Predictive role BLVRA mRNA expression in hepatocellular cancer

array:24 ["pii" => "S1665268119311147" "issn" => "16652681" "doi" => "10.5604/16652681.1222104" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "70869" "copyright" => "Fundación Clínica Médica Sur, A.C." "copyrightAnyo" => "2016" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2016;15:881-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 83 "formatos" => array:3 [ "EPUB" => 18 "HTML" => 26 "PDF" => 39 ] ] "itemSiguiente" => array:19 [ "pii" => "S1665268119311159" "issn" => "16652681" "doi" => "10.5604/16652681.1222105" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "70870" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2016;15:888-94" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 84 "formatos" => array:3 [ "EPUB" => 19 "HTML" => 28 "PDF" => 37 ] ] "en" => array:11 [ "idiomaDefecto" => true "titulo" => "High risk, high reward: An analysis of outcomes for candidates awaiting hepatic re-transplantation" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "888" "paginaFinal" => "894" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "f0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 486 "Ancho" => 505 "Tamanyo" => 23031 ] ] "descripcion" => array:1 [ "en" => "Kaplan Meier curve comparing survival of patients who underwent hepatic re-transplantation (re-OLT) early (within 90 days) vs. late (after 90 days) of first transplant. There was no difference in 3-year survival between the groups (70 vs. 70%, log-rank test p = 0.59)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Jigesh A. Shah, Madhukar S. Patel, Johannes R. Kratz, James F. Markmann, Parsia A. Vagefi" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Jigesh A." "apellidos" => "Shah" ] 1 => array:2 [ "nombre" => "Madhukar S." "apellidos" => "Patel" ] 2 => array:2 [ "nombre" => "Johannes R." "apellidos" => "Kratz" ] 3 => array:2 [ "nombre" => "James F." "apellidos" => "Markmann" ] 4 => array:2 [ "nombre" => "Parsia A." "apellidos" => "Vagefi" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311159?idApp=UINPBA00004N" "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311159/v1_201906150956/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268119311135" "issn" => "16652681" "doi" => "10.5604/16652681.1222103" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "70868" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2016;15:870-80" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 85 "formatos" => array:3 [ "EPUB" => 14 "HTML" => 31 "PDF" => 40 ] ] "en" => array:11 [ "idiomaDefecto" => true "titulo" => "Simultaneous liver and kidney transplantation in elderly patients: Outcomes and validation of a clinical risk score for patient selection" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "870" "paginaFinal" => "880" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "f0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 504 "Ancho" => 776 "Tamanyo" => 45899 ] ] "descripcion" => array:1 [ "en" => "Liver graft survival in SLK group aged ≥ 65 years, SLK group aged < 65 years and LTA group aged ≥ 65 years. SLK group aged ≥ 65 years vs. SLK group aged < 65 years (p = 0.43); SLK group aged ≥ 65 years vs. LTA group aged ≥ 65 years (p = 0.44); SLK group aged ≥ 65 years vs. LTA group aged < 65 years (p = 0.03)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Kristopher P. Croome, David D. Lee, Justin M. Burns, Dana K. Perry, Justin H. Nguyen, Andrew P. Keaveny, Hani M. Wadei, C. Burcin Taner" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Kristopher P." "apellidos" => "Croome" ] 1 => array:2 [ "nombre" => "David D." "apellidos" => "Lee" ] 2 => array:2 [ "nombre" => "Justin M." "apellidos" => "Burns" ] 3 => array:2 [ "nombre" => "Dana K." "apellidos" => "Perry" ] 4 => array:2 [ "nombre" => "Justin H." "apellidos" => "Nguyen" ] 5 => array:2 [ "nombre" => "Andrew P." "apellidos" => "Keaveny" ] 6 => array:2 [ "nombre" => "Hani M." "apellidos" => "Wadei" ] 7 => array:3 [ "preGrado" => "MD" "nombre" => "C. Burcin" "apellidos" => "Taner" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311135?idApp=UINPBA00004N" "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311135/v1_201906150956/en/main.assets" ] "en" => array:17 [ "idiomaDefecto" => true "titulo" => "Predictive role BLVRA mRNA expression in hepatocellular cancer" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "881" "paginaFinal" => "887" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Kristýna Kubícková, Iva Subhanová, Renáta Konícková, Linda Matousová, Petr Urbánek, Hana Parobková, Martin Kupec, Jirí Pudil, Libor Vítek" "autores" => array:9 [ 0 => array:3 [ "nombre" => "Kristýna" "apellidos" => "Kubícková" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Iva" "apellidos" => "Subhanová" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "†" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Renáta" "apellidos" => "Konícková" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "†" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Linda" "apellidos" => "Matousová" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "†" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "Petr" "apellidos" => "Urbánek" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "aff0005" ] ] ] 5 => array:3 [ "nombre" => "Hana" "apellidos" => "Parobková" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "‡" "identificador" => "aff0015" ] ] ] 6 => array:3 [ "nombre" => "Martin" "apellidos" => "Kupec" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "§" "identificador" => "aff0020" ] ] ] 7 => array:3 [ "nombre" => "Jirí" "apellidos" => "Pudil" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "║" "identificador" => "aff0025" ] ] ] 8 => array:4 [ "nombre" => "Libor" "apellidos" => "Vítek" "email" => array:1 [ 0 => "vitek@cesnet.cz" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "†" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "¶" "identificador" => "aff0030" ] 2 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:6 [ 0 => array:3 [ "entidad" => "Department of Internal Medicine, 1st Faculty of Medicine, Charles University in Prague, and Military University Hospital, Prague, Czech Republic" "etiqueta" => "*" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Institute of Medical Biochemistry and Laboratory Diagnostics, General University Hospital, and 1st Faculty of Medicine, Charles University in Prague, Prague, Czech Republic" "etiqueta" => "†" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Department of Radiology, Military University Hospital, Prague, Czech Republic" "etiqueta" => "‡" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Department of Oncology, 1st Faculty of Medicine, Charles University in Prague, and Thomayer Hospital, Prague, Czech Republic, Prague, Czech Republic" "etiqueta" => "§" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Department of Surgery, 2nd Faculty of Medicine, Charles University in Prague, and Military University Hospital, Prague, Czech Republic" "etiqueta" => "║" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "4th Department of Internal Medicine, General University Hospital, 1st Faculty of Medicine, Charles University in Prague, Prague, Czech Republic" "etiqueta" => "¶" "identificador" => "aff0030" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "*" "correspondencia" => "Correspondence and reprint request:" ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "f0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 385 "Ancho" => 704 "Tamanyo" => 43881 ] ] "descripcion" => array:1 [ "en" => "mRNA levels of selected genes in the liver of HCC patients. HMOX1 : heme oxygenase 1. BLVRA: biliverdin reductase A. BLVRB: biliverdin reductase B. p22: gene encoding for p22 phox protein, NOX2: NADPH oxidase 2." ] ] ] "textoCompleto" => "IntroductionHepatocellular carcinoma (HCC) is the most common primary malignant liver tumor. The global mortality rate is 694,000 cases per year.<a class="elsevierStyleCrossRef" href="#bib0005">1</a> Worldwide, HCC is the fifth most common cancer in men and the seventh in women; representing the third most frequent cause of cancer-related death.<a class="elsevierStyleCrossRef" href="#bib0010">2</a> The incidence of HCC has different geographical distributions; sub-Saharan Africa, China, Hong Kong and Taiwan being among those regions with the highest incidence rates of HCC (i.e., more than 15 cases per 100,000 population per year.<a class="elsevierStyleCrossRef" href="#bib0015">3</a> Conversely, North and South America and most of Europe are among those countries with a lower incidence. However, in recent years, the incidence rates have increased even in these regions, and this trend is expected to continue.<a class="elsevierStyleCrossRef" href="#bib0020">4</a>This malignant disease arises in patients with chronic liver disease, mostly at the stage of liver cirrhosis. Almost 90 percent of cases are due to underlying cirrhosis or chronic hepatitis B and C virus infections.<a class="elsevierStyleCrossRef" href="#bib0025">5</a> Well-defined etiological agents for the development of HCC are aflatoxin and excessive alcohol intake. Also, non-alcoholic steatohepatitis due to obesity, metabolic syndrome, and diabetes contribute significantly to the incidence of HCC.<a class="elsevierStyleCrossRef" href="#bib0030">6</a>As far as the risk factors are known, screening programs for the risk groups can be established with an aim to detect tumors in the early stages. However, according to the available data, only 30% of patients with HCC are diagnosed in the early stages, when curative treatment is still possible.<a class="elsevierStyleCrossRef" href="#bib0035">7</a> The recommended method of surveillance of HCC is a liver ultrasound at 6-month intervals;<a class="elsevierStyleCrossRef" href="#bib0040">8</a> having sensitivity of about 65-80%, and a specificity of almost 90%.<a class="elsevierStyleCrossRef" href="#bib0045">9</a>A combination of liver ultrasound and serum a1-fetoprotein (AFP) had been recommended in the previous guidelines. However, even combinations of these procedures is not sufficiently sensitive or specific to be used as a surveillance assay. AFP is typically increased in advanced tumors,<a class="elsevierStyleCrossRef" href="#bib0050">10</a> but can be elevated in cholangiocarcinoma, liver metastases of colorectal cancer, gastric, testicular, or ovarian cancer; and it is also raised in cirrhosis. At the time of diagnosis, over 30% of HCC patients have normal serum levels of AFP.<a class="elsevierStyleCrossRef" href="#bib0055">11</a> According to current AASLD guidelines, AFP serology is still considered an inadequate screening test for HCC.Thus, new biomarkers are needed for early diagnosis of HCC. In fact, several of them are now under investigation including oxidative stress markers, angiogenic growth factors, or other markers such as glypican-3,<a class="elsevierStyleCrossRef" href="#bib0060">12</a> lectin-bound AFP or des-γ carboxyprotrombin.<a class="elsevierStyleCrossRef" href="#bib0065">13</a> However, so far, none of these, has been adequately investigated to be recommended as a screening test.Hepatic carcinogenesis is a complex, multi-step process involving all pro-oncogenic and protective mechanisms. Increased production of reactive oxygen (ROS) and nitrogen species (RONS) is considered to be a trigger point in hepatic carcinogenesis.NADPH oxidase (NOX) is a multiprotein enzyme complex importantly involved in ROS production,<a class="elsevierStyleCrossRef" href="#bib0070">14</a> a phenomenon believed to contribute significantly to the apoptosis of liver cells.<a class="elsevierStyleCrossRef" href="#bib0075">15</a>NOX2, NADPH oxidase prototypic isoform is activated by the p22phox protein, which stabilizes and binds it to other subunits.<a class="elsevierStyleCrossRef" href="#bib0080">16</a>The important enzyme in the antioxidant defense is heme oxygenase (HMOX), having two isoforms - HMOX1, highly inducible by oxidative stress, and HMOX2, the constitutive isoenzyme.<a class="elsevierStyleCrossRef" href="#bib0085">17</a>HMOX catalyzes the degradation of heme to biliverdin, carbon monoxide, and iron. Although controversies exist on the role of HMOX1 in carcinogenesis,<a class="elsevierStyleCrossRef" href="#bib0090">18</a> both biliverdin and carbon monoxide exert important protective effects against oxidative stress.<a class="elsevierStyleCrossRef" href="#bib0085">17</a>Another key enzyme in the heme catabolic pathway is biliverdin reductase (BLVR), reducing biliverdin to bilirubin, believed to be the most potent endogenous antioxidant substance.<a class="elsevierStyleCrossRef" href="#bib0095">19</a> BLVR exists in two isoforms - BLVRA, the major enzyme in adults, and BLVRB, the predominant isoform in in the fetus.<a class="elsevierStyleCrossRef" href="#bib0100">20</a>BLVRA has multiple additional functions also acting as a transcription factor,<a class="elsevierStyleCrossRef" href="#bib0105">21</a> a unique serine/threonine/tyrosine kinase,<a class="elsevierStyleCrossRef" href="#bib0110">22</a> as well as cell membrane receptor involved in the immune response.<a class="elsevierStyleCrossRef" href="#bib0115">23</a> Its role in carcinogenesis still remains to be elucidated.<a class="elsevierStyleCrossRef" href="#bib0120">24</a>The aim of our study was to assess the expressions of those genes involved in the homeostasis of oxidative stress in patients with HCC.Material and MethodsSubjectsThe study was performed on 32 patients with primary HCC (verified by liver histology in 29 patients) and 38 control subjects. The HCC patients were diagnosed, followed, and treated in the Military University Hospital in Prague between 2011 - 2014. Diagnosis of HCC was made by clinical, laboratory, and imaging (CT, MRI) examination. Liver histology was available from 29 patients (23 from CT-guided biopsies, in the remaining 6 patients the material was obtained from surgically-resected tissue).Blood samples were analyzed in 32 patients with HCC - those with a verified diagnosis by histological examination; plus those with a likely diagnosis of HCC without histological verification, but diagnosed radiologically (typical imaging features were present in a contrast-enhanced study via dynamic CT-scan or MRI). A liver biopsy was not performed in these patients due to disapproval of the patient, advanced stage of the disease or contraindication of a liver biopsy.As controls, 27 healthy volunteers (blood donors or employees of General Faculty Hospital and 1st Faculty of Medicine, Charles University in Prague) were used for gene expression studies in PBL. Eleven subjects who underwent a liver biopsy which resulted in no or minimal changes in the liver tissue (5 with non-alcoholic fatty liver disease, 3 with minimal changes, and 3 with normal liver histology) were used as controls for gene expression studies in liver tissue.The study was registered under ID: NCT00842205 (<a href="http://www.clinicaltrial.gov">www.clinicaltrial.gov</a>). The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki. All subjects involved in the study had provided prior written informed consent.Material sampling and storageLiver samples obtained from routinely performed CT-guided biopsies, or by liver tissue excision during surgical procedure were immediately placed into a RNAlater (Ambion Diagnostics, Austin, TX, USA) and stored at − 80°C. Blood samples for gene expression analyses were collected into PAXgene Blood RNA Tubes (PreAnalytix, Hombrechtikon, Switzerland) and stored at −80°C until total RNA isolation.Total RNA isolation and reverse transcriptionHomogenization of liver tissue and isolation of total RNA was performed using RNeasy Mini (Qiagen, Dallas, TX, USA), isolation total RNA from PBL using a PAX-gene kit (Qiagen, Dallas, TX, USA), according to the manufacturer’s instructions. DNase treatment with RNase-free DNase (Qiagen, Dallas, TX, USA); prior to cDNA synthesis was carried out according to the manufacturer’s instructions. First-strand cDNA was synthesized from 0.2 µg of total RNA in a final volume of 20 µg using a High-Capacity cDNA kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.Gene expression quantificationThe BLVRA, BLVRB, HMOX1 and hypoxanthine phosphoribosyl transferase (HPRT) primer sequences were used as described previously.<a class="elsevierStyleCrossRef" href="#bib0125">25</a> Primers for NOX2 and p22phox were designed using Primer 3 software (<a href="http://frodo.wi.mit.edu/primer3/">http://frodo.wi.mit.edu/primer3/</a>, accessed 2013 Feb 01) and synthesized by Generi Biotech (Hradec Králové, Czech Republic) (<a class="elsevierStyleCrossRef" href="#t0005">Table 1</a>).<elsevierMultimedia ident="t0005"></elsevierMultimedia>To determine the relative gene expression level of all data analysis, HPRT mRNA expressions were measured as internal controls. The fold change was calculated as 2-ΔΔct. The qPCR was performed in a 20 µL reaction volume, containing 4 µL of five-fold diluted cDNA template from a completed RT reaction, 1x SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA), and 200 nM (400 nM for BLVRB, 1000 nM for p22phox) of forward and reverse primers. All RT-PCR were set up in 96-well optical plates, and run on an ABI PRISM 7500 Sequence Detector System (Applied Biosystems, Foster City, CA, USA).The cycling conditions included polymerase activation at 95°C for 10 min, followed with 40 cycles of 95°C for 15 s, and 60°C for 60 s. PCR products were subjected to a melting curve analysis. All samples were analyzed in triplicates. PCR efficiencies for target and housekeeping cDNA were 96 -105%.Serum biochemistrySerum markers of liver injury (ALT, AST, GGT, ALP) and bilirubin were analyzed by routine assays on an automated analyzer (Cobas R8000 Modular analyzer, Roche Diagnostics GmbH, Mannheim, Germany).Hematologic parameters were also analyzed on automated analyzers - INR on ACL500 (Instrumentation Laboratory, Bedford, Laboratory, Bedford, Massachusetts, USA); hemoglobin and platelets on a Sysmex XCE-5000 a XT-2000i (Sysmex Corporation, Kobe, Japan), respectively.Statistical analysisDue to the non-normal distribution, data are described as median and IQ range. Differences between the studied groups were evaluated using the Mann-Whitney rank sum test. All analyses were performed with alpha set to 0.05.Results and DiscussionThe basic clinical and laboratory characteristics of our HCC patients are shown in <a class="elsevierStyleCrossRef" href="#t0010">table 2</a>. The median age of our HCC patients was 69 years, HCC was almost 4 times more frequent in men than in women. The most prevalent underlying cause of HCC was non-alcoholic steatohepatitis (NASH), followed with alcoholic liver disease (ALD) (<a class="elsevierStyleCrossRef" href="#t0015">Table 3</a>).<elsevierMultimedia ident="t0010"></elsevierMultimedia><elsevierMultimedia ident="t0015"></elsevierMultimedia>Hepatic carcinogenesis is a complex process, the understanding of which is still far from complete. Nevertheless, the role of increased oxidative stress and a dysfunctional antioxidant defense system seems to contribute significantly to the manifestation and progression of HCC (reviewed in reference 26). For instance, mice deficient in CuZn superoxide dismutase, which converts superoxide to H2O2, exhibit increased an incidence of HCC.<a class="elsevierStyleCrossRef" href="#bib0135">27</a> Increased oxidative stress induced by hepatitis C virus infection, resulting in increased hepatic tumorigenesis, was also reported.<a class="elsevierStyleCrossRef" href="#bib0140">28</a> The role of NOX, the major producer of superoxide in the mitochondria in mediating transforming growth factor (TGF)-β-induced hepatic fibrosis and carcinogenesis is also well recognized.<a class="elsevierStyleCrossRef" href="#bib0145">29</a> In this context, it is interesting to note that bilirubin, one of the most important endogenous antioxidant substances,<a class="elsevierStyleCrossRef" href="#bib0150">30</a> is a potent inhibitor of NOX.<a class="elsevierStyleCrossRef" href="#bib0155">31</a>,<a class="elsevierStyleCrossRef" href="#bib0160">32</a>For decades the heme catabolic pathway has only been recognized only as a pathway required for the disposal of heme degradation products, but is now believed to play an important role in protection from increased oxidative stress.<a class="elsevierStyleCrossRef" href="#bib0095">19</a> This pathway includes two important enzymes, HMOX and BLVR, reducing biliverdin to bilirubin, the major endogenous antioxidant. HMOX1, an inducible isoform, is a matter of controversy in terms of its role in carcinogenesis.<a class="elsevierStyleCrossRef" href="#bib0090">18</a> While in some cancers HMOX1 gene expression may be viewed as a negative prognostic factor,<a class="elsevierStyleCrossRef" href="#bib0165">33</a> clinical studies show that subjects with a more active HMOX1 gene variant are less likely to develop a variety of tumors (for review see reference <a class="elsevierStyleCrossRef" href="#bib0170">34</a>). The protective role of HMOX1 was also reported in an animal model of hepatic carcinogenesis, demonstrating increased malignancy when HMOX1 was downregulated.<a class="elsevierStyleCrossRef" href="#bib0175">35</a> However, in our study, we were not able to identify HMOX1 mRNA expression to be differentially modulated in HCC patients, either in the tumor tissue (0.67 ± 0.73 vs. 0.55 ± 0.38, p > 0.05) (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>) or in PBL (1.91 ± 2.1 vs. 1.51 ± 0.62, p > 0.05). Nevertheless, BLVRA mRNA level was significantly upregulated in our HCC patients, both in tumor tissue and PBL. In fact, an almost 3 times higher mRNA levels of BLVRA were detected in livers of HCC patients compared to controls (1.14 ± 0.76 vs. 0.41 ± 0.24, p = 0.002). In accord with results in the liver tissue, BLVRA mRNA level in PBL was also significantly increased in our HCC patients (1.17 ± 0.46 vs. 0.90 ± 0.29, p = 0.012).<elsevierMultimedia ident="f0005"></elsevierMultimedia>These results are in accord with recent data by De Giorgi, et al. on patients with HCV-induced HCC<a class="elsevierStyleCrossRef" href="#bib0180">36</a> as well as our own results demonstrating increased BLVRA mRNA expression in HCV infected patients.<a class="elsevierStyleCrossRef" href="#bib0125">25</a> Our data are also corroborated by the immunohistological study by Arena, et al., who showed increased protein expression of BLVR in tumor tissues of patients with melanoma.<a class="elsevierStyleCrossRef" href="#bib0185">37</a> Overexpression of a BLVRA protein was also reported in clinical renal cancers,<a class="elsevierStyleCrossRef" href="#bib0190">38</a> as well as vaginal carcinomas.<a class="elsevierStyleCrossRef" href="#bib0195">39</a>BLVRB, the other BLVR isoenzyme being predominantly important during fetal life, was reported to be upregulated on a protein level in HCC patients by Melle, et al.;<a class="elsevierStyleCrossRef" href="#bib0200">40</a> and its possible pro-carcinogenic role in HCC was also described in a recent experimental study by Huan, et al.<a class="elsevierStyleCrossRef" href="#bib0205">41</a> However, we were not able to confirm this data, since only a mild and non-significant elevation of BLVRB mRNA levels was found in our HCC patients compared to controls (0.73 ± 0.97 vs. 0.61 ± 0.26, p > 0.05) (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>).The functional significance of increased BLVRA mRNA expression remains to be answered. One explanation might be feedback stimulation of the antioxidant defense, which is what we believe is true in HCV-infected patients; those who responded to antiviral therapy had much higher BLVRA mRNA expression compared to non-responders.<a class="elsevierStyleCrossRef" href="#bib0125">25</a> The beneficial role of BLVRA in preventing oxidative stress-induced senescence was also reported,<a class="elsevierStyleCrossRef" href="#bib0210">42</a> supporting this hypothesis. On the other hand, BLVRA silencing in renal cells had a pro-apoptotic effect,<a class="elsevierStyleCrossRef" href="#bib0215">43</a> and BLVRA, surprisingly serving as a transcription factor, is a known activator of multiple pro-proliferative intracellular signaling pathways.<a class="elsevierStyleCrossRef" href="#bib0120">24</a>BLVRA is also a sensor of intracellular hypoxia; indeed, its expression has been shown to be significantly increased in response to hypoxia.<a class="elsevierStyleCrossRef" href="#bib0220">44</a> Thus, it seems that several mechanisms are behind the up-regulated BLVRA observed in biological studies.Our explanation of increased BLVRA mRNA expression due to increased oxidative stress might be plausible, as evidenced by increased NOX2 mRNA levels in the PBL of our HCC patients. Although mRNA levels of NOX2 and p22phox in the liver tissue only showed a non-significantly higher trend in our HCC patients (0.60 ± vs. 0.47, and 0.79 ± 0.64 vs. 0.47 ± 0.26, respectively, p > 0.05 for both comparisons) (<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>), mRNA level of NOX2 in PBL was significantly higher in these HCC patients (1.91 ± 1.21 vs. 1.22 ± 0.52, p = 0.003). Thus, BLVRA may act as a feedback mechanism to scavenge superoxide overproduced by increased NOX2.<a class="elsevierStyleCrossRef" href="#bib0130">26</a>It is also important to emphasize the importance of the PBL as a biological material to be used for screening expression studies. The PBL are easily available from blood sampling, and their gene expression profiles are more reliable compared to liver cancers often containing necrotic tissues.<a class="elsevierStyleCrossRef" href="#bib0220">44</a>ConclusionIn conclusion, we observed increased BLVRA mRNA level in the liver as well as in PBL in HCC patients, which seems to be a feedback mechanism to control increased oxidative stress associated with HCC progression, as evidenced by increased NOX2 mRNA levels in PBL of these patients. We were not able to assess either the BLVRA protein levels or BLVRA enzyme activities in our biological samples; thus further studies aimed to deeper analyze BLVRA as a possible therapeutic target are certainly needed.Abbreviations<ul class="elsevierStyleList" id="l0005"><li class="elsevierStyleListItem" id="u0005">•AFP: a1-fetoprotein.</li><li class="elsevierStyleListItem" id="u0010">•ALD: alcoholic liver disease.</li><li class="elsevierStyleListItem" id="u0015">•ALT: alanine aminotransferase.</li><li class="elsevierStyleListItem" id="u0020">•AST: aspartate aminotransferase.</li><li class="elsevierStyleListItem" id="u0025">•ALP: alkaline phosphatase.</li><li class="elsevierStyleListItem" id="u0030">•BLVR: biliverdin reductase.</li><li class="elsevierStyleListItem" id="u0035">•BLVRA: biliverdin reductase A.</li><li class="elsevierStyleListItem" id="u0040">•BLVRB: biliverdin reductase B.</li><li class="elsevierStyleListItem" id="u0045">•GGT: gamma glutamyl transpeptidase.</li><li class="elsevierStyleListItem" id="u0050">•HBV: viral hepatitis B.</li><li class="elsevierStyleListItem" id="u0055">•HCC: hepatocellular carcinoma.</li><li class="elsevierStyleListItem" id="u0060">•HCV: viral hepatitis C.</li><li class="elsevierStyleListItem" id="u0065">•HMOX1: heme oxygenase 1.</li><li class="elsevierStyleListItem" id="u0070">•HPRT: hypoxanthine phosphoribosyl transferase.</li><li class="elsevierStyleListItem" id="u0075">•INR: international normalized ratio of prothrombin time.</li><li class="elsevierStyleListItem" id="u0080">•NASH: non-alcoholic steatohepatitis.</li><li class="elsevierStyleListItem" id="u0085">•NOX2: NADPH oxidase 2.</li><li class="elsevierStyleListItem" id="u0090">•PBL: peripheral blood leukocytes.</li><li class="elsevierStyleListItem" id="u0095">•RONS: reactive nitrogen species.</li><li class="elsevierStyleListItem" id="u0100">•ROS: reactive oxygen species.</li><li class="elsevierStyleListItem" id="u0105">•TGF: transforming growth factor.</li></ul>AcknowledgementsThis work was supported by grant IGA MZ NT 13092-4/2012 from the Czech Ministry of Health." "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:3 [ "identificador" => "xres1207318" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abs0010" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1124364" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "s0005" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "s0010" "titulo" => "Material and Methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "s0015" "titulo" => "Subjects" ] 1 => array:2 [ "identificador" => "s0020" "titulo" => "Material sampling and storage" ] 2 => array:2 [ "identificador" => "s0025" "titulo" => "Total RNA isolation and reverse transcription" ] 3 => array:2 [ "identificador" => "s0030" "titulo" => "Gene expression quantification" ] 4 => array:2 [ "identificador" => "s0035" "titulo" => "Serum biochemistry" ] 5 => array:2 [ "identificador" => "s0040" "titulo" => "Statistical analysis" ] ] ] 4 => array:2 [ "identificador" => "s0045" "titulo" => "Results and Discussion" ] 5 => array:2 [ "identificador" => "s0050" "titulo" => "Conclusion" ] 6 => array:2 [ "identificador" => "s0055" "titulo" => "Abbreviations" ] 7 => array:2 [ "identificador" => "s0060" "titulo" => "Acknowledgements" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2016-03-22" "fechaAceptado" => "2016-04-13" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1124364" "palabras" => array:5 [ 0 => "Biliverdin reductase" 1 => "Heme catabolic pathway" 2 => "Heme oxygenase" 3 => "Liver cirrhosis" 4 => "Oxidative stress" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "Introduction and aim. Hepatocellular carcinoma (HCC) is the most common primary malignant liver tumor. It is primarily caused by hepatic cirrhosis or chronic viral hepatitis. Hepatic carcinogenesis is associated with increased oxidative stress. Thus, the aim of our study was to assess expression of the genes involved in the homeostasis of oxidative stress in patients with HCC.Material and methods. The study was performed on 32 patients with primary HCC (verified by liver histology in 29 patients) and 27 control subjects (in 11 subjects, liver histology was available either with no or minimal changes in the liver tissue). Gene expressions of heme oxygenase 1 (HMOX1), biliverdin reductase A/B (BLVRA/B), NADPH oxidase 2 (NOX2)and p22phox were analyzed in the liver and peripheral blood leukocytes (PBL) in the subjects.Results. Compared to controls, almost a 3 times higher mRNA level of BLVRA was detected in livers of HCC patients (p = 0.002); while those of BLVRB as well as HMOX1 were unchanged (p > 0.05). In accord with these results in the liver tissue, BLVRA mRNA levels in PBL were also significantly increased in HCC patients (p = 0.012). mRNA levels of NOX2 and p22phox in the liver tissue, although higher in HCC patients, did not differ significantly compared to control subjects (p > 0.05). Nevertheless, NOX2 mRNA level in PBL was significantly higher in HCC patients (p = 0.003).Conclusions.BLVRA mRNA levels in the liver as well as in PBL are significantly higher in HCC patients most likely as a feedback mechanism to control increased oxidative stress associated with HCC progression." ] ] "multimedia" => array:4 [ 0 => array:7 [ "identificador" => "f0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 385 "Ancho" => 704 "Tamanyo" => 43881 ] ] "descripcion" => array:1 [ "en" => "mRNA levels of selected genes in the liver of HCC patients. HMOX1 : heme oxygenase 1. BLVRA: biliverdin reductase A. BLVRB: biliverdin reductase B. p22: gene encoding for p22 phox protein, NOX2: NADPH oxidase 2." ] ] 1 => array:7 [ "identificador" => "t0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "HMOX1; heme oxygenase 1. BLVRA; biliverdin reductase A. BLVRB; biliverdin reductase B. NOX2: NADPH oxidase 2. HPRT: hypoxanthine phosphoribosyl transferase." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Fragment (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HMOX1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGGTGATAGAAGAGGCCAAGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTTGAGGAGTTGCAGGAGCT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">67 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BLVRA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCCCTCTTTGGGGAGCTTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGACCCAGACTTGAAATGGAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">180 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BLVRB \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCACGTGGTAGTGGGAGATG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCGTGGGACTGAGGTCATTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">110 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">p22phox \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTCACCCAGTGGTACTTTGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGCGGTCATGTACTTCTGTCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">130 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NOX2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GATTCTCTTGCCAGTCTGTCG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATTCCTGTCCAGTTGTCTTCG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">94 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HPRT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CACTGGCAAAACAATGCAGAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGGTCCTTTTCACCAGCAAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">96 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2060798.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Primer sequences for target and internal control genes." ] ] 2 => array:7 [ "identificador" => "t0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline plhosphatase; GGT, gamma glutamyl transpeptidase; INR, international normalized ratio of prothrombin time. Data expressed as mean ± standard deviation, or median (IQ range) depending on data normality." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gender (M:F ratio) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">3.83 \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">69 (61.0 - 74.0) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total bilirubin (µmol/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15.3 (10.8 - 22.1) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALT (µkat/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.53 (0.4 - 0.8) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AST (µkat/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.14 (0.8 - 1.6) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGT (µkat/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.9 (1.2 - 6.2) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALP (µkat/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.3 (1.7 - 4.4) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Albumin (g/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33.9 ± 4.6 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">INR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.22 (1.1 - 1.32) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hemoglobin (g/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">121. 1 ± 19.1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Platelets (× 109/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">203.5 ± 94.1 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2060796.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Clinical and laboratory characteristics of HCC patients." ] ] 3 => array:7 [ "identificador" => "t0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "NASH: non-alcoholic steatohepatitis. ALD: alcoholic liver disease. HCV: viral hepatitis C. HBV: viral hepatitis B." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Etiology \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Patients (n) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NASH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HCV \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">NASH+ALD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HBV \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fibrosis (unknown cause) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hemochromatosis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2060797.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Etiology of the HCC." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bs0010" "bibliografiaReferencia" => array:44 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1." "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Ferlay J, Shin R, Bray F, al. e. GLOBOCAN 2008 v1.2, Cancer Incidence and Mortality Worldwide: IARC CancerBase No.10. Available at http://www.iarc.fr/en/media-centre/iarcnews/2010/globocan2008.php. Access: Feb 15, 2016." ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Global cancer statistics, 2012" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Torre L.A." 1 => "Bray F." 2 => "Siegel R.L." 3 => "Ferlay J." 4 => "Lortet-Tieulent J." 5 => "Jemal A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3322/caac.21262" "Revista" => array:6 [ "tituloSerie" => "CA Cancer J Clin" "fecha" => "2015" "volumen" => "65" "paginaInicial" => "87" "paginaFinal" => "108" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25651787" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology of hepatocellular carcinoma in sub-Saharan Africa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Kew M.C." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Ann Hepatol" "fecha" => "2013" "volumen" => "12" "paginaInicial" => "173" "paginaFinal" => "182" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23396727" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Updated treatment approach to hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Llovet J.M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00535-005-1566-3" "Revista" => array:6 [ "tituloSerie" => "J Gastroenterol" "fecha" => "2005" "volumen" => "40" "paginaInicial" => "225" "paginaFinal" => "235" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15830281" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Perz J.F." 1 => "Armstrong G.L." 2 => "Farrington L.A." 3 => "Hutin Y.J." 4 => "Bell B.P." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2006.05.013" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2006" "volumen" => "45" "paginaInicial" => "529" "paginaFinal" => "538" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16879891" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Obesity and hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Caldwell S.H." 1 => "Crespo D.M." 2 => "Kang H.S." 3 => "Al-Osaimi A.M." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2004" "volumen" => "127" "paginaInicial" => "S97" "paginaFinal" => "S103" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15508109" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Design and endpoints of clinical trials in hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Llovet J.M." 1 => "Di Bisceglie A.M." 2 => "Bruix J." 3 => "Kramer B.S." 4 => "Lencioni R." 5 => "Zhu A.X." 6 => "Sherman M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jnci/djn134" "Revista" => array:6 [ "tituloSerie" => "J Natl Cancer Inst" "fecha" => "2008" "volumen" => "100" "paginaInicial" => "698" "paginaFinal" => "711" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18477802" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Management of hepatocellular carcinoma: an update" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Bruix J." 1 => "Sherman M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.24199" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2011" "volumen" => "53" "paginaInicial" => "1020" "paginaFinal" => "1022" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21374666" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Meta-analysis: surveillance with ultrasound for early-stage hepatocellular carcinoma in patients with cirrhosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Singal A." 1 => "Volk M.L." 2 => "Waljee A." 3 => "Salgia R." 4 => "Higgins P." 5 => "Rogers M.A." 6 => "Marrero J.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2036.2009.04014.x" "Revista" => array:6 [ "tituloSerie" => "Aliment Pharmacol Ther" "fecha" => "2009" "volumen" => "30" "paginaInicial" => "37" "paginaFinal" => "47" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19392863" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serological surveillance for hepatocellular carcinoma: time to quit" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Sherman M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2009.11.026" "Revista" => array:6 [ "tituloSerie" => "J Hepatol" "fecha" => "2010" "volumen" => "52" "paginaInicial" => "614" "paginaFinal" => "615" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20185193" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Screening for cancer in viral hepatitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Colombo M." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Liver Dis" "fecha" => "2001" "volumen" => "5" "paginaInicial" => "109" "paginaFinal" => "122" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11218910" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Glypican-3: a novel serum and histochemical marker for hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Capurro M." 1 => "Wanless I.R." 2 => "Sherman M." 3 => "Deboer G." 4 => "Shi W." 5 => "Miyoshi E." 6 => "Filmus J." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2003" "volumen" => "125" "paginaInicial" => "89" "paginaFinal" => "97" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12851874" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in American patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Marrero J.A." 1 => "Su G.L." 2 => "Wei W." 3 => "Emick D." 4 => "Conjeevaram H.S." 5 => "Fontana R.J." 6 => "Lok A.S." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/jhep.2003.50195" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2003" "volumen" => "37" "paginaInicial" => "1114" "paginaFinal" => "1121" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12717392" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure and regulation of the neutrophil respiratory burst oxidase: comparison with non-phagocyte oxidases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Quinn M.T." 1 => "Gauss K.A." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1189/jlb.0404216" "Revista" => array:6 [ "tituloSerie" => "J Leukoc Biol" "fecha" => "2004" "volumen" => "76" "paginaInicial" => "760" "paginaFinal" => "781" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15240752" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Involvement of NADPH oxidase-mediated generation of reactive oxygen species in the apototic cell death by capsaicin in HepG2 human hepatoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Lee Y.S." 1 => "Kang Y.S." 2 => "Lee J.S." 3 => "Nicolova S." 4 => "Kim J.A." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Free Radic Res" "fecha" => "2004" "volumen" => "38" "paginaInicial" => "405" "paginaFinal" => "412" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15190937" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Bedard K." 1 => "Krause K.H." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/physrev.00044.2005" "Revista" => array:6 [ "tituloSerie" => "Physiol Rev" "fecha" => "2007" "volumen" => "87" "paginaInicial" => "245" "paginaFinal" => "313" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17237347" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Ryter S.W." 1 => "Alam J." 2 => "Choi A.M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/physrev.00011.2005" "Revista" => array:6 [ "tituloSerie" => "Physiol Rev" "fecha" => "2006" "volumen" => "86" "paginaInicial" => "583" "paginaFinal" => "650" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16601269" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Heme oxygenase-1 in tumor biology and therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Was H." 1 => "Dulak J." 2 => "Jozkowicz A." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Curr Drug Targets" "fecha" => "2010" "volumen" => "11" "paginaInicial" => "1551" "paginaFinal" => "1570" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20704546" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The heme catabolic pathway and its protective effects on oxidative stress-mediated diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Vitek L." 1 => "Schwertner H.A." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Adv Clin Chem" "fecha" => "2007" "volumen" => "43" "paginaInicial" => "1" "paginaFinal" => "57" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17249379" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Initial-rate kinetics of the flavin reductase reaction catalysed by human biliverdin-IX-beta reductase (BVR-B)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Cunningham O." 1 => "Gore M.G." 2 => "Mantle T.J." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Biochem J" "fecha" => "2000" "volumen" => "345" "numero" => "Pt. 2" "paginaInicial" => "393" "paginaFinal" => "399" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10620517" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biliverdin reductase isozymes in metabolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "O’Brien L." 1 => "Hosick P.A." 2 => "John K." 3 => "Stec D.E." 4 => "Hinds T.D. Jr" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.tem.2015.02.001" "Revista" => array:6 [ "tituloSerie" => "Trends Endocrinol Metab" "fecha" => "2015" "volumen" => "26" "paginaInicial" => "212" "paginaFinal" => "220" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25726384" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human biliverdin reductase: a member of the insulin receptor substrate family with serine/threonine/tyrosine kinase activity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Lerner-Marmarosh N." 1 => "Shen J." 2 => "Torno M.D." 3 => "Kravets A." 4 => "Hu Z." 5 => "Maines M.D." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.0502173102" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2005" "volumen" => "102" "paginaInicial" => "7109" "paginaFinal" => "7114" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15870194" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cell surface biliverdin reductase mediates biliverdin-induced anti-inflammatory effects via phosphatidylinositol 3-kinase and Akt" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Wegiel B." 1 => "Baty C.J." 2 => "Gallo D." 3 => "Csizmadia E." 4 => "Scott J.R." 5 => "Akhavan A." 6 => "Chin B.Y." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M109.027433" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2009" "volumen" => "284" "paginaInicial" => "21369" "paginaFinal" => "21378" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19509285" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biliverdin reductase: a target for cancer therapy?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Gibbs P.E." 1 => "Miralem T." 2 => "Maines M.D." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fphar.2015.00119" "Revista" => array:5 [ "tituloSerie" => "Front Pharmacol" "fecha" => "2015" "volumen" => "6" "paginaInicial" => "119" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26089799" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expression of biliverdin reductase A in peripheral blood leukocytes is associated with treatment response in HCV-infected patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Subhanova I." 1 => "Muchova L." 2 => "Lenicek M." 3 => "Vreman H.J." 4 => "Luksan O." 5 => "Kubickova K." 6 => "Kreidlova M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0057555" "Revista" => array:6 [ "tituloSerie" => "PloS One" "fecha" => "2013" "volumen" => "8" "paginaInicial" => "e57555" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23536765" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1878875016311809" "estado" => "S300" "issn" => "18788750" ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oxidative stress and hepatic Nox proteins in chronic hepatitis C and hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Choi J." 1 => "Corder N.L." 2 => "Koduru B." 3 => "Wang Y." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.freeradbiomed.2014.04.020" "Revista" => array:6 [ "tituloSerie" => "Free Radic Biol Med" "fecha" => "2014" "volumen" => "72" "paginaInicial" => "267" "paginaFinal" => "284" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24816297" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Elchuri S." 1 => "Oberley T.D." 2 => "Qi W." 3 => "Eisenstein R.S." 4 => "Jackson Roberts L." 5 => "Van Remmen H." 6 => "Epstein C.J." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.onc.1208207" "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "2005" "volumen" => "24" "paginaInicial" => "367" "paginaFinal" => "380" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15531919" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of oxidative stress in hepatocar-cinogenesis induced by hepatitis C virus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Tsukiyama-Kohara K." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/ijms131115271" "Revista" => array:6 [ "tituloSerie" => "Int J Mol Sci" "fecha" => "2012" "volumen" => "13" "paginaInicial" => "15271" "paginaFinal" => "15278" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23203124" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cross-Talk Between TGF-beta and NADPH Oxidases During Liver Fibrosis and Hepatocarcinogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Crosas-Molist E." 1 => "Bertran E." 2 => "Fabregat I." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Curr Pharm Des" "fecha" => "2015" "volumen" => "21" "paginaInicial" => "5964" "paginaFinal" => "5976" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26510436" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatitis C virus induces oxidative stress, DNA damage and modulates the DNA repair enzyme NEIL1" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Pal S." 1 => "Polyak S.J." 2 => "Bano N." 3 => "Qiu W.C." 4 => "Carithers R.L." 5 => "Shuhart M." 6 => "Gretch D.R." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1440-1746.2009.06128.x" "Revista" => array:6 [ "tituloSerie" => "J Gastroenterol Hepatol" "fecha" => "2010" "volumen" => "25" "paginaInicial" => "627" "paginaFinal" => "634" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20074151" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bilirubin decreases nos2 expression via inhibition of NAD(P)H oxidase: implications for protection against endotoxic shock in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Lanone S." 1 => "Bloc S." 2 => "Foresti R." 3 => "Almolki A." 4 => "Taille C." 5 => "Callebert J." 6 => "Conti M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.04-2368fje" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2005" "volumen" => "19" "paginaInicial" => "1890" "paginaFinal" => "1892" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16129699" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bilirubin and biliverdin protect rodents against diabetic nephropathy by downregulating NAD(P)H oxidase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:7 [ 0 => "Fujii M." 1 => "Inoguchi T." 2 => "Sasaki S." 3 => "Maeda Y." 4 => "Zheng J." 5 => "Kobayashi K." 6 => "Takayanagi R." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ki.2010.265" "Revista" => array:7 [ "tituloSerie" => "Kidney Int" "fecha" => "2010" "volumen" => "78" "paginaInicial" => "905" "paginaFinal" => "919" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20686447" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0303846714002285" "estado" => "S300" "issn" => "03038467" ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inhibition of heme oxygenase-1 increases responsiveness of pancreatic cancer cells to anticancer treatment" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Berberat P.O." 1 => "Dambrauskas Z." 2 => "Gulbinas A." 3 => "Giese T." 4 => "Giese N." 5 => "Kunzli B." 6 => "Autschbach F." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/1078-0432.CCR-04-2159" "Revista" => array:6 [ "tituloSerie" => "Clin Cancer Res" "fecha" => "2005" "volumen" => "11" "paginaInicial" => "3790" "paginaFinal" => "3798" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15897578" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "34." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of heme oxygenase-1 promoter polymorphisms in human disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Exner M." 1 => "Minar E." 2 => "Wagner O." 3 => "Schillinger M." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.freeradbiomed.2004.07.008" "Revista" => array:6 [ "tituloSerie" => "Free Rad Biol Med" "fecha" => "2004" "volumen" => "37" "paginaInicial" => "1097" "paginaFinal" => "1104" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15451051" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "35." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immunohistochemical analysis of heme oxygenase-1 in preneoplastic and neoplastic lesions during chemical hepatocarcinogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Caballero F." 1 => "Meiss R." 2 => "Gimenez A." 3 => "Batlle A." 4 => "Vazquez E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.0959-9673.2004.00391.x" "Revista" => array:6 [ "tituloSerie" => "Int J Exp Pathol" "fecha" => "2004" "volumen" => "85" "paginaInicial" => "213" "paginaFinal" => "221" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15312126" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0180" "etiqueta" => "36." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular signatures associated with HCV-induced hepatocellular carcinoma and liver metastasis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "De Giorgi V." 1 => "Buonaguro L." 2 => "Worschech A." 3 => "Tornesello M.L." 4 => "Izzo F." 5 => "Marincola F.M." 6 => "Wang E." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0056153" "Revista" => array:5 [ "tituloSerie" => "PLoS One" "fecha" => "2013" "volumen" => "8" "paginaInicial" => "e56153" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23441164" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0185" "etiqueta" => "37." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The heme oxygenase/biliverdin reductase system in skin cancers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Arena V." 1 => "Pennacchia I." 2 => "Guerriero G." 3 => "Mancuso C." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Regul Homeost Agents" "fecha" => "2015" "volumen" => "29" "paginaInicial" => "259" "paginaFinal" => "264" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25864768" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0190" "etiqueta" => "38." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The oxidoreductase, biliverdin reductase, is induced in human renal carcinoma-pH and cofactor-specific increase in activity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Maines M.D." 1 => "Mayer R.D." 2 => "Erturk E." 3 => "Huang T.J." 4 => "Disantagnese A." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Urol" "fecha" => "1999" "volumen" => "162" "paginaInicial" => "1467" "paginaFinal" => "1472" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10492239" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0195" "etiqueta" => "39." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Differential tissue-specific protein markers of vaginal carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Hellman K." 1 => "Alaiya A.A." 2 => "Becker S." 3 => "Lomnytska M." 4 => "Schedvins K." 5 => "Steinberg W." 6 => "Hellstrom A.C." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjc.6604975" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer" "fecha" => "2009" "volumen" => "100" "paginaInicial" => "1303" "paginaFinal" => "1314" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19367286" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0200" "etiqueta" => "40." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of specific protein markers in microdissected hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "Melle C." 1 => "Ernst G." 2 => "Scheibner O." 3 => "Kaufmann R." 4 => "Schimmel B." 5 => "Bleul A." 6 => "Settmacher U." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/pr060439b" "Revista" => array:6 [ "tituloSerie" => "J Proteome Res" "fecha" => "2007" "volumen" => "6" "paginaInicial" => "306" "paginaFinal" => "315" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17203974" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0205" "etiqueta" => "41." "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Huan L, Bao C, Chen D, Li Y, Lian J, Ding J, Huang S, et al. MiR-127-5p targets the biliverdin reductase B/NF-kappaB pathway to suppress cell growth in hepatocellular carcinoma cells. Cancer Sei 2016; 10.1111/cas.12869." ] ] ] 41 => array:3 [ "identificador" => "bib0210" "etiqueta" => "42." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biliverdin reductase A in the prevention of cellular senescence against oxidative stress" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Kim S.Y." 1 => "Kang H.T." 2 => "Choi H.R." 3 => "Park S.C." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3858/emm.2011.43.1.002" "Revista" => array:6 [ "tituloSerie" => "Exp Mol Med" "fecha" => "2011" "volumen" => "43" "paginaInicial" => "15" "paginaFinal" => "23" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21099244" "web" => "Medline" ] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0215" "etiqueta" => "43." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Small interference RNA-mediated gene silencing of human biliverdin reductase, but not that of heme oxygenase-1, attenuates arsenite-mediated induction of the oxygenase and increases apoptosis in 293A kidney cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Miralem T." 1 => "Hu Z.B." 2 => "Torno M.D." 3 => "Lelli K.M." 4 => "Maines M.D." ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Biol Chem" "fecha" => "2005" "volumen" => "280" "paginaInicial" => "17084" "paginaFinal" => "17092" ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0220" "etiqueta" => "44." "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biliverdin reductase plays a crucial role in hypoxia-induced chemoresistance in human glioblastoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Kim S.S." 1 => "Seong S." 2 => "Lim S.H." 3 => "Kim S.Y." ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2013.09.120" "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2013" "volumen" => "440" "paginaInicial" => "658" "paginaFinal" => "663" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24113378" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311147/v1_201906150956/en/main.assets" "Apartado" => array:4 [ "identificador" => "77721" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Article" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/0000001500000006/v1_201906150956/S1665268119311147/v1_201906150956/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311147?idApp=UINPBA00004N"]

Statistics

Kristýna Kubícková*, Iva Subhanová†, Renáta Konícková†, Linda Matousová†, Petr Urbánek*, Hana Parobková‡, Martin Kupec§, Jirí Pudil║, Libor Vítek†,¶,

Corresponding author

vitek@cesnet.cz

Correspondence and reprint request:

* Department of Internal Medicine, 1st Faculty of Medicine, Charles University in Prague, and Military University Hospital, Prague, Czech Republic

† Institute of Medical Biochemistry and Laboratory Diagnostics, General University Hospital, and 1st Faculty of Medicine, Charles University in Prague, Prague, Czech Republic

‡ Department of Radiology, Military University Hospital, Prague, Czech Republic

§ Department of Oncology, 1st Faculty of Medicine, Charles University in Prague, and Thomayer Hospital, Prague, Czech Republic, Prague, Czech Republic

║ Department of Surgery, 2nd Faculty of Medicine, Charles University in Prague, and Military University Hospital, Prague, Czech Republic

¶ 4th Department of Internal Medicine, General University Hospital, 1st Faculty of Medicine, Charles University in Prague, Prague, Czech Republic

Read

1008

Times
was read the article

359

Total PDF

649

Total HTML

Share statistics

 array:24 [
  "pii" => "S1665268119311147"
  "issn" => "16652681"
  "doi" => "10.5604/16652681.1222104"
  "estado" => "S300"
  "fechaPublicacion" => "2016-11-01"
  "aid" => "70869"
  "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
  "copyrightAnyo" => "2016"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Ann Hepatol. 2016;15:881-7"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 83
    "formatos" => array:3 [
      "EPUB" => 18
      "HTML" => 26
      "PDF" => 39
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1665268119311159"
    "issn" => "16652681"
    "doi" => "10.5604/16652681.1222105"
    "estado" => "S300"
    "fechaPublicacion" => "2016-11-01"
    "aid" => "70870"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2016;15:888-94"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 84
      "formatos" => array:3 [
        "EPUB" => 19
        "HTML" => 28
        "PDF" => 37
      ]
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "titulo" => "High risk&#44; high reward&#58; An analysis of outcomes for candidates awaiting hepatic re-transplantation"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "888"
          "paginaFinal" => "894"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "f0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 486
              "Ancho" => 505
              "Tamanyo" => 23031
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Kaplan Meier curve comparing survival of patients who underwent hepatic re-transplantation &#40;re-OLT&#41; early &#40;within 90 days&#41; vs&#46; late &#40;after 90 days&#41; of first transplant&#46; There was no difference in 3-year survival between the groups &#40;70 vs&#46; 70&#37;&#44; log-rank test p &#61; 0&#46;59&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Jigesh A&#46; Shah, Madhukar S&#46; Patel, Johannes R&#46; Kratz, James F&#46; Markmann, Parsia A&#46; Vagefi"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Jigesh A&#46;"
              "apellidos" => "Shah"
            ]
            1 => array:2 [
              "nombre" => "Madhukar S&#46;"
              "apellidos" => "Patel"
            ]
            2 => array:2 [
              "nombre" => "Johannes R&#46;"
              "apellidos" => "Kratz"
            ]
            3 => array:2 [
              "nombre" => "James F&#46;"
              "apellidos" => "Markmann"
            ]
            4 => array:2 [
              "nombre" => "Parsia A&#46;"
              "apellidos" => "Vagefi"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311159?idApp=UINPBA00004N"
    "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311159/v1_201906150956/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1665268119311135"
    "issn" => "16652681"
    "doi" => "10.5604/16652681.1222103"
    "estado" => "S300"
    "fechaPublicacion" => "2016-11-01"
    "aid" => "70868"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2016;15:870-80"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 85
      "formatos" => array:3 [
        "EPUB" => 14
        "HTML" => 31
        "PDF" => 40
      ]
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "titulo" => "Simultaneous liver and kidney transplantation in elderly patients&#58; Outcomes and validation of a clinical risk score for patient selection"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "870"
          "paginaFinal" => "880"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "f0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 504
              "Ancho" => 776
              "Tamanyo" => 45899
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="sp0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Liver graft survival in SLK group aged</span> &#8805; <span class="elsevierStyleItalic">65 years&#44; SLK group aged &#60; 65 years and LTA group aged</span> &#8805; <span class="elsevierStyleItalic">65 years&#46; SLK group aged</span> &#8805; <span class="elsevierStyleItalic">65 years</span> vs&#46; <span class="elsevierStyleItalic">SLK group aged &#60; 65 years &#40;p &#61; 0&#46;43&#41;&#59; SLK group aged</span> &#8805; <span class="elsevierStyleItalic">65 years</span> vs&#46; <span class="elsevierStyleItalic">LTA group aged</span> &#8805; <span class="elsevierStyleItalic">65 years &#40;p &#61; 0&#46;44&#41;&#59; SLK group aged</span> &#8805; <span class="elsevierStyleItalic">65 years</span> vs&#46; <span class="elsevierStyleItalic">LTA group aged &#60; 65 years &#40;p &#61; 0&#46;03&#41;&#46;</span></p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Kristopher P&#46; Croome, David D&#46; Lee, Justin M&#46; Burns, Dana K&#46; Perry, Justin H&#46; Nguyen, Andrew P&#46; Keaveny, Hani M&#46; Wadei, C&#46; Burcin Taner"
          "autores" => array:8 [
            0 => array:2 [
              "nombre" => "Kristopher P&#46;"
              "apellidos" => "Croome"
            ]
            1 => array:2 [
              "nombre" => "David D&#46;"
              "apellidos" => "Lee"
            ]
            2 => array:2 [
              "nombre" => "Justin M&#46;"
              "apellidos" => "Burns"
            ]
            3 => array:2 [
              "nombre" => "Dana K&#46;"
              "apellidos" => "Perry"
            ]
            4 => array:2 [
              "nombre" => "Justin H&#46;"
              "apellidos" => "Nguyen"
            ]
            5 => array:2 [
              "nombre" => "Andrew P&#46;"
              "apellidos" => "Keaveny"
            ]
            6 => array:2 [
              "nombre" => "Hani M&#46;"
              "apellidos" => "Wadei"
            ]
            7 => array:3 [
              "preGrado" => "MD"
              "nombre" => "C&#46; Burcin"
              "apellidos" => "Taner"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311135?idApp=UINPBA00004N"
    "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311135/v1_201906150956/en/main.assets"
  ]
  "en" => array:17 [
    "idiomaDefecto" => true
    "titulo" => "Predictive role <span class="elsevierStyleItalic">BLVRA</span> mRNA expression in hepatocellular cancer"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "881"
        "paginaFinal" => "887"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Krist&#253;na Kub&#237;ckov&#225;, Iva Subhanov&#225;, Ren&#225;ta Kon&#237;ckov&#225;, Linda Matousov&#225;, Petr Urb&#225;nek, Hana Parobkov&#225;, Martin Kupec, Jir&#237; Pudil, Libor V&#237;tek"
        "autores" => array:9 [
          0 => array:3 [
            "nombre" => "Krist&#253;na"
            "apellidos" => "Kub&#237;ckov&#225;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Iva"
            "apellidos" => "Subhanov&#225;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#8224;</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Ren&#225;ta"
            "apellidos" => "Kon&#237;ckov&#225;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#8224;</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Linda"
            "apellidos" => "Matousov&#225;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#8224;</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Petr"
            "apellidos" => "Urb&#225;nek"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Hana"
            "apellidos" => "Parobkov&#225;"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#8225;</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Martin"
            "apellidos" => "Kupec"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#167;</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Jir&#237;"
            "apellidos" => "Pudil"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#9553;</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          8 => array:4 [
            "nombre" => "Libor"
            "apellidos" => "V&#237;tek"
            "email" => array:1 [
              0 => "vitek@cesnet.cz"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#8224;</span>"
                "identificador" => "aff0010"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#182;</span>"
                "identificador" => "aff0030"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:6 [
          0 => array:3 [
            "entidad" => "Department of Internal Medicine&#44; 1st Faculty of Medicine&#44; Charles University in Prague&#44; and Military University Hospital&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#42;"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Institute of Medical Biochemistry and Laboratory Diagnostics&#44; General University Hospital&#44; and 1st Faculty of Medicine&#44; Charles University in Prague&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#8224;"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Radiology&#44; Military University Hospital&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#8225;"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Department of Oncology&#44; 1st Faculty of Medicine&#44; Charles University in Prague&#44; and Thomayer Hospital&#44; Prague&#44; Czech Republic&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#167;"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Department of Surgery&#44; 2nd Faculty of Medicine&#44; Charles University in Prague&#44; and Military University Hospital&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#9553;"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "4th Department of Internal Medicine&#44; General University Hospital&#44; 1st Faculty of Medicine&#44; Charles University in Prague&#44; Prague&#44; Czech Republic"
            "etiqueta" => "&#182;"
            "identificador" => "aff0030"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#42;"
            "correspondencia" => "Correspondence and reprint request&#58;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "f0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 385
            "Ancho" => 704
            "Tamanyo" => 43881
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">mRNA levels of selected genes in the liver of HCC patients&#46;</span> HMOX1 <span class="elsevierStyleItalic">&#58; heme oxygenase 1&#46;</span> BLVRA&#58; <span class="elsevierStyleItalic">biliverdin reductase A&#46;</span> BLVRB&#58; <span class="elsevierStyleItalic">biliverdin reductase B&#46; p22&#58; gene encoding for p22 <span class="elsevierStyleSup">phox</span> protein</span>&#44; NOX2&#58; <span class="elsevierStyleItalic">NADPH oxidase 2&#46;</span></p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="s0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0015">Introduction</span><p id="p0005" class="elsevierStylePara elsevierViewall">Hepatocellular carcinoma &#40;HCC&#41; is the most common primary malignant liver tumor&#46; The global mortality rate is 694&#44;000 cases per year&#46;<a class="elsevierStyleCrossRef" href="#bib0005">1</a> Worldwide&#44; HCC is the fifth most common cancer in men and the seventh in women&#59; representing the third most frequent cause of cancer-related death&#46;<a class="elsevierStyleCrossRef" href="#bib0010">2</a> The incidence of HCC has different geographical distributions&#59; sub-Saharan Africa&#44; China&#44; Hong Kong and Taiwan being among those regions with the highest incidence rates of HCC &#40;i&#46;e&#46;&#44; more than 15 cases per 100&#44;000 population per year&#46;<a class="elsevierStyleCrossRef" href="#bib0015">3</a> Conversely&#44; North and South America and most of Europe are among those countries with a lower incidence&#46; However&#44; in recent years&#44; the incidence rates have increased even in these regions&#44; and this trend is expected to continue&#46;<a class="elsevierStyleCrossRef" href="#bib0020">4</a></p><p id="p0010" class="elsevierStylePara elsevierViewall">This malignant disease arises in patients with chronic liver disease&#44; mostly at the stage of liver cirrhosis&#46; Almost 90 percent of cases are due to underlying cirrhosis or chronic hepatitis B and C virus infections&#46;<a class="elsevierStyleCrossRef" href="#bib0025">5</a> Well-defined etiological agents for the development of HCC are aflatoxin and excessive alcohol intake&#46; Also&#44; non-alcoholic steatohepatitis due to obesity&#44; metabolic syndrome&#44; and diabetes contribute significantly to the incidence of HCC&#46;<a class="elsevierStyleCrossRef" href="#bib0030">6</a></p><p id="p0015" class="elsevierStylePara elsevierViewall">As far as the risk factors are known&#44; screening programs for the risk groups can be established with an aim to detect tumors in the early stages&#46; However&#44; according to the available data&#44; only 30&#37; of patients with HCC are diagnosed in the early stages&#44; when curative treatment is still possible&#46;<a class="elsevierStyleCrossRef" href="#bib0035">7</a> The recommended method of surveillance of HCC is a liver ultrasound at 6-month intervals&#59;<a class="elsevierStyleCrossRef" href="#bib0040">8</a> having sensitivity of about 65-80&#37;&#44; and a specificity of almost 90&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0045">9</a></p><p id="p0020" class="elsevierStylePara elsevierViewall">A combination of liver ultrasound and serum a1-fetoprotein &#40;AFP&#41; had been recommended in the previous guidelines&#46; However&#44; even combinations of these procedures is not sufficiently sensitive or specific to be used as a surveillance assay&#46; AFP is typically increased in advanced tumors&#44;<a class="elsevierStyleCrossRef" href="#bib0050">10</a> but can be elevated in cholangiocarcinoma&#44; liver metastases of colorectal cancer&#44; gastric&#44; testicular&#44; or ovarian cancer&#59; and it is also raised in cirrhosis&#46; At the time of diagnosis&#44; over 30&#37; of HCC patients have normal serum levels of AFP&#46;<a class="elsevierStyleCrossRef" href="#bib0055">11</a> According to current AASLD guidelines&#44; AFP serology is still considered an inadequate screening test for HCC&#46;</p><p id="p0025" class="elsevierStylePara elsevierViewall">Thus&#44; new biomarkers are needed for early diagnosis of HCC&#46; In fact&#44; several of them are now under investigation including oxidative stress markers&#44; angiogenic growth factors&#44; or other markers such as glypican-3&#44;<a class="elsevierStyleCrossRef" href="#bib0060">12</a> lectin-bound AFP or des-&#947; carboxyprotrombin&#46;<a class="elsevierStyleCrossRef" href="#bib0065">13</a> However&#44; so far&#44; none of these&#44; has been adequately investigated to be recommended as a screening test&#46;</p><p id="p0030" class="elsevierStylePara elsevierViewall">Hepatic carcinogenesis is a complex&#44; multi-step process involving all pro-oncogenic and protective mechanisms&#46; Increased production of reactive oxygen &#40;ROS&#41; and nitrogen species &#40;RONS&#41; is considered to be a trigger point in hepatic carcinogenesis&#46;</p><p id="p0035" class="elsevierStylePara elsevierViewall">NADPH oxidase &#40;NOX&#41; is a multiprotein enzyme complex importantly involved in ROS production&#44;<a class="elsevierStyleCrossRef" href="#bib0070">14</a> a phenomenon believed to contribute significantly to the apoptosis of liver cells&#46;<a class="elsevierStyleCrossRef" href="#bib0075">15</a><span class="elsevierStyleItalic">NOX2</span>&#44; NADPH oxidase prototypic isoform is activated by the p22<span class="elsevierStyleSup">phox</span> protein&#44; which stabilizes and binds it to other subunits&#46;<a class="elsevierStyleCrossRef" href="#bib0080">16</a></p><p id="p0040" class="elsevierStylePara elsevierViewall">The important enzyme in the antioxidant defense is heme oxygenase <span class="elsevierStyleItalic">&#40;HMOX&#41;</span>&#44; having two isoforms - <span class="elsevierStyleItalic">HMOX1</span>&#44; highly inducible by oxidative stress&#44; and <span class="elsevierStyleItalic">HMOX2</span>&#44; the constitutive isoenzyme&#46;<a class="elsevierStyleCrossRef" href="#bib0085">17</a><span class="elsevierStyleItalic">HMOX</span> catalyzes the degradation of heme to biliverdin&#44; carbon monoxide&#44; and iron&#46; Although controversies exist on the role of <span class="elsevierStyleItalic">HMOX1</span> in carcinogenesis&#44;<a class="elsevierStyleCrossRef" href="#bib0090">18</a> both biliverdin and carbon monoxide exert important protective effects against oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0085">17</a></p><p id="p0045" class="elsevierStylePara elsevierViewall">Another key enzyme in the heme catabolic pathway is biliverdin reductase &#40;BLVR&#41;&#44; reducing biliverdin to bilirubin&#44; believed to be the most potent endogenous antioxidant substance&#46;<a class="elsevierStyleCrossRef" href="#bib0095">19</a> BLVR exists in two isoforms - <span class="elsevierStyleItalic">BLVRA</span>&#44; the major enzyme in adults&#44; and <span class="elsevierStyleItalic">BLVRB</span>&#44; the predominant isoform in in the fetus&#46;<a class="elsevierStyleCrossRef" href="#bib0100">20</a><span class="elsevierStyleItalic">BLVRA</span> has multiple additional functions also acting as a transcription factor&#44;<a class="elsevierStyleCrossRef" href="#bib0105">21</a> a unique serine&#47;threonine&#47;tyrosine kinase&#44;<a class="elsevierStyleCrossRef" href="#bib0110">22</a> as well as cell membrane receptor involved in the immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0115">23</a> Its role in carcinogenesis still remains to be elucidated&#46;<a class="elsevierStyleCrossRef" href="#bib0120">24</a></p><p id="p0050" class="elsevierStylePara elsevierViewall">The aim of our study was to assess the expressions of those genes involved in the homeostasis of oxidative stress in patients with HCC&#46;</p></span><span id="s0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0020">Material and Methods</span><span id="s0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0025">Subjects</span><p id="p0055" class="elsevierStylePara elsevierViewall">The study was performed on 32 patients with primary HCC &#40;verified by liver histology in 29 patients&#41; and 38 control subjects&#46; The HCC patients were diagnosed&#44; followed&#44; and treated in the Military University Hospital in Prague between 2011 - 2014&#46; Diagnosis of HCC was made by clinical&#44; laboratory&#44; and imaging &#40;CT&#44; MRI&#41; examination&#46; Liver histology was available from 29 patients &#40;23 from CT-guided biopsies&#44; in the remaining 6 patients the material was obtained from surgically-resected tissue&#41;&#46;</p><p id="p0060" class="elsevierStylePara elsevierViewall">Blood samples were analyzed in 32 patients with HCC - those with a verified diagnosis by histological examination&#59; plus those with a likely diagnosis of HCC without histological verification&#44; but diagnosed radiologically &#40;typical imaging features were present in a contrast-enhanced study via dynamic CT-scan or MRI&#41;&#46; A liver biopsy was not performed in these patients due to disapproval of the patient&#44; advanced stage of the disease or contraindication of a liver biopsy&#46;</p><p id="p0065" class="elsevierStylePara elsevierViewall">As controls&#44; 27 healthy volunteers &#40;blood donors or employees of General Faculty Hospital and 1st Faculty of Medicine&#44; Charles University in Prague&#41; were used for gene expression studies in PBL&#46; Eleven subjects who underwent a liver biopsy which resulted in no or minimal changes in the liver tissue &#40;5 with non-alcoholic fatty liver disease&#44; 3 with minimal changes&#44; and 3 with normal liver histology&#41; were used as controls for gene expression studies in liver tissue&#46;</p><p id="p0070" class="elsevierStylePara elsevierViewall">The study was registered under ID&#58; NCT00842205 &#40;<a href="http://www.clinicaltrial.gov">www&#46;clinicaltrial&#46;gov</a>&#41;&#46; The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki&#46; All subjects involved in the study had provided prior written informed consent&#46;</p></span><span id="s0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0030">Material sampling and storage</span><p id="p0075" class="elsevierStylePara elsevierViewall">Liver samples obtained from routinely performed CT-guided biopsies&#44; or by liver tissue excision during surgical procedure were immediately placed into a RNAlater &#40;Ambion Diagnostics&#44; Austin&#44; TX&#44; USA&#41; and stored at &#8722; 80&#176;C&#46; Blood samples for gene expression analyses were collected into PAXgene Blood RNA Tubes &#40;PreAnalytix&#44; Hombrechtikon&#44; Switzerland&#41; and stored at &#8722;80&#176;C until total RNA isolation&#46;</p></span><span id="s0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0035">Total RNA isolation and reverse transcription</span><p id="p0080" class="elsevierStylePara elsevierViewall">Homogenization of liver tissue and isolation of total RNA was performed using RNeasy Mini &#40;Qiagen&#44; Dallas&#44; TX&#44; USA&#41;&#44; isolation total RNA from PBL using a PAX-gene kit &#40;Qiagen&#44; Dallas&#44; TX&#44; USA&#41;&#44; according to the manufacturer&#8217;s instructions&#46; DNase treatment with RNase-free DNase &#40;Qiagen&#44; Dallas&#44; TX&#44; USA&#41;&#59; prior to cDNA synthesis was carried out according to the manufacturer&#8217;s instructions&#46; First-strand cDNA was synthesized from 0&#46;2 <span class="elsevierStyleItalic">&#181;</span>g of total RNA in a final volume of 20 <span class="elsevierStyleItalic">&#181;</span>g using a High-Capacity cDNA kit &#40;Applied Biosystems&#44; Foster City&#44; CA&#44; USA&#41; according to the manufacturer&#8217;s instructions&#46;</p></span><span id="s0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0040">Gene expression quantification</span><p id="p0085" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">BLVRA&#44; BLVRB&#44; HMOX1</span> and hypoxanthine phosphoribosyl transferase &#40;HPRT&#41; primer sequences were used as described previously&#46;<a class="elsevierStyleCrossRef" href="#bib0125">25</a> Primers for <span class="elsevierStyleItalic">NOX2</span> and p22<span class="elsevierStyleSup">phox</span> were designed using Primer 3 software &#40;<a href="http://frodo.wi.mit.edu/primer3/">http&#58;&#47;&#47;frodo&#46;wi&#46;mit&#46;edu&#47;primer3&#47;</a>&#44; accessed 2013 Feb 01&#41; and synthesized by Generi Biotech &#40;Hradec Kr&#225;lov&#233;&#44; Czech Republic&#41; &#40;<a class="elsevierStyleCrossRef" href="#t0005">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="t0005"></elsevierMultimedia><p id="p0090" class="elsevierStylePara elsevierViewall">To determine the relative gene expression level of all data analysis&#44; HPRT mRNA expressions were measured as internal controls&#46; The fold change was calculated as 2-<span class="elsevierStyleSup">&#916;&#916;ct</span>&#46; The qPCR was performed in a 20 <span class="elsevierStyleItalic">&#181;</span>L reaction volume&#44; containing 4 <span class="elsevierStyleItalic">&#181;</span>L of five-fold diluted cDNA template from a completed RT reaction&#44; 1x SYBR Green Master Mix &#40;Applied Biosystems&#44; Foster City&#44; CA&#44; USA&#41;&#44; and 200 nM &#40;400 nM for <span class="elsevierStyleItalic">BLVRB</span>&#44; 1000 nM for p22phox&#41; of forward and reverse primers&#46; All RT-PCR were set up in 96-well optical plates&#44; and run on an ABI PRISM 7500 Sequence Detector System &#40;Applied Biosystems&#44; Foster City&#44; CA&#44; USA&#41;&#46;</p><p id="p0095" class="elsevierStylePara elsevierViewall">The cycling conditions included polymerase activation at 95&#176;C for 10 min&#44; followed with 40 cycles of 95&#176;C for 15 s&#44; and 60&#176;C for 60 s&#46; PCR products were subjected to a melting curve analysis&#46; All samples were analyzed in triplicates&#46; PCR efficiencies for target and housekeeping cDNA were 96 -105&#37;&#46;</p></span><span id="s0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0045">Serum biochemistry</span><p id="p0100" class="elsevierStylePara elsevierViewall">Serum markers of liver injury &#40;ALT&#44; AST&#44; GGT&#44; ALP&#41; and bilirubin were analyzed by routine assays on an automated analyzer &#40;Cobas R8000 Modular analyzer&#44; Roche Diagnostics GmbH&#44; Mannheim&#44; Germany&#41;&#46;</p><p id="p0105" class="elsevierStylePara elsevierViewall">Hematologic parameters were also analyzed on automated analyzers - INR on ACL500 &#40;Instrumentation Laboratory&#44; Bedford&#44; Laboratory&#44; Bedford&#44; Massachusetts&#44; USA&#41;&#59; hemoglobin and platelets on a Sysmex XCE-5000 a XT-2000i &#40;Sysmex Corporation&#44; Kobe&#44; Japan&#41;&#44; respectively&#46;</p></span><span id="s0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0050">Statistical analysis</span><p id="p0110" class="elsevierStylePara elsevierViewall">Due to the non-normal distribution&#44; data are described as median and IQ range&#46; Differences between the studied groups were evaluated using the Mann-Whitney rank sum test&#46; All analyses were performed with alpha set to 0&#46;05&#46;</p></span></span><span id="s0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0055">Results and Discussion</span><p id="p0115" class="elsevierStylePara elsevierViewall">The basic clinical and laboratory characteristics of our HCC patients are shown in <a class="elsevierStyleCrossRef" href="#t0010">table 2</a>&#46; The median age of our HCC patients was 69 years&#44; HCC was almost 4 times more frequent in men than in women&#46; The most prevalent underlying cause of HCC was non-alcoholic steatohepatitis &#40;NASH&#41;&#44; followed with alcoholic liver disease &#40;ALD&#41; &#40;<a class="elsevierStyleCrossRef" href="#t0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="t0010"></elsevierMultimedia><elsevierMultimedia ident="t0015"></elsevierMultimedia><p id="p0120" class="elsevierStylePara elsevierViewall">Hepatic carcinogenesis is a complex process&#44; the understanding of which is still far from complete&#46; Nevertheless&#44; the role of increased oxidative stress and a dysfunctional antioxidant defense system seems to contribute significantly to the manifestation and progression of HCC &#40;reviewed in reference 26&#41;&#46; For instance&#44; mice deficient in CuZn superoxide dismutase&#44; which converts superoxide to H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#44; exhibit increased an incidence of HCC&#46;<a class="elsevierStyleCrossRef" href="#bib0135">27</a> Increased oxidative stress induced by hepatitis C virus infection&#44; resulting in increased hepatic tumorigenesis&#44; was also reported&#46;<a class="elsevierStyleCrossRef" href="#bib0140">28</a> The role of NOX&#44; the major producer of superoxide in the mitochondria in mediating transforming growth factor &#40;TGF&#41;-&#946;-induced hepatic fibrosis and carcinogenesis is also well recognized&#46;<a class="elsevierStyleCrossRef" href="#bib0145">29</a> In this context&#44; it is interesting to note that bilirubin&#44; one of the most important endogenous antioxidant substances&#44;<a class="elsevierStyleCrossRef" href="#bib0150">30</a> is a potent inhibitor of NOX&#46;<a class="elsevierStyleCrossRef" href="#bib0155">31</a>&#44;<a class="elsevierStyleCrossRef" href="#bib0160">32</a></p><p id="p0125" class="elsevierStylePara elsevierViewall">For decades the heme catabolic pathway has only been recognized only as a pathway required for the disposal of heme degradation products&#44; but is now believed to play an important role in protection from increased oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0095">19</a> This pathway includes two important enzymes&#44; HMOX and BLVR&#44; reducing biliverdin to bilirubin&#44; the major endogenous antioxidant&#46; <span class="elsevierStyleItalic">HMOX1</span>&#44; an inducible isoform&#44; is a matter of controversy in terms of its role in carcinogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0090">18</a> While in some cancers <span class="elsevierStyleItalic">HMOX1</span> gene expression may be viewed as a negative prognostic factor&#44;<a class="elsevierStyleCrossRef" href="#bib0165">33</a> clinical studies show that subjects with a more active <span class="elsevierStyleItalic">HMOX1</span> gene variant are less likely to develop a variety of tumors &#40;for review see reference <a class="elsevierStyleCrossRef" href="#bib0170">34</a>&#41;&#46; The protective role of <span class="elsevierStyleItalic">HMOX1</span> was also reported in an animal model of hepatic carcinogenesis&#44; demonstrating increased malignancy when <span class="elsevierStyleItalic">HMOX1</span> was downregulated&#46;<a class="elsevierStyleCrossRef" href="#bib0175">35</a> However&#44; in our study&#44; we were not able to identify <span class="elsevierStyleItalic">HMOX1</span> mRNA expression to be differentially modulated in HCC patients&#44; either in the tumor tissue &#40;0&#46;67 &#177; 0&#46;73 vs&#46; 0&#46;55 &#177; 0&#46;38&#44; p &#62; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>&#41; or in PBL &#40;1&#46;91 &#177; 2&#46;1 <span class="elsevierStyleItalic">vs&#46;</span> 1&#46;51 &#177; 0&#46;62&#44; p &#62; 0&#46;05&#41;&#46; Nevertheless&#44; <span class="elsevierStyleItalic">BLVRA</span> mRNA level was significantly upregulated in our HCC patients&#44; both in tumor tissue and PBL&#46; In fact&#44; an almost 3 times higher mRNA levels of <span class="elsevierStyleItalic">BLVRA</span> were detected in livers of HCC patients compared to controls &#40;1&#46;14 &#177; 0&#46;76 <span class="elsevierStyleItalic">vs&#46;</span> 0&#46;41 &#177; 0&#46;24&#44; p &#61; 0&#46;002&#41;&#46; In accord with results in the liver tissue&#44; <span class="elsevierStyleItalic">BLVRA</span> mRNA level in PBL was also significantly increased in our HCC patients &#40;1&#46;17 &#177; 0&#46;46 <span class="elsevierStyleItalic">vs&#46;</span> 0&#46;90 &#177; 0&#46;29&#44; p &#61; 0&#46;012&#41;&#46;</p><elsevierMultimedia ident="f0005"></elsevierMultimedia><p id="p0130" class="elsevierStylePara elsevierViewall">These results are in accord with recent data by De Giorgi&#44; <span class="elsevierStyleItalic">et al&#46;</span> on patients with HCV-induced HCC<a class="elsevierStyleCrossRef" href="#bib0180">36</a> as well as our own results demonstrating increased <span class="elsevierStyleItalic">BLVRA</span> mRNA expression in HCV infected patients&#46;<a class="elsevierStyleCrossRef" href="#bib0125">25</a> Our data are also corroborated by the immunohistological study by Arena&#44; <span class="elsevierStyleItalic">et al&#46;</span>&#44; who showed increased protein expression of BLVR in tumor tissues of patients with melanoma&#46;<a class="elsevierStyleCrossRef" href="#bib0185">37</a> Overexpression of a <span class="elsevierStyleItalic">BLVRA</span> protein was also reported in clinical renal cancers&#44;<a class="elsevierStyleCrossRef" href="#bib0190">38</a> as well as vaginal carcinomas&#46;<a class="elsevierStyleCrossRef" href="#bib0195">39</a><span class="elsevierStyleItalic">BLVRB</span>&#44; the other BLVR isoenzyme being predominantly important during fetal life&#44; was reported to be upregulated on a protein level in HCC patients by Melle&#44; <span class="elsevierStyleItalic">et al</span>&#46;&#59;<a class="elsevierStyleCrossRef" href="#bib0200">40</a> and its possible pro-carcinogenic role in HCC was also described in a recent experimental study by Huan&#44; <span class="elsevierStyleItalic">et al&#46;</span><a class="elsevierStyleCrossRef" href="#bib0205">41</a> However&#44; we were not able to confirm this data&#44; since only a mild and non-significant elevation of <span class="elsevierStyleItalic">BLVRB</span> mRNA levels was found in our HCC patients compared to controls &#40;0&#46;73 &#177; 0&#46;97 <span class="elsevierStyleItalic">vs&#46;</span> 0&#46;61 &#177; 0&#46;26&#44; p &#62; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>&#41;&#46;</p><p id="p0135" class="elsevierStylePara elsevierViewall">The functional significance of increased <span class="elsevierStyleItalic">BLVRA</span> mRNA expression remains to be answered&#46; One explanation might be feedback stimulation of the antioxidant defense&#44; which is what we believe is true in HCV-infected patients&#59; those who responded to antiviral therapy had much higher <span class="elsevierStyleItalic">BLVRA</span> mRNA expression compared to non-responders&#46;<a class="elsevierStyleCrossRef" href="#bib0125">25</a> The beneficial role of <span class="elsevierStyleItalic">BLVRA</span> in preventing oxidative stress-induced senescence was also reported&#44;<a class="elsevierStyleCrossRef" href="#bib0210">42</a> supporting this hypothesis&#46; On the other hand&#44; <span class="elsevierStyleItalic">BLVRA</span> silencing in renal cells had a pro-apoptotic effect&#44;<a class="elsevierStyleCrossRef" href="#bib0215">43</a> and <span class="elsevierStyleItalic">BLVRA</span>&#44; surprisingly serving as a transcription factor&#44; is a known activator of multiple pro-proliferative intracellular signaling pathways&#46;<a class="elsevierStyleCrossRef" href="#bib0120">24</a><span class="elsevierStyleItalic">BLVRA</span> is also a sensor of intracellular hypoxia&#59; indeed&#44; its expression has been shown to be significantly increased in response to hypoxia&#46;<a class="elsevierStyleCrossRef" href="#bib0220">44</a> Thus&#44; it seems that several mechanisms are behind the up-regulated <span class="elsevierStyleItalic">BLVRA</span> observed in biological studies&#46;</p><p id="p0140" class="elsevierStylePara elsevierViewall">Our explanation of increased <span class="elsevierStyleItalic">BLVRA</span> mRNA expression due to increased oxidative stress might be plausible&#44; as evidenced by increased <span class="elsevierStyleItalic">NOX2</span> mRNA levels in the PBL of our HCC patients&#46; Although mRNA levels of <span class="elsevierStyleItalic">NOX2</span> and <span class="elsevierStyleItalic">p22<span class="elsevierStyleSup">phox</span></span> in the liver tissue only showed a non-significantly higher trend in our HCC patients &#40;0&#46;60 &#177; <span class="elsevierStyleItalic">vs&#46;</span> 0&#46;47&#44; and 0&#46;79 &#177; 0&#46;64 <span class="elsevierStyleItalic">vs&#46;</span> 0&#46;47 &#177; 0&#46;26&#44; respectively&#44; p &#62; 0&#46;05 for both comparisons&#41; &#40;<a class="elsevierStyleCrossRef" href="#f0005">Figure 1</a>&#41;&#44; mRNA level of <span class="elsevierStyleItalic">NOX2</span> in PBL was significantly higher in these HCC patients &#40;1&#46;91 &#177; 1&#46;21 <span class="elsevierStyleItalic">vs&#46;</span> 1&#46;22 &#177; 0&#46;52&#44; p &#61; 0&#46;003&#41;&#46; Thus&#44; <span class="elsevierStyleItalic">BLVRA</span> may act as a feedback mechanism to scavenge superoxide overproduced by increased <span class="elsevierStyleItalic">NOX2</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0130">26</a></p><p id="p0145" class="elsevierStylePara elsevierViewall">It is also important to emphasize the importance of the PBL as a biological material to be used for screening expression studies&#46; The PBL are easily available from blood sampling&#44; and their gene expression profiles are more reliable compared to liver cancers often containing necrotic tissues&#46;<a class="elsevierStyleCrossRef" href="#bib0220">44</a></p></span><span id="s0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0060">Conclusion</span><p id="p0150" class="elsevierStylePara elsevierViewall">In conclusion&#44; we observed increased <span class="elsevierStyleItalic">BLVRA</span> mRNA level in the liver as well as in PBL in HCC patients&#44; which seems to be a feedback mechanism to control increased oxidative stress associated with HCC progression&#44; as evidenced by increased <span class="elsevierStyleItalic">NOX2</span> mRNA levels in PBL of these patients&#46; We were not able to assess either the BLVRA protein levels or BLVRA enzyme activities in our biological samples&#59; thus further studies aimed to deeper analyze BLVRA as a possible therapeutic target are certainly needed&#46;</p></span><span id="s0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0065">Abbreviations</span><p id="p0155" class="elsevierStylePara elsevierViewall"><ul class="elsevierStyleList" id="l0005"><li class="elsevierStyleListItem" id="u0005"><span class="elsevierStyleLabel">&#8226;</span><p id="p0160" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">AFP&#58;</span> a1-fetoprotein&#46;</p></li><li class="elsevierStyleListItem" id="u0010"><span class="elsevierStyleLabel">&#8226;</span><p id="p0165" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ALD&#58;</span> alcoholic liver disease&#46;</p></li><li class="elsevierStyleListItem" id="u0015"><span class="elsevierStyleLabel">&#8226;</span><p id="p0170" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ALT&#58;</span> alanine aminotransferase&#46;</p></li><li class="elsevierStyleListItem" id="u0020"><span class="elsevierStyleLabel">&#8226;</span><p id="p0175" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">AST&#58;</span> aspartate aminotransferase&#46;</p></li><li class="elsevierStyleListItem" id="u0025"><span class="elsevierStyleLabel">&#8226;</span><p id="p0180" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ALP&#58;</span> alkaline phosphatase&#46;</p></li><li class="elsevierStyleListItem" id="u0030"><span class="elsevierStyleLabel">&#8226;</span><p id="p0185" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">BLVR&#58;</span> biliverdin reductase&#46;</p></li><li class="elsevierStyleListItem" id="u0035"><span class="elsevierStyleLabel">&#8226;</span><p id="p0190" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">BLVRA&#58;</span> biliverdin reductase A&#46;</p></li><li class="elsevierStyleListItem" id="u0040"><span class="elsevierStyleLabel">&#8226;</span><p id="p0195" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">BLVRB&#58;</span> biliverdin reductase B&#46;</p></li><li class="elsevierStyleListItem" id="u0045"><span class="elsevierStyleLabel">&#8226;</span><p id="p0200" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">GGT&#58;</span> gamma glutamyl transpeptidase&#46;</p></li><li class="elsevierStyleListItem" id="u0050"><span class="elsevierStyleLabel">&#8226;</span><p id="p0205" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HBV&#58;</span> viral hepatitis B&#46;</p></li><li class="elsevierStyleListItem" id="u0055"><span class="elsevierStyleLabel">&#8226;</span><p id="p0210" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HCC&#58;</span> hepatocellular carcinoma&#46;</p></li><li class="elsevierStyleListItem" id="u0060"><span class="elsevierStyleLabel">&#8226;</span><p id="p0215" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HCV&#58;</span> viral hepatitis C&#46;</p></li><li class="elsevierStyleListItem" id="u0065"><span class="elsevierStyleLabel">&#8226;</span><p id="p0220" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HMOX1&#58;</span> heme oxygenase 1&#46;</p></li><li class="elsevierStyleListItem" id="u0070"><span class="elsevierStyleLabel">&#8226;</span><p id="p0225" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">HPRT&#58;</span> hypoxanthine phosphoribosyl transferase&#46;</p></li><li class="elsevierStyleListItem" id="u0075"><span class="elsevierStyleLabel">&#8226;</span><p id="p0230" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">INR&#58;</span> international normalized ratio of prothrombin time&#46;</p></li><li class="elsevierStyleListItem" id="u0080"><span class="elsevierStyleLabel">&#8226;</span><p id="p0235" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NASH&#58;</span> non-alcoholic steatohepatitis&#46;</p></li><li class="elsevierStyleListItem" id="u0085"><span class="elsevierStyleLabel">&#8226;</span><p id="p0240" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">NOX2&#58;</span> NADPH oxidase 2&#46;</p></li><li class="elsevierStyleListItem" id="u0090"><span class="elsevierStyleLabel">&#8226;</span><p id="p0245" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">PBL&#58;</span> peripheral blood leukocytes&#46;</p></li><li class="elsevierStyleListItem" id="u0095"><span class="elsevierStyleLabel">&#8226;</span><p id="p0250" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">RONS&#58;</span> reactive nitrogen species&#46;</p></li><li class="elsevierStyleListItem" id="u0100"><span class="elsevierStyleLabel">&#8226;</span><p id="p0255" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">ROS&#58;</span> reactive oxygen species&#46;</p></li><li class="elsevierStyleListItem" id="u0105"><span class="elsevierStyleLabel">&#8226;</span><p id="p0260" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleBold">TGF&#58;</span> transforming growth factor&#46;</p></li></ul></p></span><span id="s0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="st0070">Acknowledgements</span><p id="p0265" class="elsevierStylePara elsevierViewall">This work was supported by grant IGA MZ NT 13092-4&#47;2012 from the Czech Ministry of Health&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:3 [
          "identificador" => "xres1207318"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abs0010"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1124364"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "s0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "s0010"
          "titulo" => "Material and Methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "s0015"
              "titulo" => "Subjects"
            ]
            1 => array:2 [
              "identificador" => "s0020"
              "titulo" => "Material sampling and storage"
            ]
            2 => array:2 [
              "identificador" => "s0025"
              "titulo" => "Total RNA isolation and reverse transcription"
            ]
            3 => array:2 [
              "identificador" => "s0030"
              "titulo" => "Gene expression quantification"
            ]
            4 => array:2 [
              "identificador" => "s0035"
              "titulo" => "Serum biochemistry"
            ]
            5 => array:2 [
              "identificador" => "s0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "s0045"
          "titulo" => "Results and Discussion"
        ]
        5 => array:2 [
          "identificador" => "s0050"
          "titulo" => "Conclusion"
        ]
        6 => array:2 [
          "identificador" => "s0055"
          "titulo" => "Abbreviations"
        ]
        7 => array:2 [
          "identificador" => "s0060"
          "titulo" => "Acknowledgements"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2016-03-22"
    "fechaAceptado" => "2016-04-13"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1124364"
          "palabras" => array:5 [
            0 => "Biliverdin reductase"
            1 => "Heme catabolic pathway"
            2 => "Heme oxygenase"
            3 => "Liver cirrhosis"
            4 => "Oxidative stress"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abs0010" class="elsevierStyleSection elsevierViewall"><p id="sp0025" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">Introduction and aim&#46;</span> Hepatocellular carcinoma &#40;HCC&#41; is the most common primary malignant liver tumor&#46; It is primarily caused by hepatic cirrhosis or chronic viral hepatitis&#46; Hepatic carcinogenesis is associated with increased oxidative stress&#46; Thus&#44; the aim of our study was to assess expression of the genes involved in the homeostasis of oxidative stress in patients with HCC&#46;</p><p id="sp0030" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">Material and methods&#46;</span> The study was performed on 32 patients with primary HCC &#40;verified by liver histology in 29 patients&#41; and 27 control subjects &#40;in 11 subjects&#44; liver histology was available either with no or minimal changes in the liver tissue&#41;&#46; Gene expressions of heme oxygenase 1 <span class="elsevierStyleItalic">&#40;HMOX1&#41;</span>&#44; biliverdin reductase A&#47;B <span class="elsevierStyleItalic">&#40;BLVRA&#47;B&#41;</span>&#44; NADPH oxidase 2 <span class="elsevierStyleItalic">&#40;NOX2&#41;</span>and <span class="elsevierStyleItalic">p22<span class="elsevierStyleSup">phox</span></span> were analyzed in the liver and peripheral blood leukocytes &#40;PBL&#41; in the subjects&#46;</p><p id="sp0035" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">Results&#46;</span> Compared to controls&#44; almost a 3 times higher mRNA level of <span class="elsevierStyleItalic">BLVRA</span> was detected in livers of HCC patients &#40;p &#61; 0&#46;002&#41;&#59; while those of <span class="elsevierStyleItalic">BLVRB</span> as well as <span class="elsevierStyleItalic">HMOX1 were</span> unchanged &#40;p &#62; 0&#46;05&#41;&#46; In accord with these results in the liver tissue&#44; <span class="elsevierStyleItalic">BLVRA</span> mRNA levels in PBL were also significantly increased in HCC patients &#40;p &#61; 0&#46;012&#41;&#46; mRNA levels of <span class="elsevierStyleItalic">NOX2</span> and <span class="elsevierStyleItalic">p22<span class="elsevierStyleSup">p</span><span class="elsevierStyleSup">hox</span></span> in the liver tissue&#44; although higher in HCC patients&#44; did not differ significantly compared to control subjects &#40;p &#62; 0&#46;05&#41;&#46; Nevertheless&#44; <span class="elsevierStyleItalic">NOX2</span> mRNA level in PBL was significantly higher in HCC patients &#40;p &#61; 0&#46;003&#41;&#46;</p><p id="sp0040" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">Conclusions&#46;</span><span class="elsevierStyleItalic">BLVRA</span> mRNA levels in the liver as well as in PBL are significantly higher in HCC patients most likely as a feedback mechanism to control increased oxidative stress associated with HCC progression&#46;</p></span>"
      ]
    ]
    "multimedia" => array:4 [
      0 => array:7 [
        "identificador" => "f0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 385
            "Ancho" => 704
            "Tamanyo" => 43881
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">mRNA levels of selected genes in the liver of HCC patients&#46;</span> HMOX1 <span class="elsevierStyleItalic">&#58; heme oxygenase 1&#46;</span> BLVRA&#58; <span class="elsevierStyleItalic">biliverdin reductase A&#46;</span> BLVRB&#58; <span class="elsevierStyleItalic">biliverdin reductase B&#46; p22&#58; gene encoding for p22 <span class="elsevierStyleSup">phox</span> protein</span>&#44; NOX2&#58; <span class="elsevierStyleItalic">NADPH oxidase 2&#46;</span></p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "t0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="np0005" class="elsevierStyleSimplePara elsevierViewall">HMOX1&#59; <span class="elsevierStyleItalic">heme oxygenase 1&#46;</span> BLVRA&#59; <span class="elsevierStyleItalic">biliverdin reductase A&#46;</span> BLVRB&#59; <span class="elsevierStyleItalic">biliverdin reductase B&#46;</span> NOX2&#58; <span class="elsevierStyleItalic">NADPH oxidase 2&#46;</span> HPRT&#58; <span class="elsevierStyleItalic">hypoxanthine phosphoribosyl transferase&#46;</span></p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Fragment &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HMOX1</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGGTGATAGAAGAGGCCAAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTTGAGGAGTTGCAGGAGCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">BLVRA</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCCCTCTTTGGGGAGCTTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGACCCAGACTTGAAATGGAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">180&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">BLVRB</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCACGTGGTAGTGGGAGATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCGTGGGACTGAGGTCATTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">110&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">p22<span class="elsevierStyleSup">p</span><span class="elsevierStyleSup">hox</span></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTCACCCAGTGGTACTTTGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCGGTCATGTACTTCTGTCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">130&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">NOX2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GATTCTCTTGCCAGTCTGTCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATTCCTGTCCAGTTGTCTTCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HPRT</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CACTGGCAAAACAATGCAGAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGGTCCTTTTCACCAGCAAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2060798.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0010" class="elsevierStyleSimplePara elsevierViewall">Primer sequences for target and internal control genes&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "t0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="np0010" class="elsevierStyleSimplePara elsevierViewall">ALT&#44; alanine aminotransferase&#59; AST&#44; aspartate aminotransferase&#59; ALP&#44; alkaline plhosphatase&#59; GGT&#44; gamma glutamyl transpeptidase&#59; INR&#44; international normalized ratio of prothrombin time&#46; Data expressed as mean &#177; standard deviation&#44; or median &#40;IQ range&#41; depending on data normality&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gender &#40;M&#58;F ratio&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">3&#46;83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">69 &#40;61&#46;0 - 74&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total bilirubin &#40;&#181;mol&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&#46;3 &#40;10&#46;8 - 22&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ALT &#40;&#181;kat&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;53 &#40;0&#46;4 - 0&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AST &#40;&#181;kat&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;14 &#40;0&#46;8 - 1&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGT &#40;&#181;kat&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;9 &#40;1&#46;2 - 6&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ALP &#40;&#181;kat&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;3 &#40;1&#46;7 - 4&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Albumin &#40;g&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33&#46;9 &#177; 4&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">INR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;22 &#40;1&#46;1 - 1&#46;32&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Hemoglobin &#40;g&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">121&#46; 1 &#177; 19&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Platelets &#40;&#215; 10<span class="elsevierStyleSup">9</span>&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">203&#46;5 &#177; 94&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2060796.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0015" class="elsevierStyleSimplePara elsevierViewall">Clinical and laboratory characteristics of HCC patients&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "t0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="np0015" class="elsevierStyleSimplePara elsevierViewall">NASH&#58; non-alcoholic steatohepatitis&#46; ALD&#58; alcoholic liver disease&#46; HCV&#58; viral hepatitis C&#46; HBV&#58; viral hepatitis B&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Etiology&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Patients &#40;n&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NASH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ALD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HCV&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NASH&#43;ALD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HBV&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Fibrosis &#40;unknown cause&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Hemochromatosis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2060797.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="sp0020" class="elsevierStyleSimplePara elsevierViewall">Etiology of the HCC&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bs0010"
          "bibliografiaReferencia" => array:44 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1&#46;"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Ferlay J&#44; Shin R&#44; Bray F&#44; al&#46; e&#46; GLOBOCAN 2008 v1&#46;2&#44; Cancer Incidence and Mortality Worldwide&#58; IARC CancerBase No&#46;10&#46; Available at http&#58;&#47;&#47;www&#46;iarc&#46;fr&#47;en&#47;media-centre&#47;iarcnews&#47;2010&#47;globocan2008&#46;php&#46; Access&#58; Feb 15&#44; 2016&#46;"
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Global cancer statistics&#44; 2012"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Torre L&#46;A&#46;"
                            1 => "Bray F&#46;"
                            2 => "Siegel R&#46;L&#46;"
                            3 => "Ferlay J&#46;"
                            4 => "Lortet-Tieulent J&#46;"
                            5 => "Jemal A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3322/caac.21262"
                      "Revista" => array:6 [
                        "tituloSerie" => "CA Cancer J Clin"
                        "fecha" => "2015"
                        "volumen" => "65"
                        "paginaInicial" => "87"
                        "paginaFinal" => "108"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25651787"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology of hepatocellular carcinoma in sub-Saharan Africa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Kew M&#46;C&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Hepatol"
                        "fecha" => "2013"
                        "volumen" => "12"
                        "paginaInicial" => "173"
                        "paginaFinal" => "182"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23396727"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Updated treatment approach to hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Llovet J&#46;M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00535-005-1566-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Gastroenterol"
                        "fecha" => "2005"
                        "volumen" => "40"
                        "paginaInicial" => "225"
                        "paginaFinal" => "235"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15830281"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Perz J&#46;F&#46;"
                            1 => "Armstrong G&#46;L&#46;"
                            2 => "Farrington L&#46;A&#46;"
                            3 => "Hutin Y&#46;J&#46;"
                            4 => "Bell B&#46;P&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2006.05.013"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2006"
                        "volumen" => "45"
                        "paginaInicial" => "529"
                        "paginaFinal" => "538"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16879891"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Obesity and hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Caldwell S&#46;H&#46;"
                            1 => "Crespo D&#46;M&#46;"
                            2 => "Kang H&#46;S&#46;"
                            3 => "Al-Osaimi A&#46;M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "2004"
                        "volumen" => "127"
                        "paginaInicial" => "S97"
                        "paginaFinal" => "S103"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15508109"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Design and endpoints of clinical trials in hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Llovet J&#46;M&#46;"
                            1 => "Di Bisceglie A&#46;M&#46;"
                            2 => "Bruix J&#46;"
                            3 => "Kramer B&#46;S&#46;"
                            4 => "Lencioni R&#46;"
                            5 => "Zhu A&#46;X&#46;"
                            6 => "Sherman M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jnci/djn134"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Natl Cancer Inst"
                        "fecha" => "2008"
                        "volumen" => "100"
                        "paginaInicial" => "698"
                        "paginaFinal" => "711"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18477802"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of hepatocellular carcinoma&#58; an update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Bruix J&#46;"
                            1 => "Sherman M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/hep.24199"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hepatology"
                        "fecha" => "2011"
                        "volumen" => "53"
                        "paginaInicial" => "1020"
                        "paginaFinal" => "1022"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21374666"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Meta-analysis&#58; surveillance with ultrasound for early-stage hepatocellular carcinoma in patients with cirrhosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "Singal A&#46;"
                            1 => "Volk M&#46;L&#46;"
                            2 => "Waljee A&#46;"
                            3 => "Salgia R&#46;"
                            4 => "Higgins P&#46;"
                            5 => "Rogers M&#46;A&#46;"
                            6 => "Marrero J&#46;A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2036.2009.04014.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Aliment Pharmacol Ther"
                        "fecha" => "2009"
                        "volumen" => "30"
                        "paginaInicial" => "37"
                        "paginaFinal" => "47"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19392863"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serological surveillance for hepatocellular carcinoma&#58; time to quit"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Sherman M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2009.11.026"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2010"
                        "volumen" => "52"
                        "paginaInicial" => "614"
                        "paginaFinal" => "615"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20185193"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Screening for cancer in viral hepatitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Colombo M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Liver Dis"
                        "fecha" => "2001"
                        "volumen" => "5"
                        "paginaInicial" => "109"
                        "paginaFinal" => "122"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11218910"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Glypican-3&#58; a novel serum and histochemical marker for hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "Capurro M&#46;"
                            1 => "Wanless I&#46;R&#46;"
                            2 => "Sherman M&#46;"
                            3 => "Deboer G&#46;"
                            4 => "Shi W&#46;"
                            5 => "Miyoshi E&#46;"
                            6 => "Filmus J&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "2003"
                        "volumen" => "125"
                        "paginaInicial" => "89"
                        "paginaFinal" => "97"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12851874"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in American patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "Marrero J&#46;A&#46;"
                            1 => "Su G&#46;L&#46;"
                            2 => "Wei W&#46;"
                            3 => "Emick D&#46;"
                            4 => "Conjeevaram H&#46;S&#46;"
                            5 => "Fontana R&#46;J&#46;"
                            6 => "Lok A&#46;S&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1053/jhep.2003.50195"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hepatology"
                        "fecha" => "2003"
                        "volumen" => "37"
                        "paginaInicial" => "1114"
                        "paginaFinal" => "1121"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12717392"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structure and regulation of the neutrophil respiratory burst oxidase&#58; comparison with non-phagocyte oxidases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Quinn M&#46;T&#46;"
                            1 => "Gauss K&#46;A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1189/jlb.0404216"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Leukoc Biol"
                        "fecha" => "2004"
                        "volumen" => "76"
                        "paginaInicial" => "760"
                        "paginaFinal" => "781"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15240752"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Involvement of NADPH oxidase-mediated generation of reactive oxygen species in the apototic cell death by capsaicin in HepG2 human hepatoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Lee Y&#46;S&#46;"
                            1 => "Kang Y&#46;S&#46;"
                            2 => "Lee J&#46;S&#46;"
                            3 => "Nicolova S&#46;"
                            4 => "Kim J&#46;A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Radic Res"
                        "fecha" => "2004"
                        "volumen" => "38"
                        "paginaInicial" => "405"
                        "paginaFinal" => "412"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15190937"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The NOX family of ROS-generating NADPH oxidases&#58; physiology and pathophysiology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Bedard K&#46;"
                            1 => "Krause K&#46;H&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/physrev.00044.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Physiol Rev"
                        "fecha" => "2007"
                        "volumen" => "87"
                        "paginaInicial" => "245"
                        "paginaFinal" => "313"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17237347"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Heme oxygenase-1&#47;carbon monoxide&#58; from basic science to therapeutic applications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Ryter S&#46;W&#46;"
                            1 => "Alam J&#46;"
                            2 => "Choi A&#46;M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/physrev.00011.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Physiol Rev"
                        "fecha" => "2006"
                        "volumen" => "86"
                        "paginaInicial" => "583"
                        "paginaFinal" => "650"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16601269"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Heme oxygenase-1 in tumor biology and therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Was H&#46;"
                            1 => "Dulak J&#46;"
                            2 => "Jozkowicz A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Drug Targets"
                        "fecha" => "2010"
                        "volumen" => "11"
                        "paginaInicial" => "1551"
                        "paginaFinal" => "1570"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20704546"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The heme catabolic pathway and its protective effects on oxidative stress-mediated diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Vitek L&#46;"
                            1 => "Schwertner H&#46;A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Adv Clin Chem"
                        "fecha" => "2007"
                        "volumen" => "43"
                        "paginaInicial" => "1"
                        "paginaFinal" => "57"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17249379"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Initial-rate kinetics of the flavin reductase reaction catalysed by human biliverdin-IX-beta reductase &#40;BVR-B&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Cunningham O&#46;"
                            1 => "Gore M&#46;G&#46;"
                            2 => "Mantle T&#46;J&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "2000"
                        "volumen" => "345"
                        "numero" => "Pt&#46; 2"
                        "paginaInicial" => "393"
                        "paginaFinal" => "399"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10620517"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biliverdin reductase isozymes in metabolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "O&#8217;Brien L&#46;"
                            1 => "Hosick P&#46;A&#46;"
                            2 => "John K&#46;"
                            3 => "Stec D&#46;E&#46;"
                            4 => "Hinds T&#46;D&#46; Jr"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.tem.2015.02.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Trends Endocrinol Metab"
                        "fecha" => "2015"
                        "volumen" => "26"
                        "paginaInicial" => "212"
                        "paginaFinal" => "220"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25726384"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human biliverdin reductase&#58; a member of the insulin receptor substrate family with serine&#47;threonine&#47;tyrosine kinase activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Lerner-Marmarosh N&#46;"
                            1 => "Shen J&#46;"
                            2 => "Torno M&#46;D&#46;"
                            3 => "Kravets A&#46;"
                            4 => "Hu Z&#46;"
                            5 => "Maines M&#46;D&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.0502173102"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2005"
                        "volumen" => "102"
                        "paginaInicial" => "7109"
                        "paginaFinal" => "7114"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15870194"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cell surface biliverdin reductase mediates biliverdin-induced anti-inflammatory effects via phosphatidylinositol 3-kinase and Akt"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Wegiel B&#46;"
                            1 => "Baty C&#46;J&#46;"
                            2 => "Gallo D&#46;"
                            3 => "Csizmadia E&#46;"
                            4 => "Scott J&#46;R&#46;"
                            5 => "Akhavan A&#46;"
                            6 => "Chin B&#46;Y&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M109.027433"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2009"
                        "volumen" => "284"
                        "paginaInicial" => "21369"
                        "paginaFinal" => "21378"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19509285"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biliverdin reductase&#58; a target for cancer therapy&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Gibbs P&#46;E&#46;"
                            1 => "Miralem T&#46;"
                            2 => "Maines M&#46;D&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fphar.2015.00119"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Pharmacol"
                        "fecha" => "2015"
                        "volumen" => "6"
                        "paginaInicial" => "119"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26089799"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression of biliverdin reductase A in peripheral blood leukocytes is associated with treatment response in HCV-infected patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Subhanova I&#46;"
                            1 => "Muchova L&#46;"
                            2 => "Lenicek M&#46;"
                            3 => "Vreman H&#46;J&#46;"
                            4 => "Luksan O&#46;"
                            5 => "Kubickova K&#46;"
                            6 => "Kreidlova M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0057555"
                      "Revista" => array:6 [
                        "tituloSerie" => "PloS One"
                        "fecha" => "2013"
                        "volumen" => "8"
                        "paginaInicial" => "e57555"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23536765"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1878875016311809"
                          "estado" => "S300"
                          "issn" => "18788750"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress and hepatic Nox proteins in chronic hepatitis C and hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Choi J&#46;"
                            1 => "Corder N&#46;L&#46;"
                            2 => "Koduru B&#46;"
                            3 => "Wang Y&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.freeradbiomed.2014.04.020"
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Radic Biol Med"
                        "fecha" => "2014"
                        "volumen" => "72"
                        "paginaInicial" => "267"
                        "paginaFinal" => "284"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24816297"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Elchuri S&#46;"
                            1 => "Oberley T&#46;D&#46;"
                            2 => "Qi W&#46;"
                            3 => "Eisenstein R&#46;S&#46;"
                            4 => "Jackson Roberts L&#46;"
                            5 => "Van Remmen H&#46;"
                            6 => "Epstein C&#46;J&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.onc.1208207"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "2005"
                        "volumen" => "24"
                        "paginaInicial" => "367"
                        "paginaFinal" => "380"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15531919"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of oxidative stress in hepatocar-cinogenesis induced by hepatitis C virus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "Tsukiyama-Kohara K&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ijms131115271"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Sci"
                        "fecha" => "2012"
                        "volumen" => "13"
                        "paginaInicial" => "15271"
                        "paginaFinal" => "15278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23203124"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cross-Talk Between TGF-beta and NADPH Oxidases During Liver Fibrosis and Hepatocarcinogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Crosas-Molist E&#46;"
                            1 => "Bertran E&#46;"
                            2 => "Fabregat I&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Pharm Des"
                        "fecha" => "2015"
                        "volumen" => "21"
                        "paginaInicial" => "5964"
                        "paginaFinal" => "5976"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26510436"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatitis C virus induces oxidative stress&#44; DNA damage and modulates the DNA repair enzyme NEIL1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Pal S&#46;"
                            1 => "Polyak S&#46;J&#46;"
                            2 => "Bano N&#46;"
                            3 => "Qiu W&#46;C&#46;"
                            4 => "Carithers R&#46;L&#46;"
                            5 => "Shuhart M&#46;"
                            6 => "Gretch D&#46;R&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1440-1746.2009.06128.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Gastroenterol Hepatol"
                        "fecha" => "2010"
                        "volumen" => "25"
                        "paginaInicial" => "627"
                        "paginaFinal" => "634"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20074151"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bilirubin decreases nos2 expression via inhibition of NAD&#40;P&#41;H oxidase&#58; implications for protection against endotoxic shock in rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Lanone S&#46;"
                            1 => "Bloc S&#46;"
                            2 => "Foresti R&#46;"
                            3 => "Almolki A&#46;"
                            4 => "Taille C&#46;"
                            5 => "Callebert J&#46;"
                            6 => "Conti M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.04-2368fje"
                      "Revista" => array:6 [
                        "tituloSerie" => "FASEB J"
                        "fecha" => "2005"
                        "volumen" => "19"
                        "paginaInicial" => "1890"
                        "paginaFinal" => "1892"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16129699"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bilirubin and biliverdin protect rodents against diabetic nephropathy by downregulating NAD&#40;P&#41;H oxidase"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:7 [
                            0 => "Fujii M&#46;"
                            1 => "Inoguchi T&#46;"
                            2 => "Sasaki S&#46;"
                            3 => "Maeda Y&#46;"
                            4 => "Zheng J&#46;"
                            5 => "Kobayashi K&#46;"
                            6 => "Takayanagi R&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ki.2010.265"
                      "Revista" => array:7 [
                        "tituloSerie" => "Kidney Int"
                        "fecha" => "2010"
                        "volumen" => "78"
                        "paginaInicial" => "905"
                        "paginaFinal" => "919"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20686447"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0303846714002285"
                          "estado" => "S300"
                          "issn" => "03038467"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inhibition of heme oxygenase-1 increases responsiveness of pancreatic cancer cells to anticancer treatment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Berberat P&#46;O&#46;"
                            1 => "Dambrauskas Z&#46;"
                            2 => "Gulbinas A&#46;"
                            3 => "Giese T&#46;"
                            4 => "Giese N&#46;"
                            5 => "Kunzli B&#46;"
                            6 => "Autschbach F&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1158/1078-0432.CCR-04-2159"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Cancer Res"
                        "fecha" => "2005"
                        "volumen" => "11"
                        "paginaInicial" => "3790"
                        "paginaFinal" => "3798"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15897578"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of heme oxygenase-1 promoter polymorphisms in human disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Exner M&#46;"
                            1 => "Minar E&#46;"
                            2 => "Wagner O&#46;"
                            3 => "Schillinger M&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.freeradbiomed.2004.07.008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Rad Biol Med"
                        "fecha" => "2004"
                        "volumen" => "37"
                        "paginaInicial" => "1097"
                        "paginaFinal" => "1104"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15451051"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immunohistochemical analysis of heme oxygenase-1 in preneoplastic and neoplastic lesions during chemical hepatocarcinogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Caballero F&#46;"
                            1 => "Meiss R&#46;"
                            2 => "Gimenez A&#46;"
                            3 => "Batlle A&#46;"
                            4 => "Vazquez E&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.0959-9673.2004.00391.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Exp Pathol"
                        "fecha" => "2004"
                        "volumen" => "85"
                        "paginaInicial" => "213"
                        "paginaFinal" => "221"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15312126"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular signatures associated with HCV-induced hepatocellular carcinoma and liver metastasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "De Giorgi V&#46;"
                            1 => "Buonaguro L&#46;"
                            2 => "Worschech A&#46;"
                            3 => "Tornesello M&#46;L&#46;"
                            4 => "Izzo F&#46;"
                            5 => "Marincola F&#46;M&#46;"
                            6 => "Wang E&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0056153"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2013"
                        "volumen" => "8"
                        "paginaInicial" => "e56153"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23441164"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "37&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The heme oxygenase&#47;biliverdin reductase system in skin cancers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Arena V&#46;"
                            1 => "Pennacchia I&#46;"
                            2 => "Guerriero G&#46;"
                            3 => "Mancuso C&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Regul Homeost Agents"
                        "fecha" => "2015"
                        "volumen" => "29"
                        "paginaInicial" => "259"
                        "paginaFinal" => "264"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25864768"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "38&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The oxidoreductase&#44; biliverdin reductase&#44; is induced in human renal carcinoma-pH and cofactor-specific increase in activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Maines M&#46;D&#46;"
                            1 => "Mayer R&#46;D&#46;"
                            2 => "Erturk E&#46;"
                            3 => "Huang T&#46;J&#46;"
                            4 => "Disantagnese A&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Urol"
                        "fecha" => "1999"
                        "volumen" => "162"
                        "paginaInicial" => "1467"
                        "paginaFinal" => "1472"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10492239"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "39&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Differential tissue-specific protein markers of vaginal carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Hellman K&#46;"
                            1 => "Alaiya A&#46;A&#46;"
                            2 => "Becker S&#46;"
                            3 => "Lomnytska M&#46;"
                            4 => "Schedvins K&#46;"
                            5 => "Steinberg W&#46;"
                            6 => "Hellstrom A&#46;C&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bjc.6604975"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Cancer"
                        "fecha" => "2009"
                        "volumen" => "100"
                        "paginaInicial" => "1303"
                        "paginaFinal" => "1314"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19367286"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "40&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of specific protein markers in microdissected hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:7 [
                            0 => "Melle C&#46;"
                            1 => "Ernst G&#46;"
                            2 => "Scheibner O&#46;"
                            3 => "Kaufmann R&#46;"
                            4 => "Schimmel B&#46;"
                            5 => "Bleul A&#46;"
                            6 => "Settmacher U&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1021/pr060439b"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Proteome Res"
                        "fecha" => "2007"
                        "volumen" => "6"
                        "paginaInicial" => "306"
                        "paginaFinal" => "315"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17203974"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "41&#46;"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Huan L&#44; Bao C&#44; Chen D&#44; Li Y&#44; Lian J&#44; Ding J&#44; Huang S&#44; et al&#46; MiR-127-5p targets the biliverdin reductase B&#47;NF-kappaB pathway to suppress cell growth in hepatocellular carcinoma cells&#46; <span class="elsevierStyleItalic">Cancer Sei</span> 2016&#59; 10&#46;1111&#47;cas&#46;12869&#46;"
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "42&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biliverdin reductase A in the prevention of cellular senescence against oxidative stress"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Kim S&#46;Y&#46;"
                            1 => "Kang H&#46;T&#46;"
                            2 => "Choi H&#46;R&#46;"
                            3 => "Park S&#46;C&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3858/emm.2011.43.1.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Mol Med"
                        "fecha" => "2011"
                        "volumen" => "43"
                        "paginaInicial" => "15"
                        "paginaFinal" => "23"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21099244"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "43&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Small interference RNA-mediated gene silencing of human biliverdin reductase&#44; but not that of heme oxygenase-1&#44; attenuates arsenite-mediated induction of the oxygenase and increases apoptosis in 293A kidney cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Miralem T&#46;"
                            1 => "Hu Z&#46;B&#46;"
                            2 => "Torno M&#46;D&#46;"
                            3 => "Lelli K&#46;M&#46;"
                            4 => "Maines M&#46;D&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2005"
                        "volumen" => "280"
                        "paginaInicial" => "17084"
                        "paginaFinal" => "17092"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "44&#46;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biliverdin reductase plays a crucial role in hypoxia-induced chemoresistance in human glioblastoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Kim S&#46;S&#46;"
                            1 => "Seong S&#46;"
                            2 => "Lim S&#46;H&#46;"
                            3 => "Kim S&#46;Y&#46;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2013.09.120"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2013"
                        "volumen" => "440"
                        "paginaInicial" => "658"
                        "paginaFinal" => "663"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24113378"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/16652681/0000001500000006/v1_201906150956/S1665268119311147/v1_201906150956/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "77721"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/16652681/0000001500000006/v1_201906150956/S1665268119311147/v1_201906150956/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268119311147?idApp=UINPBA00004N"
]

Article information

ISSN: 16652681
Original language: English

DOI:10.5604/16652681.1222104

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	10	1	11
2024 October	27	4	31
2024 September	12	8	20
2024 August	13	8	21
2024 July	24	6	30
2024 June	17	5	22
2024 May	43	4	47
2024 April	15	7	22
2024 March	11	0	11
2024 February	9	6	15
2024 January	13	8	21
2023 December	10	7	17
2023 November	9	6	15
2023 October	11	7	18
2023 September	6	2	8
2023 August	11	1	12
2023 July	5	3	8
2023 June	4	0	4
2023 May	10	0	10
2023 April	6	2	8
2023 March	7	2	9
2023 February	8	1	9
2023 January	8	2	10
2022 December	12	6	18
2022 November	8	5	13
2022 October	12	6	18
2022 September	14	4	18
2022 August	6	6	12
2022 July	9	9	18
2022 June	9	4	13
2022 May	10	9	19
2022 April	14	7	21
2022 March	8	8	16
2022 February	7	5	12
2022 January	14	5	19
2021 December	11	6	17
2021 November	10	6	16
2021 October	14	11	25
2021 September	6	7	13
2021 August	5	4	9
2021 July	9	12	21
2021 June	8	5	13
2021 May	6	10	16
2021 April	18	8	26
2021 March	43	6	49
2021 February	9	8	17
2021 January	7	11	18
2020 December	7	5	12
2020 November	3	10	13
2020 October	8	4	12
2020 September	8	8	16
2020 August	18	10	28
2020 July	3	6	9
2020 June	2	7	9
2020 May	4	3	7
2020 April	4	2	6
2020 March	4	3	7
2020 February	7	5	12
2020 January	5	2	7
2019 December	6	4	10
2019 November	5	3	8
2019 October	2	3	5
2019 September	1	2	3
2019 August	1	3	4
2019 July	2	15	17
2019 June	1	6	7

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter