STRUCTURE-FUNCTION STUDIES OF THE ALPHA PHEROMONE RECEPTOR FROM YEAST | TIP. Revista Especializada en Ciencias Químico-Biológicas

array:24 ["pii" => "S1405888X16300134" "issn" => "1405888X" "doi" => "10.1016/j.recqb.2016.11.002" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "27" "copyright" => "Universidad Nacional Autónoma de México, Facultad de Estudios Superiores Zaragoza" "copyrightAnyo" => "2017" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "TIP. 2017;20:16-26" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 851 "formatos" => array:3 [ "EPUB" => 45 "HTML" => 665 "PDF" => 141 ] ] "itemSiguiente" => array:19 [ "pii" => "S1405888X16300146" "issn" => "1405888X" "doi" => "10.1016/j.recqb.2016.11.003" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "28" "copyright" => "Universidad Nacional Autónoma de México, Facultad de Estudios Superiores Zaragoza" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "ssu" "cita" => "TIP. 2017;20:27-39" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 4719 "formatos" => array:3 [ "EPUB" => 44 "HTML" => 4388 "PDF" => 287 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "ARTÍCULO DE REVISIÓN" "titulo" => "CONSIDERACIONES GENERALES EN EL ESTABLECIMIENTO DEL SEXO EN MAMÍFEROS" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "27" "paginaFinal" => "39" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "A consideration of the establishment of sex in mammals" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0030" "etiqueta" => "Figura 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 2769 "Ancho" => 3578 "Tamanyo" => 692802 ] ] "descripcion" => array:1 [ "es" => "Esquema de diferenciación de los genitales externos. A. Fase indiferenciada de los genitales externos, aproximadamente a las 4 semanas de gestación en humano. B. Desarrollo de los genitales externos en el varón, al nacimiento. El tubérculo genital crece y origina el falo, los pliegues cloacales se fusionan para dar origen a la uretra, las eminencias genitales se fusionan y originan el escroto. C. Formación de los genitales externos femeninos. El tubérculo genital aparenta una reducción de tamaño y da origen al clítoris. Los pliegues cloacales crecen para originar los labios menores, mientras que las eminencias genitales forman los labios mayores." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Verónica Díaz-Hernández, Horacio Merchant-Larios" "autores" => array:2 [ 0 => array:2 [ "nombre" => "Verónica" "apellidos" => "Díaz-Hernández" ] 1 => array:2 [ "nombre" => "Horacio" "apellidos" => "Merchant-Larios" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300146?idApp=UINPBA00004N" "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300146/v1_201612310020/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1405888X16300122" "issn" => "1405888X" "doi" => "10.1016/j.recqb.2016.11.001" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "26" "copyright" => "Universidad Nacional Autónoma de México, Facultad de Estudios Superiores Zaragoza" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "TIP. 2017;20:5-15" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 910 "formatos" => array:3 [ "EPUB" => 33 "HTML" => 678 "PDF" => 199 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "ARTÍCULO ORIGINAL" "titulo" => "COMPORTAMIENTO VOLUMÉTRICO DE LA DL-VALINA EN SOLUCIONES ACUOSAS DE NITRATO DE SODIO A DIFERENTES TEMPERATURAS" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "5" "paginaFinal" => "15" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Volumetric behavior of the DL-valine in aqueous solutions of sodium nitrate at different temperatures" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1073 "Ancho" => 1707 "Tamanyo" => 169104 ] ] "descripcion" => array:1 [ "es" => "Densidades de la DL-valina en mezcla acuosa de NaNO3 0.0106mol kg-1 a diferentes temperaturas. (Todos los sistemas acuosos de NaNO3 estudiados presentan la misma tendencia en sus datos)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Manuel Páez-Meza, Jorge Ramos-Montiel, Nicolás De La Espriella-Vélez" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Manuel" "apellidos" => "Páez-Meza" ] 1 => array:2 [ "nombre" => "Jorge" "apellidos" => "Ramos-Montiel" ] 2 => array:2 [ "nombre" => "Nicolás" "apellidos" => "De La Espriella-Vélez" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300122?idApp=UINPBA00004N" "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300122/v1_201612310020/es/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "ARTÍCULO ORIGINAL" "titulo" => "STRUCTURE-FUNCTION STUDIES OF THE ALPHA PHEROMONE RECEPTOR FROM YEAST" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "16" "paginaFinal" => "26" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Laura Marina Robles, César Millán-Pacheco, Nina Pastor, Gabriel Del Río" "autores" => array:4 [ 0 => array:3 [ "nombre" => "Laura" "apellidos" => "Marina Robles" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "César" "apellidos" => "Millán-Pacheco" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "Nina" "apellidos" => "Pastor" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:4 [ "nombre" => "Gabriel" "apellidos" => "Del Río" "email" => array:1 [ 0 => "gdelrio@ifc.unam.mx" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Departamento de Bioquímica y Biología Estructural, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Ciudad Universitaria, Deleg. Coyoacán, C.P. 04510, Ciudad de México, México" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Centro de Investigación en Dinámica Celular, IICBA, Universidad Autónoma del Estado de Morelos, Av. Universidad #1001, Col. Chamilpa, Cuernavaca, Morelos, C.P. 62209, México" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Facultad de Farmacia, Universidad Autónoma del Estado de Morelos, Av. Universidad #1001, Col. Chamilpa, Cuernavaca, Morelos, C.P. 62209, México" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Estudio de la relación entre la estructura y la función del receptor de la feromona alfa de levadura" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1415 "Ancho" => 3581 "Tamanyo" => 416347 ] ] "descripcion" => array:1 [ "en" => "Topological diagram of Ste2p. Every amino acid residue from Ste2p is represented by a single letter code within a gray circle. The two horizontal lines separating the extracellular from the intracellular spaces represent the membrane. Data derived from<a class="elsevierStyleCrossRef" href="#bib0100">20</a>." ] ] ] "textoCompleto" => "INTRODUCTIONOver the past four decades extensive research has been carried out about the structure-function relationships of G protein coupled receptors (GPCRs), promoted by both basic and applied aspects of this group of receptors; more than 40% of drugs in clinical use target GPCRs<a class="elsevierStyleCrossRef" href="#bib0005">1</a> and many fundamental aspects of cell physiology are regulated by these receptors<a class="elsevierStyleCrossRef" href="#bib0010">2</a>. Relevant to this study, the GPCR Ste2p from Saccharomyces cerevisiae mediates mating by recognizing the tridecapeptide mating factor, alpha pheromone.The first studies on Ste2p were reported in 1970-1980 when the molecular basis of mating in yeast cells was discovered. Many genes rendering a sterile (STE) phenotype were discovered, and among these was STE2<a class="elsevierStyleCrossRefs" href="#bib0015">3,4</a> that was further cloned and characterized<a class="elsevierStyleCrossRefs" href="#bib0025">5,6</a>. A few years later, the topological structure of Ste2p was inferred through solvent accessibility studies (<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>). Due to difficulties to purify and crystallize integral membrane proteins, the atomic three-dimensional structure of Ste2p has not yet been determined. However, NMR was used to determine the structures of two fragments of this receptor: the HI-H2 segment (Protein Data Base entry code: 2K9P), and a segment of H6 (PDB entry code: 1PJD)<a class="elsevierStyleCrossRefs" href="#bib0035">7,8</a>.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Several residues and regions that are critical for STE2 function have been determined by site-directed mutagenesis. For example, the N-terminal domain mediates oligomerization of the receptor<a class="elsevierStyleCrossRefs" href="#bib0045">9,10</a> while the C-terminal domain acts as negative regulator<a class="elsevierStyleCrossRefs" href="#bib0055">11–13</a>. The third cytoplasmic loop interacts with the trimeric G protein<a class="elsevierStyleCrossRef" href="#bib0070">14</a>, and the first extracellular loop undergoes a conformational change upon ligand binding<a class="elsevierStyleCrossRef" href="#bib0075">15</a> and also plays a role in signal transduction<a class="elsevierStyleCrossRef" href="#bib0080">16</a>.Three different 2D models of Ste2p bound to the pheromone have been proposed and were built based on biochemical data derived until 2004 in an attempt to recapitulate the structure-function studies of this receptor. Briefly, Lee B. K. and colleagues<a class="elsevierStyleCrossRef" href="#bib0085">17</a> proposed a model where both the N and C-termini of the pheromone are buried inside the transmembrane helices of Ste2p, whereas the central region, including a turn structure, interacts with the extracellular domains. In that model, two residues of the receptor, Ser47 and Thr48, were proposed to interact with Gln10 of the pheromone. Lin J. C. and colleagues<a class="elsevierStyleCrossRef" href="#bib0090">18</a> proposed a model that highlights the role of aromatic residues in the interaction between the pheromone and the pocket formed by the extracellular ends of the transmembrane helices in the receptor. In this model, a β-bend is formed at the central region of the pheromone. Tyr266 on helix 6 is oriented toward the surrounding lipids and interacts with Trp1-His2-Trp3 of the pheromone, while Phe204, located within the helix bundle between helix 4 and helix 5, interacts with Tyr13 of the pheromone. Finally, Son C. D. and colleagues<a class="elsevierStyleCrossRef" href="#bib0095">19</a> proposed a model where Gln10 of the pheromone interacts with residues Ser47 and Thr48 in Ste2. Tyr13 in the pheromone interacts with helix 1 (Phe55−Arg58) and Trp1 and Trp3 in the pheromone interact with aromatic residues Phe262 and Tyr266 at the extracellular interface of helix 6. All these models have in common that the central region of the pheromone forms a turn structure that is oriented away from the transmembranal helix-bundle, whereas both the N and C-termini of the pheromone are oriented toward the binding pocket formed by extracellular ends of helix 1, helix 5, and helix 6.In the present study, we built a novel three-dimensional model of Ste2 bound to the pheromone, incorporating mutagenesis information about Ste2p function that was not necessarily incorporated in previous models of this interaction; our model was built using the state of art tools used to build three-dimensional models of proteins. In our model, Ile190 in Ste2p, a conserved position among fungal species, does not interact with the pheromone. To test our model, we performed a mutagenesis at this residue. We choose this residue because it is part of the second extracellular loop, which has been previously implied to play a role in ligand recognition and binding in other GPCRs, such as the dopamine D2<a class="elsevierStyleCrossRef" href="#bib0105">21</a>, MT2 melatonin<a class="elsevierStyleCrossRef" href="#bib0110">22</a>, thyrotropin<a class="elsevierStyleCrossRef" href="#bib0115">23</a> angiotensin<a class="elsevierStyleCrossRef" href="#bib0120">24</a>, and histamine H1<a class="elsevierStyleCrossRef" href="#bib0125">25</a> receptors. Our results indicate that some mutants of this residue have a small effect on the Ste2p signaling cascade that leads cells to arrest cell growth in the presence of the pheromone. The structural bases of these results are discussed using our three-dimensional model.MATERIAL AND METHODSThe construction of a Ste2 model was done using the rhodopsin crystal as a template. The receptor model was built using the i-TASSER V4.1 server<a class="elsevierStyleCrossRef" href="#bib0130">26</a>. i-TASSER was chosen because it was ranked as the server with best results in CASP7 to CASP10 (Critical Assessment of Techniques for Protein Structure Prediction). We modeled residues 47 to 296. The N-terminal (residues 1-46) and C-terminal domains (residues 297-431) were not modeled because these domains are not essential for ligand binding.Despite the fact that Ste2p and rhodopsin have a low sequence identity (20%), rhodopsin was used as a template for Ste2p modeling because: 1) Ste2p and rhodopsin share structural and functional properties, 2) available structural and mutational data show that the Ste2p and rhodopsin sequences align properly based on a comparison of amino acids that have similar structural and functional roles in membrane proteins<a class="elsevierStyleCrossRef" href="#bib0135">27</a> and 3) rhodopsin has been used as a template for previously developed Ste2p models<a class="elsevierStyleCrossRef" href="#bib0090">18</a>. The sequences for Ste2p and rhodopsin were obtained from the UniProt database. The crystal structure of rhodopsin (PDB entry code 1U19<a class="elsevierStyleCrossRef" href="#bib0140">28</a>) was obtained from the Protein Data Bank<a class="elsevierStyleCrossRef" href="#bib0145">29</a>. The alignment of Ste2p with rhodopsin was carried out as described previously<a class="elsevierStyleCrossRef" href="#bib0135">27</a>.The membrane boundaries in the Ste2p sequence were obtained from solvent accessibility data<a class="elsevierStyleCrossRef" href="#bib0100">20</a> and were used in i-TASSER to specify boundaries of secondary structures. To guide i-TASSER on the correct helix orientation, distance restraints between specific residues were obtained from the PDB file of rhodopsin using the distance between the alpha-carbon from a residue placed at the end of a helix and the alpha-carbon from the residues localized at the ends of all the other helices.Construction of the alpha-pheromone three-dimensional model. The PEP-FOLD server<a class="elsevierStyleCrossRef" href="#bib0150">30</a> was used to develop an atomic three-dimensional model of the alpha pheromone peptide. The sequence of alpha pheromone Trp-His-Trp-Leu-Gln-Leu-Lys-Pro-Gly-Gln-Pro-Met-Tyr was sent to the server in FASTA format. The model that was closer to the structural characterization of the pheromone by NMR<a class="elsevierStyleCrossRef" href="#bib0155">31</a> was selected from the results generated by the PEP-FOLD server.Docking of Ste2 with alpha pheromone. For docking experiments the ClusPro 2.0 server<a class="elsevierStyleCrossRef" href="#bib0160">32</a> was used. Amino acid residues of the Ste2p receptor and the pheromone involved in binding were used to focus the docking on such residues. These residues included (Ste2p-pheromone pairs; the secondary structure element of the Ste2p residue is indicated in parenthesis for convenience): Ser47(H1)-Gln10<a class="elsevierStyleCrossRef" href="#bib0085">17</a>, Thr48(H1)-Gln10<a class="elsevierStyleCrossRef" href="#bib0085">17</a>, Phe204(H5)-Tyr13<a class="elsevierStyleCrossRef" href="#bib0090">18</a>, Asn205(H5)-Trp3<a class="elsevierStyleCrossRef" href="#bib0165">33</a>, Tyr266(H6)-Trp3<a class="elsevierStyleCrossRef" href="#bib0090">18</a> and Lys269(H6)-Trp1<a class="elsevierStyleCrossRef" href="#bib0170">34</a>. The energy of the Ste2p-alpha pheromone complex was minimized using CHARMM<a class="elsevierStyleCrossRef" href="#bib0175">35</a>; for that end the C38B2 CHARMM version and CHARMM36 potentials were used. The complex that showed the lowest interaction energy with the lowest average distance between contacts was selected. All the structures were visually inspected with the PyMol viewer software<a class="elsevierStyleCrossRef" href="#bib0180">36</a>.Site-directed mutagenesis of the STE2 gene. Mutations were introduced into the receptor gene (STE2) by PCR using the kit “QuikChange Lightning” (Agilent Technologies Cat. No. 210519).The pYES-STE2 plasmid was used as template for PCR and was constructed by subcloning the 1296bp STE2 gene into the pYES2 plasmid (Invitrogen Cat. No. V82520). STE2 was obtained from the pGRB2.2-STE2 plasmid using the XbaI and EcoRI restriction enzymes. The pGRB2.2-STE2 plasmid was kindly provided by Dra. Irene Castaño (Instituto Potosino de Investigación Científica y Tecnológica, San Luis Potosí, México). Mutagenic primers were designed according to manufacturer's instructions and were complementary to the STE2 sequence, except for the AUU codon of Ile190 that was changed for NNG/C to introduce the mutations. Sequences of the primers used are described next:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">1)5’GCGCTGTTAAAGGTATGNNG/CGTGACTTATAAT GATGTTAGTGCCACCC 3’</li><li class="elsevierStyleListItem" id="lsti0010">2)5’ GGGTGGCACTAACATCATTATAAGTCACG/CNNCA TACCTTTAACAGCGC 3’.</li></ul>The whole vector pYES-STE2 was amplified using PfuTurbe polymerase. Then, the PCR product was digested with DpnI restriction enzyme at 37°C for 30minutes to eliminate the parental (non mutated) plasmid, and then transformed into DH5α E. coli strain. Transformed cells were selected on ampicillin-containing plates and plasmids were isolated from transformed cells using QIAprep Spin Miniprep Kit (QIAGEN Cat. No. 27106). Isolated mutants were confirmed by DNA sequence analysis. DNA sequencing was carried out in the Unidad de Biología Molecular, located at the Instituto de Fisiología Celular. Constructs were transformed into a STE2 null mutant MATa strain (BY4741 ΔYFLO26W::kanMX4) as previously described elsewhere<a class="elsevierStyleCrossRef" href="#bib0185">37</a> and transformed cells were selected by their growth in minimal medium lacking uracil.Growth curves. Yeast cultures expressing the mutant receptor were incubated for 24hours at 30°C with minimal medium lacking uracil with glucose, and then were incubated for 6 additional hours with minimal medium lacking uracil with galactose in order to induce the expression of STE2 in the plasmid. Afterwards, yeast cells were diluted to optical density of 0.11 and incubated with pheromone (Anaspec) at 10μM into a 96-well half area plate in a total volume of 150μl. The incubation was carried out at 30°C with shaking and the A600nm was measured every hour for 24h using a Synergy MX plate reader (BioTek Instruments). The experiment was repeated three times each time with a triplicate. Growth curves data were normalized and the area under the curve was calculated for each mutant.RESULTS AND DISCUSSIONThree-dimensional model of Ste2p. The Ste2p model with the best C-score (confidence score) was selected (<a class="elsevierStyleCrossRef" href="#fig0010">Figure 2</a>); in our case the C-score was -1.01 and the TM-score was 0.30. The C-score given by i-TASSER estimates the quality of predicted models is in the range of [-5, 2]. Models with C-score >-1.5 tend to be close to the native structure. The TM-score provided by i-TASSER estimates the similarity of the protein model and its template; a score below 0.17 corresponds to two proteins that are not similar while above 0.5 correspond to proteins that are structurally homologues. Thus, the TM-score indicates the Ste2p model differs from the rhodopsin template (1U19) as expected (see Methods), but remains similar. In our three-dimensional model the boundaries of the transmembrane helices matched the solvent accessibility data previously described<a class="elsevierStyleCrossRef" href="#bib0045">9</a>, except for the H6. This helix has been reported to expand from Leu248 to Leu268 (<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>), while in our model it spans from Phe244 to Ile263. This difference reflects the fact that the loop connecting H5 to H6 presents two residues (244 and 245) at the end of this loop that are not accessible to biotinylation, followed by two other residues that are accessible to biotinylation (246 and 247). The authors proposed that H6 should start at residue 248, but we prefer to use the first residues that were inaccessible as part of this helix. These authors could not establish the end of this helix, so we used as a criterion the sequence alignment between Ste2p and rhodopsin generated with i-TASSER.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>The Ste2p model showed helix-helix interactions that were consistent with biochemical data. For example, Ste2p has a GXXXG motif in H1 that includes Gly56 and Gly60. These motifs mediate helix-helix interactions<a class="elsevierStyleCrossRef" href="#bib0190">38</a> and have been implicated in the dimerization of Ste2p<a class="elsevierStyleCrossRef" href="#bib0050">10</a>. To achieve this, these glycines must face outwards the protein. In our model, these glycines are properly oriented (see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>).<elsevierMultimedia ident="fig0015"></elsevierMultimedia>As opposed to globular proteins, interactions between transmembrane helices are generally mediated by polar amino acids located in the transmembrane region<a class="elsevierStyleCrossRef" href="#bib0195">39</a>. These amino acids can form single helix-helix contacts or hydrogen-bonding networks. It has been proposed based on sequence conservation that the H1-H2 interaction is mediated by a hydrogen bond between Arg58 (HI) and His94 (H2)<a class="elsevierStyleCrossRef" href="#bib0135">27</a>. However, in our Ste2p model Arg58 may form a hydrogen bond with Tyr101 on the same face of H2 (see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>), so further mutagenesis and structural experiments may test for the relevance of these pairs of residues in the H1-H2 interaction. Similarly, our model proposed other new helix-helix interactions. For instance, the proximity of residues Ser170 (H3) and Glu143 (H4) would mediate H3-H4 interactions (see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>). Likewise Ser107 and Thr110 of the extracellular loop 2 may interact with Gln51 (H1) (see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>). Our three-dimensional model of Ste2p also displays the orientation of residues that are consistent with their functional role in other GPCRs. For instance, we observed that Gln149 appears to be functionally equivalent to Glu134, which is part of the ERY motif in rhodopsin. Both Glu134 in rhodopsin and Gln149 in Ste2p are localized in a similar position at the end of H3, and are residues where mutation to arginine or alanine leads to constitutive activation<a class="elsevierStyleCrossRefs" href="#bib0200">40–42</a>. In agreement with these previous observations, Gln149 is oriented in a position similar to that of Glu134 in rhodopsin and presumably shares the role of preventing constitutive activation of the receptor; the reported single point mutations to alanine in positions Gln149 or Asn84 rendered a constitutive activation of the Ste2p receptor, and a double mutation that swapped the side chains of these two residues maintained a wild-type phenotype suggesting these residues are in close proximity in the 3D structure of Ste2p. In our model, Gln149 and Asn84 are 10.5Å apart and facing away from each other, indicating that our model is not consistent with these experimental results. Since our model did not include the N and C termini located at the side where Gln149 lies, it seems that the orientation of H2 and H3 on this side of the transmembrane region of the receptor are not properly oriented in our model. Yet, pheromone binding takes place at the opposite side of the transmembrane region and presumably does not include these helices, so we proceed to analyze the reliability of our model.Docking. The ligand binding orientations vary widely between the members of the GPCR family<a class="elsevierStyleCrossRef" href="#bib0215">43</a>. It has been shown that large ligands bind to the extracellular loops of GPCRs, while small ligands bind to the transmembrane region of receptor. In the case of peptide ligands it has been proposed that a combination of both binding modes takes place. In such case, the ligand binds first to extracellular loops and later enters the transmembrane domain where the binding pocket acts like an epicenter of conformational changes. These conformational changes are propagated to intracellular loops through the movement of helices. Then, the intracellular domain binds to and activates the trimeric G protein<a class="elsevierStyleCrossRef" href="#bib0215">43</a>. In the case of Ste2p, alpha pheromone binding has been mapped to the pocket formed by the extracellular ends of the transmembrane helices, specifically H1, H5, and H6<a class="elsevierStyleCrossRefs" href="#bib0085">17,18,33,34</a>.The GPCRs interact with their ligands via hydrogen bonds, ionic pairs and hydrophobic contacts<a class="elsevierStyleCrossRef" href="#bib0220">44</a>. The interactions between Ste2p and the alpha pheromone responsible for binding and activation are not well characterized. However, electrostatic interactions have been suggested to play a critical role in the Ste2p-alpha pheromone complex<a class="elsevierStyleCrossRef" href="#bib0225">45</a>.The docking simulation aimed to model the Ste2p-alpha pheromone interaction (<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>). In this model all contacts in the Ste2p-alpha pheromone interaction previously reported are present. For instance, previous studies about the affinities and activities of various alpha pheromone analogues have shown that residues Ser47 and Thr48 are near Gln10 in the alpha pheromone<a class="elsevierStyleCrossRef" href="#bib0085">17</a>. As we see in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>, our binding model is congruent with these data. Phe204 and Tyr266 are located in the extracellular ends of the helices H5 and H6, respectively. These helices are linked at the opposite end involved in pheromone binding by the third intracellular loop that interacts with the trimeric G protein and promotes its activation<a class="elsevierStyleCrossRefs" href="#bib0070">14,46,48</a>. Site-directed mutagenesis studies showed that Phe204 interacts with the C-terminal region of the pheromone (likely with Tyr13), while Tyr266 interacts with the N-terminal region (likely with Trp1 or Trp3)<a class="elsevierStyleCrossRef" href="#bib0090">18</a>. Both residues, Phe204 and Tyr266, play roles in the transformation of Ste2p into an activated state upon agonist binding<a class="elsevierStyleCrossRefs" href="#bib0090">18,47</a>. As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a> our model is consistent with these experimental data despite the previously noted differences in our model about H6 and the intracellular ends of H2 and H3 (residues Asn84 and Gln149). Finally, interaction between aromatic residues in the alpha pheromone and Ste2p could be stabilized by ring stacking effects or by hydrogen bonding. In our model the interaction between Tyr266 and Trp3 is stabilized by hydrogen bonding (<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>).<elsevierMultimedia ident="fig0020"></elsevierMultimedia>However, our model does not present the Asn205-pheromone contact. Asn205 has been implicated in the binding of the N-terminal domain of the pheromone because mutations at this position affect the Ste2p binding to the pheromone<a class="elsevierStyleCrossRef" href="#bib0165">33</a>. It has been shown that residues that are important for binding are not necessarily near the ligand or at the interface in the three-dimensional structure<a class="elsevierStyleCrossRef" href="#bib0245">49</a>. In our Ste2p model, Asn205 faces away from the binding pocket (<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>). Thus, according to our model, Asn205 would contribute to binding not by direct interaction with the pheromone. In such case, it would be expected that Asn205 may contribute to the pheromone binding through a set of interactions with residues that support the position of the residues that directly bind to the pheromone. Analyzing the contacts (cutoff distance <= 5Å) of the Ste2p residues involved in the pheromone binding (Ser47, Thr48, Phe204 and Tyr266) and comparing these with the contacts of residue Asn205, we learned these share 9 residues (Val191, Tyr193, Asn194, Tyr203, Phe204, Ala206, Ser207, Thr208, and Ile209), which corresponds to 29% of the residues that support the position of the residues directly binding the pheromone. This analysis further supports the relevance of Asn205 in pheromone binding through indirect contacts with the ligand binding residues. These results constitute a hypothesis that can be experimentally tested by performing double swap mutants at Asn205 and the residues in the pheromone proposed to interact with Asn205 for instance; in the present study we decided to mutate another region of the protein as explained below.Additionally, our three-dimensional model has some discrepancies with other computational studies reported previously. For example, Phe204 does not interact with Tyr13 of the alpha pheromone in the Umanah model<a class="elsevierStyleCrossRef" href="#bib0170">34</a>. The lack of interaction between these residues was modeled based on studies of alpha pheromone analogues and chemical cross-linking experiments that proposed an interaction between Tyr13 of the alpha pheromone with Arg58 of Ste2p<a class="elsevierStyleCrossRef" href="#bib0095">19</a>. Our model on the other hand, includes the interaction between Tyr13 and Phe204 proposed by Lee and colleagues<a class="elsevierStyleCrossRef" href="#bib0085">17</a>, based on site-directed mutagenesis and cross-linking experiments that were disregarded by the group of Umanah and colleagues. We prefer to use the Tyr13-Phe204 interaction in the construction of our Ste2p model because it has more support by other research groups<a class="elsevierStyleCrossRefs" href="#bib0090">18,50–52</a> than the Tyr13-Arg58 interaction<a class="elsevierStyleCrossRefs" href="#bib0095">19,34</a>.In the interface we found residues both accessible and inaccessible to solvent. This is a feature of many other interfaces of proteins, where solvent accessible residues play roles in ligand binding, while those not accessible to solvent mediate the transition to an active state<a class="elsevierStyleCrossRef" href="#bib0260">52</a>. Additionally, our binding model allows us to propose that the interface between Ste2p and the pheromone is composed of 26 residues. As shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>, interface residues include both polar and non-polar residues. This is consistent with previous studies indicating that both hydrophobic and hydrophilic residues form the binding pocket of Ste2p<a class="elsevierStyleCrossRef" href="#bib0265">53</a>. The interface residues that are structurally and functionally important tend to be conserved residues or they have a lower rate of mutation compared with the rest of the residues of the protein<a class="elsevierStyleCrossRef" href="#bib0270">54</a>. This is the case for Tyr266, which is a critical residue for binding as well as signal transduction<a class="elsevierStyleCrossRefs" href="#bib0090">18,47</a> and shows a large percentage of sequence identity conservation (see <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>). However, this is not always the case and many residues that are important for binding are not conserved<a class="elsevierStyleCrossRef" href="#bib0275">55</a>. In agreement with this idea, <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a> shows that few interface residues are conserved among Ste2p orthologues (Val49, Ser108, Leu113, Thr114, Tyr266). Furthermore, Ser108 and Thr114 of the first extracellular loop, found in the interface of Ste2 and the alpha pheromone in this study, were previously proposed as critical for signaling<a class="elsevierStyleCrossRef" href="#bib0080">16</a>. Gln51 and Ser107, also found at the interface, are hydrogen bonded as suggested by the Ste2p model developed in this work, yet these positions do not preserve the same side chain as Ste2p in other fungal orthologues. Considering that the first extracellular loop has been observed to undergo a conformational change upon ligand binding<a class="elsevierStyleCrossRef" href="#bib0075">15</a> this hydrogen bond could be modified during the signaling process. Other non-conserved residues (e.g., Val49, Asp201) were also found in the interface that could play a critical role in Ste2p function. Site-directed mutagenesis on these residues may help to test the role of these residues in ligand binding or signaling.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Site-directed mutagenesis of STE2. Several studies have shown that the second extracellular loop of GPCRs plays an important role in ligand binding<a class="elsevierStyleCrossRefs" href="#bib0105">21–25</a>. Since no mutation for Ste2p at this loop has been reported, we did not use this information to guide the docking of the pheromone to Ste2p. A sequence conservation analysis performed among fungal receptors (<a id="intr0005" class="elsevierStyleInterRef" href="http://www.yeastgenome.org/cache/fungi/YFL026W.html">http://www.yeastgenome.org/cache/fungi/YFL026W.html</a>) indicated that residue Ile190 of extracellular loop 2 might be relevant for Ste2p activity. In this study, Ile190 was mutated to test for its role in Ste2p function. Five mutants (Ile190Arg, Ile190His, Ile190Pro, Ile190Leu and Ile190Ser) were obtained and their ability to respond to the pheromone was tested. <a class="elsevierStyleCrossRef" href="#fig0025">Figure 5</a> shows the cell growth of all strains expressing these mutants. Two mutations that introduced a ring into that position (Ile190His, Ile190Pro) or arginine reduced slightly the cell growth arrest induced by the pheromone, while two other mutations (Ile190Leu, Ile190Ser) did not reduce the cell growth arrest induced by the pheromone. These results indicate that this position is not critical for receptor function, but ring and positively-charged side chains are tolerated less at this position. In our Ste2p-alpha pheromone model, Ile190 is oriented away from the binding pocket, behind Lys202, a direct ligand of the pheromone (<a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>). Placing an arginine at position 190 could result in an excess of positive charge at this site, altering the conformation of Lys202 and debilitating the interaction with the pheromone. Placing another ring, such as Pro or His, at position 190 could modify the position of Tyr203, another residue in direct contact with the pheromone, and/or interact with His126 at the N-terminus of H3 (<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>), altering the tilt of H3 with allosteric consequences at the cytoplasmic loops that could impair signaling.<elsevierMultimedia ident="fig0025"></elsevierMultimedia>Validating a model requires testing four different statistical parameters: true positive (TP), true negative (TN), false positive (FP) and false negative (FN) predictions. Yet, most modeling studies of protein structure commonly test for TP; for instance, the world contest on protein structure prediction only tests for TP by establishing a score that accounts for the fraction of the model that may be superimposed to the real protein structure with no more than certain cutoff RMSD value<a class="elsevierStyleCrossRef" href="#bib0280">56</a>. The relevance of the other 3 parameters becomes apparent when it is recognized that experimental protein 3D structures should also be considered a model to test for the critical role of residues in protein function. In the present work we tested 4 parameters in our model, thus providing a more complete test about the quality of the generated structure. Particularly, we showed that:TP are residues predicted critical and indeed are critical for protein function/structure. For instance, we show that residues Phe204 and Tyr266 that are close to the pheromone in our model are indeed important for binding.FP are residues predicted critical but are not truly relevant for protein function/structure. Here we show that residue Ile190 is predicted by sequence conservation to be relevant for protein structure/function, yet our experimental results provide evidence against this hypothesis.TN are residues predicted not critical and are not truly relevant for protein function/structure. Our 3D model predicted that Ile190 was not critical and here we show that indeed this is the case.FN are residues that are predicted not critical but are truly relevant for protein function/structure. Our model predicts that residues Gln149 and Asn84 are far apart from each other, yet experimental evidence has shown otherwise.Note that TN and FN are difficult to test in protein structure-function studies because in most cases only residues with an effect on protein structure or function are reported in the literature. Yet, we argue this information is particularly relevant in testing for structure-function prediction models, such as in the case of residues like Ile190.CONCLUSIONSThe present study presents an atomic three-dimensional structure model of the alpha pheromone receptor from S. cerevisiae, Ste2p, based on state-of-the-art modeling methods and current available experimental data. The Ste2p model is consistent with most available biochemical information and allows us to propose specific interactions that could stabilize the native conformation of the receptor. Furthermore, a model of the interaction between Ste2p and the alpha pheromone was generated based on what is known about the binding contacts. The Ste2p-alpha pheromone model allowed us to identify 26 residues that are presumably found in the interface, but did not include Ile190, a conserved residues among fungi species. Mutagenesis of Ile190 in Ste2p had small or no effect on receptor function and in the model this residue points away from the pheromone. Thus, the model may serve as a starting point for further site-directed mutagenesis to test the structure-function relationship of this receptor." "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres784716" "titulo" => "ABSTRACT" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec783500" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres784717" "titulo" => "RESUMEN" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0010" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec783499" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "INTRODUCTION" ] 5 => array:2 [ "identificador" => "sec0010" "titulo" => "MATERIAL AND METHODS" ] 6 => array:2 [ "identificador" => "sec0015" "titulo" => "RESULTS AND DISCUSSION" ] 7 => array:2 [ "identificador" => "sec0020" "titulo" => "CONCLUSIONS" ] 8 => array:2 [ "identificador" => "xack262683" "titulo" => "ACKNOWLEDGMENTS" ] 9 => array:1 [ "titulo" => "REFERENCES" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2016-07-28" "fechaAceptado" => "2016-11-03" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec783500" "palabras" => array:5 [ 0 => "alpha pheromone receptor" 1 => "docking" 2 => "molecular modeling" 3 => "pheromone" 4 => "Ste2p" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec783499" "palabras" => array:5 [ 0 => "receptor de la feromona alfa" 1 => "anclado molecular simulado" 2 => "modelado molecular" 3 => "feromona" 4 => "Ste2p" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "ABSTRACT" "resumen" => "Ste2p is a G protein-coupled receptor (GPCR) in Saccharomyces cerevisiae that mediates mating by responding to the alpha-mating factor pheromone. Ste2p belongs to a subfamily of GPCRs with no global sequence similarity to GPCRs of known atomic three-dimensional structure, yet it shares functional similarities with many of these. To deepen our understanding of the structure-function relationship of this receptor, we built an atomic three-dimensional homology-based model of Ste2p that was used to simulate the docking of the alpha pheromone. The Ste2p model is in general agreement with the available experimental data and allowed us to propose that the interface between Ste2p and alpha pheromone is formed by 26 residues, most of which are polar residues located at the three extracellular loops and helices HI, H5, and H6. This interface does not include Ile190, a highly conserved residue among fungal species, located at the second extracellular loop and therefore a potential binding site residue. By performing mutagenesis of STE2 at this position we observed only a small effect of this residue in receptor signaling. Hence, the Ste2p model presented here is consistent in general with current experimental data and constitutes a framework to test hypothesis about the structure-function relationship of this receptor." ] "es" => array:2 [ "titulo" => "RESUMEN" "resumen" => "Ste2p es un receptor acoplado a la proteína G (GPCR) en Saccharomyces cerevisiae que se une a la feromona alfa para mediar el apareamiento. Ste2p pertenece a una subfamilia de GPCRs que no presentan homología global en secuencia con los GPCRs de estructura atómica tridimensional conocida, pero comparte propiedades funcionales con muchos de éstos. Para profundizar nuestro entendimiento de la relación estructura-función de este receptor, en este trabajo presentamos un modelo de la estructura atómica tridimensional de Ste2p asociado a su ligando. El modelo de Ste2p generado es congruente con la información experimental disponible y sugiere que la interfaz entre Ste2p y la feromona está compuesta por 26 residuos, en su mayor parte polares, localizados en las tres asas extracelulares y las hélices H1, H5 y H6. La interfaz no incluye a la Ile190, un residuo altamente conservado entre especies de hongos, que se encuentra en el asa extracelular 2 y es un potencial sitio de anclaje. Mutantes en esta posición en STE2 muestran un efecto pequeño en la señalización del receptor. El modelo presentado de Ste2p es consistente en general con los datos de mutagénesis disponibles a la fecha, por lo que constituye un marco de referencia para evaluar hipótesis sobre la relación estructura-función en este receptor." ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1415 "Ancho" => 3581 "Tamanyo" => 416347 ] ] "descripcion" => array:1 [ "en" => "Topological diagram of Ste2p. Every amino acid residue from Ste2p is represented by a single letter code within a gray circle. The two horizontal lines separating the extracellular from the intracellular spaces represent the membrane. Data derived from<a class="elsevierStyleCrossRef" href="#bib0100">20</a>." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1886 "Ancho" => 1707 "Tamanyo" => 178972 ] ] "descripcion" => array:1 [ "en" => "Three-dimensional structural model of Ste2p. A ribbon representation of the three-dimensional structure of Ste2p is presented. Ste2p has a central core made of seven transmembrane helices (HI to H7) connected by three intracellular (IL1, IL2 and IL3) and three extracellular loops (EL1, EL2 and EL3). This model shows the counterclockwise orientation of transmembrane helices used for modeling GPCRs. The image was generated with PyMol." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1936 "Ancho" => 3581 "Tamanyo" => 361302 ] ] "descripcion" => array:1 [ "en" => "Residues involved in helix-helix interactions in Ste2p model. The transmembrane helices of Ste2p are presented as ribbons and are enumerated from H1 to H7. For convenience, transmembrane helices are displayed in a clockwise orientation. Hydrogen bonds are formed between Arg58-Tyr101, Ser170-Glu143, and Ser107-Gln51-Thr110, and are displayed with dots. Gly56 and Gly60 are oriented outwards the protein. The image was generated with PyMol." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 3008 "Ancho" => 3581 "Tamanyo" => 493534 ] ] "descripcion" => array:1 [ "en" => "Atomic three-dimensional model of the interaction between Ste2p and the alpha pheromone. Ste2p is shown in a light grey ribbon representation. The alpha pheromone is shown as a dark grey object. The upper part of the figure illustrates the binding pocket formed by extracellular loops and extracellular ends of H1, H5, and H6. In the lower part of the figure, selected residues of Ste2p and pheromone are shown in a ball-and-stick representation. First, the C-terminal region of the pheromone (Gln10) binds to the receptor residues Ser47 and Thr48 (H1)<a class="elsevierStyleCrossRef" href="#bib0085">17</a>. Then, the central region of the pheromone (Pro8-Gly9) forms a β-turn<a class="elsevierStyleCrossRef" href="#bib0230">46</a>. At this point, Phe204 (H5) is near to Tyr13 in the pheromone<a class="elsevierStyleCrossRef" href="#bib0090">18</a>, and Lys269 (H6) is near to both the N and C-termini of the pheromone. Asn205 is facing toward the outside of Ste2p and away from the binding pocket (left). In our model, Tyr266 (H6) is oriented towards the surrounding lipids and is inaccessible to solvent. This orientation is consistent with experimental data from<a class="elsevierStyleCrossRef" href="#bib0090">18</a>. Finally, Tyr266 interacts with Trp3 in the pheromone, mediating the transition to an active state of Ste2<a class="elsevierStyleCrossRefs" href="#bib0090">18,47</a> (right). The image was generated with PyMol." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 1284 "Ancho" => 1707 "Tamanyo" => 198595 ] ] "descripcion" => array:1 [ "en" => "Area under the growth curve for each mutant strain. The population growth of yeast strains expressing any of five mutants at Ile190 (I190L, I190S, I190R, I190H and I190P) is represented by the Area Under the growth curve (Y axis) both in the presence and absence of the alpha pheromone (indicated by the abbreviation “pher” in the figure). As control, the growth of wild type strain (BY4741) and a strain carrying a deletion of STE2 gene are presented." ] ] 5 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table I" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="center" valign="top" scope="col">H1 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col">Extracellular loop 1 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col">Extracellular loop 2 and H5 \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col">Extracellular loop 3 and H6 \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Ser47 (7%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Ser107 (16%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asn194 (7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Ala265 (9%) Inaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr48 (9%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Ser108 (27%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asp195 (12%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Tyr266 (45%) Inaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Val49 (32%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Leu113 (26%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Val196 (13%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Ser267 (10%) Inaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Thr50 (9%) Inaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Thr114 (30%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Gln200 (7%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Lys269 (3%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Gln51 (8%) unaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Phe116 (12%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asp201 (5%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Pro270 (5%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Met54 (6%) Inaccessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Pro117 (11%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Lys202 (8%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Gly273 (9%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Tyr203 (7%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Phe204 (10%) Accessible to solvent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1304342.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Composition of the interface between Ste2 and alpha pheromone. Interface residues were defined as those residues in Ste2p that were no more than 5Å apart from the pheromone. Solvent accessibility data were obtained from Lin, J.C., et al., 2004<a class="elsevierStyleCrossRef" href="#bib0265">53</a>. Percentage of conservation (indicated in parenthesis for each residue; this percentage represents the fraction of 214 orthologue sequences that have an identical residue to Ste2p at that position) was derived from the multiple sequence alignment for all the Ste2p orthologues reported for PFAM family PF02116. Those positions with the largest percentage of sequence identity conservation are marked in bold." ] ] ] "bibliografia" => array:2 [ "titulo" => "REFERENCES" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:56 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An overreview on GPCRs and drug discovery: structure-based drug design and structural biology on GPCRs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "K. Lundstrom" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-60327-317-6_4" "Revista" => array:6 [ "tituloSerie" => "Methods Mol. Biol." "fecha" => "2009" "volumen" => "552" "paginaInicial" => "51" "paginaFinal" => "66" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19513641" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The structure and function of G-protein-coupled receptors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D.M. Rosenbaum" 1 => "S.G.F. Rasmussen" 2 => "B.K. Kobilka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nature08144" "Revista" => array:7 [ "tituloSerie" => "Nature" "fecha" => "2009" "volumen" => "459" "numero" => "7245" "paginaInicial" => "356" "paginaFinal" => "363" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19458711" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mutations affecting sexual conjugation and related processes in Saccharomyces cerevisiae. I. Isolation and phenotypic characterization of nonmating mutants" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "V. Mackay" 1 => "T.R. Manney" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Genetics" "fecha" => "1974" "volumen" => "76" "numero" => "2" "paginaInicial" => "255" "paginaFinal" => "271" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/4595643" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mutants of Saccharomyces cerevisiae unresponsive to cell division control by polypeptide mating hormone" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "L.H. Hartwell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J. Cell Biol." "fecha" => "1980" "volumen" => "85" "paginaInicial" => "811" "paginaFinal" => "822" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6993497" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Binding of α-factor pheromone to yeast a cells: chemical and genetic evidence for an α-factor receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D.D. Jenness" 1 => "A.C. Burkholder" 2 => "L.H. Hartwell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Cell" "fecha" => "1983" "volumen" => "35" "numero" => "2" "paginaInicial" => "521" "paginaFinal" => "529" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6360378" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The yeast α-factor receptor: Structural properties deduced from the sequence of the STE2 gene" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A.C. Burkholder" 1 => "L.H. Hartwell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Nucleic Acids Res." "fecha" => "1985" "volumen" => "13" "paginaInicial" => "8463" "paginaFinal" => "8475" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3001640" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure of a double transmembrane fragment of a G-protein-coupled receptor in micelles" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "A. Neumoin" 1 => "L.S. Cohen" 2 => "B. Arshava" 3 => "S. Tantry" 4 => "J.M. Becker" 5 => "O. Zerbe" 6 => "F. Naider" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bpj.2009.01.012" "Revista" => array:7 [ "tituloSerie" => "Biophysical Journal" "fecha" => "2009" "volumen" => "96" "numero" => "8" "paginaInicial" => "3187" "paginaFinal" => "3196" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19383463" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:3 [ "comentario" => "2-H" "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure and topology of a peptide segment of the 6th transmembrane domain of the Saccharomyces cerevisae alpha-factor receptor in phospholipid bilayers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "K.G. Valentine" 1 => "S.F. Liu" 2 => "F.M. Marassi" 3 => "G. Veglia" 4 => "S.J. Opella" 5 => "F.X. Ding" 6 => "F. Naider" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/1097-0282(20011005)59:4<243::AID-BIP1021>3.0.CO" "Revista" => array:7 [ "tituloSerie" => "Biopolymers" "fecha" => "2001" "volumen" => "59" "numero" => "4" "paginaInicial" => "243" "paginaFinal" => "256" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11473349" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of residues involved in homodimer formation located within a β-strand region of the N-terminus of a Yeast G protein-coupled receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.S. Uddin" 1 => "H. Kim" 2 => "A. Deyo" 3 => "F. Naider" 4 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/10799893.2011.647352" "Revista" => array:6 [ "tituloSerie" => "Journal of Receptors and Signal Transduction Research" "fecha" => "2012" "volumen" => "32" "numero" => "2" "paginaInicial" => "65" "paginaFinal" => "75" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The extracellular N-terminal domain and transmembrane domains 1 and 2 mediate oligomerization of a yeast G protein-coupled receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.C. Overton" 1 => "K.J. Blumer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M205368200" "Revista" => array:7 [ "tituloSerie" => "Journal of Biological Chemistry" "fecha" => "2002" "volumen" => "277" "numero" => "44" "paginaInicial" => "41463" "paginaFinal" => "41472" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12194975" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Direct evidence for ligand-induced internalization of the yeast α-factor pheromone receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K.A. Schandel" 1 => "D.D. Jenness" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mol. Cell. Biol." "fecha" => "1994" "volumen" => "14" "paginaInicial" => "7245" "paginaFinal" => "7255" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7935439" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L. Hicke" 1 => "H. Riezman" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Cell" "fecha" => "1996" "volumen" => "84" "numero" => "2" "paginaInicial" => "277" "paginaFinal" => "287" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8565073" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of a novel sequence mediating regulated endocytosis of the G protein-coupled α-pheromone receptor in yeast" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J. Rohrer" 1 => "H. Benedetti" 2 => "B. Zanolari" 3 => "H. Riezman" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mol. Biol. Cell" "fecha" => "1993" "volumen" => "4" "paginaInicial" => "511" "paginaFinal" => "521" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8392878" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The third cytoplasmic loop of a yeast G-protein-coupled receptor controls pathway activation, ligand discrimination, and receptor internalization" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "C.J. Stefan" 1 => "K.J. Blumer" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Mol Cell Biol." "fecha" => "1994" "volumen" => "14" "numero" => "5" "paginaInicial" => "3339" "paginaFinal" => "3349" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8164685" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The first extracellular loop of the Saccharomyces cerevisiae G protein-coupled receptor Ste2p undergoes a conformational change upon ligand binding" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Hauser" 1 => "S. Kauffman" 2 => "B.-K. Lee" 3 => "F. Naider" 4 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M608903200" "Revista" => array:7 [ "tituloSerie" => "Journal of Biological Chemistry" "fecha" => "2007" "volumen" => "282" "numero" => "14" "paginaInicial" => "10387" "paginaFinal" => "10397" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17293349" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Residues in the first extracellular loop of a G protein-coupled receptor play a role in signal transduction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Akal-Strader" 1 => "S. Khare" 2 => "D. Xu" 3 => "F. Naider" 4 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M204089200" "Revista" => array:7 [ "tituloSerie" => "J. Biol. Chem." "fecha" => "2002" "volumen" => "277" "numero" => "34" "paginaInicial" => "30581" "paginaFinal" => "30590" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12058045" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of residues of the Saccharomyces cerevisiae G protein-coupled receptor contributing to alpha-factor pheromone binding" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B.K. Lee" 1 => "S. Khare" 2 => "F. Naider" 3 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M103579200" "Revista" => array:7 [ "tituloSerie" => "J. Biol. Chem." "fecha" => "2001" "volumen" => "276" "numero" => "41" "paginaInicial" => "37950" "paginaFinal" => "37961" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11495900" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aromatic residues at the extracellular ends of transmembrane domains 5 and 6 promote ligand activation of the G protein-coupled alpha-factor receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.C. Lin" 1 => "W. Parrish" 2 => "M. Eilers" 3 => "S.O. Smith" 4 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi026766o" "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2003" "volumen" => "42" "numero" => "2" "paginaInicial" => "293" "paginaFinal" => "301" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12525156" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of ligand binding regions of the Saccharomyces cerevisiae alpha-factor pheromone receptor by photoaffinity cross-linking" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C.D. Son" 1 => "H. Sargsyan" 2 => "F. Naider" 3 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi0496889" "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2004" "volumen" => "43" "numero" => "41" "paginaInicial" => "13193" "paginaFinal" => "13203" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15476413" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Accessibility of cysteine residues substituted into the cytoplasmic regions of the alpha-factor receptor identifies the intracellular residues that are available for G protein interaction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y. Choi" 1 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi0614939" "Revista" => array:6 [ "tituloSerie" => "Biochemestry" "fecha" => "2006" "volumen" => "45" "numero" => "51" "paginaInicial" => "15310" "paginaFinal" => "15317" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The second extracellular loop of the dopamine D2 receptor lines the binding-site crevice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L. Shi" 1 => "J.A. Javitch" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.2237265100" "Revista" => array:7 [ "tituloSerie" => "Proc. Natl. Acad. Sci. USA" "fecha" => "2004" "volumen" => "101" "numero" => "2" "paginaInicial" => "440" "paginaFinal" => "445" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14704269" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ligand binding to the human MT2 melatonin receptor: the role of residues in transmembrane domains 3, 6, and 7" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "P. Mazna" 1 => "K. Berka" 2 => "I. Jelinkova" 3 => "A. Balik" 4 => "P. Svoboda" 5 => "V. Obsilova" 6 => "T. Obsil" 7 => "J. Teisinger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2005.05.017" "Revista" => array:7 [ "tituloSerie" => "Biochem. Biophys. Res. Commun." "fecha" => "2005" "volumen" => "332" "numero" => "3" "paginaInicial" => "726" "paginaFinal" => "734" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15913560" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Thyrotropin and homologous glycoprotein hormone receptors: structural and functional aspects of extracellular signaling mechanisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G. Kleinau" 1 => "G. Krause" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/er.2008-0044" "Revista" => array:7 [ "tituloSerie" => "Endocr. Rev." "fecha" => "2009" "volumen" => "30" "numero" => "2" "paginaInicial" => "133" "paginaFinal" => "151" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19176466" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ligand-specific conformation of extracellular loop-2 in the angiotensin II type 1 receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H. Unal" 1 => "R. Jagannathan" 2 => "M.B. Bhat" 3 => "S.S. Karnik" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M109.094870" "Revista" => array:7 [ "tituloSerie" => "J. Biol. Chem." "fecha" => "2010" "volumen" => "285" "numero" => "21" "paginaInicial" => "16341" "paginaFinal" => "16350" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20299456" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Extracellular Loop 2 (ECL2) of the Human Histamine H 4 Receptor Substantially Contributes to Ligand Binding and Constitutive Activity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:172 [ 0 => "D. Wifling" 1 => "G. Bernhardt" 2 => "S. Dove" 3 => "A. Buschauer" 4 => "M. Peeters" 5 => "G. van Westen" 6 => "Q. Li" 7 => "I. AP" 8 => "M. Wheatley" 9 => "D. Wootten" 10 => "M. Conner" 11 => "J. Simms" 12 => "R. Kendrick" 13 => "D. Massotte" 14 => "B. Kieffer" 15 => "J. Klco" 16 => "C. Wiegand" 17 => "K. Narzinski" 18 => "T. Baranski" 19 => "C. Sum" 20 => "I. Tikhonova" 21 => "S. Costanzi" 22 => "M. Gershengorn" 23 => "T. Nanevicz" 24 => "L. Wang" 25 => "M. Chen" 26 => "M. Ishii" 27 => "S. Coughlin" 28 => "M. Scarselli" 29 => "B. Li" 30 => "S. Kim" 31 => "J. Wess" 32 => "I. Brunskole" 33 => "A. Strasser" 34 => "R. Seifert" 35 => "A. Buschauer" 36 => "D. Wifling" 37 => "K. Löffel" 38 => "U. Nordemann" 39 => "A. Strasser" 40 => "G. Bernhardt" 41 => "F. Davidson" 42 => "P. Loewen" 43 => "H. Khorana" 44 => "L. Shi" 45 => "J. Javitch" 46 => "K. Noda" 47 => "Y. Saad" 48 => "R. Graham" 49 => "S. Karnik" 50 => "J. Cook" 51 => "K. Eidne" 52 => "L. Shi" 53 => "J. Javitch" 54 => "V. Avlani" 55 => "K. Gregory" 56 => "C. Morton" 57 => "M. Parker" 58 => "P. Sexton" 59 => "R. Lefkowitz" 60 => "S. Cotecchia" 61 => "P. Samama" 62 => "T. Costa" 63 => "G. Milligan" 64 => "R. Seifert" 65 => "K. Wenzel-Seifert" 66 => "T. Lee" 67 => "U. Gether" 68 => "E. Sanders-Bush" 69 => "D. Schnell" 70 => "I. Brunskole" 71 => "K. Ladova" 72 => "E. Schneider" 73 => "P. Igel" 74 => "R. Seifert" 75 => "A. Strasser" 76 => "E. Schneider" 77 => "D. Neumann" 78 => "S. Dove" 79 => "H. Lim" 80 => "A. Jongejan" 81 => "R. Bakker" 82 => "E. Haaksma" 83 => "I. de Esch" 84 => "K. Haga" 85 => "A. Kruse" 86 => "H. Asada" 87 => "T. Yurugi-Kobayashi" 88 => "M. Shiroishi" 89 => "S. Rasmussen" 90 => "H. Choi" 91 => "J. Fung" 92 => "E. Pardon" 93 => "P. Casarosa" 94 => "T. Shimamura" 95 => "M. Shiroishi" 96 => "S. Weyand" 97 => "H. Tsujimoto" 98 => "G. Winter" 99 => "E. Schneider" 100 => "D. Schnell" 101 => "D. Papa" 102 => "R. Seifert" 103 => "P. Igel" 104 => "R. Geyer" 105 => "A. Strasser" 106 => "S. Dove" 107 => "R. Seifert" 108 => "P. Igel" 109 => "E. Schneider" 110 => "D. Schnell" 111 => "S. Elz" 112 => "R. Seifert" 113 => "J. Lange" 114 => "H. Wals" 115 => "A. Vandenhoogenband" 116 => "A. Vandekuilen" 117 => "J. Denhartog" 118 => "J. Jablonowski" 119 => "C. Grice" 120 => "W. Chai" 121 => "C. Dvorak" 122 => "J. Venable" 123 => "H. Lim" 124 => "R. Smits" 125 => "R. Bakker" 126 => "C. van Dam" 127 => "I. de Esch" 128 => "J. Schmutz" 129 => "G. Kuenzle" 130 => "F. Hunziker" 131 => "R. Gauch" 132 => "R. Smits" 133 => "H. Lim" 134 => "B. Stegink" 135 => "R. Bakker" 136 => "I. de Esch" 137 => "U. Gether" 138 => "S. Lin" 139 => "B. Kobilka" 140 => "Y. Cheng" 141 => "W. Prusoff" 142 => "E. Schneider" 143 => "D. Schnell" 144 => "A. Strasser" 145 => "S. Dove" 146 => "R. Seifert" 147 => "A. Kooistra" 148 => "S. Kuhne" 149 => "I. de Esch" 150 => "R. Leurs" 151 => "C. de Graaf" 152 => "H. Lim" 153 => "C. de Graaf" 154 => "W. Jiang" 155 => "P. Sadek" 156 => "P. McGovern" 157 => "S. Schultes" 158 => "S. Nijmeijer" 159 => "H. Engelhardt" 160 => "A. Kooistra" 161 => "H. Vischer" 162 => "H.-J. Wittmann" 163 => "R. Seifert" 164 => "A. Strasser" 165 => "A. Alewijnse" 166 => "H. Timmerman" 167 => "E. Jacobs" 168 => "M. Smit" 169 => "E. Roovers" 170 => "J. Ballesteros" 171 => "H. Weinstein" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0117185" "Revista" => array:6 [ "tituloSerie" => "PloS One" "fecha" => "2015" "volumen" => "10" "numero" => "1" "paginaInicial" => "e0117185" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25629160" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The I-TASSER Suite: protein structure and function prediction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. Yang" 1 => "R. Yan" 2 => "A. Roy" 3 => "D. Xu" 4 => "J. Poisson" 5 => "Y. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nmeth.3213" "Revista" => array:7 [ "tituloSerie" => "Nature Methods" "fecha" => "2015" "volumen" => "12" "numero" => "1" "paginaInicial" => "7" "paginaFinal" => "8" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25549265" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of Class A and D G Protein-Coupled Receptors: Common Features in Structure and Activation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Eilers" 1 => "V. Hornak" 2 => "S.O. Smith" 3 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi047316u" "Revista" => array:5 [ "tituloSerie" => "Biochemistry 2005" "fecha" => "2005" "volumen" => "44" "paginaInicial" => "8959" "paginaFinal" => "8975" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Crystal structure of rhodopsin: AG protein-coupled receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:12 [ 0 => "K. Palczewski" 1 => "T. Kumasaka" 2 => "T. Hori" 3 => "C.A. Behnke" 4 => "H. Motoshima" 5 => "B.A. Fox" 6 => "I. Le Trong" 7 => "D.C. Teller" 8 => "T. Okada" 9 => "R.E. Stenkamp" 10 => "M. Yamamoto" 11 => "M. Miyano" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Science" "fecha" => "2000" "volumen" => "289" "numero" => "5480" "paginaInicial" => "739" "paginaFinal" => "745" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10926528" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Protein Data Bank" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "H.M. Berman" 1 => "J. Westbrook" 2 => "Z. Feng" 3 => "G. Gilliland" 4 => "T.N. Bhat" 5 => "H. Weissig" 6 => "I.N. Shindyalov" 7 => "P.E. Bourne" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/nar/28.1.235" "Revista" => array:7 [ "tituloSerie" => "Nucleic Acids Res." "fecha" => "2000" "volumen" => "28" "numero" => "1" "paginaInicial" => "235" "paginaFinal" => "242" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10592235" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A fast method for large-scale de novo peptide and miniprotein structure prediction" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J. Maupetit" 1 => "P. Derreumaux" 2 => "P. Tufféry" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcc.21365" "Revista" => array:7 [ "tituloSerie" => "J. Comput. Chem." "fecha" => "2010" "volumen" => "31" "numero" => "4" "paginaInicial" => "726" "paginaFinal" => "738" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19569182" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nuclear-magnetic-resonance studies on the conformations of tridecapeptide alpha-mating factor from yeast Saccharomyces cerevisiae and analog peptides in aqueous solution. Conformation-activity relationship" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "T. Higashijima" 1 => "Y. Masui" 2 => "N. Chino" 3 => "S. Sakakibara" 4 => "H. Kita" 5 => "T. Miyazawa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Eur. J. Biochem." "fecha" => "1984" "volumen" => "140" "numero" => "1" "paginaInicial" => "163" "paginaFinal" => "171" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6323177" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ClusPro: an automated docking and discrimination method for the prediction of protein complexes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.R. Comeau" 1 => "D.W. Gatchell" 2 => "S. Vajda" 3 => "C.J. Camacho" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Bioinformatics" "fecha" => "2004" "volumen" => "20" "numero" => "1" "paginaInicial" => "45" "paginaFinal" => "50" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14693807" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Double-mutant cycle scanning of the interaction of a peptide ligand and its G protein-coupled receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F. Naider" 1 => "J.M. Becker" 2 => "Y.H. Lee" 3 => "-" 4 => "A. Horovitz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi602415u" "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2007" "volumen" => "46" "numero" => "11" "paginaInicial" => "3476" "paginaFinal" => "3481" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17298081" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of residue-to-residue contact between a peptide ligand and its G protein-coupled receptor using periodate-mediated dihydroxyphenylalanine cross-linking and mass spectrometry" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:8 [ 0 => "G.K.E. Umanah" 1 => "L. Huang" 2 => "F. Ding" 3 => "B. Arshava" 4 => "A.R. Farley" 5 => "A.J. Link" 6 => "F. Naider" 7 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M110.149500" "Revista" => array:7 [ "tituloSerie" => "J. Biol. Chem." "fecha" => "2010" "volumen" => "285" "numero" => "50" "paginaInicial" => "39425" "paginaFinal" => "39436" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20923758" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CHARMM: A program for macromolecular energy, minimization, and dynamics calculations" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B.R. Brooks" 1 => "R.E. Bruccoleri" 2 => "B.D. Olafson" 3 => "D.J. States" 4 => "S. Swaminathan" 5 => "M. Karplus" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcc.540040211" "Revista" => array:6 [ "tituloSerie" => "Journal of Computational Chemistry" "fecha" => "1983" "volumen" => "4" "numero" => "2" "paginaInicial" => "187" "paginaFinal" => "217" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0180" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Schrodinger, L.L.C. The PyMOL Molecular Graphics System, Version 1.8 <a id="intr0010" class="elsevierStyleInterRef" href="https://www.pymol.org/">https://www.pymol.org/</a>." ] ] ] 36 => array:3 [ "identificador" => "bib0185" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "One-step transformation of yeast in stationary phase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D.C. Chen" 1 => "B.C. Yang" 2 => "T.T. Kuo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Current Genetics" "fecha" => "1992" "volumen" => "21" "numero" => "1" "paginaInicial" => "83" "paginaFinal" => "84" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1735128" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0190" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The GxxxG motif: a framework for transmembrane helix-helix association" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "W. Russ" 1 => "D. Engelman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1006/jmbi.1999.3489" "Revista" => array:7 [ "tituloSerie" => "J. Mol. Biol." "fecha" => "2000" "volumen" => "296" "numero" => "3" "paginaInicial" => "911" "paginaFinal" => "919" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10677291" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0195" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interhelical hydrogen bonding drives strong interactions in membrane proteins" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F.X. Zhou" 1 => "M.J. Cocco" 2 => "W.P. Russ" 3 => "A.T. Brunger" 4 => "D.M. Engelman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/72430" "Revista" => array:7 [ "tituloSerie" => "Nat. Struct. Biol." "fecha" => "2000" "volumen" => "7" "numero" => "2" "paginaInicial" => "154" "paginaFinal" => "160" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10655619" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0200" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Constitutive activation of opsin: influence of charge at position 134 and size at position 296" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G.B. Cohen" 1 => "T. Yang" 2 => "P.R. Robinson" 3 => "D.D. Oprian" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biochemistry" "fecha" => "1993" "volumen" => "32" "paginaInicial" => "6111" "paginaFinal" => "6115" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8099498" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0205" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure and function in rhodopsins rhodopsin mutants with a neutral amino acid at E134 have a partially activated conformation in the dark state" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.M. Kim" 1 => "C. Altenbach" 2 => "R.L. Thurmond" 3 => "H.G. Khorana" 4 => "W.L. Hubbell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Proc. Natl. Acad. Sci. U.S.A." "fecha" => "1997" "volumen" => "94" "numero" => "26" "paginaInicial" => "14273" "paginaFinal" => "14278" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9405602" "web" => "Medline" ] ] ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0210" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The cytoplasmic end of transmembrane domain 3 regulates the activity of the Saccharomyces cerevisiae G-protein-coupled alpha-factor receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Parrish" 1 => "M. Eilers" 2 => "W. Ying" 3 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Genetics" "fecha" => "2002" "volumen" => "160" "paginaInicial" => "429" "paginaFinal" => "443" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11861550" "web" => "Medline" ] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0215" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Activation of G-protein-coupled receptors: a common molecular mechanism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Karnik" 1 => "C. Gogonea" 2 => "S. Patil" 3 => "Y. Saad" 4 => "T. Takezako" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Trends Endocrinol. Metab." "fecha" => "2003" "volumen" => "14" "numero" => "9" "paginaInicial" => "431" "paginaFinal" => "437" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14580763" "web" => "Medline" ] ] ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0220" "etiqueta" => "44" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "G protein-coupled receptors. I. Diversity of receptor–ligand interactions" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T.H. Ji" 1 => "M. Grossmann" 2 => "I. Ji" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "J. Biol. Chem." "fecha" => "1998" "volumen" => "273" "numero" => "28" "paginaInicial" => "17299" "paginaFinal" => "17302" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9651309" "web" => "Medline" ] ] ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib0225" "etiqueta" => "45" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of extracellular charged amino acids in the yeast α-factor receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Bajaj" 1 => "S. Connelly" 2 => "A. Gehret" 3 => "F. Naider" 4 => "M. Dumont" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbamcr.2007.02.002" "Revista" => array:6 [ "tituloSerie" => "Biochim. Biophys. Acta (BBA)-Molecular Cell Research" "fecha" => "2007" "volumen" => "1773" "numero" => "6" "paginaInicial" => "707" "paginaFinal" => "717" ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib0230" "etiqueta" => "46" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sequences in the intracellular loops of the yeast pheromone receptor Ste2p required for G protein activation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Celić" 1 => "N.P. Martin" 2 => "C.D. Son" 3 => "J.M. Becker" 4 => "F. Naider" 5 => "M.E. Dumont" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/bi0269308" "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2003" "volumen" => "42" "numero" => "10" "paginaInicial" => "3004" "paginaFinal" => "3017" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12627966" "web" => "Medline" ] ] ] ] ] ] ] ] 46 => array:3 [ "identificador" => "bib0235" "etiqueta" => "47" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of a contact region between the tridecapeptide alpha-factor mating pheromone of Saccharomyces cerevisiae and its G protein-coupled receptor by photoaffinity labeling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L.K. Henry" 1 => "S. Khare" 2 => "C. Son" 3 => "V.V.S. Babu" 4 => "F. Naider" 5 => "J.M. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2002" "volumen" => "41" "numero" => "19" "paginaInicial" => "6128" "paginaFinal" => "6139" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11994008" "web" => "Medline" ] ] ] ] ] ] ] ] 47 => array:3 [ "identificador" => "bib0240" "etiqueta" => "48" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Systematic mutagenesis of the yeast mating pheromone receptor third intracellular loop" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C.D. Clark" 1 => "T. Palzkill" 2 => "D. Botstein" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Journal of Biological Chemistry" "fecha" => "1994" "volumen" => "269" "numero" => "12" "paginaInicial" => "8831" "paginaFinal" => "8841" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8132618" "web" => "Medline" ] ] ] ] ] ] ] ] 48 => array:3 [ "identificador" => "bib0245" "etiqueta" => "49" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anatomy of hot spots in protein interfaces" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Bogann" 1 => "K. Thorn" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1006/jmbi.1998.1843" "Revista" => array:7 [ "tituloSerie" => "Journal of Molecular Biology" "fecha" => "1998" "volumen" => "280" "numero" => "1" "paginaInicial" => "1" "paginaFinal" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9653027" "web" => "Medline" ] ] ] ] ] ] ] ] 49 => array:3 [ "identificador" => "bib0250" "etiqueta" => "50" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mutations affecting ligand specificity of the G-protein-coupled receptor for the Saccharomyces cerevisiae tridecapeptide pheromone" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Abel" 1 => "B. Lee" 2 => "F. Naider" 3 => "J. Becker" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Biochimica et Biophysica Acta (BBA)-Molecular Cell Research" "fecha" => "1998" "volumen" => "1448" "numero" => "1" "paginaInicial" => "12" "paginaFinal" => "26" ] ] ] ] ] ] 50 => array:3 [ "identificador" => "bib0255" "etiqueta" => "51" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dominant-negative mutations in the G-protein-coupled R-factor receptor map to the extracellular ends of the transmembrane segments" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Dosil" 1 => "L. Giot" 2 => "C. Davis" 3 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mol. Cell. Biol." "fecha" => "1998" "volumen" => "18" "paginaInicial" => "5981" "paginaFinal" => "5991" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9742115" "web" => "Medline" ] ] ] ] ] ] ] ] 51 => array:3 [ "identificador" => "bib0260" "etiqueta" => "52" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Probing the binding domain of the Saccharomyces cerevisiae alpha-mating factor receptor with fluorescent ligands" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "F.X. Ding" 1 => "B.K. Lee" 2 => "M. Hauser" 3 => "L. Davenport" 4 => "J.M. Becker" 5 => "F. Naider" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Biochemistry" "fecha" => "2001" "volumen" => "40" "numero" => "4" "paginaInicial" => "1102" "paginaFinal" => "1108" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11170434" "web" => "Medline" ] ] ] ] ] ] ] ] 52 => array:3 [ "identificador" => "bib0265" "etiqueta" => "53" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A microdomain formed by the extracellular ends of the transmembrane domains promotes activation of the G protein-coupled alpha-factor receptor" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.C. Lin" 1 => "K. Duell" 2 => "J.B. Konopka" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Molecular and Cellular Biology" "fecha" => "2004" "volumen" => "24" "numero" => "5" "paginaInicial" => "2041" "paginaFinal" => "2051" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14966283" "web" => "Medline" ] ] ] ] ] ] ] ] 53 => array:3 [ "identificador" => "bib0270" "etiqueta" => "54" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Conservation and relative importance of residues across protein-protein interfaces" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Guharoy" 1 => "P. Chakrabarti" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.0505425102" "Revista" => array:7 [ "tituloSerie" => "Proc. Natl. Acad. Sci.U.S.A." "fecha" => "2005" "volumen" => "102" "numero" => "43" "paginaInicial" => "15447" "paginaFinal" => "15452" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16221766" "web" => "Medline" ] ] ] ] ] ] ] ] 54 => array:3 [ "identificador" => "bib0275" "etiqueta" => "55" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Are protein–protein interfaces more conserved in sequence than the rest of the protein surface?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D.R. Caffrey" 1 => "S. Somaroo" 2 => "J.D. Hughes" 3 => "J. Mintseris" 4 => "E.S. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1110/ps.03323604" "Revista" => array:6 [ "tituloSerie" => "Prot. Sci." "fecha" => "2004" "volumen" => "13" "numero" => "1" "paginaInicial" => "190" "paginaFinal" => "202" ] ] ] ] ] ] 55 => array:3 [ "identificador" => "bib0280" "etiqueta" => "56" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Moult, J., Fidelis, K., Kryshtafovych, A., Schwede, T. & Tramontano, A. Critical assessment of methods of protein structure prediction (CASP)–round x. 82 Suppl 2 (0 2), 1-6 (2014). DOI: 10.1002/prot.24452." ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack262683" "titulo" => "ACKNOWLEDGMENTS" "texto" => "This work was in part supported by PAPIIT grant number IN208014 to Gabriel del Río. Laura Marina Robles (fellowship number 261023) was supported in part by Consejo Nacional de Ciencia y Tecnología (CONACYT) while she was student of the Programa de Maestría en Ciencias Bioquímicas, UNAM. We thank María Teresa Lara Ortiz at the Institute of Cellular Physiology/Universidad Nacional Autónoma de México for her technical assistance in this work." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300134/v1_201612310020/en/main.assets" "Apartado" => array:4 [ "identificador" => "41941" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Artículos originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/1405888X/0000002000000001/v1_201612310020/S1405888X16300134/v1_201612310020/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300134?idApp=UINPBA00004N"]

Statistics

ARTÍCULO ORIGINAL

STRUCTURE-FUNCTION STUDIES OF THE ALPHA PHEROMONE RECEPTOR FROM YEAST

Estudio de la relación entre la estructura y la función del receptor de la feromona alfa de levadura

Laura Marina Roblesa, César Millán-Pachecoc, Nina Pastorb, Gabriel Del Ríoa,

Corresponding author

gdelrio@ifc.unam.mx

Corresponding author.

a Departamento de Bioquímica y Biología Estructural, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Ciudad Universitaria, Deleg. Coyoacán, C.P. 04510, Ciudad de México, México

b Centro de Investigación en Dinámica Celular, IICBA, Universidad Autónoma del Estado de Morelos, Av. Universidad #1001, Col. Chamilpa, Cuernavaca, Morelos, C.P. 62209, México

c Facultad de Farmacia, Universidad Autónoma del Estado de Morelos, Av. Universidad #1001, Col. Chamilpa, Cuernavaca, Morelos, C.P. 62209, México

Read

2149

Times
was read the article

500

Total PDF

1649

Total HTML

Share statistics

 array:24 [
  "pii" => "S1405888X16300134"
  "issn" => "1405888X"
  "doi" => "10.1016/j.recqb.2016.11.002"
  "estado" => "S300"
  "fechaPublicacion" => "2017-01-01"
  "aid" => "27"
  "copyright" => "Universidad Nacional Aut&#243;noma de M&#233;xico&#44; Facultad de Estudios Superiores Zaragoza"
  "copyrightAnyo" => "2017"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "TIP. 2017;20:16-26"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 851
    "formatos" => array:3 [
      "EPUB" => 45
      "HTML" => 665
      "PDF" => 141
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1405888X16300146"
    "issn" => "1405888X"
    "doi" => "10.1016/j.recqb.2016.11.003"
    "estado" => "S300"
    "fechaPublicacion" => "2017-01-01"
    "aid" => "28"
    "copyright" => "Universidad Nacional Aut&#243;noma de M&#233;xico&#44; Facultad de Estudios Superiores Zaragoza"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "ssu"
    "cita" => "TIP. 2017;20:27-39"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 4719
      "formatos" => array:3 [
        "EPUB" => 44
        "HTML" => 4388
        "PDF" => 287
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">ART&#205;CULO DE REVISI&#211;N</span>"
      "titulo" => "CONSIDERACIONES GENERALES EN EL ESTABLECIMIENTO DEL SEXO EN MAM&#205;FEROS"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "27"
          "paginaFinal" => "39"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "A consideration of the establishment of sex in mammals"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0030"
          "etiqueta" => "Figura 6"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr6.jpeg"
              "Alto" => 2769
              "Ancho" => 3578
              "Tamanyo" => 692802
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Esquema de diferenciaci&#243;n de los genitales externos&#46; A&#46; Fase indiferenciada de los genitales externos&#44; aproximadamente a las 4 semanas de gestaci&#243;n en humano&#46; B&#46; Desarrollo de los genitales externos en el var&#243;n&#44; al nacimiento&#46; El tub&#233;rculo genital crece y origina el falo&#44; los pliegues cloacales se fusionan para dar origen a la uretra&#44; las eminencias genitales se fusionan y originan el escroto&#46; C&#46; Formaci&#243;n de los genitales externos femeninos&#46; El tub&#233;rculo genital aparenta una reducci&#243;n de tama&#241;o y da origen al cl&#237;toris&#46; Los pliegues cloacales crecen para originar los labios menores&#44; mientras que las eminencias genitales forman los labios mayores&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ver&#243;nica D&#237;az-Hern&#225;ndez, Horacio Merchant-Larios"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "Ver&#243;nica"
              "apellidos" => "D&#237;az-Hern&#225;ndez"
            ]
            1 => array:2 [
              "nombre" => "Horacio"
              "apellidos" => "Merchant-Larios"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300146?idApp=UINPBA00004N"
    "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300146/v1_201612310020/es/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1405888X16300122"
    "issn" => "1405888X"
    "doi" => "10.1016/j.recqb.2016.11.001"
    "estado" => "S300"
    "fechaPublicacion" => "2017-01-01"
    "aid" => "26"
    "copyright" => "Universidad Nacional Aut&#243;noma de M&#233;xico&#44; Facultad de Estudios Superiores Zaragoza"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "TIP. 2017;20:5-15"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 910
      "formatos" => array:3 [
        "EPUB" => 33
        "HTML" => 678
        "PDF" => 199
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">ART&#205;CULO ORIGINAL</span>"
      "titulo" => "COMPORTAMIENTO VOLUM&#201;TRICO DE LA DL-VALINA EN SOLUCIONES ACUOSAS DE NITRATO DE SODIO A DIFERENTES TEMPERATURAS"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "5"
          "paginaFinal" => "15"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Volumetric behavior of the DL-valine in aqueous solutions of sodium nitrate at different temperatures"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figura 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1073
              "Ancho" => 1707
              "Tamanyo" => 169104
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Densidades de la DL-valina en mezcla acuosa de NaNO<span class="elsevierStyleInf">3</span> 0&#46;0106<span class="elsevierStyleHsp" style=""></span>mol kg<span class="elsevierStyleSup">-1</span> a diferentes temperaturas&#46; &#40;Todos los sistemas acuosos de NaNO<span class="elsevierStyleInf">3</span> estudiados presentan la misma tendencia en sus datos&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Manuel P&#225;ez-Meza, Jorge Ramos-Montiel, Nicol&#225;s De La Espriella-V&#233;lez"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Manuel"
              "apellidos" => "P&#225;ez-Meza"
            ]
            1 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "Ramos-Montiel"
            ]
            2 => array:2 [
              "nombre" => "Nicol&#225;s"
              "apellidos" => "De La Espriella-V&#233;lez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300122?idApp=UINPBA00004N"
    "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300122/v1_201612310020/es/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">ART&#205;CULO ORIGINAL</span>"
    "titulo" => "STRUCTURE-FUNCTION STUDIES OF THE ALPHA PHEROMONE RECEPTOR FROM YEAST"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "16"
        "paginaFinal" => "26"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Laura Marina Robles, C&#233;sar Mill&#225;n-Pacheco, Nina Pastor, Gabriel Del R&#237;o"
        "autores" => array:4 [
          0 => array:3 [
            "nombre" => "Laura"
            "apellidos" => "Marina Robles"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "C&#233;sar"
            "apellidos" => "Mill&#225;n-Pacheco"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Nina"
            "apellidos" => "Pastor"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:4 [
            "nombre" => "Gabriel"
            "apellidos" => "Del R&#237;o"
            "email" => array:1 [
              0 => "gdelrio&#64;ifc&#46;unam&#46;mx"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Departamento de Bioqu&#237;mica y Biolog&#237;a Estructural&#44; Instituto de Fisiolog&#237;a Celular&#44; Universidad Nacional Aut&#243;noma de M&#233;xico&#44; Ciudad Universitaria&#44; Deleg&#46; Coyoac&#225;n&#44; C&#46;P&#46; 04510&#44; Ciudad de M&#233;xico&#44; M&#233;xico"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Centro de Investigaci&#243;n en Din&#225;mica Celular&#44; IICBA&#44; Universidad Aut&#243;noma del Estado de Morelos&#44; Av&#46; Universidad &#35;1001&#44; Col&#46; Chamilpa&#44; Cuernavaca&#44; Morelos&#44; C&#46;P&#46; 62209&#44; M&#233;xico"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Facultad de Farmacia&#44; Universidad Aut&#243;noma del Estado de Morelos&#44; Av&#46; Universidad &#35;1001&#44; Col&#46; Chamilpa&#44; Cuernavaca&#44; Morelos&#44; C&#46;P&#46; 62209&#44; M&#233;xico"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Estudio de la relaci&#243;n entre la estructura y la funci&#243;n del receptor de la feromona alfa de levadura"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1415
            "Ancho" => 3581
            "Tamanyo" => 416347
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Topological diagram of Ste2p&#46; Every amino acid residue from Ste2p is represented by a single letter code within a gray circle&#46; The two horizontal lines separating the extracellular from the intracellular spaces represent the membrane&#46; Data derived from<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a>&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">INTRODUCTION</span><p id="par0005" class="elsevierStylePara elsevierViewall">Over the past four decades extensive research has been carried out about the structure-function relationships of G protein coupled receptors &#40;GPCRs&#41;&#44; promoted by both basic and applied aspects of this group of receptors&#59; more than 40&#37; of drugs in clinical use target GPCRs<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> and many fundamental aspects of cell physiology are regulated by these receptors<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>&#46; Relevant to this study&#44; the GPCR Ste2p from <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span> mediates mating by recognizing the tridecapeptide mating factor&#44; alpha pheromone&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">The first studies on Ste2p were reported in 1970-1980 when the molecular basis of mating in yeast cells was discovered&#46; Many genes rendering a sterile &#40;STE&#41; phenotype were discovered&#44; and among these was <span class="elsevierStyleItalic">STE2</span><a class="elsevierStyleCrossRefs" href="#bib0015"><span class="elsevierStyleSup">3&#44;4</span></a> that was further cloned and characterized<a class="elsevierStyleCrossRefs" href="#bib0025"><span class="elsevierStyleSup">5&#44;6</span></a>&#46; A few years later&#44; the topological structure of Ste2p was inferred through solvent accessibility studies &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>&#41;&#46; Due to difficulties to purify and crystallize integral membrane proteins&#44; the atomic three-dimensional structure of Ste2p has not yet been determined&#46; However&#44; NMR was used to determine the structures of two fragments of this receptor&#58; the HI-H2 segment &#40;Protein Data Base entry code&#58; 2K9P&#41;&#44; and a segment of H6 &#40;PDB entry code&#58; 1PJD&#41;<a class="elsevierStyleCrossRefs" href="#bib0035"><span class="elsevierStyleSup">7&#44;8</span></a>&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0015" class="elsevierStylePara elsevierViewall">Several residues and regions that are critical for <span class="elsevierStyleItalic">STE2</span> function have been determined by site-directed mutagenesis&#46; For example&#44; the N-terminal domain mediates oligomerization of the receptor<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9&#44;10</span></a> while the C-terminal domain acts as negative regulator<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11&#8211;13</span></a>&#46; The third cytoplasmic loop interacts with the trimeric G protein<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a>&#44; and the first extracellular loop undergoes a conformational change upon ligand binding<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> and also plays a role in signal transduction<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a>&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Three different 2D models of Ste2p bound to the pheromone have been proposed and were built based on biochemical data derived until 2004 in an attempt to recapitulate the structure-function studies of this receptor&#46; Briefly&#44; Lee B&#46; K&#46; and colleagues<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> proposed a model where both the N and C-termini of the pheromone are buried inside the transmembrane helices of Ste2p&#44; whereas the central region&#44; including a turn structure&#44; interacts with the extracellular domains&#46; In that model&#44; two residues of the receptor&#44; Ser47 and Thr48&#44; were proposed to interact with Gln10 of the pheromone&#46; Lin J&#46; C&#46; and colleagues<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> proposed a model that highlights the role of aromatic residues in the interaction between the pheromone and the pocket formed by the extracellular ends of the transmembrane helices in the receptor&#46; In this model&#44; a &#946;-bend is formed at the central region of the pheromone&#46; Tyr266 on helix 6 is oriented toward the surrounding lipids and interacts with Trp1-His2-Trp3 of the pheromone&#44; while Phe204&#44; located within the helix bundle between helix 4 and helix 5&#44; interacts with Tyr13 of the pheromone&#46; Finally&#44; Son C&#46; D&#46; and colleagues<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> proposed a model where Gln10 of the pheromone interacts with residues Ser47 and Thr48 in Ste2&#46; Tyr13 in the pheromone interacts with helix 1 &#40;Phe55&#8722;Arg58&#41; and Trp1 and Trp3 in the pheromone interact with aromatic residues Phe262 and Tyr266 at the extracellular interface of helix 6&#46; All these models have in common that the central region of the pheromone forms a turn structure that is oriented away from the transmembranal helix-bundle&#44; whereas both the N and C-termini of the pheromone are oriented toward the binding pocket formed by extracellular ends of helix 1&#44; helix 5&#44; and helix 6&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">In the present study&#44; we built a novel three-dimensional model of Ste2 bound to the pheromone&#44; incorporating mutagenesis information about Ste2p function that was not necessarily incorporated in previous models of this interaction&#59; our model was built using the state of art tools used to build three-dimensional models of proteins&#46; In our model&#44; Ile190 in Ste2p&#44; a conserved position among fungal species&#44; does not interact with the pheromone&#46; To test our model&#44; we performed a mutagenesis at this residue&#46; We choose this residue because it is part of the second extracellular loop&#44; which has been previously implied to play a role in ligand recognition and binding in other GPCRs&#44; such as the dopamine D2<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a>&#44; MT2 melatonin<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a>&#44; thyrotropin<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> angiotensin<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a>&#44; and histamine H1<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a> receptors&#46; Our results indicate that some mutants of this residue have a small effect on the Ste2p signaling cascade that leads cells to arrest cell growth in the presence of the pheromone&#46; The structural bases of these results are discussed using our three-dimensional model&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">MATERIAL AND METHODS</span><p id="par0030" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The construction of a Ste2 model was done using the rhodopsin crystal as a template</span>&#46; The receptor model was built using the i-TASSER V4&#46;1 server<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a>&#46; i-TASSER was chosen because it was ranked as the server with best results in CASP7 to CASP10 &#40;Critical Assessment of Techniques for Protein Structure Prediction&#41;&#46; We modeled residues 47 to 296&#46; The N-terminal &#40;residues 1-46&#41; and C-terminal domains &#40;residues 297-431&#41; were not modeled because these domains are not essential for ligand binding&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall">Despite the fact that Ste2p and rhodopsin have a low sequence identity &#40;20&#37;&#41;&#44; rhodopsin was used as a template for Ste2p modeling because&#58; 1&#41; Ste2p and rhodopsin share structural and functional properties&#44; 2&#41; available structural and mutational data show that the Ste2p and rhodopsin sequences align properly based on a comparison of amino acids that have similar structural and functional roles in membrane proteins<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> and 3&#41; rhodopsin has been used as a template for previously developed Ste2p models<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a>&#46; The sequences for Ste2p and rhodopsin were obtained from the UniProt database&#46; The crystal structure of rhodopsin &#40;PDB entry code 1U19<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">28</span></a>&#41; was obtained from the Protein Data Bank<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">29</span></a>&#46; The alignment of Ste2p with rhodopsin was carried out as described previously<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a>&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">The membrane boundaries in the Ste2p sequence were obtained from solvent accessibility data<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> and were used in i-TASSER to specify boundaries of secondary structures&#46; To guide i-TASSER on the correct helix orientation&#44; distance restraints between specific residues were obtained from the PDB file of rhodopsin using the distance between the alpha-carbon from a residue placed at the end of a helix and the alpha-carbon from the residues localized at the ends of all the other helices&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Construction of the alpha-pheromone three-dimensional model&#46;</span> The PEP-FOLD server<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a> was used to develop an atomic three-dimensional model of the alpha pheromone peptide&#46; The sequence of alpha pheromone Trp-His-Trp-Leu-Gln-Leu-Lys-Pro-Gly-Gln-Pro-Met-Tyr was sent to the server in FASTA format&#46; The model that was closer to the structural characterization of the pheromone by NMR<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> was selected from the results generated by the PEP-FOLD server&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Docking of Ste2 with alpha pheromone</span>&#46; For docking experiments the ClusPro 2&#46;0 server<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> was used&#46; Amino acid residues of the Ste2p receptor and the pheromone involved in binding were used to focus the docking on such residues&#46; These residues included &#40;Ste2p-pheromone pairs&#59; the secondary structure element of the Ste2p residue is indicated in parenthesis for convenience&#41;&#58; Ser47&#40;H1&#41;-Gln10<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a>&#44; Thr48&#40;H1&#41;-Gln10<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a>&#44; Phe204&#40;H5&#41;-Tyr13<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a>&#44; Asn205&#40;H5&#41;-Trp3<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a>&#44; Tyr266&#40;H6&#41;-Trp3<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> and Lys269&#40;H6&#41;-Trp1<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a>&#46; The energy of the Ste2p-alpha pheromone complex was minimized using CHARMM<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">35</span></a>&#59; for that end the C38B2 CHARMM version and CHARMM36 potentials were used&#46; The complex that showed the lowest interaction energy with the lowest average distance between contacts was selected&#46; All the structures were visually inspected with the PyMol viewer software<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">36</span></a>&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Site-directed mutagenesis of the STE2 gene</span>&#46; Mutations were introduced into the receptor gene &#40;<span class="elsevierStyleItalic">STE2</span>&#41; by PCR using the kit &#8220;QuikChange Lightning&#8221; &#40;Agilent Technologies Cat&#46; No&#46; 210519&#41;&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">The pYES-STE2 plasmid was used as template for PCR and was constructed by subcloning the 1296<span class="elsevierStyleHsp" style=""></span>bp <span class="elsevierStyleItalic">STE2</span> gene into the pYES2 plasmid &#40;Invitrogen Cat&#46; No&#46; V82520&#41;&#46; <span class="elsevierStyleItalic">STE2</span> was obtained from the pGRB2&#46;2-STE2 plasmid using the XbaI and EcoRI restriction enzymes&#46; The pGRB2&#46;2-STE2 plasmid was kindly provided by Dra&#46; Irene Casta&#241;o &#40;Instituto Potosino de Investigaci&#243;n Cient&#237;fica y Tecnol&#243;gica&#44; San Luis Potos&#237;&#44; M&#233;xico&#41;&#46; Mutagenic primers were designed according to manufacturer&#39;s instructions and were complementary to the <span class="elsevierStyleItalic">STE2</span> sequence&#44; except for the AUU codon of Ile190 that was changed for NNG&#47;C to introduce the mutations&#46; Sequences of the primers used are described next&#58;<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">1&#41;</span><p id="par0065" class="elsevierStylePara elsevierViewall">5&#8217;GCGCTGTTAAAGGTATGNNG&#47;CGTGACTTATAAT GATGTTAGTGCCACCC 3&#8217;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">2&#41;</span><p id="par0070" class="elsevierStylePara elsevierViewall">5&#8217; GGGTGGCACTAACATCATTATAAGTCACG&#47;CNNCA TACCTTTAACAGCGC 3&#8217;&#46;</p></li></ul></p><p id="par0075" class="elsevierStylePara elsevierViewall">The whole vector pYES-STE2 was amplified using PfuTurbe polymerase&#46; Then&#44; the PCR product was digested with DpnI restriction enzyme at 37<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>minutes to eliminate the parental &#40;non mutated&#41; plasmid&#44; and then transformed into DH5&#945; <span class="elsevierStyleItalic">E&#46; coli</span> strain&#46; Transformed cells were selected on ampicillin-containing plates and plasmids were isolated from transformed cells using QIAprep Spin Miniprep Kit &#40;QIAGEN Cat&#46; No&#46; 27106&#41;&#46; Isolated mutants were confirmed by DNA sequence analysis&#46; DNA sequencing was carried out in the Unidad de Biolog&#237;a Molecular&#44; located at the Instituto de Fisiolog&#237;a Celular&#46; Constructs were transformed into a <span class="elsevierStyleItalic">STE2</span> null mutant MATa strain &#40;BY4741 &#916;YFLO26W&#58;&#58;kanMX4&#41; as previously described elsewhere<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">37</span></a> and transformed cells were selected by their growth in minimal medium lacking uracil&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Growth curves&#46;</span> Yeast cultures expressing the mutant receptor were incubated for 24<span class="elsevierStyleHsp" style=""></span>hours at 30<span class="elsevierStyleHsp" style=""></span>&#176;C with minimal medium lacking uracil with glucose&#44; and then were incubated for 6 additional hours with minimal medium lacking uracil with galactose in order to induce the expression of <span class="elsevierStyleItalic">STE2</span> in the plasmid&#46; Afterwards&#44; yeast cells were diluted to optical density of 0&#46;11 and incubated with pheromone &#40;Anaspec&#41; at 10<span class="elsevierStyleHsp" style=""></span>&#956;M into a 96-well half area plate in a total volume of 150<span class="elsevierStyleHsp" style=""></span>&#956;l&#46; The incubation was carried out at 30<span class="elsevierStyleHsp" style=""></span>&#176;C with shaking and the A600<span class="elsevierStyleHsp" style=""></span>nm was measured every hour for 24<span class="elsevierStyleHsp" style=""></span>h using a Synergy MX plate reader &#40;BioTek Instruments&#41;&#46; The experiment was repeated three times each time with a triplicate&#46; Growth curves data were normalized and the area under the curve was calculated for each mutant&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">RESULTS AND DISCUSSION</span><p id="par0085" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Three-dimensional model of Ste2p&#46;</span> The Ste2p model with the best C-score &#40;confidence score&#41; was selected &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Figure 2</a>&#41;&#59; in our case the C-score was -1&#46;01 and the TM-score was 0&#46;30&#46; The C-score given by i-TASSER estimates the quality of predicted models is in the range of &#91;-5&#44; 2&#93;&#46; Models with C-score &#62;-1&#46;5 tend to be close to the native structure&#46; The TM-score provided by i-TASSER estimates the similarity of the protein model and its template&#59; a score below 0&#46;17 corresponds to two proteins that are not similar while above 0&#46;5 correspond to proteins that are structurally homologues&#46; Thus&#44; the TM-score indicates the Ste2p model differs from the rhodopsin template &#40;1U19&#41; as expected &#40;see Methods&#41;&#44; but remains similar&#46; In our three-dimensional model the boundaries of the transmembrane helices matched the solvent accessibility data previously described<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a>&#44; except for the H6&#46; This helix has been reported to expand from Leu248 to Leu268 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>&#41;&#44; while in our model it spans from Phe244 to Ile263&#46; This difference reflects the fact that the loop connecting H5 to H6 presents two residues &#40;244 and 245&#41; at the end of this loop that are not accessible to biotinylation&#44; followed by two other residues that are accessible to biotinylation &#40;246 and 247&#41;&#46; The authors proposed that H6 should start at residue 248&#44; but we prefer to use the first residues that were inaccessible as part of this helix&#46; These authors could not establish the end of this helix&#44; so we used as a criterion the sequence alignment between Ste2p and rhodopsin generated with i-TASSER&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0090" class="elsevierStylePara elsevierViewall">The Ste2p model showed helix-helix interactions that were consistent with biochemical data&#46; For example&#44; Ste2p has a GXXXG motif in H1 that includes Gly56 and Gly60&#46; These motifs mediate helix-helix interactions<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">38</span></a> and have been implicated in the dimerization of Ste2p<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a>&#46; To achieve this&#44; these glycines must face outwards the protein&#46; In our model&#44; these glycines are properly oriented &#40;see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0095" class="elsevierStylePara elsevierViewall">As opposed to globular proteins&#44; interactions between transmembrane helices are generally mediated by polar amino acids located in the transmembrane region<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">39</span></a>&#46; These amino acids can form single helix-helix contacts or hydrogen-bonding networks&#46; It has been proposed based on sequence conservation that the H1-H2 interaction is mediated by a hydrogen bond between Arg58 &#40;HI&#41; and His94 &#40;H2&#41;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a>&#46; However&#44; in our Ste2p model Arg58 may form a hydrogen bond with Tyr101 on the same face of H2 &#40;see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>&#41;&#44; so further mutagenesis and structural experiments may test for the relevance of these pairs of residues in the H1-H2 interaction&#46; Similarly&#44; our model proposed other new helix-helix interactions&#46; For instance&#44; the proximity of residues Ser170 &#40;H3&#41; and Glu143 &#40;H4&#41; would mediate H3-H4 interactions &#40;see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>&#41;&#46; Likewise Ser107 and Thr110 of the extracellular loop 2 may interact with Gln51 &#40;H1&#41; &#40;see <a class="elsevierStyleCrossRef" href="#fig0015">Figure 3</a>&#41;&#46; Our three-dimensional model of Ste2p also displays the orientation of residues that are consistent with their functional role in other GPCRs&#46; For instance&#44; we observed that Gln149 appears to be functionally equivalent to Glu134&#44; which is part of the ERY motif in rhodopsin&#46; Both Glu134 in rhodopsin and Gln149 in Ste2p are localized in a similar position at the end of H3&#44; and are residues where mutation to arginine or alanine leads to constitutive activation<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">40&#8211;42</span></a>&#46; In agreement with these previous observations&#44; Gln149 is oriented in a position similar to that of Glu134 in rhodopsin and presumably shares the role of preventing constitutive activation of the receptor&#59; the reported single point mutations to alanine in positions Gln149 or Asn84 rendered a constitutive activation of the Ste2p receptor&#44; and a double mutation that swapped the side chains of these two residues maintained a wild-type phenotype suggesting these residues are in close proximity in the 3D structure of Ste2p&#46; In our model&#44; Gln149 and Asn84 are 10&#46;5<span class="elsevierStyleHsp" style=""></span>&#8491; apart and facing away from each other&#44; indicating that our model is not consistent with these experimental results&#46; Since our model did not include the N and C termini located at the side where Gln149 lies&#44; it seems that the orientation of H2 and H3 on this side of the transmembrane region of the receptor are not properly oriented in our model&#46; Yet&#44; pheromone binding takes place at the opposite side of the transmembrane region and presumably does not include these helices&#44; so we proceed to analyze the reliability of our model&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Docking</span>&#46; The ligand binding orientations vary widely between the members of the GPCR family<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">43</span></a>&#46; It has been shown that large ligands bind to the extracellular loops of GPCRs&#44; while small ligands bind to the transmembrane region of receptor&#46; In the case of peptide ligands it has been proposed that a combination of both binding modes takes place&#46; In such case&#44; the ligand binds first to extracellular loops and later enters the transmembrane domain where the binding pocket acts like an epicenter of conformational changes&#46; These conformational changes are propagated to intracellular loops through the movement of helices&#46; Then&#44; the intracellular domain binds to and activates the trimeric G protein<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">43</span></a>&#46; In the case of Ste2p&#44; alpha pheromone binding has been mapped to the pocket formed by the extracellular ends of the transmembrane helices&#44; specifically H1&#44; H5&#44; and H6<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;18&#44;33&#44;34</span></a>&#46;</p><p id="par0105" class="elsevierStylePara elsevierViewall">The GPCRs interact with their ligands via hydrogen bonds&#44; ionic pairs and hydrophobic contacts<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">44</span></a>&#46; The interactions between Ste2p and the alpha pheromone responsible for binding and activation are not well characterized&#46; However&#44; electrostatic interactions have been suggested to play a critical role in the Ste2p-alpha pheromone complex<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">45</span></a>&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">The docking simulation aimed to model the Ste2p-alpha pheromone interaction &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>&#41;&#46; In this model all contacts in the Ste2p-alpha pheromone interaction previously reported are present&#46; For instance&#44; previous studies about the affinities and activities of various alpha pheromone analogues have shown that residues Ser47 and Thr48 are near Gln10 in the alpha pheromone<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a>&#46; As we see in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>&#44; our binding model is congruent with these data&#46; Phe204 and Tyr266 are located in the extracellular ends of the helices H5 and H6&#44; respectively&#46; These helices are linked at the opposite end involved in pheromone binding by the third intracellular loop that interacts with the trimeric G protein and promotes its activation<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;46&#44;48</span></a>&#46; Site-directed mutagenesis studies showed that Phe204 interacts with the C-terminal region of the pheromone &#40;likely with Tyr13&#41;&#44; while Tyr266 interacts with the N-terminal region &#40;likely with Trp1 or Trp3&#41;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a>&#46; Both residues&#44; Phe204 and Tyr266&#44; play roles in the transformation of Ste2p into an activated state upon agonist binding<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;47</span></a>&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a> our model is consistent with these experimental data despite the previously noted differences in our model about H6 and the intracellular ends of H2 and H3 &#40;residues Asn84 and Gln149&#41;&#46; Finally&#44; interaction between aromatic residues in the alpha pheromone and Ste2p could be stabilized by ring stacking effects or by hydrogen bonding&#46; In our model the interaction between Tyr266 and Trp3 is stabilized by hydrogen bonding &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>&#41;&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><p id="par0115" class="elsevierStylePara elsevierViewall">However&#44; our model does not present the Asn205-pheromone contact&#46; Asn205 has been implicated in the binding of the N-terminal domain of the pheromone because mutations at this position affect the Ste2p binding to the pheromone<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a>&#46; It has been shown that residues that are important for binding are not necessarily near the ligand or at the interface in the three-dimensional structure<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">49</span></a>&#46; In our Ste2p model&#44; Asn205 faces away from the binding pocket &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Figure 4</a>&#41;&#46; Thus&#44; according to our model&#44; Asn205 would contribute to binding not by direct interaction with the pheromone&#46; In such case&#44; it would be expected that Asn205 may contribute to the pheromone binding through a set of interactions with residues that support the position of the residues that directly bind to the pheromone&#46; Analyzing the contacts &#40;cutoff distance &#60;&#61; 5<span class="elsevierStyleHsp" style=""></span>&#8491;&#41; of the Ste2p residues involved in the pheromone binding &#40;Ser47&#44; Thr48&#44; Phe204 and Tyr266&#41; and comparing these with the contacts of residue Asn205&#44; we learned these share 9 residues &#40;Val191&#44; Tyr193&#44; Asn194&#44; Tyr203&#44; Phe204&#44; Ala206&#44; Ser207&#44; Thr208&#44; and Ile209&#41;&#44; which corresponds to 29&#37; of the residues that support the position of the residues directly binding the pheromone&#46; This analysis further supports the relevance of Asn205 in pheromone binding through indirect contacts with the ligand binding residues&#46; These results constitute a hypothesis that can be experimentally tested by performing double swap mutants at Asn205 and the residues in the pheromone proposed to interact with Asn205 for instance&#59; in the present study we decided to mutate another region of the protein as explained below&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">Additionally&#44; our three-dimensional model has some discrepancies with other computational studies reported previously&#46; For example&#44; Phe204 does not interact with Tyr13 of the alpha pheromone in the Umanah model<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a>&#46; The lack of interaction between these residues was modeled based on studies of alpha pheromone analogues and chemical cross-linking experiments that proposed an interaction between Tyr13 of the alpha pheromone with Arg58 of Ste2p<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a>&#46; Our model on the other hand&#44; includes the interaction between Tyr13 and Phe204 proposed by Lee and colleagues<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a>&#44; based on site-directed mutagenesis and cross-linking experiments that were disregarded by the group of Umanah and colleagues&#46; We prefer to use the Tyr13-Phe204 interaction in the construction of our Ste2p model because it has more support by other research groups<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;50&#8211;52</span></a> than the Tyr13-Arg58 interaction<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">19&#44;34</span></a>&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">In the interface we found residues both accessible and inaccessible to solvent&#46; This is a feature of many other interfaces of proteins&#44; where solvent accessible residues play roles in ligand binding&#44; while those not accessible to solvent mediate the transition to an active state<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">52</span></a>&#46; Additionally&#44; our binding model allows us to propose that the interface between Ste2p and the pheromone is composed of 26 residues&#46; As shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>&#44; interface residues include both polar and non-polar residues&#46; This is consistent with previous studies indicating that both hydrophobic and hydrophilic residues form the binding pocket of Ste2p<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">53</span></a>&#46; The interface residues that are structurally and functionally important tend to be conserved residues or they have a lower rate of mutation compared with the rest of the residues of the protein<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">54</span></a>&#46; This is the case for Tyr266&#44; which is a critical residue for binding as well as signal transduction<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;47</span></a> and shows a large percentage of sequence identity conservation &#40;see <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>&#41;&#46; However&#44; this is not always the case and many residues that are important for binding are not conserved<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">55</span></a>&#46; In agreement with this idea&#44; <a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a> shows that few interface residues are conserved among Ste2p orthologues &#40;Val49&#44; Ser108&#44; Leu113&#44; Thr114&#44; Tyr266&#41;&#46; Furthermore&#44; Ser108 and Thr114 of the first extracellular loop&#44; found in the interface of Ste2 and the alpha pheromone in this study&#44; were previously proposed as critical for signaling<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a>&#46; Gln51 and Ser107&#44; also found at the interface&#44; are hydrogen bonded as suggested by the Ste2p model developed in this work&#44; yet these positions do not preserve the same side chain as Ste2p in other fungal orthologues&#46; Considering that the first extracellular loop has been observed to undergo a conformational change upon ligand binding<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> this hydrogen bond could be modified during the signaling process&#46; Other non-conserved residues &#40;<span class="elsevierStyleItalic">e&#46;g</span>&#46;&#44; Val49&#44; Asp201&#41; were also found in the interface that could play a critical role in Ste2p function&#46; Site-directed mutagenesis on these residues may help to test the role of these residues in ligand binding or signaling&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0130" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Site-directed mutagenesis of STE2</span>&#46; Several studies have shown that the second extracellular loop of GPCRs plays an important role in ligand binding<a class="elsevierStyleCrossRefs" href="#bib0105"><span class="elsevierStyleSup">21&#8211;25</span></a>&#46; Since no mutation for Ste2p at this loop has been reported&#44; we did not use this information to guide the docking of the pheromone to Ste2p&#46; A sequence conservation analysis performed among fungal receptors &#40;<a id="intr0005" class="elsevierStyleInterRef" href="http://www.yeastgenome.org/cache/fungi/YFL026W.html">http&#58;&#47;&#47;www&#46;yeastgenome&#46;org&#47;cache&#47;fungi&#47;YFL026W&#46;html</a>&#41; indicated that residue Ile190 of extracellular loop 2 might be relevant for Ste2p activity&#46; In this study&#44; Ile190 was mutated to test for its role in Ste2p function&#46; Five mutants &#40;Ile190Arg&#44; Ile190His&#44; Ile190Pro&#44; Ile190Leu and Ile190Ser&#41; were obtained and their ability to respond to the pheromone was tested&#46; <a class="elsevierStyleCrossRef" href="#fig0025">Figure 5</a> shows the cell growth of all strains expressing these mutants&#46; Two mutations that introduced a ring into that position &#40;Ile190His&#44; Ile190Pro&#41; or arginine reduced slightly the cell growth arrest induced by the pheromone&#44; while two other mutations &#40;Ile190Leu&#44; Ile190Ser&#41; did not reduce the cell growth arrest induced by the pheromone&#46; These results indicate that this position is not critical for receptor function&#44; but ring and positively-charged side chains are tolerated less at this position&#46; In our Ste2p-alpha pheromone model&#44; Ile190 is oriented away from the binding pocket&#44; behind Lys202&#44; a direct ligand of the pheromone &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table I</a>&#41;&#46; Placing an arginine at position 190 could result in an excess of positive charge at this site&#44; altering the conformation of Lys202 and debilitating the interaction with the pheromone&#46; Placing another ring&#44; such as Pro or His&#44; at position 190 could modify the position of Tyr203&#44; another residue in direct contact with the pheromone&#44; and&#47;or interact with His126 at the N-terminus of H3 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Figure 1</a>&#41;&#44; altering the tilt of H3 with allosteric consequences at the cytoplasmic loops that could impair signaling&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia><p id="par0135" class="elsevierStylePara elsevierViewall">Validating a model requires testing four different statistical parameters&#58; true positive &#40;TP&#41;&#44; true negative &#40;TN&#41;&#44; false positive &#40;FP&#41; and false negative &#40;FN&#41; predictions&#46; Yet&#44; most modeling studies of protein structure commonly test for TP&#59; for instance&#44; the world contest on protein structure prediction only tests for TP by establishing a score that accounts for the fraction of the model that may be superimposed to the real protein structure with no more than certain cutoff RMSD value<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">56</span></a>&#46; The relevance of the other 3 parameters becomes apparent when it is recognized that experimental protein 3D structures should also be considered a model to test for the critical role of residues in protein function&#46; In the present work we tested 4 parameters in our model&#44; thus providing a more complete test about the quality of the generated structure&#46; Particularly&#44; we showed that&#58;</p><p id="par0140" class="elsevierStylePara elsevierViewall">TP are residues predicted critical and indeed are critical for protein function&#47;structure&#46; For instance&#44; we show that residues Phe204 and Tyr266 that are close to the pheromone in our model are indeed important for binding&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">FP are residues predicted critical but are not truly relevant for protein function&#47;structure&#46; Here we show that residue Ile190 is predicted by sequence conservation to be relevant for protein structure&#47;function&#44; yet our experimental results provide evidence against this hypothesis&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">TN are residues predicted not critical and are not truly relevant for protein function&#47;structure&#46; Our 3D model predicted that Ile190 was not critical and here we show that indeed this is the case&#46;</p><p id="par0155" class="elsevierStylePara elsevierViewall">FN are residues that are predicted not critical but are truly relevant for protein function&#47;structure&#46; Our model predicts that residues Gln149 and Asn84 are far apart from each other&#44; yet experimental evidence has shown otherwise&#46;</p><p id="par0160" class="elsevierStylePara elsevierViewall">Note that TN and FN are difficult to test in protein structure-function studies because in most cases only residues with an effect on protein structure or function are reported in the literature&#46; Yet&#44; we argue this information is particularly relevant in testing for structure-function prediction models&#44; such as in the case of residues like Ile190&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">CONCLUSIONS</span><p id="par0165" class="elsevierStylePara elsevierViewall">The present study presents an atomic three-dimensional structure model of the alpha pheromone receptor from <span class="elsevierStyleItalic">S&#46; cerevisiae</span>&#44; Ste2p&#44; based on state-of-the-art modeling methods and current available experimental data&#46; The Ste2p model is consistent with most available biochemical information and allows us to propose specific interactions that could stabilize the native conformation of the receptor&#46; Furthermore&#44; a model of the interaction between Ste2p and the alpha pheromone was generated based on what is known about the binding contacts&#46; The Ste2p-alpha pheromone model allowed us to identify 26 residues that are presumably found in the interface&#44; but did not include Ile190&#44; a conserved residues among fungi species&#46; Mutagenesis of Ile190 in Ste2p had small or no effect on receptor function and in the model this residue points away from the pheromone&#46; Thus&#44; the model may serve as a starting point for further site-directed mutagenesis to test the structure-function relationship of this receptor&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:3 [
          "identificador" => "xres784716"
          "titulo" => "ABSTRACT"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec783500"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres784717"
          "titulo" => "RESUMEN"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0010"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec783499"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "INTRODUCTION"
        ]
        5 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "MATERIAL AND METHODS"
        ]
        6 => array:2 [
          "identificador" => "sec0015"
          "titulo" => "RESULTS AND DISCUSSION"
        ]
        7 => array:2 [
          "identificador" => "sec0020"
          "titulo" => "CONCLUSIONS"
        ]
        8 => array:2 [
          "identificador" => "xack262683"
          "titulo" => "ACKNOWLEDGMENTS"
        ]
        9 => array:1 [
          "titulo" => "REFERENCES"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2016-07-28"
    "fechaAceptado" => "2016-11-03"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec783500"
          "palabras" => array:5 [
            0 => "alpha pheromone receptor"
            1 => "docking"
            2 => "molecular modeling"
            3 => "pheromone"
            4 => "Ste2p"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec783499"
          "palabras" => array:5 [
            0 => "receptor de la feromona alfa"
            1 => "anclado molecular simulado"
            2 => "modelado molecular"
            3 => "feromona"
            4 => "Ste2p"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:2 [
        "titulo" => "ABSTRACT"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Ste2p is a G protein-coupled receptor &#40;GPCR&#41; in <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span> that mediates mating by responding to the alpha-mating factor pheromone&#46; Ste2p belongs to a subfamily of GPCRs with no global sequence similarity to GPCRs of known atomic three-dimensional structure&#44; yet it shares functional similarities with many of these&#46; To deepen our understanding of the structure-function relationship of this receptor&#44; we built an atomic three-dimensional homology-based model of Ste2p that was used to simulate the docking of the alpha pheromone&#46; The Ste2p model is in general agreement with the available experimental data and allowed us to propose that the interface between Ste2p and alpha pheromone is formed by 26 residues&#44; most of which are polar residues located at the three extracellular loops and helices HI&#44; H5&#44; and H6&#46; This interface does not include Ile190&#44; a highly conserved residue among fungal species&#44; located at the second extracellular loop and therefore a potential binding site residue&#46; By performing mutagenesis of <span class="elsevierStyleItalic">STE2</span> at this position we observed only a small effect of this residue in receptor signaling&#46; Hence&#44; the Ste2p model presented here is consistent in general with current experimental data and constitutes a framework to test hypothesis about the structure-function relationship of this receptor&#46;</p></span>"
      ]
      "es" => array:2 [
        "titulo" => "RESUMEN"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Ste2p es un receptor acoplado a la prote&#237;na G &#40;GPCR&#41; en <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span> que se une a la feromona alfa para mediar el apareamiento&#46; Ste2p pertenece a una subfamilia de GPCRs que no presentan homolog&#237;a global en secuencia con los GPCRs de estructura at&#243;mica tridimensional conocida&#44; pero comparte propiedades funcionales con muchos de &#233;stos&#46; Para profundizar nuestro entendimiento de la relaci&#243;n estructura-funci&#243;n de este receptor&#44; en este trabajo presentamos un modelo de la estructura at&#243;mica tridimensional de Ste2p asociado a su ligando&#46; El modelo de Ste2p generado es congruente con la informaci&#243;n experimental disponible y sugiere que la interfaz entre Ste2p y la feromona est&#225; compuesta por 26 residuos&#44; en su mayor parte polares&#44; localizados en las tres asas extracelulares y las h&#233;lices H1&#44; H5 y H6&#46; La interfaz no incluye a la Ile190&#44; un residuo altamente conservado entre especies de hongos&#44; que se encuentra en el asa extracelular 2 y es un potencial sitio de anclaje&#46; Mutantes en esta posici&#243;n en <span class="elsevierStyleItalic">STE2</span> muestran un efecto peque&#241;o en la se&#241;alizaci&#243;n del receptor&#46; El modelo presentado de Ste2p es consistente en general con los datos de mutag&#233;nesis disponibles a la fecha&#44; por lo que constituye un marco de referencia para evaluar hip&#243;tesis sobre la relaci&#243;n estructura-funci&#243;n en este receptor&#46;</p></span>"
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1415
            "Ancho" => 3581
            "Tamanyo" => 416347
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Topological diagram of Ste2p&#46; Every amino acid residue from Ste2p is represented by a single letter code within a gray circle&#46; The two horizontal lines separating the extracellular from the intracellular spaces represent the membrane&#46; Data derived from<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a>&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1886
            "Ancho" => 1707
            "Tamanyo" => 178972
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Three-dimensional structural model of Ste2p&#46; A ribbon representation of the three-dimensional structure of Ste2p is presented&#46; Ste2p has a central core made of seven transmembrane helices &#40;HI to H7&#41; connected by three intracellular &#40;IL1&#44; IL2 and IL3&#41; and three extracellular loops &#40;EL1&#44; EL2 and EL3&#41;&#46; This model shows the counterclockwise orientation of transmembrane helices used for modeling GPCRs&#46; The image was generated with PyMol&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1936
            "Ancho" => 3581
            "Tamanyo" => 361302
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Residues involved in helix-helix interactions in Ste2p model&#46; The transmembrane helices of Ste2p are presented as ribbons and are enumerated from H1 to H7&#46; For convenience&#44; transmembrane helices are displayed in a clockwise orientation&#46; Hydrogen bonds are formed between Arg58-Tyr101&#44; Ser170-Glu143&#44; and Ser107-Gln51-Thr110&#44; and are displayed with dots&#46; Gly56 and Gly60 are oriented outwards the protein&#46; The image was generated with PyMol&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 3008
            "Ancho" => 3581
            "Tamanyo" => 493534
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Atomic three-dimensional model of the interaction between Ste2p and the alpha pheromone&#46; Ste2p is shown in a light grey ribbon representation&#46; The alpha pheromone is shown as a dark grey object&#46; The upper part of the figure illustrates the binding pocket formed by extracellular loops and extracellular ends of H1&#44; H5&#44; and H6&#46; In the lower part of the figure&#44; selected residues of Ste2p and pheromone are shown in a ball-and-stick representation&#46; First&#44; the C-terminal region of the pheromone &#40;Gln10&#41; binds to the receptor residues Ser47 and Thr48 &#40;H1&#41;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a>&#46; Then&#44; the central region of the pheromone &#40;Pro8-Gly9&#41; forms a &#946;-turn<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">46</span></a>&#46; At this point&#44; Phe204 &#40;H5&#41; is near to Tyr13 in the pheromone<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a>&#44; and Lys269 &#40;H6&#41; is near to both the N and C-termini of the pheromone&#46; Asn205 is facing toward the outside of Ste2p and away from the binding pocket &#40;left&#41;&#46; In our model&#44; Tyr266 &#40;H6&#41; is oriented towards the surrounding lipids and is inaccessible to solvent&#46; This orientation is consistent with experimental data from<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a>&#46; Finally&#44; Tyr266 interacts with Trp3 in the pheromone&#44; mediating the transition to an active state of Ste2<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;47</span></a> &#40;right&#41;&#46; The image was generated with PyMol&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Figure 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 1284
            "Ancho" => 1707
            "Tamanyo" => 198595
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Area under the growth curve for each mutant strain&#46; The population growth of yeast strains expressing any of five mutants at Ile190 &#40;I190L&#44; I190S&#44; I190R&#44; I190H and I190P&#41; is represented by the Area Under the growth curve &#40;Y axis&#41; both in the presence and absence of the alpha pheromone &#40;indicated by the abbreviation &#8220;pher&#8221; in the figure&#41;&#46; As control&#44; the growth of wild type strain &#40;BY4741&#41; and a strain carrying a deletion of STE2 gene are presented&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table I"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="center" valign="top" scope="col">H1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col">Extracellular loop 1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col">Extracellular loop 2 and H5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col">Extracellular loop 3 and H6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Ser47</span><br>&#40;7&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Ser107</span><br>&#40;16&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Asn194</span><br>&#40;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Ala265</span><br>&#40;9&#37;&#41;<br>Inaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Thr48</span><br>&#40;9&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Ser108</span><br>&#40;27&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Asp195</span><br>&#40;12&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Tyr266</span><br>&#40;45&#37;&#41;<br>Inaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Val49</span><br>&#40;32&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Leu113</span><br>&#40;26&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Val196</span><br>&#40;13&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Ser267</span><br>&#40;10&#37;&#41;<br>Inaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Thr50</span><br>&#40;9&#37;&#41;<br>Inaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Thr114</span><br>&#40;30&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Gln200</span><br>&#40;7&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Lys269</span><br>&#40;3&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Gln51</span><br>&#40;8&#37;&#41;<br>unaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Phe116</span><br>&#40;12&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Asp201</span><br>&#40;5&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Pro270</span><br>&#40;5&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top"><span class="elsevierStyleBold">Met54</span><br>&#40;6&#37;&#41;<br>Inaccessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Pro117</span><br>&#40;11&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Lys202</span><br>&#40;8&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Gly273</span><br>&#40;9&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Tyr203</span><br>&#40;7&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="left" valign="top"><span class="elsevierStyleBold">Phe204</span><br>&#40;10&#37;&#41;<br>Accessible to solvent&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1304342.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Composition of the interface between Ste2 and alpha pheromone&#46; Interface residues were defined as those residues in Ste2p that were no more than 5<span class="elsevierStyleHsp" style=""></span>&#8491; apart from the pheromone&#46; Solvent accessibility data were obtained from Lin&#44; J&#46;C&#46;&#44; <span class="elsevierStyleItalic">et al&#46;</span>&#44; 2004<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">53</span></a>&#46; Percentage of conservation &#40;indicated in parenthesis for each residue&#59; this percentage represents the fraction of 214 orthologue sequences that have an identical residue to Ste2p at that position&#41; was derived from the multiple sequence alignment for all the Ste2p orthologues reported for PFAM family PF02116&#46; Those positions with the largest percentage of sequence identity conservation are marked in bold&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "REFERENCES"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:56 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An overreview on GPCRs and drug discovery&#58; structure-based drug design and structural biology on GPCRs"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "K&#46; Lundstrom"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-60327-317-6_4"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol&#46; Biol&#46;"
                        "fecha" => "2009"
                        "volumen" => "552"
                        "paginaInicial" => "51"
                        "paginaFinal" => "66"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19513641"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The structure and function of G-protein-coupled receptors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46;M&#46; Rosenbaum"
                            1 => "S&#46;G&#46;F&#46; Rasmussen"
                            2 => "B&#46;K&#46; Kobilka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nature08144"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2009"
                        "volumen" => "459"
                        "numero" => "7245"
                        "paginaInicial" => "356"
                        "paginaFinal" => "363"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19458711"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutations affecting sexual conjugation and related processes in <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span>&#46; I&#46; Isolation and phenotypic characterization of nonmating mutants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "V&#46; Mackay"
                            1 => "T&#46;R&#46; Manney"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Genetics"
                        "fecha" => "1974"
                        "volumen" => "76"
                        "numero" => "2"
                        "paginaInicial" => "255"
                        "paginaFinal" => "271"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/4595643"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutants of <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span> unresponsive to cell division control by polypeptide mating hormone"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "L&#46;H&#46; Hartwell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J&#46; Cell Biol&#46;"
                        "fecha" => "1980"
                        "volumen" => "85"
                        "paginaInicial" => "811"
                        "paginaFinal" => "822"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6993497"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Binding of &#945;-factor pheromone to yeast a cells&#58; chemical and genetic evidence for an &#945;-factor receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46;D&#46; Jenness"
                            1 => "A&#46;C&#46; Burkholder"
                            2 => "L&#46;H&#46; Hartwell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Cell"
                        "fecha" => "1983"
                        "volumen" => "35"
                        "numero" => "2"
                        "paginaInicial" => "521"
                        "paginaFinal" => "529"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6360378"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The yeast &#945;-factor receptor&#58; Structural properties deduced from the sequence of the STE2 gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46;C&#46; Burkholder"
                            1 => "L&#46;H&#46; Hartwell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Nucleic Acids Res&#46;"
                        "fecha" => "1985"
                        "volumen" => "13"
                        "paginaInicial" => "8463"
                        "paginaFinal" => "8475"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3001640"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structure of a double transmembrane fragment of a G-protein-coupled receptor in micelles"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "A&#46; Neumoin"
                            1 => "L&#46;S&#46; Cohen"
                            2 => "B&#46; Arshava"
                            3 => "S&#46; Tantry"
                            4 => "J&#46;M&#46; Becker"
                            5 => "O&#46; Zerbe"
                            6 => "F&#46; Naider"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bpj.2009.01.012"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biophysical Journal"
                        "fecha" => "2009"
                        "volumen" => "96"
                        "numero" => "8"
                        "paginaInicial" => "3187"
                        "paginaFinal" => "3196"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19383463"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:3 [
                  "comentario" => "2-H"
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structure and topology of a peptide segment of the 6th transmembrane domain of the <span class="elsevierStyleItalic">Saccharomyces cerevisae</span> alpha-factor receptor in phospholipid bilayers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "K&#46;G&#46; Valentine"
                            1 => "S&#46;F&#46; Liu"
                            2 => "F&#46;M&#46; Marassi"
                            3 => "G&#46; Veglia"
                            4 => "S&#46;J&#46; Opella"
                            5 => "F&#46;X&#46; Ding"
                            6 => "F&#46; Naider"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/1097-0282(20011005)59:4<243::AID-BIP1021>3.0.CO"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biopolymers"
                        "fecha" => "2001"
                        "volumen" => "59"
                        "numero" => "4"
                        "paginaInicial" => "243"
                        "paginaFinal" => "256"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11473349"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of residues involved in homodimer formation located within a &#946;-strand region of the N-terminus of a Yeast G protein-coupled receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;S&#46; Uddin"
                            1 => "H&#46; Kim"
                            2 => "A&#46; Deyo"
                            3 => "F&#46; Naider"
                            4 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/10799893.2011.647352"
                      "Revista" => array:6 [
                        "tituloSerie" => "Journal of Receptors and Signal Transduction Research"
                        "fecha" => "2012"
                        "volumen" => "32"
                        "numero" => "2"
                        "paginaInicial" => "65"
                        "paginaFinal" => "75"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The extracellular N-terminal domain and transmembrane domains 1 and 2 mediate oligomerization of a yeast G protein-coupled receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;C&#46; Overton"
                            1 => "K&#46;J&#46; Blumer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M205368200"
                      "Revista" => array:7 [
                        "tituloSerie" => "Journal of Biological Chemistry"
                        "fecha" => "2002"
                        "volumen" => "277"
                        "numero" => "44"
                        "paginaInicial" => "41463"
                        "paginaFinal" => "41472"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12194975"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Direct evidence for ligand-induced internalization of the yeast &#945;-factor pheromone receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46;A&#46; Schandel"
                            1 => "D&#46;D&#46; Jenness"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol&#46; Cell&#46; Biol&#46;"
                        "fecha" => "1994"
                        "volumen" => "14"
                        "paginaInicial" => "7245"
                        "paginaFinal" => "7255"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7935439"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46; Hicke"
                            1 => "H&#46; Riezman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Cell"
                        "fecha" => "1996"
                        "volumen" => "84"
                        "numero" => "2"
                        "paginaInicial" => "277"
                        "paginaFinal" => "287"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8565073"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a novel sequence mediating regulated endocytosis of the G protein-coupled &#945;-pheromone receptor in yeast"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Rohrer"
                            1 => "H&#46; Benedetti"
                            2 => "B&#46; Zanolari"
                            3 => "H&#46; Riezman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol&#46; Biol&#46; Cell"
                        "fecha" => "1993"
                        "volumen" => "4"
                        "paginaInicial" => "511"
                        "paginaFinal" => "521"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8392878"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The third cytoplasmic loop of a yeast G-protein-coupled receptor controls pathway activation&#44; ligand discrimination&#44; and receptor internalization"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46;J&#46; Stefan"
                            1 => "K&#46;J&#46; Blumer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Cell Biol&#46;"
                        "fecha" => "1994"
                        "volumen" => "14"
                        "numero" => "5"
                        "paginaInicial" => "3339"
                        "paginaFinal" => "3349"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8164685"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The first extracellular loop of the Saccharomyces cerevisiae G protein-coupled receptor Ste2p undergoes a conformational change upon ligand binding"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Hauser"
                            1 => "S&#46; Kauffman"
                            2 => "B&#46;-K&#46; Lee"
                            3 => "F&#46; Naider"
                            4 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M608903200"
                      "Revista" => array:7 [
                        "tituloSerie" => "Journal of Biological Chemistry"
                        "fecha" => "2007"
                        "volumen" => "282"
                        "numero" => "14"
                        "paginaInicial" => "10387"
                        "paginaFinal" => "10397"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17293349"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Residues in the first extracellular loop of a G protein-coupled receptor play a role in signal transduction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Akal-Strader"
                            1 => "S&#46; Khare"
                            2 => "D&#46; Xu"
                            3 => "F&#46; Naider"
                            4 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M204089200"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Biol&#46; Chem&#46;"
                        "fecha" => "2002"
                        "volumen" => "277"
                        "numero" => "34"
                        "paginaInicial" => "30581"
                        "paginaFinal" => "30590"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12058045"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of residues of the Saccharomyces cerevisiae G protein-coupled receptor contributing to alpha-factor pheromone binding"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46;K&#46; Lee"
                            1 => "S&#46; Khare"
                            2 => "F&#46; Naider"
                            3 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M103579200"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Biol&#46; Chem&#46;"
                        "fecha" => "2001"
                        "volumen" => "276"
                        "numero" => "41"
                        "paginaInicial" => "37950"
                        "paginaFinal" => "37961"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11495900"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Aromatic residues at the extracellular ends of transmembrane domains 5 and 6 promote ligand activation of the G protein-coupled alpha-factor receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;C&#46; Lin"
                            1 => "W&#46; Parrish"
                            2 => "M&#46; Eilers"
                            3 => "S&#46;O&#46; Smith"
                            4 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi026766o"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2003"
                        "volumen" => "42"
                        "numero" => "2"
                        "paginaInicial" => "293"
                        "paginaFinal" => "301"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12525156"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of ligand binding regions of the Saccharomyces cerevisiae alpha-factor pheromone receptor by photoaffinity cross-linking"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46;D&#46; Son"
                            1 => "H&#46; Sargsyan"
                            2 => "F&#46; Naider"
                            3 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi0496889"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2004"
                        "volumen" => "43"
                        "numero" => "41"
                        "paginaInicial" => "13193"
                        "paginaFinal" => "13203"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15476413"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Accessibility of cysteine residues substituted into the cytoplasmic regions of the alpha-factor receptor identifies the intracellular residues that are available for G protein interaction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46; Choi"
                            1 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi0614939"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochemestry"
                        "fecha" => "2006"
                        "volumen" => "45"
                        "numero" => "51"
                        "paginaInicial" => "15310"
                        "paginaFinal" => "15317"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The second extracellular loop of the dopamine D2 receptor lines the binding-site crevice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46; Shi"
                            1 => "J&#46;A&#46; Javitch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.2237265100"
                      "Revista" => array:7 [
                        "tituloSerie" => "Proc&#46; Natl&#46; Acad&#46; Sci&#46; USA"
                        "fecha" => "2004"
                        "volumen" => "101"
                        "numero" => "2"
                        "paginaInicial" => "440"
                        "paginaFinal" => "445"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14704269"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ligand binding to the human MT2 melatonin receptor&#58; the role of residues in transmembrane domains 3&#44; 6&#44; and 7"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "P&#46; Mazna"
                            1 => "K&#46; Berka"
                            2 => "I&#46; Jelinkova"
                            3 => "A&#46; Balik"
                            4 => "P&#46; Svoboda"
                            5 => "V&#46; Obsilova"
                            6 => "T&#46; Obsil"
                            7 => "J&#46; Teisinger"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2005.05.017"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochem&#46; Biophys&#46; Res&#46; Commun&#46;"
                        "fecha" => "2005"
                        "volumen" => "332"
                        "numero" => "3"
                        "paginaInicial" => "726"
                        "paginaFinal" => "734"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15913560"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Thyrotropin and homologous glycoprotein hormone receptors&#58; structural and functional aspects of extracellular signaling mechanisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46; Kleinau"
                            1 => "G&#46; Krause"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1210/er.2008-0044"
                      "Revista" => array:7 [
                        "tituloSerie" => "Endocr&#46; Rev&#46;"
                        "fecha" => "2009"
                        "volumen" => "30"
                        "numero" => "2"
                        "paginaInicial" => "133"
                        "paginaFinal" => "151"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19176466"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ligand-specific conformation of extracellular loop-2 in the angiotensin II type 1 receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H&#46; Unal"
                            1 => "R&#46; Jagannathan"
                            2 => "M&#46;B&#46; Bhat"
                            3 => "S&#46;S&#46; Karnik"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M109.094870"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Biol&#46; Chem&#46;"
                        "fecha" => "2010"
                        "volumen" => "285"
                        "numero" => "21"
                        "paginaInicial" => "16341"
                        "paginaFinal" => "16350"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20299456"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Extracellular Loop 2 &#40;ECL2&#41; of the Human Histamine H 4 Receptor Substantially Contributes to Ligand Binding and Constitutive Activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:172 [
                            0 => "D&#46; Wifling"
                            1 => "G&#46; Bernhardt"
                            2 => "S&#46; Dove"
                            3 => "A&#46; Buschauer"
                            4 => "M&#46; Peeters"
                            5 => "G&#46; van Westen"
                            6 => "Q&#46; Li"
                            7 => "I&#46; AP"
                            8 => "M&#46; Wheatley"
                            9 => "D&#46; Wootten"
                            10 => "M&#46; Conner"
                            11 => "J&#46; Simms"
                            12 => "R&#46; Kendrick"
                            13 => "D&#46; Massotte"
                            14 => "B&#46; Kieffer"
                            15 => "J&#46; Klco"
                            16 => "C&#46; Wiegand"
                            17 => "K&#46; Narzinski"
                            18 => "T&#46; Baranski"
                            19 => "C&#46; Sum"
                            20 => "I&#46; Tikhonova"
                            21 => "S&#46; Costanzi"
                            22 => "M&#46; Gershengorn"
                            23 => "T&#46; Nanevicz"
                            24 => "L&#46; Wang"
                            25 => "M&#46; Chen"
                            26 => "M&#46; Ishii"
                            27 => "S&#46; Coughlin"
                            28 => "M&#46; Scarselli"
                            29 => "B&#46; Li"
                            30 => "S&#46; Kim"
                            31 => "J&#46; Wess"
                            32 => "I&#46; Brunskole"
                            33 => "A&#46; Strasser"
                            34 => "R&#46; Seifert"
                            35 => "A&#46; Buschauer"
                            36 => "D&#46; Wifling"
                            37 => "K&#46; L&#246;ffel"
                            38 => "U&#46; Nordemann"
                            39 => "A&#46; Strasser"
                            40 => "G&#46; Bernhardt"
                            41 => "F&#46; Davidson"
                            42 => "P&#46; Loewen"
                            43 => "H&#46; Khorana"
                            44 => "L&#46; Shi"
                            45 => "J&#46; Javitch"
                            46 => "K&#46; Noda"
                            47 => "Y&#46; Saad"
                            48 => "R&#46; Graham"
                            49 => "S&#46; Karnik"
                            50 => "J&#46; Cook"
                            51 => "K&#46; Eidne"
                            52 => "L&#46; Shi"
                            53 => "J&#46; Javitch"
                            54 => "V&#46; Avlani"
                            55 => "K&#46; Gregory"
                            56 => "C&#46; Morton"
                            57 => "M&#46; Parker"
                            58 => "P&#46; Sexton"
                            59 => "R&#46; Lefkowitz"
                            60 => "S&#46; Cotecchia"
                            61 => "P&#46; Samama"
                            62 => "T&#46; Costa"
                            63 => "G&#46; Milligan"
                            64 => "R&#46; Seifert"
                            65 => "K&#46; Wenzel-Seifert"
                            66 => "T&#46; Lee"
                            67 => "U&#46; Gether"
                            68 => "E&#46; Sanders-Bush"
                            69 => "D&#46; Schnell"
                            70 => "I&#46; Brunskole"
                            71 => "K&#46; Ladova"
                            72 => "E&#46; Schneider"
                            73 => "P&#46; Igel"
                            74 => "R&#46; Seifert"
                            75 => "A&#46; Strasser"
                            76 => "E&#46; Schneider"
                            77 => "D&#46; Neumann"
                            78 => "S&#46; Dove"
                            79 => "H&#46; Lim"
                            80 => "A&#46; Jongejan"
                            81 => "R&#46; Bakker"
                            82 => "E&#46; Haaksma"
                            83 => "I&#46; de Esch"
                            84 => "K&#46; Haga"
                            85 => "A&#46; Kruse"
                            86 => "H&#46; Asada"
                            87 => "T&#46; Yurugi-Kobayashi"
                            88 => "M&#46; Shiroishi"
                            89 => "S&#46; Rasmussen"
                            90 => "H&#46; Choi"
                            91 => "J&#46; Fung"
                            92 => "E&#46; Pardon"
                            93 => "P&#46; Casarosa"
                            94 => "T&#46; Shimamura"
                            95 => "M&#46; Shiroishi"
                            96 => "S&#46; Weyand"
                            97 => "H&#46; Tsujimoto"
                            98 => "G&#46; Winter"
                            99 => "E&#46; Schneider"
                            100 => "D&#46; Schnell"
                            101 => "D&#46; Papa"
                            102 => "R&#46; Seifert"
                            103 => "P&#46; Igel"
                            104 => "R&#46; Geyer"
                            105 => "A&#46; Strasser"
                            106 => "S&#46; Dove"
                            107 => "R&#46; Seifert"
                            108 => "P&#46; Igel"
                            109 => "E&#46; Schneider"
                            110 => "D&#46; Schnell"
                            111 => "S&#46; Elz"
                            112 => "R&#46; Seifert"
                            113 => "J&#46; Lange"
                            114 => "H&#46; Wals"
                            115 => "A&#46; Vandenhoogenband"
                            116 => "A&#46; Vandekuilen"
                            117 => "J&#46; Denhartog"
                            118 => "J&#46; Jablonowski"
                            119 => "C&#46; Grice"
                            120 => "W&#46; Chai"
                            121 => "C&#46; Dvorak"
                            122 => "J&#46; Venable"
                            123 => "H&#46; Lim"
                            124 => "R&#46; Smits"
                            125 => "R&#46; Bakker"
                            126 => "C&#46; van Dam"
                            127 => "I&#46; de Esch"
                            128 => "J&#46; Schmutz"
                            129 => "G&#46; Kuenzle"
                            130 => "F&#46; Hunziker"
                            131 => "R&#46; Gauch"
                            132 => "R&#46; Smits"
                            133 => "H&#46; Lim"
                            134 => "B&#46; Stegink"
                            135 => "R&#46; Bakker"
                            136 => "I&#46; de Esch"
                            137 => "U&#46; Gether"
                            138 => "S&#46; Lin"
                            139 => "B&#46; Kobilka"
                            140 => "Y&#46; Cheng"
                            141 => "W&#46; Prusoff"
                            142 => "E&#46; Schneider"
                            143 => "D&#46; Schnell"
                            144 => "A&#46; Strasser"
                            145 => "S&#46; Dove"
                            146 => "R&#46; Seifert"
                            147 => "A&#46; Kooistra"
                            148 => "S&#46; Kuhne"
                            149 => "I&#46; de Esch"
                            150 => "R&#46; Leurs"
                            151 => "C&#46; de Graaf"
                            152 => "H&#46; Lim"
                            153 => "C&#46; de Graaf"
                            154 => "W&#46; Jiang"
                            155 => "P&#46; Sadek"
                            156 => "P&#46; McGovern"
                            157 => "S&#46; Schultes"
                            158 => "S&#46; Nijmeijer"
                            159 => "H&#46; Engelhardt"
                            160 => "A&#46; Kooistra"
                            161 => "H&#46; Vischer"
                            162 => "H&#46;-J&#46; Wittmann"
                            163 => "R&#46; Seifert"
                            164 => "A&#46; Strasser"
                            165 => "A&#46; Alewijnse"
                            166 => "H&#46; Timmerman"
                            167 => "E&#46; Jacobs"
                            168 => "M&#46; Smit"
                            169 => "E&#46; Roovers"
                            170 => "J&#46; Ballesteros"
                            171 => "H&#46; Weinstein"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0117185"
                      "Revista" => array:6 [
                        "tituloSerie" => "PloS One"
                        "fecha" => "2015"
                        "volumen" => "10"
                        "numero" => "1"
                        "paginaInicial" => "e0117185"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25629160"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The I-TASSER Suite&#58; protein structure and function prediction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "J&#46; Yang"
                            1 => "R&#46; Yan"
                            2 => "A&#46; Roy"
                            3 => "D&#46; Xu"
                            4 => "J&#46; Poisson"
                            5 => "Y&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nmeth.3213"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nature Methods"
                        "fecha" => "2015"
                        "volumen" => "12"
                        "numero" => "1"
                        "paginaInicial" => "7"
                        "paginaFinal" => "8"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25549265"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison of Class A and D G Protein-Coupled Receptors&#58; Common Features in Structure and Activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Eilers"
                            1 => "V&#46; Hornak"
                            2 => "S&#46;O&#46; Smith"
                            3 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi047316u"
                      "Revista" => array:5 [
                        "tituloSerie" => "Biochemistry 2005"
                        "fecha" => "2005"
                        "volumen" => "44"
                        "paginaInicial" => "8959"
                        "paginaFinal" => "8975"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Crystal structure of rhodopsin&#58; AG protein-coupled receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:12 [
                            0 => "K&#46; Palczewski"
                            1 => "T&#46; Kumasaka"
                            2 => "T&#46; Hori"
                            3 => "C&#46;A&#46; Behnke"
                            4 => "H&#46; Motoshima"
                            5 => "B&#46;A&#46; Fox"
                            6 => "I&#46; Le Trong"
                            7 => "D&#46;C&#46; Teller"
                            8 => "T&#46; Okada"
                            9 => "R&#46;E&#46; Stenkamp"
                            10 => "M&#46; Yamamoto"
                            11 => "M&#46; Miyano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Science"
                        "fecha" => "2000"
                        "volumen" => "289"
                        "numero" => "5480"
                        "paginaInicial" => "739"
                        "paginaFinal" => "745"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10926528"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Protein Data Bank"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "H&#46;M&#46; Berman"
                            1 => "J&#46; Westbrook"
                            2 => "Z&#46; Feng"
                            3 => "G&#46; Gilliland"
                            4 => "T&#46;N&#46; Bhat"
                            5 => "H&#46; Weissig"
                            6 => "I&#46;N&#46; Shindyalov"
                            7 => "P&#46;E&#46; Bourne"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/nar/28.1.235"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nucleic Acids Res&#46;"
                        "fecha" => "2000"
                        "volumen" => "28"
                        "numero" => "1"
                        "paginaInicial" => "235"
                        "paginaFinal" => "242"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10592235"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A fast method for large-scale de novo peptide and miniprotein structure prediction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46; Maupetit"
                            1 => "P&#46; Derreumaux"
                            2 => "P&#46; Tuff&#233;ry"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcc.21365"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Comput&#46; Chem&#46;"
                        "fecha" => "2010"
                        "volumen" => "31"
                        "numero" => "4"
                        "paginaInicial" => "726"
                        "paginaFinal" => "738"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19569182"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nuclear-magnetic-resonance studies on the conformations of tridecapeptide alpha-mating factor from yeast Saccharomyces cerevisiae and analog peptides in aqueous solution&#46; Conformation-activity relationship"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "T&#46; Higashijima"
                            1 => "Y&#46; Masui"
                            2 => "N&#46; Chino"
                            3 => "S&#46; Sakakibara"
                            4 => "H&#46; Kita"
                            5 => "T&#46; Miyazawa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Eur&#46; J&#46; Biochem&#46;"
                        "fecha" => "1984"
                        "volumen" => "140"
                        "numero" => "1"
                        "paginaInicial" => "163"
                        "paginaFinal" => "171"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6323177"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ClusPro&#58; an automated docking and discrimination method for the prediction of protein complexes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46;R&#46; Comeau"
                            1 => "D&#46;W&#46; Gatchell"
                            2 => "S&#46; Vajda"
                            3 => "C&#46;J&#46; Camacho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Bioinformatics"
                        "fecha" => "2004"
                        "volumen" => "20"
                        "numero" => "1"
                        "paginaInicial" => "45"
                        "paginaFinal" => "50"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14693807"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Double-mutant cycle scanning of the interaction of a peptide ligand and its G protein-coupled receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "F&#46; Naider"
                            1 => "J&#46;M&#46; Becker"
                            2 => "Y&#46;H&#46; Lee"
                            3 => "-"
                            4 => "A&#46; Horovitz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi602415u"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2007"
                        "volumen" => "46"
                        "numero" => "11"
                        "paginaInicial" => "3476"
                        "paginaFinal" => "3481"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17298081"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of residue-to-residue contact between a peptide ligand and its G protein-coupled receptor using periodate-mediated dihydroxyphenylalanine cross-linking and mass spectrometry"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:8 [
                            0 => "G&#46;K&#46;E&#46; Umanah"
                            1 => "L&#46; Huang"
                            2 => "F&#46; Ding"
                            3 => "B&#46; Arshava"
                            4 => "A&#46;R&#46; Farley"
                            5 => "A&#46;J&#46; Link"
                            6 => "F&#46; Naider"
                            7 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M110.149500"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Biol&#46; Chem&#46;"
                        "fecha" => "2010"
                        "volumen" => "285"
                        "numero" => "50"
                        "paginaInicial" => "39425"
                        "paginaFinal" => "39436"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20923758"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CHARMM&#58; A program for macromolecular energy&#44; minimization&#44; and dynamics calculations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "B&#46;R&#46; Brooks"
                            1 => "R&#46;E&#46; Bruccoleri"
                            2 => "B&#46;D&#46; Olafson"
                            3 => "D&#46;J&#46; States"
                            4 => "S&#46; Swaminathan"
                            5 => "M&#46; Karplus"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcc.540040211"
                      "Revista" => array:6 [
                        "tituloSerie" => "Journal of Computational Chemistry"
                        "fecha" => "1983"
                        "volumen" => "4"
                        "numero" => "2"
                        "paginaInicial" => "187"
                        "paginaFinal" => "217"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Schrodinger&#44; L&#46;L&#46;C&#46; The PyMOL Molecular Graphics System&#44; Version 1&#46;8 <a id="intr0010" class="elsevierStyleInterRef" href="https://www.pymol.org/">https&#58;&#47;&#47;www&#46;pymol&#46;org&#47;</a>&#46;"
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "One-step transformation of yeast in stationary phase"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46;C&#46; Chen"
                            1 => "B&#46;C&#46; Yang"
                            2 => "T&#46;T&#46; Kuo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Current Genetics"
                        "fecha" => "1992"
                        "volumen" => "21"
                        "numero" => "1"
                        "paginaInicial" => "83"
                        "paginaFinal" => "84"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1735128"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The GxxxG motif&#58; a framework for transmembrane helix-helix association"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "W&#46; Russ"
                            1 => "D&#46; Engelman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1006/jmbi.1999.3489"
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Mol&#46; Biol&#46;"
                        "fecha" => "2000"
                        "volumen" => "296"
                        "numero" => "3"
                        "paginaInicial" => "911"
                        "paginaFinal" => "919"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10677291"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interhelical hydrogen bonding drives strong interactions in membrane proteins"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "F&#46;X&#46; Zhou"
                            1 => "M&#46;J&#46; Cocco"
                            2 => "W&#46;P&#46; Russ"
                            3 => "A&#46;T&#46; Brunger"
                            4 => "D&#46;M&#46; Engelman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/72430"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat&#46; Struct&#46; Biol&#46;"
                        "fecha" => "2000"
                        "volumen" => "7"
                        "numero" => "2"
                        "paginaInicial" => "154"
                        "paginaFinal" => "160"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10655619"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Constitutive activation of opsin&#58; influence of charge at position 134 and size at position 296"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46;B&#46; Cohen"
                            1 => "T&#46; Yang"
                            2 => "P&#46;R&#46; Robinson"
                            3 => "D&#46;D&#46; Oprian"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "1993"
                        "volumen" => "32"
                        "paginaInicial" => "6111"
                        "paginaFinal" => "6115"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8099498"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structure and function in rhodopsins rhodopsin mutants with a neutral amino acid at E134 have a partially activated conformation in the dark state"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;M&#46; Kim"
                            1 => "C&#46; Altenbach"
                            2 => "R&#46;L&#46; Thurmond"
                            3 => "H&#46;G&#46; Khorana"
                            4 => "W&#46;L&#46; Hubbell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Proc&#46; Natl&#46; Acad&#46; Sci&#46; U&#46;S&#46;A&#46;"
                        "fecha" => "1997"
                        "volumen" => "94"
                        "numero" => "26"
                        "paginaInicial" => "14273"
                        "paginaFinal" => "14278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9405602"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The cytoplasmic end of transmembrane domain 3 regulates the activity of the <span class="elsevierStyleItalic">Saccharomyces cerevisiae</span> G-protein-coupled alpha-factor receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "W&#46; Parrish"
                            1 => "M&#46; Eilers"
                            2 => "W&#46; Ying"
                            3 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Genetics"
                        "fecha" => "2002"
                        "volumen" => "160"
                        "paginaInicial" => "429"
                        "paginaFinal" => "443"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11861550"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Activation of G-protein-coupled receptors&#58; a common molecular mechanism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Karnik"
                            1 => "C&#46; Gogonea"
                            2 => "S&#46; Patil"
                            3 => "Y&#46; Saad"
                            4 => "T&#46; Takezako"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Trends Endocrinol&#46; Metab&#46;"
                        "fecha" => "2003"
                        "volumen" => "14"
                        "numero" => "9"
                        "paginaInicial" => "431"
                        "paginaFinal" => "437"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14580763"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "44"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "G protein-coupled receptors&#46; I&#46; Diversity of receptor&#8211;ligand interactions"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46;H&#46; Ji"
                            1 => "M&#46; Grossmann"
                            2 => "I&#46; Ji"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "J&#46; Biol&#46; Chem&#46;"
                        "fecha" => "1998"
                        "volumen" => "273"
                        "numero" => "28"
                        "paginaInicial" => "17299"
                        "paginaFinal" => "17302"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9651309"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            44 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "45"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of extracellular charged amino acids in the yeast &#945;-factor receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Bajaj"
                            1 => "S&#46; Connelly"
                            2 => "A&#46; Gehret"
                            3 => "F&#46; Naider"
                            4 => "M&#46; Dumont"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbamcr.2007.02.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochim&#46; Biophys&#46; Acta &#40;BBA&#41;-Molecular Cell Research"
                        "fecha" => "2007"
                        "volumen" => "1773"
                        "numero" => "6"
                        "paginaInicial" => "707"
                        "paginaFinal" => "717"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            45 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "46"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sequences in the intracellular loops of the yeast pheromone receptor Ste2p required for G protein activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; Celi&#263;"
                            1 => "N&#46;P&#46; Martin"
                            2 => "C&#46;D&#46; Son"
                            3 => "J&#46;M&#46; Becker"
                            4 => "F&#46; Naider"
                            5 => "M&#46;E&#46; Dumont"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/bi0269308"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2003"
                        "volumen" => "42"
                        "numero" => "10"
                        "paginaInicial" => "3004"
                        "paginaFinal" => "3017"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12627966"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            46 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "47"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a contact region between the tridecapeptide alpha-factor mating pheromone of Saccharomyces cerevisiae and its G protein-coupled receptor by photoaffinity labeling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46;K&#46; Henry"
                            1 => "S&#46; Khare"
                            2 => "C&#46; Son"
                            3 => "V&#46;V&#46;S&#46; Babu"
                            4 => "F&#46; Naider"
                            5 => "J&#46;M&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2002"
                        "volumen" => "41"
                        "numero" => "19"
                        "paginaInicial" => "6128"
                        "paginaFinal" => "6139"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11994008"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            47 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "48"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Systematic mutagenesis of the yeast mating pheromone receptor third intracellular loop"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46;D&#46; Clark"
                            1 => "T&#46; Palzkill"
                            2 => "D&#46; Botstein"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Journal of Biological Chemistry"
                        "fecha" => "1994"
                        "volumen" => "269"
                        "numero" => "12"
                        "paginaInicial" => "8831"
                        "paginaFinal" => "8841"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8132618"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            48 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "49"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anatomy of hot spots in protein interfaces"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Bogann"
                            1 => "K&#46; Thorn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1006/jmbi.1998.1843"
                      "Revista" => array:7 [
                        "tituloSerie" => "Journal of Molecular Biology"
                        "fecha" => "1998"
                        "volumen" => "280"
                        "numero" => "1"
                        "paginaInicial" => "1"
                        "paginaFinal" => "9"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9653027"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            49 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "50"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutations affecting ligand specificity of the G-protein-coupled receptor for the Saccharomyces cerevisiae tridecapeptide pheromone"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Abel"
                            1 => "B&#46; Lee"
                            2 => "F&#46; Naider"
                            3 => "J&#46; Becker"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochimica et Biophysica Acta &#40;BBA&#41;-Molecular Cell Research"
                        "fecha" => "1998"
                        "volumen" => "1448"
                        "numero" => "1"
                        "paginaInicial" => "12"
                        "paginaFinal" => "26"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            50 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "51"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dominant-negative mutations in the G-protein-coupled R-factor receptor map to the extracellular ends of the transmembrane segments"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Dosil"
                            1 => "L&#46; Giot"
                            2 => "C&#46; Davis"
                            3 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol&#46; Cell&#46; Biol&#46;"
                        "fecha" => "1998"
                        "volumen" => "18"
                        "paginaInicial" => "5981"
                        "paginaFinal" => "5991"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9742115"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            51 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "52"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Probing the binding domain of the Saccharomyces cerevisiae alpha-mating factor receptor with fluorescent ligands"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "F&#46;X&#46; Ding"
                            1 => "B&#46;K&#46; Lee"
                            2 => "M&#46; Hauser"
                            3 => "L&#46; Davenport"
                            4 => "J&#46;M&#46; Becker"
                            5 => "F&#46; Naider"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochemistry"
                        "fecha" => "2001"
                        "volumen" => "40"
                        "numero" => "4"
                        "paginaInicial" => "1102"
                        "paginaFinal" => "1108"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11170434"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            52 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "53"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A microdomain formed by the extracellular ends of the transmembrane domains promotes activation of the G protein-coupled alpha-factor receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;C&#46; Lin"
                            1 => "K&#46; Duell"
                            2 => "J&#46;B&#46; Konopka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Molecular and Cellular Biology"
                        "fecha" => "2004"
                        "volumen" => "24"
                        "numero" => "5"
                        "paginaInicial" => "2041"
                        "paginaFinal" => "2051"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14966283"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            53 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "54"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Conservation and relative importance of residues across protein-protein interfaces"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Guharoy"
                            1 => "P&#46; Chakrabarti"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.0505425102"
                      "Revista" => array:7 [
                        "tituloSerie" => "Proc&#46; Natl&#46; Acad&#46; Sci&#46;U&#46;S&#46;A&#46;"
                        "fecha" => "2005"
                        "volumen" => "102"
                        "numero" => "43"
                        "paginaInicial" => "15447"
                        "paginaFinal" => "15452"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16221766"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            54 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "55"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Are protein&#8211;protein interfaces more conserved in sequence than the rest of the protein surface&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "D&#46;R&#46; Caffrey"
                            1 => "S&#46; Somaroo"
                            2 => "J&#46;D&#46; Hughes"
                            3 => "J&#46; Mintseris"
                            4 => "E&#46;S&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1110/ps.03323604"
                      "Revista" => array:6 [
                        "tituloSerie" => "Prot&#46; Sci&#46;"
                        "fecha" => "2004"
                        "volumen" => "13"
                        "numero" => "1"
                        "paginaInicial" => "190"
                        "paginaFinal" => "202"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            55 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "56"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Moult&#44; J&#46;&#44; Fidelis&#44; K&#46;&#44; Kryshtafovych&#44; A&#46;&#44; Schwede&#44; T&#46; &#38; Tramontano&#44; A&#46; Critical assessment of methods of protein structure prediction &#40;CASP&#41;&#8211;round x<span class="elsevierStyleItalic">&#46;</span> 82 Suppl 2 &#40;0 2&#41;&#44; 1-6 &#40;2014&#41;&#46; DOI&#58; 10&#46;1002&#47;prot&#46;24452&#46;"
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack262683"
        "titulo" => "ACKNOWLEDGMENTS"
        "texto" => "<p id="par0170" class="elsevierStylePara elsevierViewall">This work was in part supported by PAPIIT grant number IN208014 to Gabriel del R&#237;o&#46; Laura Marina Robles &#40;fellowship number 261023&#41; was supported in part by Consejo Nacional de Ciencia y Tecnolog&#237;a &#40;CONACYT&#41; while she was student of the Programa de Maestr&#237;a en Ciencias Bioqu&#237;micas&#44; UNAM&#46; We thank Mar&#237;a Teresa Lara Ortiz at the Institute of Cellular Physiology&#47;Universidad Nacional Aut&#243;noma de M&#233;xico for her technical assistance in this work&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/1405888X/0000002000000001/v1_201612310020/S1405888X16300134/v1_201612310020/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "41941"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Art&#237;culos originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/1405888X/0000002000000001/v1_201612310020/S1405888X16300134/v1_201612310020/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1405888X16300134?idApp=UINPBA00004N"
]

Article information

ISSN: 1405888X
Original language: English

DOI:10.1016/j.recqb.2016.11.002

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	2	0	2
2024 October	20	15	35
2024 September	29	7	36
2024 August	31	6	37
2024 July	22	6	28
2024 June	37	9	46
2024 May	19	3	22
2024 April	24	2	26
2024 March	14	3	17
2024 February	17	6	23
2024 January	20	4	24
2023 December	14	10	24
2023 November	21	4	25
2023 October	15	2	17
2023 September	19	3	22
2023 August	14	6	20
2023 July	18	1	19
2023 June	29	3	32
2023 May	38	4	42
2023 April	42	4	46
2023 March	25	0	25
2023 February	13	5	18
2023 January	15	3	18
2022 December	18	9	27
2022 November	11	2	13
2022 October	18	5	23
2022 September	17	3	20
2022 August	7	7	14
2022 July	13	5	18
2022 June	10	4	14
2022 May	15	4	19
2022 April	12	6	18
2022 March	15	8	23
2022 February	8	6	14
2022 January	19	8	27
2021 December	14	7	21
2021 November	9	13	22
2021 October	15	6	21
2021 September	12	6	18
2021 August	19	13	32
2021 July	7	6	13
2021 June	11	8	19
2021 May	8	5	13
2021 April	43	30	73
2021 March	12	5	17
2021 February	11	5	16
2021 January	12	8	20
2020 December	14	8	22
2020 November	18	6	24
2020 October	8	8	16
2020 September	16	8	24
2020 August	20	9	29
2020 July	18	13	31
2020 June	15	9	24
2020 May	17	2	19
2020 April	8	5	13
2020 March	13	4	17
2020 February	7	5	12
2020 January	15	4	19
2019 December	9	7	16
2019 November	10	2	12
2019 October	15	0	15
2019 September	5	7	12
2019 August	6	2	8
2019 July	16	3	19
2019 June	37	3	40
2019 May	107	6	113
2019 April	68	4	72
2019 March	6	1	7
2019 February	6	5	11
2019 January	4	7	11
2018 December	5	3	8
2018 November	9	1	10
2018 October	9	10	19
2018 September	8	3	11
2018 August	24	11	35
2018 July	9	1	10
2018 June	5	3	8
2018 May	10	3	13
2018 April	21	3	24
2018 March	11	0	11
2018 February	6	0	6
2018 January	10	0	10
2017 December	6	0	6
2017 November	10	4	14
2017 October	18	6	24
2017 September	9	7	16
2017 August	12	1	13
2017 July	18	1	19
2017 June	36	5	41
2017 May	41	8	49
2017 April	27	5	32
2017 March	21	4	25
2017 February	17	3	20
2017 January	14	4	18
2016 December	1	1	2

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter