span class="elsevierStyleHsp" style=""></span>&#176;C and 2<span class="elsevierStyleHsp" style=""></span>min extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; followed by a final extension cycle for 10<span class="elsevierStyleHsp" style=""></span>min at 72<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The PCR products were double digested with <span class="elsevierStyleItalic">Sau</span>96I &#40;10<span class="elsevierStyleHsp" style=""></span>U&#47;&#956;L&#41; and <span class="elsevierStyleItalic">Hha</span>I &#40;20<span class="elsevierStyleHsp" style=""></span>U&#47;&#956;L&#41; for 3<span class="elsevierStyleHsp" style=""></span>h or overnight and separated by 3&#37; agarose gel electrophoresis at 100<span class="elsevierStyleHsp" style=""></span>V for 5<span class="elsevierStyleHsp" style=""></span>h&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2</span><span class="elsevierStyleSectionTitle">Results</span><p id="par0055" class="elsevierStylePara elsevierViewall">The epidemiological characteristics of the patients with cryptococcosis were evaluated&#46; Males were more commonly infected &#40;70&#37;&#41; than females&#44; and the age group most affected was between 16 and 30 years &#40;53&#37;&#59; median<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>28&#46;5 years&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; The majority of patients with cryptococcosis were also infected with HIV &#40;72&#37;&#41; and resided in the east zone of the city of Manaus &#40;25&#37;&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; Cerebrospinal fluid &#40;CSF&#41; was collected for the isolation of the fungal agents from most patients &#40;93&#37;&#41;&#46; Isolates were inoculated on a CGB medium&#59; 9 were positive for the presence of <span class="elsevierStyleItalic">C&#46; gattii</span>&#44; and 31 were positive for <span class="elsevierStyleItalic">C&#46; neoformans</span>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0060" class="elsevierStylePara elsevierViewall">All of the isolates had high protease production &#40;Pz<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;64&#41; and an average Pz<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;3 for both <span class="elsevierStyleItalic">Cryptococcus</span> species&#46; All but 1 isolate was positive for the production of phospholipase &#40;average Pz<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;53&#41;&#46; Twenty-six <span class="elsevierStyleItalic">C&#46; neoformans</span> isolates &#40;83&#46;8&#37;&#41; presented strong positive results &#40;Pz<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;64&#41;&#44; and 4 isolates &#40;12&#46;9&#37;&#41; presented positive results &#40;Pz<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>0&#46;64 and &#60; 1&#46;0&#41;&#44; whereas all 9 isolates of <span class="elsevierStyleItalic">C&#46; gattii</span> were classified as strong-positive producers of phospholipase&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">Using the disk diffusion test &#40;CLSI M44-A&#41;&#44; 81&#44; 35 and 100&#37; of the isolates of <span class="elsevierStyleItalic">C&#46; neoformans</span> were identified as susceptible to fluconazole&#44; itraconazole and amphotericin B&#44; respectively&#44; and 78&#37;&#44; 56&#37; and 100&#37; of the isolates of <span class="elsevierStyleItalic">C&#46; gattii</span> were susceptible to these antifungal compounds &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; The average MIC for amphotericin B&#44; evaluated by <span class="elsevierStyleItalic">E</span>-test methodology&#44; was 0&#46;26<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;22<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL for <span class="elsevierStyleItalic">C&#46; neoformans</span> and 0&#46;58<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;53<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL for <span class="elsevierStyleItalic">C&#46; gattii</span>&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0070" class="elsevierStylePara elsevierViewall">DNA was extracted from all clinical isolates and was used to identify the molecular genotypes by <span class="elsevierStyleItalic">URA5</span>-RFLP&#46; All 9 isolates of <span class="elsevierStyleItalic">C&#46; gattii</span> possessed a fingerprint pattern consistent with the VGII molecular genotype&#44; and all 31 isolates of <span class="elsevierStyleItalic">C&#46; neoformans</span> had the profile of the VNI molecular type&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3</span><span class="elsevierStyleSectionTitle">Discussion</span><p id="par0075" class="elsevierStylePara elsevierViewall">The total number of the inhabitants in the state of Amazonas is approximately 3&#46;5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">6</span> and according to the Mycology Service of the Foundation of Tropical Medicine of Manaus&#44; 20&#8211;25 new cases of cryptococcosis occur annually in the region&#46; Manaus&#44; the capital of Amazonas State&#44; is located near the centre of the Amazon Basin on the left bank of the Rio Negro&#44; consisting of Tertiary sediments on sandy-clay land&#46; The region has an average rainfall of 2300<span class="elsevierStyleHsp" style=""></span>mm&#47;year and is thus associated with a hot and humid climate and lush vegetation&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> In this study&#44; the incidence of cryptococcosis was not related to these weather patterns&#44; as the number of isolates was similar throughout the year&#46; The identification of potential environmental sources of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gatii</span> that are introduced into the human population requires further investigation&#46; It is hypothesise that the sources of contamination are similar to those described in other countries&#58; human infection with the <span class="elsevierStyleItalic">Cryptoccocus</span> type VNI primarily occurs from contact with bird faeces&#44; and infection with the VGII type usually occurs following contact with decomposing vegetal biomass&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">This is one of the first studies to characterise cryptococcosis in the Amazonas State in Brazil&#46; This study determined that the patients most affected by cryptococcosis were male&#44; young &#40;16&#8211;30 years old&#41;&#44; HIV-positive and inhabitants of the east zone of the city of Manaus&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">The number of cases of HIV&#47;AIDS reported annually in the Amazonas State is approximately 700&#44; half of them receive HAART treatment&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a> AIDS is the most important risk factor for cryptococcosis&#44; due to the suppression of immune responses by the HIV virus&#46;<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9&#44;13&#44;26</span></a><span class="elsevierStyleItalic">C&#46; neoformans</span> was the species most frequently isolated &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>31&#59; 77&#46;5&#37;&#41;&#44; which is consistent with the 82&#46;3&#37; reported in the literature&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;19</span></a><span class="elsevierStyleItalic">C&#46; neoformans</span> almost exclusively causes disease in immunocompromised patients&#44; and the majority of the isolates that we obtained came from patients with AIDS&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;19</span></a> Among the nine <span class="elsevierStyleItalic">C&#46; gattii</span> isolates&#44; three were obtained from immunocompetent patients&#44; four from AIDS patients and two from patients without documented immune status&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">In this study&#44; we obtained three isolates from children aged 0&#8211;15 years&#46; <span class="elsevierStyleItalic">C&#46; gattii</span> was the primary causative agent of meningitis in these patients&#46; In a previous study in the Amazonas State from 1988 to 1998&#44; Martins<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> reported that the frequency of cryptococcosis in children represented 33&#37; of the total cases&#46; In the Par&#225; state&#44; neighbouring the Amazonas State&#44; 19&#8211;24&#37; of cryptococcosis cases were reported in children over the last 10 years&#46;<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">28&#44;29</span></a> These studies demonstrate that in the Amazon Rainforest&#44; the prevalence of cryptococcosis in children is high and is also associated with the molecular type VGII&#46; Further epidemiological studies and environmental sampling are necessary to define the importance of the environmental conditions in the incidence of cryptococcosis cases in children&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">The production of lipases and proteases is related to the virulence of <span class="elsevierStyleItalic">Cryptococcus</span> pathogenic species&#46;<a class="elsevierStyleCrossRefs" href="#bib0035"><span class="elsevierStyleSup">7&#44;8</span></a> These enzymes are involved in the destruction of cellular structures to both obtain nutrients for the fungal pathogens and to facilitate spread throughout tissues&#46; Both <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> produced proteases and lipases in similar quantities&#44; and no difference was observed between molecular types&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">Antifungal cryptococcosis testing showed 80&#37; and 77&#37; susceptibility to fluconazole in <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span>&#44; respectively&#46; This maintenance drug is commonly used in patients with AIDS to prevent opportunistic fungal diseases&#44; and the emergence of resistant strains has been described&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;9</span></a><span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> had 35&#37; and 55&#37; susceptibility to itraconozole&#44; respectively&#44; and all of the clinical isolates were susceptible to amphotericin B&#46; These results are consistent with previous studies&#46;<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;22&#44;27</span></a> Amphotericin B is considered to be the gold standard for cryptococcosis treatment&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> In one study&#44; amphotericin B resistance was reported in 10&#37; of clinical isolates&#44;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> but other studies demonstrate low in vitro resistance to this compound&#46;<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;27</span></a> Although all isolates were considered to be susceptible to amphotericin B &#40;MIC<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>2<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL&#41;&#44; the average MIC of the <span class="elsevierStyleItalic">C&#46; gattii</span> isolates &#40;0&#46;56<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL&#41; was greater than that of <span class="elsevierStyleItalic">C&#46; neoformans</span> isolates &#40;0&#46;26<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL&#41;&#46; This result has been previously reported<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a> and highlights the potential for differential efficacy of therapeutics in the treatment of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span>&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">The identification of pathogenic <span class="elsevierStyleItalic">Cryptococcus</span> species and sub-species are important for both clinical guiding and as well as for epidemiology&#46; Recently&#44; false-positive <span class="elsevierStyleItalic">C&#46; gattii</span> results have been reported using the conventional CGB differentiation method due to the existence of <span class="elsevierStyleItalic">C&#46; neoformans</span> isolates that are resistant to canavanine<span class="elsevierStyleItalic">&#46;</span><a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> Meanwhile&#44; PCR fingerprinting and PCR-RFLP are being utilized more frequently&#46;<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9&#44;20&#44;24</span></a> In the current study&#44; PCR-RFLP was used to characterize the <span class="elsevierStyleItalic">Cryptococcus</span> isolates as the molecular types VNI and VGII&#46; Furthermore&#44; these results are consistent with previous studies that identified <span class="elsevierStyleItalic">C&#46; neoformans</span> VNI as the primary agent of cryptococcosis&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#44;16&#44;19</span></a> A study that characterized 63 Brazilian isolates described the prevalence of the molecular types VNI &#40;82&#46;3&#37;&#41;&#44; VGII &#40;13&#46;6&#37;&#41; and VNII &#40;3&#46;0&#37;&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> and more recent studies in the Par&#225; state reinforce the prevalence of VNI and VGII as being the principal molecular types of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span>&#44; respectively&#44; in the northern region of Brazil&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">Data from this study can assist with current and future management of cryptococcosis in Northern Brazil by identifying the frequency of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> in patients as well as their susceptibility to commonly used antifungal drugs&#46; These data also contribute to epidemiological studies of the distribution of different molecular types of <span class="elsevierStyleItalic">Cryptococcus</span> species in the Brazilian Amazon&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Conflict of interest</span><p id="par0115" class="elsevierStylePara elsevierViewall">The authors have no conflict of interest to declare&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:2 [
          "identificador" => "xres121165"
          "titulo" => array:6 [
            0 => "Abstract"
            1 => "Background"
            2 => "Aims"
            3 => "Methods"
            4 => "Results"
            5 => "Conclusions"
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec108451"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xres121166"
          "titulo" => array:6 [
            0 => "Resumen"
            1 => "Antecedentes"
            2 => "Objetivos"
            3 => "M&#233;todos"
            4 => "Resultados"
            5 => "Conclusiones"
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec108452"
          "titulo" => "Palabras clave"
        ]
        4 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Isolates and strains"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Patient information"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Identification of the species"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Enzyme quantification"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Susceptibility to antifungal agents"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Characterization of molecular genotypes"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0045"
          "titulo" => "Results"
        ]
        6 => array:2 [
          "identificador" => "sec0050"
          "titulo" => "Discussion"
        ]
        7 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Conflict of interest"
        ]
        8 => array:2 [
          "identificador" => "xack37740"
          "titulo" => "Acknowledgement"
        ]
        9 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2010-08-09"
    "fechaAceptado" => "2011-05-13"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec108451"
          "palabras" => array:4 [
            0 => "<span class="elsevierStyleItalic">Cryptococcus neoformans</span>"
            1 => "<span class="elsevierStyleItalic">Cryptococcus gattii</span>"
            2 => "Epidemiology"
            3 => "Phenotyping and genotyping"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec108452"
          "palabras" => array:4 [
            0 => "<span class="elsevierStyleItalic">Cryptococcus neoformans</span>"
            1 => "<span class="elsevierStyleItalic">Cryptococcus gattii</span>"
            2 => "Epidemiolog&#237;a"
            3 => "Fenotipo y genotipo"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span class="elsevierStyleSectionTitle">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">The differentiation and classification of pathogenic <span class="elsevierStyleItalic">Cryptococcus</span> species provides useful data for epidemiological studies and for the clinical diagnosis and treatment of patients&#46;</p> <span class="elsevierStyleSectionTitle">Aims</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">The aim of this study was to characterise 40 clinical <span class="elsevierStyleItalic">Cryptococcus</span> isolates obtained from patients at the Tropical Medicine Foundation of Amazonas &#40;FMTAM&#41; from 2006 to 2008&#46;</p> <span class="elsevierStyleSectionTitle">Methods</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">It was used phenotypic &#40;i&#46;e&#46;&#44; enzyme production and antifungal resistance&#41; and molecular biological &#40;<span class="elsevierStyleItalic">URA5</span>-RFLP&#41; experiments&#46;</p> <span class="elsevierStyleSectionTitle">Results</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Patients with HIV&#47;AIDS were most affected with cryptococcosis&#46; Thirty-one &#40;75&#46;5&#37;&#41; of the clinical isolates were classified as <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and 9 &#40;22&#46;5&#37;&#41; as <span class="elsevierStyleItalic">Cryptococcus gattii</span>&#46; High amounts of protease and phospholipase enzymes were produced by most of the isolates&#46; Using the disk diffusion test &#40;CLSI M44-A&#41;&#44; 81&#44; 35 and 100&#37; of the <span class="elsevierStyleItalic">C&#46; neoformans</span> isolates were characterized as susceptible to fluconazole&#44; itraconazole and amphotericin B&#44; respectively&#44; whereas 78&#44; 56 and 100&#37; of the <span class="elsevierStyleItalic">C&#46; gattii</span> isolates were susceptible to these antimicrobial agents&#46; The average of Minimal Inhibitory Concentration &#40;MIC&#41; for <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> isolates was 0&#46;26 and 0&#46;58<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL&#44; respectively&#46; The 9 isolates of <span class="elsevierStyleItalic">C&#46; gattii</span> had a fingerprint pattern comparable with the VGII molecular type&#44; while all 31 isolates of <span class="elsevierStyleItalic">C&#46; neoformans</span> presented with a pattern consistent with the VNI type&#46;</p> <span class="elsevierStyleSectionTitle">Conclusions</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">This study confirms the importance of HIV&#47;AIDS for the cryptococcosis epidemiology&#44; the susceptibility of the isolates to amphotericin B and the high prevalence of the molecular genotypes VNI and VGII in the north of Brazil&#46;</p>"
      ]
      "es" => array:2 [
        "titulo" => "Resumen"
        "resumen" => "<span class="elsevierStyleSectionTitle">Antecedentes</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">La diferenciaci&#243;n y clasificaci&#243;n de las especies pat&#243;genas del g&#233;nero <span class="elsevierStyleItalic">Cryptococcus</span> aporta datos importantes para la asistencia cl&#237;nica y para estudios epidemiol&#243;gicos&#46;</p> <span class="elsevierStyleSectionTitle">Objetivos</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El objetivo de este trabajo fue caracterizar 40 aislamientos cl&#237;nicos del complejo <span class="elsevierStyleItalic">Cryptococcus neoformans</span> de pacientes que fueron atendidos en la Fundaci&#243;n de Medicina Tropical de Amazonas desde 2006 hasta 2008&#46;</p> <span class="elsevierStyleSectionTitle">M&#233;todos</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Se utilizaron m&#233;todos fenot&#237;picos &#40;producci&#243;n de enzimas y pruebas de sensibilidad a los antif&#250;ngicos&#41; y moleculares &#40;URA5-RFLP&#41;&#46;</p> <span class="elsevierStyleSectionTitle">Resultados</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Los pacientes con VIH&#47;sida fueron los m&#225;s afectados de criptococosis&#46; Se observ&#243; que 31 &#40;75&#44;5&#37;&#41; y 9 &#40;22&#44;5&#37;&#41; de los aislamientos fueron <span class="elsevierStyleItalic">Cryptococcus neoformans</span> y <span class="elsevierStyleItalic">Cryptococcus gattii</span>&#44; respectivamente&#46; La producci&#243;n de proteasa y fosfolipasa fue alta en la mayor&#237;a de las cepas&#46; Utilizando la prueba de difusi&#243;n en disco &#40;CLSI M44-A&#41; se observ&#243; que el 81&#44; 35 y 100&#37; de los aislamientos de <span class="elsevierStyleItalic">C&#46; neoformans</span> fueron sensibles al fluconazol&#44; itraconazol y amphotericin B&#44; respectivamente&#44; mientras que 78&#44; 56 y 100&#37; de los aislamientos de <span class="elsevierStyleItalic">C&#46; gattii</span> fueron sensibles a estas sustancias&#46; El valor promedio de la concentraci&#243;n m&#237;nima inhibitoria &#40;CMI&#41; para <span class="elsevierStyleItalic">C&#46; neoformans</span> y <span class="elsevierStyleItalic">C&#46; gattii</span> fue de 0&#44;26 y 0&#44;58<span class="elsevierStyleHsp" style=""></span>mg&#47;ml&#44; respectivamente&#46; Todos los aislamientos &#40;9&#41; de <span class="elsevierStyleItalic">C&#46; gattii</span> presentaron un patr&#243;n de electroforesis compatible con el genotipo VGII&#44; y todos los aislamientos &#40;31&#41; de <span class="elsevierStyleItalic">C&#46; neoformans</span> presentaron el genotipo VNI&#46;</p> <span class="elsevierStyleSectionTitle">Conclusiones</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Este estudio confirma la importancia del HIV&#47;sida para la epidemiolog&#237;a de la criptococosis&#44; la sensibilidad de los aislamientos a la anfotericina B y la alta prevalencia de los genotipos moleculares VNI y VGII en el norte de Brasil&#46;</p>"
      ]
    ]
    "multimedia" => array:2 [
      0 => array:7 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">C&#46; neoformans</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">C&#46; gattii</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Total &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Sex</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;30&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Age &#40;Years&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>0&#8211; 5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>16&#8211;30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;53&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>31&#8211;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>46&#8211;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;10&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#62;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HIV Infection</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;10&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29 &#40;73&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Unknown&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Area of the residence in Manaus</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>North&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;12&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>South&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>East&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;24&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>West&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>South Central&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Midwest&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;12&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Unknown&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;33&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Biological sample</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Cerebrospinal fluid&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37 &#40;92&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Blood culture&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Sputum&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab209030.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Epidemiological characteristics of patients with cryptococcosis&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Antifungal&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Susceptible&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Intermediate&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Resistant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">N &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">N &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">N &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">C&#46; neoformans</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Fluconazole&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;80&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;16&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;3&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Itraconazole&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;35&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;64&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Amphotericin B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">C&#46; gattii</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Fluconazole&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;77&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;22&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Itraconazole&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;55&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;44&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Amphotericin B&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;100&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab209029.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">- Susceptibility of <span class="elsevierStyleItalic">C&#46; neoformans</span> and <span class="elsevierStyleItalic">C&#46; gattii</span> to antifungal compounds&#44; as measured by disk diffusion&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:33 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Urban sources of <span class="elsevierStyleItalic">Cryptococcus spp</span> &#8211; Lisbon"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "F&#46;M&#46; Bernardo"
                            1 => "H&#46;M&#46; Martins"
                            2 => "M&#46;L&#46; Martins"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Ver Port Clin"
                        "fecha" => "2001"
                        "volumen" => "96"
                        "paginaInicial" => "157"
                        "paginaFinal" => "160"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Brasil&#44; Minist&#233;rio da Sa&#250;de&#46; Documentos e publica&#231;&#245;es em DST e AIDS&#46; Coordena&#231;&#227;o do programa nacional de DTS&#47;AIDS&#46; <span class="elsevierStyleItalic">Epidemiol Vigilance</span>&#46; 2004&#58;1&#46; Available at&#58; <a class="elsevierStyleInterRef" href="http://www.aids.gov.br/">http&#58;&#47;&#47;www&#46;aids&#46;gov&#46;br</a> &#91;consulted on 03-22-2009&#93;&#46;"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diversity of the <span class="elsevierStyleItalic">Cryptococcus neoformans</span>&#8211;<span class="elsevierStyleItalic">Cryptococcus gattii</span> species complex"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Bovers"
                            1 => "F&#46; Hagen"
                            2 => "T&#46; Boekhout"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Iberoam Micol"
                        "fecha" => "2008"
                        "volumen" => "25"
                        "paginaInicial" => "4"
                        "paginaFinal" => "12"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reference method for antifungal disk diffusion susceptibility testing of yeasts&#59; Approved guideline"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Clinical Laboratory Standards Institute &#40;CLSI&#41;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "titulo" => "NCCLS document M44-A"
                        "fecha" => "2004"
                        "editorial" => "National Committee for Clinical Laboratory Standards"
                        "editorialLocalizacion" => "Wayne&#44; PA"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In vitro antifungal susceptibility of clinical isolates of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> var&#46; <span class="elsevierStyleItalic">neoformans</span> and <span class="elsevierStyleItalic">C&#46; neoformans</span> var&#46; <span class="elsevierStyleItalic">gattii</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; De Bedout"
                            1 => "N&#46; Ord&#243;&#241;ez"
                            2 => "B&#46;L&#46; G&#243;mez"
                            3 => "M&#46;C&#46; Rodr&#237;guez"
                            4 => "M&#46; Arango"
                            5 => "A&#46; Restrepo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Iberoam Micol"
                        "fecha" => "1999"
                        "volumen" => "16"
                        "paginaInicial" => "36"
                        "paginaFinal" => "39"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18473590"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison of three commercial assays and a modified disk diffusion assay with two broth microdilution reference assays for testing zygomycetes&#44; <span class="elsevierStyleItalic">Aspergillus</span> spp&#46;&#44; <span class="elsevierStyleItalic">Candida</span> spp&#46;&#44; and <span class="elsevierStyleItalic">Cryptococcus neoformans</span> with posaconazole and amphotericin B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "A&#46; Espinel-Ingroff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.01187-06"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2006"
                        "volumen" => "44"
                        "paginaInicial" => "3616"
                        "paginaFinal" => "3622"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16943356"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of inositol phospho-sphingolipid-phospholipase C1 &#40;Isc1&#41; in <span class="elsevierStyleItalic">Cryptococcus neoformans</span> reveals unique biochemical features"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Henry"
                            1 => "A&#46; Guillotte"
                            2 => "C&#46; Luberto"
                            3 => "M&#46; Del Poeta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.febslet.2011.01.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "FEBS Lett"
                        "fecha" => "2011"
                        "volumen" => "585"
                        "paginaInicial" => "635"
                        "paginaFinal" => "640"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21256847"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role and mechanism of diacylglycerol-protein kinase C1 signaling in melanogenesis by <span class="elsevierStyleItalic">Cryptococcus neoformans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46;J&#46; Heung"
                            1 => "A&#46;C&#46; Kaiser"
                            2 => "C&#46; Luberto"
                            3 => "M&#46;D&#46; Poeta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M503404200"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2005"
                        "volumen" => "280"
                        "paginaInicial" => "28547"
                        "paginaFinal" => "28555"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15946943"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular epidemiology of clinical <span class="elsevierStyleItalic">Cryptococcus neoformans</span> strains from India"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Jain"
                            1 => "B&#46;L&#46; Wickes"
                            2 => "S&#46;M&#46; Keller"
                            3 => "J&#46; Fu"
                            4 => "A&#46; Casadevall"
                            5 => "P&#46; Jain"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.43.11.5733-5742.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2005"
                        "volumen" => "43"
                        "paginaInicial" => "5733"
                        "paginaFinal" => "5742"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16272511"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Drug resistance in <span class="elsevierStyleItalic">Cryptococcus neoformans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46;P&#46; John"
                            1 => "M&#46;C&#46; Gary"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1999"
                        "volumen" => "2"
                        "paginaInicial" => "259"
                        "paginaFinal" => "269"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A rare genotype of <span class="elsevierStyleItalic">Cryptococcus gattii</span> caused the cryptococcosis outbreak on Vancouver Island &#40;British Columbia&#44; Canada&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;E&#46; Kidd"
                            1 => "F&#46; Hagen"
                            2 => "R&#46;L&#46; Tscharke"
                            3 => "M&#46; Huynh"
                            4 => "K&#46;H&#46; Bartlett"
                            5 => "M&#46; Fyfe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2004"
                        "volumen" => "172"
                        "paginaInicial" => "58"
                        "paginaFinal" => "63"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Safety and efficacy of liposomal amphotericin B in patients with cryptococcal meningitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "R&#46;N&#46; Kotwani"
                            1 => "P&#46;C&#46; Gokhale"
                            2 => "P&#46;V&#46; Bodhe"
                            3 => "B&#46;G&#46; Kirodian"
                            4 => "N&#46;A&#46; Kshirsagar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Assoc Physicians India"
                        "fecha" => "2001"
                        "volumen" => "49"
                        "paginaInicial" => "1086"
                        "paginaFinal" => "1090"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11868862"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cryptococcosis&#58; clinical and biological aspects"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "K&#46;J&#46; Kwon-Chung"
                            1 => "T&#46;C&#46; Sorrell"
                            2 => "F&#46; Dromer"
                            3 => "E&#46; Fung"
                            4 => "S&#46;M&#46; Levitz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Med Mycol"
                        "fecha" => "2000"
                        "volumen" => "38"
                        "paginaInicial" => "205"
                        "paginaFinal" => "213"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11204147"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of resistance to amphotericin B among <span class="elsevierStyleItalic">Cryptococcus neoformans</span> clinical isolates&#58; performances of three different media assessed by using E-test and National Committee for Clinical Laboratory Standards M27-A methodologies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Lozano-Chiu"
                            1 => "V&#46;L&#46; Paetznick"
                            2 => "M&#46;A&#46; Ghannoum"
                            3 => "J&#46;H&#46; Rex"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1998"
                        "volumen" => "36"
                        "paginaInicial" => "2817"
                        "paginaFinal" => "2822"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9738026"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Martins LMS&#46; Epidemiologia da criptococose em crian&#231;as e adultos jovens e diversidade de <span class="elsevierStyleItalic">Cryptococcus neoformans</span> no meio Norte do Brasil&#46; MSc thesis&#46; Fiocruz&#44; Rio de Janeiro&#58; Instituto Oswaldo Cruz&#59; 2003&#46;"
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genotipagem&#44; sorotipagem e determina&#231;&#227;o de mating-type de isolados cl&#237;nicos de <span class="elsevierStyleItalic">Cryptococcus neoformans</span> do Estado de S&#227;o Paulo&#44; Brasil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;T&#46; Matsumoto"
                            1 => "A&#46;M&#46; Fusco-Almeida"
                            2 => "L&#46;C&#46; Baeza"
                            3 => "M&#46;S&#46;C&#46; Melhem"
                            4 => "M&#46;J&#46;S&#46; Medes-Giannini"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop S Paulo"
                        "fecha" => "2007"
                        "volumen" => "39"
                        "paginaInicial" => "3"
                        "paginaFinal" => "6"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular typing of Ibero American <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "W&#46;E&#46; Meyer"
                            1 => "S&#46; Kidd"
                            2 => "A&#46; Casta&#241;eda"
                            3 => "S&#46; Jackson"
                            4 => "M&#46; Huynh"
                            5 => "G&#46;N&#46; Latouche"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3201/eid0902.020246"
                      "Revista" => array:6 [
                        "tituloSerie" => "Emerg Infect Dis"
                        "fecha" => "2003"
                        "volumen" => "9"
                        "paginaInicial" => "189"
                        "paginaFinal" => "195"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12603989"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Criptococose&#58; estudo cl&#237;nico-epidemiol&#243;gico&#44; laboratorial e das variedades do fungo em 96 pacientes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46;A&#46; Moreira"
                            1 => "M&#46;S&#46; Ferreira"
                            2 => "R&#46;M&#46; Ribas"
                            3 => "A&#46;S&#46; Borges"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Soc Bras Med Trop"
                        "fecha" => "2006"
                        "volumen" => "39"
                        "paginaInicial" => "255"
                        "paginaFinal" => "258"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16906248"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serotyping of 467 <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates from clinical and environmental sources in Brazil&#58; analysis of host and regional patterns"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;M&#46; Nishikawa"
                            1 => "S&#46;M&#46; Lazera"
                            2 => "G&#46;G&#46; Barbosa"
                            3 => "L&#46; Trilles"
                            4 => "B&#46;R&#46; Balassiano"
                            5 => "R&#46;C&#46;L&#46; Macedo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2003"
                        "volumen" => "41"
                        "paginaInicial" => "73"
                        "paginaFinal" => "77"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12517828"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serotype&#44; mating type and ploidy of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> strains isolated from patients in Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Ohkusu"
                            1 => "K&#46; Hata"
                            2 => "K&#46; Takeo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Inst Med Trop S Paulo"
                        "fecha" => "2002"
                        "volumen" => "44"
                        "paginaInicial" => "299"
                        "paginaFinal" => "302"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12532211"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Criptococose&#58; revis&#227;o sobre a experi&#234;ncia brasileira sobre a doen&#231;a"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;C&#46;S&#46;M&#46; Pappalardo"
                            1 => "M&#46;S&#46;C&#46; Melhem"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop S Paulo"
                        "fecha" => "2003"
                        "volumen" => "45"
                        "paginaInicial" => "73"
                        "paginaFinal" => "78"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In vitro susceptibilities of clinical isolates of <span class="elsevierStyleItalic">Candida</span> species&#44; <span class="elsevierStyleItalic">Cryptococcus neoformans</span>&#44; and <span class="elsevierStyleItalic">Aspergillus</span> species to itraconazole&#58; global survey of 9359 isolates tested by clinical and laboratory standards institute broth microdilution methods"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;A&#46; Pfaller"
                            1 => "L&#46; Boyken"
                            2 => "R&#46;J&#46; Hollis"
                            3 => "S&#46;A&#46; Messer"
                            4 => "S&#46; Tendolkar"
                            5 => "D&#46;J&#46; Diekema"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.43.8.3807-3810.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "2005"
                        "volumen" => "43"
                        "paginaInicial" => "3807"
                        "paginaFinal" => "3810"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16081915"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Plate method for detection of phospholipase activity in <span class="elsevierStyleItalic">Candida albicans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;F&#46; Price"
                            1 => "I&#46;D&#46; Wilkinson"
                            2 => "I&#46;O&#46; Gentry"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Sabouraudia"
                        "fecha" => "1982"
                        "volumen" => "20"
                        "paginaInicial" => "15"
                        "paginaFinal" => "20"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7064045"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular characterization of environmental <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolated in Vitoria&#44; ES&#44; Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;A&#46; Ribeiro"
                            1 => "P&#46; Ngamskulrungroj"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Inst Med Trop S Paulo"
                        "fecha" => "2008"
                        "volumen" => "50"
                        "paginaInicial" => "25"
                        "paginaFinal" => "28"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18383630"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A comparison of secretory proteinases from different strains of <span class="elsevierStyleItalic">Candida albicans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46; Ruchel"
                            1 => "K&#46; Uhlemann"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Sabouraudia"
                        "fecha" => "1982"
                        "volumen" => "20"
                        "paginaInicial" => "233"
                        "paginaFinal" => "244"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6753190"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Relationship of the glyoxylate pathway to the pathogenesis of <span class="elsevierStyleItalic">Cryptococcus neoformans</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46;H&#46; Rude"
                            1 => "D&#46;L&#46; Toffaletti"
                            2 => "G&#46;M&#46; Cox"
                            3 => "J&#46;R&#46; Perfect"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Infect Immun"
                        "fecha" => "2002"
                        "volumen" => "70"
                        "paginaInicial" => "5684"
                        "paginaFinal" => "5694"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12228298"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Unusual presentation of central nervous system Cryptococcal infection in an immunocompetent patient"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "G&#46; Salgal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Neuroradiol"
                        "fecha" => "2005"
                        "volumen" => "26"
                        "paginaInicial" => "2522"
                        "paginaFinal" => "2526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16286394"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Primary endemic <span class="elsevierStyleItalic">Cryptococcosis gattii</span> by molecular type VGII in the state of Par&#225;&#44; Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46;R&#46; Santos"
                            1 => "W&#46; Meyer"
                            2 => "B&#46; Wanke"
                            3 => "S&#46;P&#46;S&#46;C&#46; Costa"
                            4 => "T&#46; Luciana"
                            5 => "J&#46;L&#46;M&#46; Nascimento"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mem Inst Oswaldo Cruz"
                        "fecha" => "2008"
                        "volumen" => "103"
                        "paginaInicial" => "813"
                        "paginaFinal" => "818"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19148422"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Caracteriza&#231;&#227;o dos isolados cl&#237;nicos de esp&#233;cies do complexo Cryptococcus neoformans em Bel&#233;m do Par&#225;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "W&#46;R&#46; Santos"
                            1 => "W&#46; Meyer"
                            2 => "B&#46; Wanke"
                            3 => "S&#46;P&#46;S&#46;C&#46; Costa"
                            4 => "T&#46; Luciana"
                            5 => "J&#46;L&#46;M&#46; Nascimento"
                            6 => "Medeiros R"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:3 [
                        "titulo" => "Norte do Brasil"
                        "fecha" => "2007"
                        "editorial" => "Congresso Brasileiro de Micologia"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Padr&#227;o da infec&#231;&#227;o pelo HIV&#47;AIDS em Manaus&#44; Estado do Amazonas&#44; no per&#237;odo de 1986 a 2000"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46;C&#46;F&#46; Silva"
                            1 => "E&#46;M&#46; Santos"
                            2 => "N&#46;A&#46;L&#46; Silva"
                            3 => "A&#46;E&#46; Miranda"
                            4 => "S&#46; Talhari"
                            5 => "L&#46;M&#46; Toledo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Soc Bras Med Trop"
                        "fecha" => "2009"
                        "volumen" => "42"
                        "paginaInicial" => "543"
                        "paginaFinal" => "550"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19967237"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Silva MSR Perfil da qualidade das &#225;guas subterr&#226;neas de Manaus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46;L&#46; Silva"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Holos Environ"
                        "fecha" => "2007"
                        "volumen" => "1"
                        "paginaInicial" => "1"
                        "paginaFinal" => "13"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Cryptococcus neoformans</span> variety <span class="elsevierStyleItalic">gattii</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "T&#46;C&#46; Sorrell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Med Mycol"
                        "fecha" => "2001"
                        "volumen" => "39"
                        "paginaInicial" => "155"
                        "paginaFinal" => "168"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11346263"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Extracellular enzymatic activity and serotype of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> strains isolated from AIDS patients in Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "V&#46; Vidotto"
                            1 => "M&#46; Melhem"
                            2 => "S&#46; Pukinskas"
                            3 => "S&#46; Aoki"
                            4 => "C&#46; Carrara"
                            5 => "A&#46; Pugliese"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Iberoam Micol"
                        "fecha" => "2005"
                        "volumen" => "22"
                        "paginaInicial" => "29"
                        "paginaFinal" => "33"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15813680"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:3 [
        "identificador" => "xack37740"
        "titulo" => "Acknowledgement"
        "texto" => "<p id="par0120" class="elsevierStylePara elsevierViewall">The authors are grateful to <span class="elsevierStyleGrantSponsor">Funda&#231;&#227;o de Amparo a Pesquisa do Estado do Amazonas &#40;FAPEAM&#41;</span> for the financial support&#46;</p>"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/11301406/0000002900000001/v1_201305061404/S1130140611000611/v1_201305061404/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "7997"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/11301406/0000002900000001/v1_201305061404/S1130140611000611/v1_201305061404/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1130140611000611?idApp=UINPBA00004N"
]

Article information

ISSN: 11301406
Original language: English

DOI:10.1016/j.riam.2011.05.003

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 October	17	2	19
2024 September	16	3	19
2024 August	26	9	35
2024 July	19	8	27
2024 June	23	6	29
2024 May	19	12	31
2024 April	10	19	29
2024 March	22	21	43
2024 February	11	9	20
2024 January	8	3	11
2023 December	12	8	20
2023 November	11	9	20
2023 October	6	9	15
2023 September	9	8	17
2023 August	4	7	11
2023 July	8	10	18
2023 June	5	5	10
2023 May	7	11	18
2023 April	5	7	12
2023 March	7	5	12
2023 February	9	11	20
2023 January	27	11	38
2022 December	15	5	20
2022 November	17	17	34
2022 October	21	10	31
2022 September	9	8	17
2022 August	9	12	21
2022 July	8	9	17
2022 June	10	11	21
2022 May	22	3	25
2022 April	17	24	41
2022 March	19	10	29
2022 February	6	11	17
2022 January	8	11	19
2021 December	11	11	22
2021 November	12	9	21
2021 October	6	4	10
2021 September	11	15	26
2021 August	9	6	15
2021 July	6	6	12
2021 June	9	8	17
2021 May	8	7	15
2021 April	15	18	33
2021 March	17	9	26
2021 February	7	11	18
2021 January	9	16	25
2020 December	12	8	20
2020 November	8	7	15
2020 October	7	10	17
2020 September	9	13	22
2020 August	14	12	26
2020 July	5	4	9
2020 June	9	8	17
2020 May	10	12	22
2020 April	5	10	15
2020 March	9	9	18
2020 February	3	4	7
2020 January	10	11	21
2019 December	7	4	11
2019 November	6	16	22
2019 October	4	3	7
2019 September	4	8	12
2019 August	7	5	12
2019 July	15	11	26
2019 June	23	19	42
2019 May	50	15	65
2019 April	21	23	44
2019 March	1	5	6
2019 February	4	4	8
2019 January	3	6	9
2018 December	3	2	5
2018 November	9	4	13
2018 October	3	4	7
2018 September	18	5	23
2018 August	2	6	8
2018 July	5	5	10
2018 June	2	0	2
2018 May	3	9	12
2018 April	8	0	8
2018 March	9	4	13
2018 February	13	0	13
2018 January	4	2	6
2017 December	19	2	21
2017 November	3	3	6
2017 October	11	3	14
2017 September	9	5	14
2017 August	20	28	48
2017 July	7	4	11
2017 June	17	27	44
2017 May	17	13	30
2017 April	12	20	32
2017 March	10	7	17
2017 February	10	3	13
2017 January	21	4	25
2016 December	24	10	34
2016 November	13	9	22
2016 October	50	2	52
2016 September	17	7	24
2016 August	22	5	27
2016 July	17	3	20
2016 June	42	10	52
2016 May	32	6	38
2016 April	9	7	16
2016 March	4	5	9
2016 February	9	4	13
2016 January	21	8	29
2015 December	29	5	34
2015 November	31	3	34
2015 October	27	5	32
2015 September	34	6	40
2015 August	38	2	40
2015 July	25	5	30
2015 June	35	1	36
2015 May	27	5	32
2015 April	13	3	16
2015 March	32	4	36
2015 February	27	2	29
2015 January	28	3	31
2014 December	42	6	48
2014 November	39	1	40
2014 October	42	6	48
2014 September	41	2	43
2014 August	45	0	45
2014 July	35	0	35
2014 June	38	2	40
2014 May	27	3	30
2014 April	27	2	29
2014 March	44	8	52
2014 February	45	17	62
2014 January	40	8	48
2013 December	56	5	61
2013 November	36	14	50
2013 October	15	16	31
2013 September	17	10	27
2013 August	31	7	38
2013 July	24	8	32
2013 June	12	5	17
2013 May	15	9	24
2013 April	19	10	29
2013 March	13	11	24
2013 February	8	4	12
2013 January	7	6	13
2012 December	4	3	7
2012 November	2	2	4
2012 October	2	1	3
2012 January	778	0	778

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter