HEK 293 (from human embryonic kidney) and H1299 (from human non-small cell lung carcinoma) cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum in a 37°C, humidified incubator with 5% CO2. HEK 293 cells were used in most experiments as they are derived from the kidney which normally expresses GCGR. H1299 cells were only used in calcium measurements because they did not apparently express GCGR intrinsically through preliminary experiments and HEK 293 cells did not load the calcium dye Rhod-3 AM well. Plasmids encoding enhanced green fluorescent protein (EGFP)-tagged human WT and P86S glucagon receptor (GCGR) and the parental plasmid pEGFP-N3 were described before.11 Cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, EE.UU.). Stable HEK 293 cell lines expressing EGFP, WT GCGR-EGFP, or P86S-EGFP were established by incubating cells with 0.6mg/ml G418 after transfection. Thapsigargin was from Sigma (St Louis, IL, EE.UU.), LLnL from Calbiochem (La Jolla, CA, EE.UU.), and colcemid from Invitrogen.

H1299 cells were incubated with 10μM Rhod-3 AM, PowerLoad, and 2.5mM probenecid (Molecular Probes, Eugene, OR, EE.UU.) in Hank's buffered salt solution (HBSS) for 45minutes, followed by incubation in HBSS with probenecid for another 45minutes. Loaded cells were placed in a confocal microscope incubator chamber and images were acquired with a TCS SP confocal microscope (Leica Microsystems, Heidelberg, Germany) using excitation/emission 550/580nm. Scanning rate was set to 7 frames per second for 200seconds.

HEK 293 cells were grown on coverslips for 2-5 days after transfection. Cells were fixed with 4% paraformaldehyde, permeabilized with 0.6% Tween 20, stained with Hoechst 33258 (1:10,000; Molecular Probes), and observed with a 40×objective. Green cells with apoptotic nuclear characteristics (i.e. nuclear condensation and fragmentation) were scored as apoptotic, which was confirmed by terminal dUTP nick-end labeling staining (TUNEL) (Roche Molecular Biochemicals, Indianapolis, IN, EE.UU.).16

Total RNA was extracted with RNeasy kit (Qiagen, Valencia, CA, EE.UU.) and treated with DNase. RNA (2μg) was reverse-transcribed using SuperScript II Reverse Transcriptase (Invitrogen). Human XBP1 (X-box binding protein 1) was amplified by PCR using 100 ng cDNA and primer set GAAGCCAAGGGGAATGAAGT (forward) and ACTGGGTCCAAGTTGTCCAG (reverse) for XBP-117 and primer set for actin B (Real Time Primers, Elkins Park, PA). Western blot of EGFP-tagged WT or P86S GCGR was described previously.11

These were performed as described.18 Briefly, HEK 293 cells expressing WT GCGR-EGFP or P86S-EGFP were fixed with 4% paraformaldehyde, and permeabilized with blocking buffer. Primary antibody, rabbit polyclonal anti-calregulin or anti-glucosidase II, goat polyclonal anti-ubiquitin (Santa Cruz Biotechnology, Santa Cruz, CA, EE.UU.), or mouse monoclonal anti-alpha tubulin (Calbiochem) was added at 1:50 in the blocking buffer and incubated for 2h. Cells were washed and incubated with appropriate rhodamine-labeled secondary antibody for 30min. EGFP fluorescence was directly visualized without staining. Immunostained cells were visualized on a TE200 inverted epifluorescence microscope (Nikon, Melville, NY, EE.UU.) equipped with relevant fluorescence filters. For live cell observation, HEK 293 cells stably expressing WT GCGR-EGFP or P86S-EGFP were grown in gridded flasks and the same groups of cells were directly visualized over time with green fluorescence filters.18

In HEK 293 cells, WT GCGR was predominantly localized on the plasma membrane and underwent glucagon-induced internalization into intracellular vesicles in a glucagon dose-dependent manner (fig. 1A), in agreement with the results from Sachdev et al.9 Internalization of WT GCGR appeared to be complete after 30minutes of maximal glucagon stimulation (fig. 1B). P86S was partially localized to the plasma membrane and partially in the cytoplasma as previously reported.11 Cells with more cytoplasmic P86S localization were shown in Figure 1A while those with more plasma membrane localization were shown in Figure 1B. Regardless of the basal receptor localization, P86S failed to accumulate in intracellular vesicles in response to glucagon stimulation, even at 1μM (which stimulates maximal cAMP production by P86S11) for 1 hour. Thus, the P86S is defective in receptor internalization.

Figure 1.

Internalization of WT GCGR and P86S. A) GCGR internalization by increasing concentrations of glucagon. Two days after transfection with plasmids encoding WT GCGR-EGFP or P86S-EGFP, HEK 293 cells were treated with glucagon from 1nM to 1μM at 37C for 30minutes. Cells were fixed and representative cells shown. B) Time course of glucagon-induced GCGR internalization. HEK 293 cells were treated with 1μM glucagon for 10-60minutes. Note that untreated WT GCGR was always localized to plasma membrane while P86S was localized to cytoplasm in some cells (shown in A) or to plasma membrane in others (shown in B). P86S did not change localization upon glucagon stimulation. Bar, 10μm.

EGFP: enhanced green fluorescent protein; GCGR: glucagon receptor.

(0.26MB).

We used red calcium sensor Rhod-3 to study glucagon-stimulated calcium response of EGFP-tagged WT or P86S GCGR. In cells expressing WT GCGR, 1μM glucagon elicited a clear increase in intracellular calcium levels (fig. 2). Most cells exhibited a monophasic calcium response that largely tapered in 100seconds after glucagon stimulation. In a few cells, calcium levels began to oscillate after glucagon. In cells expressing P86S, no calcium increase was observed in response to glucagon stimulation. A few cells exhibited spontaneous low-amplitude oscillation of calcium levels which was not changed by glucagon.

Figure 2.

Calcium signaling by WT GCGR and P86S. H1299 cells were transfected with plasmids encoding WT GCGR-EGFP or P86S-EGFP, loaded with Rhod-3 AM and stimulated with 1μM glucagon. Shown in upper panels were average Rhod-3 fluorescence levels±standard error of the mean before and after glucagon stimulation. Shown in lower panels were traces of 2 representative individual cells. P86S did not respond to glucagon with an increase in intracellular calcium.

EGFP: enhanced green fluorescent protein; GCGR: glucagon receptor.

(0.09MB).

We measured apoptotic rate of HEK 293 cells expressing EGFP, WT GCGR-EGFP, and P86S-EGFP. The apoptotic rates of cells expressing P86S were consistently higher than those of cells expressing EGFP or WT GCGR, starting 2 days after transient transfection (fig. 3A). The difference in apoptotic rates between cells expressing P86S and WT GCGR was largest 4 days after transfection (18.3±0.2% vs 2.1±0.2%, P<0.05). As P86S was significantly localized to endoplasmic reticulum (ER) (data not shown for cells transiently expressing P86S), we tested cleavage of XBP-1 mRNA, a marker of ER stress. Treatment with thapsigargin, a known inducer of ER stress, clearly showed XBP-1 cleavage, but no such cleavage was seen in cells expressing any of the 3 constructs (fig. 3B), suggesting that P86S-induced apoptosis was caused by mechanisms other than ER stress.

Figure 3.

Cell apoptosis by WT GCGR and P86S. A) Apoptosis of cells transiently expressing GCGR. H1299 cells were transfected with plasmids encoding EGFP, WT GCGR-EGFP or P86S-EGFP. Cells were replated onto coverslips 1 day after transfection and fixed 2-5 days after transfection. Apoptosis was measured by counting cells with condensed and fragmented nuclei. B) Cleavage of XBP1 mRNA. Untransfected cells treated with 1μM thapsigargin (Sigma, St Louis, IL) for 4hours (Lane 1) or without (Lane 2). H1299 cells in 60-mm dishes were transfected with plasmids encoding EGFP (Lane 5), WT GCGR-EGFP (Lane 4) or P86S-EGFP (Lane 3). Cells were plated into 10-cm dishes 1 day after transfection and total RNA extracted 1 day later. Total RNA was reverse transcribed and XBP1 amplified with PCR. P86S-induced apoptosis was not due to ER stress. Upper band, actin B (233bp); middle band, uncleaved XBP1 (195bp); and lower band, cleaved XBP1 (169bp).

EGFP: enhanced green fluorescent protein; GCGR: glucagon receptor; XBP1: X-box binding protein 1.

(0.05MB).

To further examine the effects of P86S expression on cell survival, we established stable HEK 293 cells expressing WT GCGR-EGFP or P86S-EGFP. Apoptotic rates were similar in cells expressing the two constructs: 1.2±0.1% for WT GCGR and 0.9±0.4% for P86S. The expression levels of WT GCGR and P86S were similar (fig. 4). Unlike in cells transiently transfected,11 P86S was processed slightly differently than WT GCGR and appeared as 2 bands close to 80kD (fig. 4C). A circular, inclusion body-like structure labeled by P86S was present in cells stably expressing P86S (24.9±1.9%) but not in those expressing WT GCGR (0±0%, P<0.001) (fig. 4A and B). These novel structures measured 2-3μm in diameter, and were mostly perinuclear and present in all 7 stable clones of HEK 293 cells expressing P86S-EGFP but rarely seen in cells transiently expressing it. Of 70 cells that contain that novel structure, 52 (74%) had 1, 10 (14%) had 2, 5 (7%) had 3, while 3 (4%) had 4 or more. In WT GCGR-expressing cells, WT GCGR and ER marker calregulin were localized distinctly without overlap (fig. 4A). In P86S-expressing cells, P86S and calregulin and glucosidase II, another ER marker, were almost completely colocalized (fig. 4B a-h). The circular, inclusion body-like structures containing P86S were perfectly colocalized with both ER markers. We hereafter call these novel structures circular ER bodies.

Figure 4.

Characterization of endoplasmic reticulum (ER) bodies induced by P86S. HEK 293 cells stably expressing WT GCGR-EGFP (Panel A) or P86S-EGFP (Panel B) were fixed and immunofluorescently stained with antibodies against calregulin (2, b), glucosidase II (f), α tubulin (j, n), or ubiquitin (r). The images of WT GCGR-EGFP (1) or P86S-EGFP (a, e, i, m, and q, in green), various cellular markers (2, b, f, n, and r, in red), and nuclei (3, c, g, k, o, and s, in blue) were overlaid (4, d, h, l, p, and t). Yellow or orange shows colocalization of green and red fluorescence. HEK 293 cells stably expressing P86S-EGFP were also treated with proteasome inhibitor LLnL (50μM) (u), microtubule depolymerizer colcemid (100 ng/ml) (v), or both (w), for 8hours. C) Differential processing of WT GCGR-EGFP and P86S-EGFP. HEK 293 cells stably expressing WT GCGR-EGFP and P86S-EGFP were lysed and subjected to western blot using antibody against EGFP. Time of image acquisition is indicated at the left low corner. These results demonstrated that the circular ER bodies are not aggresomes. Bar, 10μm.

EGFP: enhanced green fluorescent protein; GCGR: glucagon receptor.

(0.58MB).

As mutant G protein-coupled receptors such as mutant rhodopsin can localize to a structure called aggresome,19–22 we examined whether the circular ER bodies are aggresomes. Aggresome formation is microtubule-dependent and increases with proteasome inhibition; aggresomes are localized around microtubule organizing centers and contain ubiquitinated proteins. In both interphase (fig. 4B i-l) and metaphase (fig. 4B m-p) cells, the circular ER bodies were distinct from the microtubule organizing centers and they did not colocalize. The circular ER bodies did not colocalize with ubiquitin (fig. 4B q-t). Treatment with proteasome inhibitor LLnL or microtubule depolymerizer colcemid or both did not increase the number or size of the circular ER bodies (fig. 4B u-w). Our results thus demonstrated that the circular ER bodies are not aggresomes.

To study the fates of the circular ER bodies and the cells harboring them, we followed 791 live cells over 9-13hours. None of the cells harboring the circular ER bodies died over the observational period and all cells divided normally (fig. 5). The majority of the circular ER bodies disappeared during the observational period (fig. 6A) and new ones emerged with a half-life of 4.1hours (fig. 6B). We observed the entire life cycle of the circular ER bodies in few cells (fig. 6C). Some ER bodies split and fused (fig. 6D).

Figure 5.

Division of cells harboring dynamic circular endoplasmic reticulum (ER) bodies recorded by live cell imaging. Live HEK 293 cells stably expressing P86S-EGFP were observed hourly and the same groups of cells were followed over time. Shown are two cells (upper and lower panels) that underwent normal cell division. Time of image acquisition is indicated at the left low corner. Bar, 10μm.

EGFP: enhanced green fluorescent protein.

(0.13MB).

Figure 6.

Dynamic circular endoplasmic reticulum (ER) bodies revealed by live cell imaging. Live HEK 293 cells stably expressing P86S-EGFP were observed hourly and the same groups of cells were followed over time. A) Disappearance of circular ER bodies from 2 cells, 1 in 3hours, the other in 5hours. B) Emergence of new ER bodies in 2 cells. C) The life cycle of one circular ER body (in the cell in the center of field). Note that an adjacent cell on the left has a dynamic circular EB body that disappeared in 4hours. D) Fusion and disappearance of 3 ER bodies. Time of image acquisition is indicated at the left low corner. The circular ER bodies were dynamic structures. Bar, 10μm.

EGFP: enhanced green fluorescent protein.

(0.49MB).