Circ_0078710 promotes the development of liver cancer by upregulating TXNDC5 via miR-431-5p

array:23 ["pii" => "S1665268121002507" "issn" => "16652681" "doi" => "10.1016/j.aohep.2021.100551" "estado" => "S300" "fechaPublicacion" => "2022-01-01" "aid" => "100551" "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1665268121002453" "issn" => "16652681" "doi" => "10.1016/j.aohep.2021.100546" "estado" => "S300" "fechaPublicacion" => "2022-01-01" "aid" => "100546" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:10 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Clinical features and treatment outcomes of primary biliary cholangitis in a highly admixed population" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Guilherme Grossi Lopes Cançado, Michelle Harriz Braga, Maria Lúcia Gomes Ferraz, Cristiane Alves Villela-Nogueira, Debora Raquel Benedita Terrabuio, Eduardo Luiz Rachid Cançado, Mateus Jorge Nardelli, Luciana Costa Faria, Nathalia Mota de Faria Gomes, Elze Maria Gomes de Oliveira, Vivian Rotman, Maria Beatriz de Oliveira, Simone Muniz Carvalho Fernandes da Cunha, Daniel Ferraz de Campos Mazo, Liliana Sampaio Costa Mendes, Claudia Alexandra Pontes Ivantes, Liana Codes, Valéria Ferreira de Almeida e Borges, Fabio Heleno de Lima Pace, Mario Guimarães Pessoa, Izabelle Venturini Signorelli, Gabriela Perdomo Coral, Paulo Lisboa Bittencourt, Cynthia Levy, Cláudia Alves Couto" "autores" => array:26 [ 0 => array:2 [ "nombre" => "Guilherme Grossi Lopes" "apellidos" => "Cançado" ] 1 => array:2 [ "nombre" => "Michelle Harriz" "apellidos" => "Braga" ] 2 => array:2 [ "nombre" => "Maria Lúcia Gomes" "apellidos" => "Ferraz" ] 3 => array:2 [ "nombre" => "Cristiane Alves" "apellidos" => "Villela-Nogueira" ] 4 => array:2 [ "nombre" => "Debora Raquel Benedita" "apellidos" => "Terrabuio" ] 5 => array:2 [ "nombre" => "Eduardo Luiz Rachid" "apellidos" => "Cançado" ] 6 => array:2 [ "nombre" => "Mateus Jorge" "apellidos" => "Nardelli" ] 7 => array:2 [ "nombre" => "Luciana Costa" "apellidos" => "Faria" ] 8 => array:2 [ "nombre" => "Nathalia Mota de Faria" "apellidos" => "Gomes" ] 9 => array:2 [ "nombre" => "Elze Maria Gomes" "apellidos" => "de Oliveira" ] 10 => array:2 [ "nombre" => "Vivian" "apellidos" => "Rotman" ] 11 => array:2 [ "nombre" => "Maria Beatriz" "apellidos" => "de Oliveira" ] 12 => array:2 [ "nombre" => "Simone Muniz Carvalho Fernandes" "apellidos" => "da Cunha" ] 13 => array:2 [ "nombre" => "Daniel Ferraz de Campos" "apellidos" => "Mazo" ] 14 => array:2 [ "nombre" => "Liliana Sampaio Costa" "apellidos" => "Mendes" ] 15 => array:2 [ "nombre" => "Claudia Alexandra Pontes" "apellidos" => "Ivantes" ] 16 => array:2 [ "nombre" => "Liana" "apellidos" => "Codes" ] 17 => array:2 [ "nombre" => "Valéria Ferreira" "apellidos" => "de Almeida e Borges" ] 18 => array:2 [ "nombre" => "Fabio Heleno de Lima" "apellidos" => "Pace" ] 19 => array:2 [ "nombre" => "Mario Guimarães" "apellidos" => "Pessoa" ] 20 => array:2 [ "nombre" => "Izabelle Venturini" "apellidos" => "Signorelli" ] 21 => array:2 [ "nombre" => "Gabriela Perdomo" "apellidos" => "Coral" ] 22 => array:2 [ "nombre" => "Paulo Lisboa" "apellidos" => "Bittencourt" ] 23 => array:2 [ "nombre" => "Cynthia" "apellidos" => "Levy" ] 24 => array:2 [ "nombre" => "Cláudia Alves" "apellidos" => "Couto" ] 25 => array:1 [ "colaborador" => "Members of the Brazilian Cholestasis Study Group Consortium" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002453?idApp=UINPBA00004N" "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002453/v2_202205211521/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1665268121002519" "issn" => "16652681" "doi" => "10.1016/j.aohep.2021.100552" "estado" => "S300" "fechaPublicacion" => "2022-01-01" "aid" => "100552" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Efficacy comparison of optimal treatments for hepatocellular carcinoma patients with portal vein tumor thrombus" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 956 "Ancho" => 2500 "Tamanyo" => 180364 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Overall survival rates for HCC patients with PVTT after liver resection, TACE or sorafenib in the (A) training cohort and (B) internal validation cohort." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Yu Zhang, Jun-Li Wu, Le-Qun Li" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Yu" "apellidos" => "Zhang" ] 1 => array:2 [ "nombre" => "Jun-Li" "apellidos" => "Wu" ] 2 => array:2 [ "nombre" => "Le-Qun" "apellidos" => "Li" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002519?idApp=UINPBA00004N" "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002519/v2_202205211521/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Circ_0078710 promotes the development of liver cancer by upregulating TXNDC5 via miR-431-5p" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Huajun Lu, Lili Gao, Jixiang Lv" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Huajun" "apellidos" => "Lu" ] 1 => array:2 [ "nombre" => "Lili" "apellidos" => "Gao" ] 2 => array:4 [ "nombre" => "Jixiang" "apellidos" => "Lv" "email" => array:1 [ 0 => "lvjixiang1983@126.com" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "cor0001" ] ] ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Department of Hepatobiliary Surgery, Laiyang Central Hospital, Yantai 265200, Shandong Province, China" "identificador" => "aff0001" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0001" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1897 "Ancho" => 3583 "Tamanyo" => 339140 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0078710 and TXNDC5 were up-regulated in liver cancer. (A, B) The expression of circ_0078710 and TXNDC5 in liver cancer tissues (n = 30) were tested by qRT-PCR. (C) Western blot assay detected the expression of TXNDC5 protein. (D) The correlation between circ_0078710 and TXNDC5 expression in liver cancer tissues was analyzed by Pearson's correlation analysis. ***P < 0.001." ] ] ] "textoCompleto" => "1IntroductionLiver cancer, with the second highest mortality among all cancers, is one of the malignant tumors, and is characterized by high metastasis and recurrence rates <a class="elsevierStyleCrossRefs" href="#bib0001">[1–3]</a>. The occurrence of liver cancer is mostly from chronic liver disease transformation, accompanied by liver fibrosis <a class="elsevierStyleCrossRef" href="#bib0004">[4]</a>. Hepatocellular carcinoma (HCC), occupying about 90% of all liver cancer patients, is the most common type of liver cancer <a class="elsevierStyleCrossRef" href="#bib0002">[2]</a>. However, although liver cancer can be intervened with surgery, drugs or chemotherapy, the prognosis is not good. Therefore, it is very necessary to study the molecular mechanism of liver cancer.As a competitive endogenous RNA (ceRNA), Circular RNAs (circRNAs) have been actively studied in tumors in recent years <a class="elsevierStyleCrossRef" href="#bib0005">[5]</a>. It is a kind of non-coding RNA with a unique continuous covalent closed-loop structure, without terminal 5’cap and 3’tail [<a class="elsevierStyleCrossRef" href="#bib0006">6</a>,<a class="elsevierStyleCrossRef" href="#bib0007">7</a>]. Several studies have investigated the relationship between circRNAs and liver cancer. For example, Sun et al. showed in vivo and in vitro that silencing circ_0000105 inhibits metastasis and growth of HCC cells <a class="elsevierStyleCrossRef" href="#bib0008">[8]</a>. Wang et al. showed that circRHOT1/NR2F6 could be used to regulate the occurrence and development of liver cancer <a class="elsevierStyleCrossRef" href="#bib0009">[9]</a>. Xie et al. found that circ_0078710 can intervene in the development of HCC through miR-31 <a class="elsevierStyleCrossRef" href="#bib0010">[10]</a>. Nevertheless, the function of circ_0078710 and miR-431-5p in HCC remains unclear.MicroRNAs (miRNAs), which negatively regulate target genes by interacting with the 3’untranslated region (3’UTR), are also 22-nucleotide non-coding RNAs [<a class="elsevierStyleCrossRef" href="#bib0011">11</a>,<a class="elsevierStyleCrossRef" href="#bib0012">12</a>]. MiRNAs have been shown to negatively regulate circRNAs, and their interaction can be involved in the growth process of various cancer cells [<a class="elsevierStyleCrossRef" href="#bib0013">13</a>,<a class="elsevierStyleCrossRef" href="#bib0014">14</a>]. Recently, a large number of literatures have reported the regulatory impact of miRNA-431-5p (miR-431-5p) in the occurrence and progression of certain cancers (such as HCC). For example, miR-431-5p modulates the effects of circ_0001742 in tongue squamous cell carcinoma cells <a class="elsevierStyleCrossRef" href="#bib0015">[15]</a>. Studies have shown that miR-431-5p is significantly down-regulated in HCC cells, and its elevation impedes the proliferation of HCC cells <a class="elsevierStyleCrossRef" href="#bib0016">[16]</a>. However, the regulatory effect of miR-431-5p and TXNDC5 in liver cancer cells has not been studied.Thioredoxin domain containing 5 (TXNDC5), a member of the protein disulfide isomerase family, is a fibroblast enriched endoplasmic reticulum (ER) protein <a class="elsevierStyleCrossRef" href="#bib0017">[17]</a>. TXNDC5 has been shown to promote the development of many cancers, including HCC. For example, studies have shown that TXNDC5 is significantly upregulated in colorectal cancer tissues <a class="elsevierStyleCrossRef" href="#bib0018">[18]</a>. Zang et al. found that circ_0000517/miR-1261-5p/TXNDC5 axis can regulate the progression of liver cancer <a class="elsevierStyleCrossRef" href="#bib0019">[19]</a>.In this study, we found that circ_0078710 and TXNDC5 were highly expressed in HCC tissues and cells. In addition, we testify to the role of circ_0078710/miR-431-5p/TXNDC5 axis in liver cancer, in order to reveal the function of circ_0078710 in the progression of liver cancer.2Methods2.1Patients and cell linesThirty liver tumor specimens and adjacent normal liver tissues were collected from patients with liver cancer in XXXX. The sample was frozen in liquid nitrogen right away. All samples received any treatment preoperatively. Each patient offered written informed consent and received supervision and guidance from XXXX.Human liver normal cell lines (HHL-5) and human hepatocellular carcinoma cells (HCCLM3, huh7 and Hep3B) were purchased from American Type Culture Collection (ATCC; Manassas, VA, USA), then added 10% (v/v) fetal bovine serum (FBS; GIBCO BRL, Grand Island, NY, USA) and was placed in an incubator containing 5% CO2 at 37°C.2.2Cell transfectionShort interfering RNA (siRNA) targeting circ_0078710 (si-circ_0078710) and its corresponding control group (si-con), miR-431-5p mimics (miR-431-5p), and its negative control (miR-NC), miR-431-5p inhibitor (anti-miR-431-5p) and its matched (anti-miR-NC), TXNDC5 overexpression vector (pcDNA-TXNDC5) and matched control (pcDNA-NC), siRNA targeting TXNDC5 (si-TXNDC5) and its matched control group (si-NC) were synthesized by Ribobio Co., Ltd. (Guangzhou, China), and then transfected into huh7 and Hep3B cells using Lipofectamine 2000 (Promega, Madison, WI, USA).2.3Quantitative real-time polymerase chain reaction (qRT-PCR)Trizol Reagent (Thermo Fisher, Waltham, MA, USA) was used to separate total RNA. Then the total RNA was then reverse transcribed using Reverse Transcription Kit (Thermo Fisher). Then, qRT-PCR was performed for cDNA using SYBR Green qRT-PCR Mix (Takara, Shiga, Japan) according to the manufacturer's protocol. GAPDH or U6 were used as internal reference, and the relative expression was calculated by 2−ΔΔCT. The forward and reverse primers were displayed as below: GAPDH, (F: 5’- GGAGCGAGATCCCTCCAAAAT -3’ and R: 5’- GGCTGTTGTCATACTTCTCATGG -3’); U6, (F: 5’- CTCGCTTCGGCAGCACATATACT -3’ and R: 5’- ACGCTTCACGAATTTGCGTGTC -3’); circ_0078710, (F: 5’- CCCGATGACAGGGACAACTG -3’ and R: 5’- GCGGCTTTATATGCCGCTTC -3’); miR-431-5p, (F: 5’- GCCGAGTGTCTTGCAGGCCGT -3’ and R: 5’- CAGTGCGTGTCGTGGAGT -3’); TXNDC5, (F: 5’- TCACTGAGGGAGTACGTGGA -3’ and R: 5’- AGCAGTGCAGTCTACTTCGG -3’).2.4Western blot analysisThe total protein of liver cancer tissues or cells was separated from using Radioimmunoprecipitation analysis buffer (RIPA; Thermo Fisher). And BCA protein assay kit (Pierce; Rockford, IL, USA) was used to quantify the total protein and loaded into 12% SDS-PAGE. After blocking the membrane with 5% skim milk, anti-β-actin (1:1,000, ab8226, Abcam, Cambridge, MA, USA), anti-TXNDC5 (1:1,000, ab237697, Abcam), anti-Ki-67 (1:2,000, ab15580; Abcam), and anti-bax (1:1,000, ab32503, Abcam) were incubated respectively. Last, Western blot on the membrane was visualized using BeyoECL Plus kit (BeyoTime).2.5Cell counting Kit-8 assayCCK-8 assayed cell viability. Huh7 and Hep3B were seeded into 96-well plates at a density of 1 × 104 cells per well. Add 10 μL CCK-8 solution (Thermo Fisher) to each well and incubate for 2 hours at 0, 24, 48 and 72 h after inoculation. The absorbance at 450 nm was determined using a microplate reader (BioTek, Winooski, Vermont, USA). Three independent replicates were performed for each CCK-8 test group.2.6Flow cytometry assayFlow cytometry (BD Biosciences, San Diego, CA, USA) was used to detect the apoptosis of huh7 and Hep3B incubated with Annexin-FITC and Propidium iodide (PI; BD Biosciences) and the cell cycle of huh7 and Hep3B incubated with 1 mL of PI/TritonX-100 staining solution (containing 0.2 mg RNase A, 20 μg of PI, and 0.1% TritonX-100) at 4°C for 30 min.2.7Transwell assayThe ability of huh7 and Hep3B cells migration and invasion was detected by Transwell. These two difference is that invasion need to be covered with Matrigel in Transwell chambers (Corning, NY, Madison, USA), while migration do not. 5 × 104 cells were added into the upper of Transwell chambers. Meanwhile, the transwell lower chambers was added with fresh culture medium containing 10% FBS. The amount of migrated or invaded cells was counted under a high-powered microscope.2.8Glycolysis analysesGlycolysis was assessed by monitoring lactate production, glucose uptake and ATP level using commercial kits, including Lactate Assay Kit (Sigma-Aldrich, St. Louis, MO, USA), Glucose Uptake Colorimetric Assay Kit (Sigma-Aldrich) and ATP Bioluminescent Assay Kit (Sigma-Aldrich).2.9Dual-luciferase reporter assayThe bioinformatics prediction platform circinteractome (<a href="https://circinteractome.nia.nih.gov/mirna_target_sites.html">https://circinteractome.nia.nih.gov/mirna_target_sites.html</a>) and Starbase (<a href="http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA">http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA</a>) was used to identify the binding sites of between miR-431-5p and circ_0078710 or TXNDC5. The sequences of circ_0078710 or TXNDC5 3’UTR containing presumed miR-431-5p interacting sites were cloned into pGL3-basic vectors (Realgene, Nanjing, China), respectively. Huh7 and Hep3B cells in 48-well plates (8 × 103 cells/well) were transfected with luciferase reporter plasmid in combination with miR-431-5p or control by Lipofectamine 2000 (Promega). The relative luciferase activities were measured by Dual-Luciferase Reporter Assay Kit (GeneCopoeia, Rockville, MD, USA) after transfection 48 h, with Renilla luciferase activity as control.2.10Immunohistochemical (IHC) staining analysisResected tissues were fixed with 4% buffered paraformaldehyde, dehydrated and embedded in paraffin. Paraffin sections (5 μM) were dewaxed and rehydrated for antigen stripping. Then anti-TXNDC5 was placed at 4°C overnight, and matched with the Goat against mouse IgG (1:10,000, ab205719, Abcam) 1 h. Sections were stained with diaminobenzidine (DAB) kit (Beyotime) according to protocol. The positive staining was observed with a light microscope.2.11Animal experimentShort hairpin RNA (shRNA) targeting circ_0078710 (sh-circ_0078710) and sh-con were packaged in lentivirus for circ_0078710 stable knockdown by GENESEED. Balb/c mice (female, 6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Sh-circ_0078710 huh7 cells were injected into 1.5 × 106 cells/mice, and the subcutaneous tumor size was measured at week 1, 2, 3, 4 and 5. Tumor volume was calculated according to the formula: volume =1/2 (length × width2). And the mice were sacrificed after measuring the subcutaneous tumor size at fifth week, and the tumor quality was measured. Then the corresponding experiment was carried out.2.12Statistical analysisGraphPad Prism 7 (GraphPad, San Diego, CA, USA) was utilized for data analysis. Difference comparison between groups were determined using Student's t-test. Pearson's correlation analysis was applied to measure the correlation between two groups. Each experiment was carried out at least three times and the final data were shown as the mean ± standard deviation (SD). Using P<0.05 meant significant difference.3Results3.1Circ_0078710 and TXNDC5 were highly expressed in liver cancerIn order to investigate the role of circ_0078710 and TXNDC5 in liver cancer, we first detected the expression level of circ_0078710 and TXNDC5 in liver cancer tissues by qRT-PCR. As a result, the expression of circ_0078710 and TXNDC5 were significantly increased in liver cancer tissues (n = 30) (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>A and B). Similarly, the expression level of TXNDC5 protein was significantly increased in liver cancer tissues (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>C). Pearson's correlation analysis showed that circ_0078710 was significantly correlated with TXNDC5 and had a positive regulatory relationship (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>D). In addition, circ_0078710 was analyzed on chr6 with a size of 28899 bp using the cancer-specific circRNA database (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>E). To sum up, Circ_0078710 and TXNDC5 were up-regulated in liver cancer.<elsevierMultimedia ident="fig0001"></elsevierMultimedia>3.2Silencing circ_0078710 inhibits the growth of HCC cellsIn order to further explore the role of circ_0078710 in liver cancer, circ_0078710 was knocked down and transfected into different liver cancer cell lines for detection and analysis. As shown in <a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>A, the expression of circ_0078710 was significantly increased in all three different HCC cells. Huh7 and Hep3B cells with the highest expression were selected for subsequent experiments. The transfection efficiency of si-circ_0078710 was detected by qRT-PCR (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>B). Si-circ_0078710 significantly reduced the cell viability of huh7 and Hep3B cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>C and D). Functionally, silencing circ_0078710 significantly enhanced the apoptosis rate of HCC cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>E). Transwell results showed that knockdown of circ_0078710 inhibited the migration and invasion of HCC cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>F and G). In addition, down-regulation of circ_0078710 significantly reduced glucose uptake, lactic acid production, and ATP levels in huh7 and Hep3B cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>H-J). Western blot results showed that knockdown of circ_0078710 significantly decreased the expression of ki-67 and promoted the up-regulation of bax (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>K and L). In general, circ_0078710 knockdown can promote apoptosis and inhibit cell viability of HCC cells.<elsevierMultimedia ident="fig0002"></elsevierMultimedia>3.3Silencing TXNDC5 inhibits the growth of HCC cellsAs shown in <a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>A, the expression of TXNDC5 was significantly increased in all three different HCC cells. In the same way, huh7 and Hep3B cells with the highest expression were selected for subsequent experiments. The transfection efficiency of si-TXNDC5 was detected by Western blot (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>B). Si-TXNDC5 significantly reduced the cell viability of huh7 and Hep3B cells (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>C and D). Functionally, silencing TXNDC5 significantly enhanced the apoptosis rate of HCC cells (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>E). Transwell results showed that si-TXNDC5 inhibited the migration and invasion of HCC cells (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>F and G). In addition, si-TXNDC5 significantly reduced glucose uptake, lactic acid production, and ATP levels in huh7 and Hep3B cells (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>H-J). Western blot results showed that si-TXNDC5 significantly decreased the expression of ki67 and promoted the expression of bax (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>K and L). In general, si-TXNDC5 can inhibit the viability, migration and invasion of HCC cells.<elsevierMultimedia ident="fig0003"></elsevierMultimedia>3.4MiR-431-5p was target of both circ_0078710 and TXNDC5We predicted that miR-431-5p was the target of circ_0078710 and that TXNDC5 was the target gene of miR-431-5p using circinteractome (<a href="https://circinteractome.nia.nih.gov/mirna_target_sites.html">https://circinteractome.nia.nih.gov/mirna_target_sites.html</a>) and starbase (<a href="http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA">http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA</a>) bioinformatics tools, respectively. As shown in <a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>A is the binding site of circ_0078710 and miR-431-5p. Dual-luciferase reporter assay results showed that in huh7 and Hep3B cells, the combined transfection of circ_0078710-WT and miR-431-5p significantly inhibited luciferase activity, while there was no significant change in luciferase activity after the combined transfection of circ_0078710-MUT and miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>B and C). Next, qRT-PCR was used to detect the co-transfection of si-circ_0078710 and anti-miR-431-5p, and the transfection efficiency was verified by detecting the expression level of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>D and E). The binding sites of miR-431-5p and TXNDC5 are shown in <a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>F. Similarly, dual-luciferase reporter assay results showed that in huh7 and Hep3B cells, the combined transfection of TXNDC5 3’UTR-WT and miR-431-5p significantly inhibited luciferase activity, while the combined transfection of TXNDC5 3’UTR-MUT and miR-431-5p showed no significant change in luciferase activity (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>G and H). Finally, the protein expression of TXNDC5 in huh7 and Hep3B cells after co-transfection of si-circ_0078710 and anti-miR-431-5p was detected by Western blot. The results showed that si-circ_0078710 could significantly reduce the protein level of TXNDC5, but this was relatively recovered with the addition of miR-431-5p inhibitor (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>I and J). In general, miR-431-5p is the target of circ_0078710, and TXNDC5 is the target gene of miR-431-5p.<elsevierMultimedia ident="fig0004"></elsevierMultimedia>3.5The miR-431-5p inhibitor recovered the inhibition of cell behavior caused by circ_0078710 knockdownQRT-PCR was used to detect the transfection efficiency by detecting the expression level of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>A and B). The silencing of miR-431-5p eliminated the inhibitory effect on huh7 and Hep3B cells viability induced by si-circ_0078710 (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>C and D). Functionally, the addition of miR-431-5p inhibitor can reduce the up-regulated apoptosis rate due to si-circ_0078710 (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>E and <a class="elsevierStyleCrossRef" href="#fig0005">5</a>F). Meanwhile, the Transwell experiment showed that the addition of anti-miR-431-5p restored the decrease of migration and invasion caused by circ_0078710 knockdown (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>G and H). Moreover, anti-miR-431-5p significantly up-regulate glucose uptake, lactic acid production, and ATP levels in huh7 and Hep3B cells decreased by si-circ_0078710 (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>I – K). Functionally, Western blot analysis showed that anti-miR-495-3p could restore the protein levels of ki67 and bax affected by si-circ_0078710 (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>L and M). In short, miR-431-5p inhibitors can rescue the effect of si-circ_0078710 in HCC cells.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>3.6Overexpression of TXNDC5 recovered the inhibition of cell behavior caused by miR-431-5pThe relationship between miR-431-5p and TXNDC5 was further verified. Firstly, the over-expression efficiency of miR-431-5p was verified by qRT-PCR (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>A). Next, the expression level of TXNDC5 was detected by Western blot to verify the transfection efficiency of co-transfected miR-431-5p and pcDNA-TXNDC5 (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>B and C). Functionally, pcDNA-TXNDC5 eliminated the inhibitory effect on huh7 and Hep3B cells viability induced by overexpression of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>D and E). And the transfected huh7 and Hep3B cells apoptosis rate were rescued by pcDNA-TXNDC5 (<a class="elsevierStyleCrossRef" href="#fig0006">Fig.6</a>F and G). Meanwhile, the Transwell experiment showed that the addition of pcDNA-TXNDC5 restored the decrease of migration and invasion caused by overexpression of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>H and I). Moreover, pcDNA-TXNDC5 significantly up-regulate glucose uptake, lactic acid production, and ATP levels in huh7 and Hep3B cells decreased by overexpression of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>J – L). Functionally, Western blot analysis showed that pcDNA-TXNDC5 could restore the protein levels of ki67 and bax affected by overexpression of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>M and N). In short, pcDNA-TXNDC5 can rescue the effect of overexpression of miR-431-5p in HCC cells.<elsevierMultimedia ident="fig0006"></elsevierMultimedia>3.7Circ_0078710 affects the growth of liver cancer tumor in vivoIn order to better explore the effect of circ_0078710 on liver cancer, we constructed a xenotransplantation model to explore the effect of circ_0078710 knockdown in liver cancer tumor. By recording and observing tumor volume (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>A) and volume weight (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>B), we found that huh7 cells transfected with sh-circ_0078710 could inhibit tumor growth in a transplanted tumor model. Then, the expression of circ_0078710 and miR-431-5p was analyzed by qRT-PCR, and the results showed that knockdown of circ_0078710 could significantly decrease the expression of circ_0078710 and enhance the expression of miR-431-5p (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>C and <a class="elsevierStyleCrossRef" href="#fig0007">7</a>D). And Western blot analysis also confirmed that sh-circ_0078710 remarkably reduced the TXNDC5 protein level (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>E). Lastly, the immunoreactive levels of TXNDC5 were downregulated in tumor tissues from sh-circ_0078710 group compared with sh-con group (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>F). In short, circ_0078710 knockdown reduced the growth of liver cancer tumor.<elsevierMultimedia ident="fig0007"></elsevierMultimedia>4DiscussionLiver cancer is a malignant tumor disease that seriously threatens human health, with high mortality rate and difficult treatment. More and more reports have shown that circRNAs, as a newly discovered endogenous non-coding RNA, play an indispensable role numerous cancers, such as breast cancer <a class="elsevierStyleCrossRef" href="#bib0020">[20]</a>, ovarian cancer <a class="elsevierStyleCrossRef" href="#bib0021">[21]</a>, esophageal cancer <a class="elsevierStyleCrossRef" href="#bib0022">[22]</a> and liver cancer <a class="elsevierStyleCrossRef" href="#bib0009">[9]</a>. However, there are relatively few studies on circ_0078710 in cancer. For instance, circ_0078710 was highly expressed in HCC patients, witch consistent with our study <a class="elsevierStyleCrossRef" href="#bib0010">[10]</a>. And Xie et al. found that abnormal up-regulation of circ_0078710 in HCC cell lines promoted malignant behavior and tumor growth <a class="elsevierStyleCrossRef" href="#bib0010">[10]</a>. Similarly, we found that cell proliferation, migration and invasion ability of huh7 and Hep3B cells could be significantly inhibited and the apoptotic ability of cells was promoted by silencing circ_0078710. In addition, we also found that down-regulation of circ_0078710 inhibited glycolytic metabolism. Animal experiments showed that knocking down circ_0078710 could significantly inhibit tumor growth in nude mice in vivo. These results suggested that circ_0078710 could be a potential therapeutic target for hepatocellular carcinoma.Our mechanistic analysis showed that miR-431-5p was a target of circ_0078710. Previous studies found that the recovery of miR-431-5p eliminated the cancer-promoting effect of ATG3 in colon cancer <a class="elsevierStyleCrossRef" href="#bib0023">[23]</a>. In addition, miR-431-5p was significantly down-regulated in both HCC cells and tissues, and overexpression of miR-431-5p significantly inhibited the activity and metastasis of HCC cells by inhibiting UROC28 gene <a class="elsevierStyleCrossRef" href="#bib0016">[16]</a>. Consistently with the above study results, we found that inhibition of miR-431-5p recovered the prohibitive effects of silencing circ_0078710 on proliferation, migration, invasion and glycolytic metabolism of HCC cells. These showed that miR-431-5p may interact with circ_0078710 to play a role in liver cancer.It is well known that TXNDC5 is an oncogene that is up-regulated in many malignant tumors, such as HCC, castration-resistant prostate cancer, and esophageal squamous cell carcinoma [<a class="elsevierStyleCrossRef" href="#bib0019">19</a>,<a class="elsevierStyleCrossRefs" href="#bib0024">24-26</a>]. In this study, we demonstrated that TXNDC5 is a target of miR-431-5p. Similarly, Zang and colleagues found that miR-1296-5p plays a tumor-promoting role in HCC by targeting TXNDC5, and TXNDC5 is highly expressed in HCC, which is consistent with our results <a class="elsevierStyleCrossRef" href="#bib0019">[19]</a>. Similarly, Yu et al. found that TXNDC5 was highly expressed in HCC, and that TXNDC5 overexpression played a catalytic role in malignant behavior of HCC cells <a class="elsevierStyleCrossRef" href="#bib0024">[24]</a>. Our results also support this conclusion, TXNDC5 unusual increased restored the inhibition of miR-431-5p on the proliferation, migration, invasion and glycolytic metabolism of huh7 and Hep3B cells. More importantly, circ_0078710 knockdown significantly weakened TXNDC5 expression by releasing miR-431-5p, suggesting that circ_0078710 regulates the miR-431-5p/TXNDC5 pathway.In summary, we found that the expression of circ_0078710 was up-regulated in liver cancer. Circ_0078710 knockdown inhibited the malignant behavior of HCC cells. We demonstrated that down-regulation of circ_0078710 partially inhibits the progression of liver cancer by regulating the miR-431-5p/TXNDC5 pathway. This study suggests that inhibition of circ_0078710 may be a promising strategy for the treatment of HCC.FundingNone." "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres1716463" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0001" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abss0002" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abss0003" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0004" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1517072" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xpalclavsec1517073" "titulo" => "Abbreviations" ] 3 => array:2 [ "identificador" => "sec0001" "titulo" => "Introduction" ] 4 => array:3 [ "identificador" => "sec0002" "titulo" => "Methods" "secciones" => array:12 [ 0 => array:2 [ "identificador" => "sec0003" "titulo" => "Patients and cell lines" ] 1 => array:2 [ "identificador" => "sec0004" "titulo" => "Cell transfection" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Quantitative real-time polymerase chain reaction (qRT-PCR)" ] 3 => array:2 [ "identificador" => "sec0006" "titulo" => "Western blot analysis" ] 4 => array:2 [ "identificador" => "sec0007" "titulo" => "Cell counting Kit-8 assay" ] 5 => array:2 [ "identificador" => "sec0008" "titulo" => "Flow cytometry assay" ] 6 => array:2 [ "identificador" => "sec0009" "titulo" => "Transwell assay" ] 7 => array:2 [ "identificador" => "sec0010" "titulo" => "Glycolysis analyses" ] 8 => array:2 [ "identificador" => "sec0011" "titulo" => "Dual-luciferase reporter assay" ] 9 => array:2 [ "identificador" => "sec0012" "titulo" => "Immunohistochemical (IHC) staining analysis" ] 10 => array:2 [ "identificador" => "sec0013" "titulo" => "Animal experiment" ] 11 => array:2 [ "identificador" => "sec0014" "titulo" => "Statistical analysis" ] ] ] 5 => array:3 [ "identificador" => "sec0015" "titulo" => "Results" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0016" "titulo" => "Circ_0078710 and TXNDC5 were highly expressed in liver cancer" ] 1 => array:2 [ "identificador" => "sec0017" "titulo" => "Silencing circ_0078710 inhibits the growth of HCC cells" ] 2 => array:2 [ "identificador" => "sec0018" "titulo" => "Silencing TXNDC5 inhibits the growth of HCC cells" ] 3 => array:2 [ "identificador" => "sec0019" "titulo" => "MiR-431-5p was target of both circ_0078710 and TXNDC5" ] 4 => array:2 [ "identificador" => "sec0020" "titulo" => "The miR-431-5p inhibitor recovered the inhibition of cell behavior caused by circ_0078710 knockdown" ] 5 => array:2 [ "identificador" => "sec0021" "titulo" => "Overexpression of TXNDC5 recovered the inhibition of cell behavior caused by miR-431-5p" ] 6 => array:2 [ "identificador" => "sec0022" "titulo" => "Circ_0078710 affects the growth of liver cancer tumor in vivo" ] ] ] 6 => array:2 [ "identificador" => "sec0023" "titulo" => "Discussion" ] 7 => array:2 [ "identificador" => "sec0024" "titulo" => "Funding" ] 8 => array:2 [ "identificador" => "xack605496" "titulo" => "Acknowledgment" ] 9 => array:1 [ "titulo" => "Reference" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2021-06-14" "fechaAceptado" => "2021-08-17" "PalabrasClave" => array:1 [ "en" => array:2 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1517072" "palabras" => array:5 [ 0 => "Circ_0078710" 1 => "miR-431-5p" 2 => "TXNDC5" 3 => "Liver cancer" 4 => "Glycolysis" ] ] 1 => array:4 [ "clase" => "abr" "titulo" => "Abbreviations" "identificador" => "xpalclavsec1517073" "palabras" => array:2 [ 0 => "TXNDC5" 1 => "HCC" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "Introduction and objectivesLiver cancer, with high recurrence and metastasis rate, is a common malignant tumor. Circular RNA_0078710 (circ_0078710) has been shown to be take part in the advance of hepatocellular carcinoma. However, the interaction between circ_0091579 and microRNA-431-5p (miR-431-5p) in liver cancer has not been studied. Materials and methodsThe expressions of circ_0078710, miR-431-5p and Thioredoxin domain-containing 5 (TXNDC5) in liver cancer tissues and cells were detected by quantitative real-time polymerase chain reaction (qRT-PCR). The effect of cric_0078710 in liver cancer cells was assessed by Cell Counting Kit-8 (CCK-8) assay, Transwell, flow cytometry and Dual-luciferase reporter assay. Glycolysis metabolism was examined by lactate production, glucose uptake and ATP level. The protein levels of ki-67, bax and TXNEC5 were tested by western blot. The role of circ_0078710 in vivo was determined by animal study. ResultsCirc_0078710 and TXNDC5 were notably expressed in liver cancer tissues and cells. Circ_0078710 knockdown diminished proliferation, migration, invasion and glycolytic metabolism of huh7 and Hep3B cells, and accelerated cell apoptosis. MiR-431-5p is the target of circ_0078710, and silence circ_0078710 can inhibit the malignant behavior and glycolysis of hepatocellular carcinoma (HCC) cells by releasing miR-431-5p. In addition, TXNDC5 was a target of miR-431-5p, and overexpression of TXNDC5 restored cell proliferation and glycolysis inhibition due to miR-431-5p. Animal experiments made clear the anti-tumor effect of circ_0078710 knockdown. ConclusionCirc_0078710 promotes the progression of liver cancer by regulating TXNDC5 expression by targeting miR-431-5p. These results demonstrate that circ_0078710 could be a remedy target for liver cancer." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0001" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abss0002" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abss0003" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0004" "titulo" => "Conclusion" ] ] ] ] "multimedia" => array:7 [ 0 => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1897 "Ancho" => 3583 "Tamanyo" => 339140 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0078710 and TXNDC5 were up-regulated in liver cancer. (A, B) The expression of circ_0078710 and TXNDC5 in liver cancer tissues (n = 30) were tested by qRT-PCR. (C) Western blot assay detected the expression of TXNDC5 protein. (D) The correlation between circ_0078710 and TXNDC5 expression in liver cancer tissues was analyzed by Pearson's correlation analysis. ***P < 0.001." ] ] 1 => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 4208 "Ancho" => 3583 "Tamanyo" => 1569530 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0078710 knockdown can inhibit the viability, migration and invasion of HCC cells. (A) QRT-PCR was used to detect the expression of circ_0078710 in three different HCC cells. (B) The transfection efficiency of si-circ_0078710 was detected by qRT-PCR. (C, D) CCK-8 was used to detect cell viability. (E) Flow cytometry was used to detect huh7 and Hep3B cells apoptosis. (F, G) Transwell assay was used to assess cell migration and invasion. (H-J) Glucose uptake, lactic acid production, and ATP levels were measured to assess glycolysis metabolism using commercial kits. (K, L) Western blot assay detected the expression of ki-67 and bax protein. ***P < 0.001." ] ] 2 => array:8 [ "identificador" => "fig0003" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2477 "Ancho" => 3583 "Tamanyo" => 523466 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0003" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "TXNDC5 knockdown can inhibit the viability, migration and invasion of HCC cells. (A) QRT-PCR was used to detect the expression of TXNDC5 in HCCLM3, huh7 and Hep3B cells. (B) The transfection efficiency of si-TXNDC5 was detected by qRT-PCR. (C, D) CCK-8 was used to detect cell viability. (E) Flow cytometry was used to detect huh7 and Hep3B cells apoptosis. (F, G) Transwell assay was used to assess cell migration and invasion. (H-J) Glucose uptake, lactic acid production, and ATP levels were measured to assess glycolysis metabolism using commercial kits. (K, L) Western blot assay detected the expression of ki67 and bax protein. ***P < 0.001." ] ] 3 => array:8 [ "identificador" => "fig0004" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1539 "Ancho" => 3583 "Tamanyo" => 349949 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0004" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "MiR-431-5p was target of both circ_0078710 and TXNDC5. (A, F) The binding site of circ_0078710 and miR-431-5p, and the binding sites of miR-431-5p and TXNDC5. (B, C, G, H) Dual-luciferase reporter assays were performed to confirm the association between circ_0078710 and miR-431-5p, and miR-431-5p and TXNDC5 in huh7 and Hep3B cells. (D, E) qRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells. (I, J) the protein expression of TXNDC5 in transfected huh7 and Hep3B cells was detected by Western blot. ***P < 0.001." ] ] 4 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 3161 "Ancho" => 3583 "Tamanyo" => 897870 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0078710 regulate the proliferation, migration, and invasion by targeting miR-431-5p in liver cancer cells. (A, B) qRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells. (C, D) CCK-8 was used to detect cell viability in transfected huh7 and Hep3B cells. (E, F) Flow cytometry was used to detect huh7 and Hep3B cells apoptosis. (G, H) Transwell assay was used to assess cell migration and cell invasion. (I-K) Glucose uptake, lactic acid production, and ATP levels were measured to assess glycolysis metabolism using commercial kits. (L, M) The protein levels of ki67 and bax were measured by Western blot. ***P < 0.001." ] ] 5 => array:8 [ "identificador" => "fig0006" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 2944 "Ancho" => 3583 "Tamanyo" => 863398 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0006" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "TXNDC5 regulate the proliferation, migration, and invasion by targeting miR-431-5p in liver cancer cells. (A) QRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells. (B, C) Western blot was used to detect the expression of TXNDC5 in transfected huh7 and Hep3B cells. (D, E) CCK-8 was used to detect cell viability in transfected huh7 and Hep3B cells. (F, G) Flow cytometry was used to detect huh7 and Hep3B cells apoptosis. (H, I) Transwell assay was used to assess cell migration and cell invasion. (J-L) Glucose uptake, lactic acid production, and ATP levels were measured to assess glycolysis metabolism using commercial kits. (M, N) The protein levels of ki67 and bax were measured by Western blot. ***P < 0.001." ] ] 6 => array:8 [ "identificador" => "fig0007" "etiqueta" => "Fig. 7" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr7.jpeg" "Alto" => 1981 "Ancho" => 3583 "Tamanyo" => 507223 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0007" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0078710 knockdown inhibited tumor growth in vivo. (A, B) Tumor volume and weight after circ_0078710 knockdown in vivo. (C, D) Relative expression levels of circ_0078710 and miR-431-5p in xenografts were detected by qRT-PCR. (E) TXNDC5 protein level tested by western blot in xenografts. (F) The levels of TXNDC5 was evaluated by immunohistochemical staining in tumor samples. ***P < 0.001." ] ] ] "bibliografia" => array:2 [ "titulo" => "Reference" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec1" "bibliografiaReferencia" => array:26 [ 0 => array:3 [ "identificador" => "bib0001" "etiqueta" => "[1]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Current state of liver-directed therapies and combinatory approaches with systemic therapy in hepatocellular carcinoma (HCC)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "P Viveiros" 1 => "A Riaz" 2 => "RJ Lewandowski" 3 => "D Mahalingam" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Cancers (Basel)" "fecha" => "2019" "volumen" => "11" "itemHostRev" => array:3 [ "pii" => "S0165587618305275" "estado" => "S300" "issn" => "01655876" ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0002" "etiqueta" => "[2]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "JM Llovet" 1 => "J Zucman-Rossi" 2 => "E Pikarsky" 3 => "B Sangro" 4 => "M Schwartz" 5 => "M Sherman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrdp.2016.18" "Revista" => array:5 [ "tituloSerie" => "Nat Rev Dis Primers" "fecha" => "2016" "volumen" => "2" "paginaInicial" => "16018" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27158749" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0003" "etiqueta" => "[3]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Liver cancer cell of origin, molecular class, and effects on patient prognosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "D Sia" 1 => "A Villanueva" 2 => "SL Friedman" 3 => "JM Llovet" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.gastro.2016.11.048" "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "2017" "volumen" => "152" "paginaInicial" => "745" "paginaFinal" => "761" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28043904" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0004" "etiqueta" => "[4]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of cancer-associated fibroblasts and fibrosis in liver cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S Affo" 1 => "LX Yu" 2 => "RF Schwabe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1146/annurev-pathol-052016-100322" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Pathol" "fecha" => "2017" "volumen" => "12" "paginaInicial" => "153" "paginaFinal" => "186" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27959632" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0005" "etiqueta" => "[5]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNAs and cancer: biomarkers and master regulators" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "E Arnaiz" 1 => "C Sole" 2 => "L Manterola" 3 => "L Iparraguirre" 4 => "D Otaegui" 5 => "CH. Lawrie" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.semcancer.2018.12.002" "Revista" => array:6 [ "tituloSerie" => "Semin Cancer Biol" "fecha" => "2019" "volumen" => "58" "paginaInicial" => "90" "paginaFinal" => "99" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30550956" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0006" "etiqueta" => "[6]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNAs are a large class of animal RNAs with regulatory potency" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S Memczak" 1 => "M Jens" 2 => "A Elefsinioti" 3 => "F Torti" 4 => "J Krueger" 5 => "A Rybak" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nature11928" "Revista" => array:6 [ "tituloSerie" => "Nature" "fecha" => "2013" "volumen" => "495" "paginaInicial" => "333" "paginaFinal" => "338" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23446348" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0007" "etiqueta" => "[7]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circles reshaping the RNA world: from waste to treasure" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J Liu" 1 => "T Liu" 2 => "X Wang" 3 => "A. He" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-017-0630-y" "Revista" => array:5 [ "tituloSerie" => "Mol Cancer" "fecha" => "2017" "volumen" => "16" "paginaInicial" => "58" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28279183" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0008" "etiqueta" => "[8]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ_0000105 promotes liver cancer by regulating miR-498/PIK3R1" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y Sun" 1 => "X Sun" 2 => "Q. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jgm.3256" "Revista" => array:5 [ "tituloSerie" => "J Gene Med" "fecha" => "2020" "volumen" => "22" "paginaInicial" => "e3256" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32729955" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0009" "etiqueta" => "[9]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA circRHOT1 promotes hepatocellular carcinoma progression by initiation of NR2F6 expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L Wang" 1 => "H Long" 2 => "Q Zheng" 3 => "X Bo" 4 => "X Xiao" 5 => "B. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-019-1046-7" "Revista" => array:5 [ "tituloSerie" => "Mol Cancer" "fecha" => "2019" "volumen" => "18" "paginaInicial" => "119" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31324186" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0010" "etiqueta" => "[10]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNA has_circ_0078710 acts as the sponge of microRNA-31 involved in hepatocellular carcinoma progression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B Xie" 1 => "Z Zhao" 2 => "Q Liu" 3 => "X Wang" 4 => "Z Ma" 5 => "H. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.gene.2018.10.043" "Revista" => array:6 [ "tituloSerie" => "Gene" "fecha" => "2019" "volumen" => "683" "paginaInicial" => "253" "paginaFinal" => "261" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30342168" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0011" "etiqueta" => "[11]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The widespread regulation of microRNA biogenesis, function and decay" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J Krol" 1 => "I Loedige" 2 => "W. Filipowicz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrg2843" "Revista" => array:6 [ "tituloSerie" => "Nat Rev Genet" "fecha" => "2010" "volumen" => "11" "paginaInicial" => "597" "paginaFinal" => "610" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20661255" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0012" "etiqueta" => "[12]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Disruption of microRNA nuclear transport in human cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "SA Melo" 1 => "M. Esteller" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.semcancer.2014.02.012" "Revista" => array:6 [ "tituloSerie" => "Semin Cancer Biol" "fecha" => "2014" "volumen" => "27" "paginaInicial" => "46" "paginaFinal" => "51" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24607282" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0013" "etiqueta" => "[13]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA and miR-7 in cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "TB Hansen" 1 => "J Kjems" 2 => "CK. Damgaard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1158/0008-5472.CAN-13-1568" "Revista" => array:6 [ "tituloSerie" => "Cancer Res" "fecha" => "2013" "volumen" => "73" "paginaInicial" => "5609" "paginaFinal" => "5612" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24014594" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0014" "etiqueta" => "[14]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Natural RNA circles function as efficient microRNA sponges" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "TB Hansen" 1 => "TI Jensen" 2 => "BH Clausen" 3 => "JB Bramsen" 4 => "B Finsen" 5 => "CK Damgaard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nature11993" "Revista" => array:6 [ "tituloSerie" => "Nature" "fecha" => "2013" "volumen" => "495" "paginaInicial" => "384" "paginaFinal" => "388" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23446346" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0015" "etiqueta" => "[15]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ_0001742 promotes tongue squamous cell carcinoma progression via miR-431-5p/ATF3 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "YT Hu" 1 => "XX Li" 2 => "LW Zeng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.26355/eurrev_201912_19668" "Revista" => array:6 [ "tituloSerie" => "Eur Rev Med Pharmacol Sci" "fecha" => "2019" "volumen" => "23" "paginaInicial" => "10300" "paginaFinal" => "10312" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31841185" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0016" "etiqueta" => "[16]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-431-5p alters the epithelial-to-mesenchymal transition markers by targeting UROC28 in hepatoma cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Q Kong" 1 => "J Han" 2 => "H Deng" 3 => "F Wu" 4 => "S Guo" 5 => "Z Ye" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/OTT.S173840" "Revista" => array:6 [ "tituloSerie" => "Onco Targets Ther" "fecha" => "2018" "volumen" => "11" "paginaInicial" => "6489" "paginaFinal" => "6503" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30323624" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0017" "etiqueta" => "[17]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Fibroblast-enriched endoplasmic reticulum protein TXNDC5 promotes pulmonary fibrosis by augmenting TGFbeta signaling through TGFBR1 stabilization" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "TH Lee" 1 => "CF Yeh" 2 => "YT Lee" 3 => "YC Shih" 4 => "YT Chen" 5 => "CT Hung" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41467-020-18047-x" "Revista" => array:5 [ "tituloSerie" => "Nat Commun" "fecha" => "2020" "volumen" => "11" "paginaInicial" => "4254" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32848143" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0018" "etiqueta" => "[18]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of TXNDC5 in tumorigenesis of colorectal cancer cells: in vivo and in vitro evidence" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F Tan" 1 => "H Zhu" 2 => "X He" 3 => "N Yu" 4 => "X Zhang" 5 => "H Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/ijmm.2018.3664" "Revista" => array:6 [ "tituloSerie" => "Int J Mol Med" "fecha" => "2018" "volumen" => "42" "paginaInicial" => "935" "paginaFinal" => "945" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29749460" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0019" "etiqueta" => "[19]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ_0000517 contributes to hepatocellular carcinoma progression by upregulating TXNDC5 via sponging miR-1296-5p" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H Zang" 1 => "Y Li" 2 => "X Zhang" 3 => "G. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/CMAR.S244024" "Revista" => array:6 [ "tituloSerie" => "Cancer Manag Res" "fecha" => "2020" "volumen" => "12" "paginaInicial" => "3457" "paginaFinal" => "3468" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32523376" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0020" "etiqueta" => "[20]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA circPLK1 promotes breast cancer cell proliferation, migration and invasion by regulating miR-4500/IGF1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G Lin" 1 => "S Wang" 2 => "X Zhang" 3 => "D. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12935-020-01694-x" "Revista" => array:5 [ "tituloSerie" => "Cancer Cell Int" "fecha" => "2020" "volumen" => "20" "paginaInicial" => "593" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33298061" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0021" "etiqueta" => "[21]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ_0025033 promotes the progression of ovarian cancer by activating the expression of LSM4 via targeting miR-184" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "W Hou" 1 => "Y. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Pathol Res Pract" "fecha" => "2020" "volumen" => "217" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0022" "etiqueta" => "[22]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ0120816 acts as an oncogene of esophageal squamous cell carcinoma by inhibiting miR-1305 and releasing TXNRD1" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "X Li" 1 => "L Song" 2 => "B Wang" 3 => "C Tao" 4 => "L Shi" 5 => "M. Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12935-020-01617-w" "Revista" => array:5 [ "tituloSerie" => "Cancer Cell Int" "fecha" => "2020" "volumen" => "20" "paginaInicial" => "526" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33292234" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0023" "etiqueta" => "[23]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ATG3, a Target of miR-431-5p, promotes proliferation and invasion of colon cancer via promoting autophagy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "W Huang" 1 => "C Zeng" 2 => "S Hu" 3 => "L Wang" 4 => "J. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/CMAR.S226828" "Revista" => array:6 [ "tituloSerie" => "Cancer Manag Res" "fecha" => "2019" "volumen" => "11" "paginaInicial" => "10275" "paginaFinal" => "10285" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31849517" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0024" "etiqueta" => "[24]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNA-104718 acts as competing endogenous RNA and promotes hepatocellular carcinoma progression through microRNA-218-5p/TXNDC5 signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J Yu" 1 => "M Yang" 2 => "B Zhou" 3 => "J Luo" 4 => "Z Zhang" 5 => "W Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Sci (Lond)" "fecha" => "2019" "volumen" => "133" "paginaInicial" => "1487" "paginaFinal" => "1503" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0025" "etiqueta" => "[25]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of TXNDC5 in castration-resistant prostate cancer-involvement of androgen receptor signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L Wang" 1 => "G Song" 2 => "X Chang" 3 => "W Tan" 4 => "J Pan" 5 => "X Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/onc.2014.401" "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "2015" "volumen" => "34" "paginaInicial" => "4735" "paginaFinal" => "4745" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25500540" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0026" "etiqueta" => "[26]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HERG1 promotes esophageal squamous cell carcinoma growth and metastasis through TXNDC5 by activating the PI3K/AKT pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H Wang" 1 => "X Yang" 2 => "Y Guo" 3 => "L Shui" 4 => "S Li" 5 => "Y Bai" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s13046-019-1284-y" "Revista" => array:5 [ "tituloSerie" => "J Exp Clin Cancer Res" "fecha" => "2019" "volumen" => "38" "paginaInicial" => "324" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31331361" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack605496" "titulo" => "Acknowledgment" "texto" => "None." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002507/v2_202205211521/en/main.assets" "Apartado" => array:4 [ "identificador" => "78265" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/0000002700000001/v2_202205211521/S1665268121002507/v2_202205211521/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002507?idApp=UINPBA00004N"]

Statistics

Original article

Huajun Lu, Lili Gao, Jixiang Lv

Corresponding author

lvjixiang1983@126.com

Corresponding author.

Department of Hepatobiliary Surgery, Laiyang Central Hospital, Yantai 265200, Shandong Province, China

Read

1085

Times
was read the article

221

Total PDF

864

Total HTML

Share statistics

 array:23 [
  "pii" => "S1665268121002507"
  "issn" => "16652681"
  "doi" => "10.1016/j.aohep.2021.100551"
  "estado" => "S300"
  "fechaPublicacion" => "2022-01-01"
  "aid" => "100551"
  "copyrightAnyo" => "2021"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Ann Hepatol. 2022;27:"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1665268121002453"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2021.100546"
    "estado" => "S300"
    "fechaPublicacion" => "2022-01-01"
    "aid" => "100546"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2022;27:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:10 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Clinical features and treatment outcomes of primary biliary cholangitis in a highly admixed population"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Guilherme Grossi Lopes Can&#231;ado, Michelle Harriz Braga, Maria L&#250;cia Gomes Ferraz, Cristiane Alves Villela-Nogueira, Debora Raquel Benedita Terrabuio, Eduardo Luiz Rachid Can&#231;ado, Mateus Jorge Nardelli, Luciana Costa Faria, Nathalia Mota de Faria Gomes, Elze Maria Gomes de Oliveira, Vivian Rotman, Maria Beatriz de Oliveira, Simone Muniz Carvalho Fernandes da Cunha, Daniel Ferraz de Campos Mazo, Liliana Sampaio Costa Mendes, Claudia Alexandra Pontes Ivantes, Liana Codes, Val&#233;ria Ferreira de Almeida e Borges, Fabio Heleno de Lima Pace, Mario Guimar&#227;es Pessoa, Izabelle Venturini Signorelli, Gabriela Perdomo Coral, Paulo Lisboa Bittencourt, Cynthia Levy, Cl&#225;udia Alves Couto"
          "autores" => array:26 [
            0 => array:2 [
              "nombre" => "Guilherme Grossi Lopes"
              "apellidos" => "Can&#231;ado"
            ]
            1 => array:2 [
              "nombre" => "Michelle Harriz"
              "apellidos" => "Braga"
            ]
            2 => array:2 [
              "nombre" => "Maria L&#250;cia Gomes"
              "apellidos" => "Ferraz"
            ]
            3 => array:2 [
              "nombre" => "Cristiane Alves"
              "apellidos" => "Villela-Nogueira"
            ]
            4 => array:2 [
              "nombre" => "Debora Raquel Benedita"
              "apellidos" => "Terrabuio"
            ]
            5 => array:2 [
              "nombre" => "Eduardo Luiz Rachid"
              "apellidos" => "Can&#231;ado"
            ]
            6 => array:2 [
              "nombre" => "Mateus Jorge"
              "apellidos" => "Nardelli"
            ]
            7 => array:2 [
              "nombre" => "Luciana Costa"
              "apellidos" => "Faria"
            ]
            8 => array:2 [
              "nombre" => "Nathalia Mota de Faria"
              "apellidos" => "Gomes"
            ]
            9 => array:2 [
              "nombre" => "Elze Maria Gomes"
              "apellidos" => "de Oliveira"
            ]
            10 => array:2 [
              "nombre" => "Vivian"
              "apellidos" => "Rotman"
            ]
            11 => array:2 [
              "nombre" => "Maria Beatriz"
              "apellidos" => "de Oliveira"
            ]
            12 => array:2 [
              "nombre" => "Simone Muniz Carvalho Fernandes"
              "apellidos" => "da Cunha"
            ]
            13 => array:2 [
              "nombre" => "Daniel Ferraz de Campos"
              "apellidos" => "Mazo"
            ]
            14 => array:2 [
              "nombre" => "Liliana Sampaio Costa"
              "apellidos" => "Mendes"
            ]
            15 => array:2 [
              "nombre" => "Claudia Alexandra Pontes"
              "apellidos" => "Ivantes"
            ]
            16 => array:2 [
              "nombre" => "Liana"
              "apellidos" => "Codes"
            ]
            17 => array:2 [
              "nombre" => "Val&#233;ria Ferreira"
              "apellidos" => "de Almeida e Borges"
            ]
            18 => array:2 [
              "nombre" => "Fabio Heleno de Lima"
              "apellidos" => "Pace"
            ]
            19 => array:2 [
              "nombre" => "Mario Guimar&#227;es"
              "apellidos" => "Pessoa"
            ]
            20 => array:2 [
              "nombre" => "Izabelle Venturini"
              "apellidos" => "Signorelli"
            ]
            21 => array:2 [
              "nombre" => "Gabriela Perdomo"
              "apellidos" => "Coral"
            ]
            22 => array:2 [
              "nombre" => "Paulo Lisboa"
              "apellidos" => "Bittencourt"
            ]
            23 => array:2 [
              "nombre" => "Cynthia"
              "apellidos" => "Levy"
            ]
            24 => array:2 [
              "nombre" => "Cl&#225;udia Alves"
              "apellidos" => "Couto"
            ]
            25 => array:1 [
              "colaborador" => "Members of the Brazilian Cholestasis Study Group Consortium"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002453?idApp=UINPBA00004N"
    "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002453/v2_202205211521/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1665268121002519"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2021.100552"
    "estado" => "S300"
    "fechaPublicacion" => "2022-01-01"
    "aid" => "100552"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2022;27:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Efficacy comparison of optimal treatments for hepatocellular carcinoma patients with portal vein tumor thrombus"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0002"
          "etiqueta" => "Fig&#46; 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 956
              "Ancho" => 2500
              "Tamanyo" => 180364
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0002"
              "detalle" => "Fig "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">Overall survival rates for HCC patients with PVTT after liver resection&#44; TACE or sorafenib in the &#40;A&#41; training cohort and &#40;B&#41; internal validation cohort&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Yu Zhang, Jun-Li Wu, Le-Qun Li"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Yu"
              "apellidos" => "Zhang"
            ]
            1 => array:2 [
              "nombre" => "Jun-Li"
              "apellidos" => "Wu"
            ]
            2 => array:2 [
              "nombre" => "Le-Qun"
              "apellidos" => "Li"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002519?idApp=UINPBA00004N"
    "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002519/v2_202205211521/en/main.assets"
  ]
  "en" => array:18 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Circ&#95;0078710 promotes the development of liver cancer by upregulating TXNDC5 via miR-431-5p"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Huajun Lu, Lili Gao, Jixiang Lv"
        "autores" => array:3 [
          0 => array:2 [
            "nombre" => "Huajun"
            "apellidos" => "Lu"
          ]
          1 => array:2 [
            "nombre" => "Lili"
            "apellidos" => "Gao"
          ]
          2 => array:4 [
            "nombre" => "Jixiang"
            "apellidos" => "Lv"
            "email" => array:1 [
              0 => "lvjixiang1983@126.com"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0001"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "Department of Hepatobiliary Surgery&#44; Laiyang Central Hospital&#44; Yantai 265200&#44; Shandong Province&#44; China"
            "identificador" => "aff0001"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0001"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1897
            "Ancho" => 3583
            "Tamanyo" => 339140
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 and TXNDC5 were up-regulated in liver cancer&#46; &#40;A&#44; B&#41; The expression of circ&#95;0078710 and TXNDC5 in liver cancer tissues &#40;<span class="elsevierStyleItalic">n&#160;&#61;</span>&#160;30&#41; were tested by qRT-PCR&#46; &#40;C&#41; Western blot assay detected the expression of TXNDC5 protein&#46; &#40;D&#41; The correlation between circ&#95;0078710 and TXNDC5 expression in liver cancer tissues was analyzed by Pearson&#39;s correlation analysis&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1</span><span class="elsevierStyleSectionTitle" id="cesectitle0008">Introduction</span><p id="para0005" class="elsevierStylePara elsevierViewall">Liver cancer&#44; with the second highest mortality among all cancers&#44; is one of the malignant tumors&#44; and is characterized by high metastasis and recurrence rates <a class="elsevierStyleCrossRefs" href="#bib0001">&#91;1&#8211;3&#93;</a>&#46; The occurrence of liver cancer is mostly from chronic liver disease transformation&#44; accompanied by liver fibrosis <a class="elsevierStyleCrossRef" href="#bib0004">&#91;4&#93;</a>&#46; Hepatocellular carcinoma &#40;HCC&#41;&#44; occupying about 90&#37; of all liver cancer patients&#44; is the most common type of liver cancer <a class="elsevierStyleCrossRef" href="#bib0002">&#91;2&#93;</a>&#46; However&#44; although liver cancer can be intervened with surgery&#44; drugs or chemotherapy&#44; the prognosis is not good&#46; Therefore&#44; it is very necessary to study the molecular mechanism of liver cancer&#46;</p><p id="para0006" class="elsevierStylePara elsevierViewall">As a competitive endogenous RNA &#40;ceRNA&#41;&#44; Circular RNAs &#40;circRNAs&#41; have been actively studied in tumors in recent years <a class="elsevierStyleCrossRef" href="#bib0005">&#91;5&#93;</a>&#46; It is a kind of non-coding RNA with a unique continuous covalent closed-loop structure&#44; without terminal 5&#8217;cap and 3&#8217;tail &#91;<a class="elsevierStyleCrossRef" href="#bib0006">6</a>&#44;<a class="elsevierStyleCrossRef" href="#bib0007">7</a>&#93;&#46; Several studies have investigated the relationship between circRNAs and liver cancer&#46; For example&#44; Sun et&#160;al<span class="elsevierStyleItalic">&#46;</span> showed <span class="elsevierStyleItalic">in vivo</span> and <span class="elsevierStyleItalic">in vitro</span> that silencing circ&#95;0000105 inhibits metastasis and growth of HCC cells <a class="elsevierStyleCrossRef" href="#bib0008">&#91;8&#93;</a>&#46; Wang et&#160;al&#46; showed that circRHOT1&#47;NR2F6 could be used to regulate the occurrence and development of liver cancer <a class="elsevierStyleCrossRef" href="#bib0009">&#91;9&#93;</a>&#46; Xie et&#160;al&#46; found that circ&#95;0078710 can intervene in the development of HCC through miR-31 <a class="elsevierStyleCrossRef" href="#bib0010">&#91;10&#93;</a>&#46; Nevertheless&#44; the function of circ&#95;0078710 and miR-431-5p in HCC remains unclear&#46;</p><p id="para0007" class="elsevierStylePara elsevierViewall">MicroRNAs &#40;miRNAs&#41;&#44; which negatively regulate target genes by interacting with the 3&#8217;untranslated region &#40;3&#8217;UTR&#41;&#44; are also 22-nucleotide non-coding RNAs &#91;<a class="elsevierStyleCrossRef" href="#bib0011">11</a>&#44;<a class="elsevierStyleCrossRef" href="#bib0012">12</a>&#93;&#46; MiRNAs have been shown to negatively regulate circRNAs&#44; and their interaction can be involved in the growth process of various cancer cells &#91;<a class="elsevierStyleCrossRef" href="#bib0013">13</a>&#44;<a class="elsevierStyleCrossRef" href="#bib0014">14</a>&#93;&#46; Recently&#44; a large number of literatures have reported the regulatory impact of miRNA-431-5p &#40;miR-431-5p&#41; in the occurrence and progression of certain cancers &#40;such as HCC&#41;&#46; For example&#44; miR-431-5p modulates the effects of circ&#95;0001742 in tongue squamous cell carcinoma cells <a class="elsevierStyleCrossRef" href="#bib0015">&#91;15&#93;</a>&#46; Studies have shown that miR-431-5p is significantly down-regulated in HCC cells&#44; and its elevation impedes the proliferation of HCC cells <a class="elsevierStyleCrossRef" href="#bib0016">&#91;16&#93;</a>&#46; However&#44; the regulatory effect of miR-431-5p and TXNDC5 in liver cancer cells has not been studied&#46;</p><p id="para0008" class="elsevierStylePara elsevierViewall">Thioredoxin domain containing 5 &#40;TXNDC5&#41;&#44; a member of the protein disulfide isomerase family&#44; is a fibroblast enriched endoplasmic reticulum &#40;ER&#41; protein <a class="elsevierStyleCrossRef" href="#bib0017">&#91;17&#93;</a>&#46; TXNDC5 has been shown to promote the development of many cancers&#44; including HCC&#46; For example&#44; studies have shown that TXNDC5 is significantly upregulated in colorectal cancer tissues <a class="elsevierStyleCrossRef" href="#bib0018">&#91;18&#93;</a>&#46; Zang et&#160;al&#46; found that circ&#95;0000517&#47;miR-1261-5p&#47;TXNDC5 axis can regulate the progression of liver cancer <a class="elsevierStyleCrossRef" href="#bib0019">&#91;19&#93;</a>&#46;</p><p id="para0009" class="elsevierStylePara elsevierViewall">In this study&#44; we found that circ&#95;0078710 and TXNDC5 were highly expressed in HCC tissues and cells&#46; In addition&#44; we testify to the role of circ&#95;0078710&#47;miR-431-5p&#47;TXNDC5 axis in liver cancer&#44; in order to reveal the function of circ&#95;0078710 in the progression of liver cancer&#46;</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2</span><span class="elsevierStyleSectionTitle" id="cesectitle0009">Methods</span><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;1</span><span class="elsevierStyleSectionTitle" id="cesectitle0010">Patients and cell lines</span><p id="para0010" class="elsevierStylePara elsevierViewall">Thirty liver tumor specimens and adjacent normal liver tissues were collected from patients with liver cancer in XXXX&#46; The sample was frozen in liquid nitrogen right away&#46; All samples received any treatment preoperatively&#46; Each patient offered written informed consent and received supervision and guidance from XXXX&#46;</p><p id="para0011" class="elsevierStylePara elsevierViewall">Human liver normal cell lines &#40;HHL-5&#41; and human hepatocellular carcinoma cells &#40;HCCLM3&#44; huh7 and Hep3B&#41; were purchased from American Type Culture Collection &#40;ATCC&#59; Manassas&#44; VA&#44; USA&#41;&#44; then added 10&#37; &#40;v&#47;v&#41; fetal bovine serum &#40;FBS&#59; GIBCO BRL&#44; Grand Island&#44; NY&#44; USA&#41; and was placed in an incubator containing 5&#37; CO<span class="elsevierStyleInf">2</span> at 37&#176;C&#46;</p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;2</span><span class="elsevierStyleSectionTitle" id="cesectitle0011">Cell transfection</span><p id="para0012" class="elsevierStylePara elsevierViewall">Short interfering RNA &#40;siRNA&#41; targeting circ&#95;0078710 &#40;si-circ&#95;0078710&#41; and its corresponding control group &#40;si-con&#41;&#44; miR-431-5p mimics &#40;miR-431-5p&#41;&#44; and its negative control &#40;miR-NC&#41;&#44; miR-431-5p inhibitor &#40;anti-miR-431-5p&#41; and its matched &#40;anti-miR-NC&#41;&#44; TXNDC5 overexpression vector &#40;pcDNA-TXNDC5&#41; and matched control &#40;pcDNA-NC&#41;&#44; siRNA targeting TXNDC5 &#40;si-TXNDC5&#41; and its matched control group &#40;si-NC&#41; were synthesized by Ribobio Co&#46;&#44; Ltd&#46; &#40;Guangzhou&#44; China&#41;&#44; and then transfected into huh7 and Hep3B cells using Lipofectamine 2000 &#40;Promega&#44; Madison&#44; WI&#44; USA&#41;&#46;</p></span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;3</span><span class="elsevierStyleSectionTitle" id="cesectitle0012">Quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;</span><p id="para0013" class="elsevierStylePara elsevierViewall">Trizol Reagent &#40;Thermo Fisher&#44; Waltham&#44; MA&#44; USA&#41; was used to separate total RNA&#46; Then the total RNA was then reverse transcribed using Reverse Transcription Kit &#40;Thermo Fisher&#41;&#46; Then&#44; qRT-PCR was performed for cDNA using SYBR Green qRT-PCR Mix &#40;Takara&#44; Shiga&#44; Japan&#41; according to the manufacturer&#39;s protocol&#46; GAPDH or U6 were used as internal reference&#44; and the relative expression was calculated by 2<span class="elsevierStyleSup">&#8722;&#916;&#916;CT</span>&#46; The forward and reverse primers were displayed as below&#58; GAPDH&#44; &#40;F&#58; 5&#8217;- GGAGCGAGATCCCTCCAAAAT -3&#8217; and R&#58; 5&#8217;- GGCTGTTGTCATACTTCTCATGG -3&#8217;&#41;&#59; U6&#44; &#40;F&#58; 5&#8217;- CTCGCTTCGGCAGCACATATACT -3&#8217; and R&#58; 5&#8217;- ACGCTTCACGAATTTGCGTGTC -3&#8217;&#41;&#59; circ&#95;0078710&#44; &#40;F&#58; 5&#8217;- CCCGATGACAGGGACAACTG -3&#8217; and R&#58; 5&#8217;- GCGGCTTTATATGCCGCTTC -3&#8217;&#41;&#59; miR-431-5p&#44; &#40;F&#58; 5&#8217;- GCCGAGTGTCTTGCAGGCCGT -3&#8217; and R&#58; 5&#8217;- CAGTGCGTGTCGTGGAGT -3&#8217;&#41;&#59; TXNDC5&#44; &#40;F&#58; 5&#8217;- TCACTGAGGGAGTACGTGGA -3&#8217; and R&#58; 5&#8217;- AGCAGTGCAGTCTACTTCGG -3&#8217;&#41;&#46;</p></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;4</span><span class="elsevierStyleSectionTitle" id="cesectitle0013">Western blot analysis</span><p id="para0014" class="elsevierStylePara elsevierViewall">The total protein of liver cancer tissues or cells was separated from using Radioimmunoprecipitation analysis buffer &#40;RIPA&#59; Thermo Fisher&#41;&#46; And BCA protein assay kit &#40;Pierce&#59; Rockford&#44; IL&#44; USA&#41; was used to quantify the total protein and loaded into 12&#37; SDS-PAGE&#46; After blocking the membrane with 5&#37; skim milk&#44; anti-&#946;-actin &#40;1&#58;1&#44;000&#44; ab8226&#44; Abcam&#44; Cambridge&#44; MA&#44; USA&#41;&#44; anti-TXNDC5 &#40;1&#58;1&#44;000&#44; ab237697&#44; Abcam&#41;&#44; anti-Ki-67 &#40;1&#58;2&#44;000&#44; ab15580&#59; Abcam&#41;&#44; and anti-bax &#40;1&#58;1&#44;000&#44; ab32503&#44; Abcam&#41; were incubated respectively&#46; Last&#44; Western blot on the membrane was visualized using BeyoECL Plus kit &#40;BeyoTime&#41;&#46;</p></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;5</span><span class="elsevierStyleSectionTitle" id="cesectitle0014">Cell counting Kit-8 assay</span><p id="para0015" class="elsevierStylePara elsevierViewall">CCK-8 assayed cell viability&#46; Huh7 and Hep3B were seeded into 96-well plates at a density of 1&#160;&#215;&#160;10<span class="elsevierStyleSup">4</span> cells per well&#46; Add 10 &#956;L CCK-8 solution &#40;Thermo Fisher&#41; to each well and incubate for 2 hours at 0&#44; 24&#44; 48 and 72 h after inoculation&#46; The absorbance at 450 nm was determined using a microplate reader &#40;BioTek&#44; Winooski&#44; Vermont&#44; USA&#41;&#46; Three independent replicates were performed for each CCK-8 test group&#46;</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;6</span><span class="elsevierStyleSectionTitle" id="cesectitle0015">Flow cytometry assay</span><p id="para0016" class="elsevierStylePara elsevierViewall">Flow cytometry &#40;BD Biosciences&#44; San Diego&#44; CA&#44; USA&#41; was used to detect the apoptosis of huh7 and Hep3B incubated with Annexin-FITC and Propidium iodide &#40;PI&#59; BD Biosciences&#41; and the cell cycle of huh7 and Hep3B incubated with 1 mL of PI&#47;TritonX-100 staining solution &#40;containing 0&#46;2 mg RNase A&#44; 20 &#956;g of PI&#44; and 0&#46;1&#37; TritonX-100&#41; at 4&#176;C for 30 min&#46;</p></span><span id="sec0009" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;7</span><span class="elsevierStyleSectionTitle" id="cesectitle0016">Transwell assay</span><p id="para0017" class="elsevierStylePara elsevierViewall">The ability of huh7 and Hep3B cells migration and invasion was detected by Transwell&#46; These two difference is that invasion need to be covered with Matrigel in Transwell chambers &#40;Corning&#44; NY&#44; Madison&#44; USA&#41;&#44; while migration do not&#46; 5&#160;&#215;&#160;10<span class="elsevierStyleSup">4</span> cells were added into the upper of Transwell chambers&#46; Meanwhile&#44; the transwell lower chambers was added with fresh culture medium containing 10&#37; FBS&#46; The amount of migrated or invaded cells was counted under a high-powered microscope&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;8</span><span class="elsevierStyleSectionTitle" id="cesectitle0017">Glycolysis analyses</span><p id="para0018" class="elsevierStylePara elsevierViewall">Glycolysis was assessed by monitoring lactate production&#44; glucose uptake and ATP level using commercial kits&#44; including Lactate Assay Kit &#40;Sigma-Aldrich&#44; St&#46; Louis&#44; MO&#44; USA&#41;&#44; Glucose Uptake Colorimetric Assay Kit &#40;Sigma-Aldrich&#41; and ATP Bioluminescent Assay Kit &#40;Sigma-Aldrich&#41;&#46;</p></span><span id="sec0011" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;9</span><span class="elsevierStyleSectionTitle" id="cesectitle0018">Dual-luciferase reporter assay</span><p id="para0019" class="elsevierStylePara elsevierViewall">The bioinformatics prediction platform circinteractome &#40;<a href="https://circinteractome.nia.nih.gov/mirna_target_sites.html">https&#58;&#47;&#47;circinteractome&#46;nia&#46;nih&#46;gov&#47;mirna&#95;target&#95;sites&#46;html</a>&#41; and Starbase &#40;<a href="http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA">http&#58;&#47;&#47;starbase&#46;sysu&#46;edu&#46;cn&#47;agoClipRNA&#46;php&#63;source&#61;mRNA</a>&#41; was used to identify the binding sites of between miR-431-5p and circ&#95;0078710 or TXNDC5&#46; The sequences of circ&#95;0078710 or TXNDC5 3&#8217;UTR containing presumed miR-431-5p interacting sites were cloned into pGL3-basic vectors &#40;Realgene&#44; Nanjing&#44; China&#41;&#44; respectively&#46; Huh7 and Hep3B cells in 48-well plates &#40;8&#160;&#215;&#160;10<span class="elsevierStyleSup">3</span> cells&#47;well&#41; were transfected with luciferase reporter plasmid in combination with miR-431-5p or control by Lipofectamine 2000 &#40;Promega&#41;&#46; The relative luciferase activities were measured by Dual-Luciferase Reporter Assay Kit &#40;GeneCopoeia&#44; Rockville&#44; MD&#44; USA&#41; after transfection 48 h&#44; with Renilla luciferase activity as control&#46;</p></span><span id="sec0012" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;10</span><span class="elsevierStyleSectionTitle" id="cesectitle0019">Immunohistochemical &#40;IHC&#41; staining analysis</span><p id="para0020" class="elsevierStylePara elsevierViewall">Resected tissues were fixed with 4&#37; buffered paraformaldehyde&#44; dehydrated and embedded in paraffin&#46; Paraffin sections &#40;5 &#956;M&#41; were dewaxed and rehydrated for antigen stripping&#46; Then anti-TXNDC5 was placed at 4&#176;C overnight&#44; and matched with the Goat against mouse IgG &#40;1&#58;10&#44;000&#44; ab205719&#44; Abcam&#41; 1 h&#46; Sections were stained with diaminobenzidine &#40;DAB&#41; kit &#40;Beyotime&#41; according to protocol&#46; The positive staining was observed with a light microscope&#46;</p></span><span id="sec0013" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;11</span><span class="elsevierStyleSectionTitle" id="cesectitle0020">Animal experiment</span><p id="para0021" class="elsevierStylePara elsevierViewall">Short hairpin RNA &#40;shRNA&#41; targeting circ&#95;0078710 &#40;sh-circ&#95;0078710&#41; and sh-con were packaged in lentivirus for circ&#95;0078710 stable knockdown by GENESEED&#46; Balb&#47;c mice &#40;female&#44; 6 weeks old&#41; were purchased from Beijing Vital River Laboratory Animal Technology Co&#46;&#44; Ltd&#46; &#40;Beijing&#44; China&#41;&#46; Sh-circ&#95;0078710 huh7 cells were injected into 1&#46;5&#160;&#215;&#160;10<span class="elsevierStyleSup">6</span> cells&#47;mice&#44; and the subcutaneous tumor size was measured at week 1&#44; 2&#44; 3&#44; 4 and 5&#46; Tumor volume was calculated according to the formula&#58; volume &#61;1&#47;2 &#40;length&#160;&#215;&#160;width<span class="elsevierStyleSup">2</span>&#41;&#46; And the mice were sacrificed after measuring the subcutaneous tumor size at fifth week&#44; and the tumor quality was measured&#46; Then the corresponding experiment was carried out&#46;</p></span><span id="sec0014" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;12</span><span class="elsevierStyleSectionTitle" id="cesectitle0021">Statistical analysis</span><p id="para0022" class="elsevierStylePara elsevierViewall">GraphPad Prism 7 &#40;GraphPad&#44; San Diego&#44; CA&#44; USA&#41; was utilized for data analysis&#46; Difference comparison between groups were determined using Student&#39;s <span class="elsevierStyleItalic">t</span>-test&#46; Pearson&#39;s correlation analysis was applied to measure the correlation between two groups&#46; Each experiment was carried out at least three times and the final data were shown as the mean &#177; standard deviation &#40;SD&#41;&#46; Using <span class="elsevierStyleItalic">P</span>&#60;0&#46;05 meant significant difference&#46;</p></span></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3</span><span class="elsevierStyleSectionTitle" id="cesectitle0022">Results</span><span id="sec0016" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;1</span><span class="elsevierStyleSectionTitle" id="cesectitle0023">Circ&#95;0078710 and TXNDC5 were highly expressed in liver cancer</span><p id="para0023" class="elsevierStylePara elsevierViewall">In order to investigate the role of circ&#95;0078710 and TXNDC5 in liver cancer&#44; we first detected the expression level of circ&#95;0078710 and TXNDC5 in liver cancer tissues by qRT-PCR&#46; As a result&#44; the expression of circ&#95;0078710 and TXNDC5 were significantly increased in liver cancer tissues &#40;<span class="elsevierStyleItalic">n</span>&#160;&#61;&#160;30&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46;&#160;1</a>A and B&#41;&#46; Similarly&#44; the expression level of TXNDC5 protein was significantly increased in liver cancer tissues &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46;&#160;1</a>C&#41;&#46; Pearson&#39;s correlation analysis showed that circ&#95;0078710 was significantly correlated with TXNDC5 and had a positive regulatory relationship &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46;&#160;1</a>D&#41;&#46; In addition&#44; circ&#95;0078710 was analyzed on chr6 with a size of 28899 bp using the cancer-specific circRNA database &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46;&#160;1</a>E&#41;&#46; To sum up&#44; Circ&#95;0078710 and TXNDC5 were up-regulated in liver cancer&#46;</p><elsevierMultimedia ident="fig0001"></elsevierMultimedia></span><span id="sec0017" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;2</span><span class="elsevierStyleSectionTitle" id="cesectitle0024">Silencing circ&#95;0078710 inhibits the growth of HCC cells</span><p id="para0024" class="elsevierStylePara elsevierViewall">In order to further explore the role of circ&#95;0078710 in liver cancer&#44; circ&#95;0078710 was knocked down and transfected into different liver cancer cell lines for detection and analysis&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>A&#44; the expression of circ&#95;0078710 was significantly increased in all three different HCC cells&#46; Huh7 and Hep3B cells with the highest expression were selected for subsequent experiments&#46; The transfection efficiency of si-circ&#95;0078710 was detected by qRT-PCR &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>B&#41;&#46; Si-circ&#95;0078710 significantly reduced the cell viability of huh7 and Hep3B cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>C and D&#41;&#46; Functionally&#44; silencing circ&#95;0078710 significantly enhanced the apoptosis rate of HCC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>E&#41;&#46; Transwell results showed that knockdown of circ&#95;0078710 inhibited the migration and invasion of HCC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>F and G&#41;&#46; In addition&#44; down-regulation of circ&#95;0078710 significantly reduced glucose uptake&#44; lactic acid production&#44; and ATP levels in huh7 and Hep3B cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>H-J&#41;&#46; Western blot results showed that knockdown of circ&#95;0078710 significantly decreased the expression of ki-67 and promoted the up-regulation of bax &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46;&#160;2</a>K and L&#41;&#46; In general&#44; circ&#95;0078710 knockdown can promote apoptosis and inhibit cell viability of HCC cells&#46;</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia></span><span id="sec0018" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;3</span><span class="elsevierStyleSectionTitle" id="cesectitle0025">Silencing TXNDC5 inhibits the growth of HCC cells</span><p id="para0025" class="elsevierStylePara elsevierViewall">As shown in <a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>A&#44; the expression of TXNDC5 was significantly increased in all three different HCC cells&#46; In the same way&#44; huh7 and Hep3B cells with the highest expression were selected for subsequent experiments&#46; The transfection efficiency of si-TXNDC5 was detected by Western blot &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>B&#41;&#46; Si-TXNDC5 significantly reduced the cell viability of huh7 and Hep3B cells &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>C and D&#41;&#46; Functionally&#44; silencing TXNDC5 significantly enhanced the apoptosis rate of HCC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>E&#41;&#46; Transwell results showed that si-TXNDC5 inhibited the migration and invasion of HCC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>F and G&#41;&#46; In addition&#44; si-TXNDC5 significantly reduced glucose uptake&#44; lactic acid production&#44; and ATP levels in huh7 and Hep3B cells &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>H-J&#41;&#46; Western blot results showed that si-TXNDC5 significantly decreased the expression of ki67 and promoted the expression of bax &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46;&#160;3</a>K and L&#41;&#46; In general&#44; si-TXNDC5 can inhibit the viability&#44; migration and invasion of HCC cells&#46;</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia></span><span id="sec0019" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;4</span><span class="elsevierStyleSectionTitle" id="cesectitle0026">MiR-431-5p was target of both circ&#95;0078710 and TXNDC5</span><p id="para0026" class="elsevierStylePara elsevierViewall">We predicted that miR-431-5p was the target of circ&#95;0078710 and that TXNDC5 was the target gene of miR-431-5p using circinteractome &#40;<a href="https://circinteractome.nia.nih.gov/mirna_target_sites.html">https&#58;&#47;&#47;circinteractome&#46;nia&#46;nih&#46;gov&#47;mirna&#95;target&#95;sites&#46;html</a>&#41; and starbase &#40;<a href="http://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA">http&#58;&#47;&#47;starbase&#46;sysu&#46;edu&#46;cn&#47;agoClipRNA&#46;php&#63;source&#61;mRNA</a>&#41; bioinformatics tools&#44; respectively&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>A is the binding site of circ&#95;0078710 and miR-431-5p&#46; Dual-luciferase reporter assay results showed that in huh7 and Hep3B cells&#44; the combined transfection of circ&#95;0078710-WT and miR-431-5p significantly inhibited luciferase activity&#44; while there was no significant change in luciferase activity after the combined transfection of circ&#95;0078710-MUT and miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>B and C&#41;&#46; Next&#44; qRT-PCR was used to detect the co-transfection of si-circ&#95;0078710 and anti-miR-431-5p&#44; and the transfection efficiency was verified by detecting the expression level of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>D and E&#41;&#46; The binding sites of miR-431-5p and TXNDC5 are shown in <a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>F&#46; Similarly&#44; dual-luciferase reporter assay results showed that in huh7 and Hep3B cells&#44; the combined transfection of TXNDC5 3&#8217;UTR-WT and miR-431-5p significantly inhibited luciferase activity&#44; while the combined transfection of TXNDC5 3&#8217;UTR-MUT and miR-431-5p showed no significant change in luciferase activity &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>G and H&#41;&#46; Finally&#44; the protein expression of TXNDC5 in huh7 and Hep3B cells after co-transfection of si-circ&#95;0078710 and anti-miR-431-5p was detected by Western blot&#46; The results showed that si-circ&#95;0078710 could significantly reduce the protein level of TXNDC5&#44; but this was relatively recovered with the addition of miR-431-5p inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46;&#160;4</a>I and J&#41;&#46; In general&#44; miR-431-5p is the target of circ&#95;0078710&#44; and TXNDC5 is the target gene of miR-431-5p&#46;</p><elsevierMultimedia ident="fig0004"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;5</span><span class="elsevierStyleSectionTitle" id="cesectitle0027">The miR-431-5p inhibitor recovered the inhibition of cell behavior caused by circ&#95;0078710 knockdown</span><p id="para0027" class="elsevierStylePara elsevierViewall">QRT-PCR was used to detect the transfection efficiency by detecting the expression level of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>A and B&#41;&#46; The silencing of miR-431-5p eliminated the inhibitory effect on huh7 and Hep3B cells viability induced by si-circ&#95;0078710 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>C and D&#41;&#46; Functionally&#44; the addition of miR-431-5p inhibitor can reduce the up-regulated apoptosis rate due to si-circ&#95;0078710 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>E and <a class="elsevierStyleCrossRef" href="#fig0005">5</a>F&#41;&#46; Meanwhile&#44; the Transwell experiment showed that the addition of anti-miR-431-5p restored the decrease of migration and invasion caused by circ&#95;0078710 knockdown &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>G and H&#41;&#46; Moreover&#44; anti-miR-431-5p significantly up-regulate glucose uptake&#44; lactic acid production&#44; and ATP levels in huh7 and Hep3B cells decreased by si-circ&#95;0078710 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>I &#8211; K&#41;&#46; Functionally&#44; Western blot analysis showed that anti-miR-495-3p could restore the protein levels of ki67 and bax affected by si-circ&#95;0078710 &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46;&#160;5</a>L and M&#41;&#46; In short&#44; miR-431-5p inhibitors can rescue the effect of si-circ&#95;0078710 in HCC cells&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0021" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;6</span><span class="elsevierStyleSectionTitle" id="cesectitle0028">Overexpression of TXNDC5 recovered the inhibition of cell behavior caused by miR-431-5p</span><p id="para0028" class="elsevierStylePara elsevierViewall">The relationship between miR-431-5p and TXNDC5 was further verified&#46; Firstly&#44; the over-expression efficiency of miR-431-5p was verified by qRT-PCR &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>A&#41;&#46; Next&#44; the expression level of TXNDC5 was detected by Western blot to verify the transfection efficiency of co-transfected miR-431-5p and pcDNA-TXNDC5 &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>B and C&#41;&#46; Functionally&#44; pcDNA-TXNDC5 eliminated the inhibitory effect on huh7 and Hep3B cells viability induced by overexpression of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>D and E&#41;&#46; And the transfected huh7 and Hep3B cells apoptosis rate were rescued by pcDNA-TXNDC5 &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;6</a>F and G&#41;&#46; Meanwhile&#44; the Transwell experiment showed that the addition of pcDNA-TXNDC5 restored the decrease of migration and invasion caused by overexpression of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>H and I&#41;&#46; Moreover&#44; pcDNA-TXNDC5 significantly up-regulate glucose uptake&#44; lactic acid production&#44; and ATP levels in huh7 and Hep3B cells decreased by overexpression of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>J &#8211; L&#41;&#46; Functionally&#44; Western blot analysis showed that pcDNA-TXNDC5 could restore the protein levels of ki67 and bax affected by overexpression of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46;&#160;6</a>M and N&#41;&#46; In short&#44; pcDNA-TXNDC5 can rescue the effect of overexpression of miR-431-5p in HCC cells&#46;</p><elsevierMultimedia ident="fig0006"></elsevierMultimedia></span><span id="sec0022" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;7</span><span class="elsevierStyleSectionTitle" id="cesectitle0029">Circ&#95;0078710 affects the growth of liver cancer tumor <span class="elsevierStyleItalic">in vivo</span></span><p id="para0029" class="elsevierStylePara elsevierViewall">In order to better explore the effect of circ&#95;0078710 on liver cancer&#44; we constructed a xenotransplantation model to explore the effect of circ&#95;0078710 knockdown in liver cancer tumor&#46; By recording and observing tumor volume &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46;&#160;7</a>A&#41; and volume weight &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46;&#160;7</a>B&#41;&#44; we found that huh7 cells transfected with sh-circ&#95;0078710 could inhibit tumor growth in a transplanted tumor model&#46; Then&#44; the expression of circ&#95;0078710 and miR-431-5p was analyzed by qRT-PCR&#44; and the results showed that knockdown of circ&#95;0078710 could significantly decrease the expression of circ&#95;0078710 and enhance the expression of miR-431-5p &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46;&#160;7</a>C and <a class="elsevierStyleCrossRef" href="#fig0007">7</a>D&#41;&#46; And Western blot analysis also confirmed that sh-circ&#95;0078710 remarkably reduced the TXNDC5 protein level &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46;&#160;7</a>E&#41;&#46; Lastly&#44; the immunoreactive levels of TXNDC5 were downregulated in tumor tissues from sh-circ&#95;0078710 group compared with sh-con group &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46;&#160;7</a>F&#41;&#46; In short&#44; circ&#95;0078710 knockdown reduced the growth of liver cancer tumor&#46;</p><elsevierMultimedia ident="fig0007"></elsevierMultimedia></span></span><span id="sec0023" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">4</span><span class="elsevierStyleSectionTitle" id="cesectitle0030">Discussion</span><p id="para0030" class="elsevierStylePara elsevierViewall">Liver cancer is a malignant tumor disease that seriously threatens human health&#44; with high mortality rate and difficult treatment&#46; More and more reports have shown that circRNAs&#44; as a newly discovered endogenous non-coding RNA&#44; play an indispensable role numerous cancers&#44; such as breast cancer <a class="elsevierStyleCrossRef" href="#bib0020">&#91;20&#93;</a>&#44; ovarian cancer <a class="elsevierStyleCrossRef" href="#bib0021">&#91;21&#93;</a>&#44; esophageal cancer <a class="elsevierStyleCrossRef" href="#bib0022">&#91;22&#93;</a> and liver cancer <a class="elsevierStyleCrossRef" href="#bib0009">&#91;9&#93;</a>&#46; However&#44; there are relatively few studies on circ&#95;0078710 in cancer&#46; For instance&#44; circ&#95;0078710 was highly expressed in HCC patients&#44; witch consistent with our study <a class="elsevierStyleCrossRef" href="#bib0010">&#91;10&#93;</a>&#46; And Xie et&#160;al<span class="elsevierStyleItalic">&#46;</span> found that abnormal up-regulation of circ&#95;0078710 in HCC cell lines promoted malignant behavior and tumor growth <a class="elsevierStyleCrossRef" href="#bib0010">&#91;10&#93;</a>&#46; Similarly&#44; we found that cell proliferation&#44; migration and invasion ability of huh7 and Hep3B cells could be significantly inhibited and the apoptotic ability of cells was promoted by silencing circ&#95;0078710&#46; In addition&#44; we also found that down-regulation of circ&#95;0078710 inhibited glycolytic metabolism&#46; Animal experiments showed that knocking down circ&#95;0078710 could significantly inhibit tumor growth in nude mice <span class="elsevierStyleItalic">in vivo</span>&#46; These results suggested that circ&#95;0078710 could be a potential therapeutic target for hepatocellular carcinoma&#46;</p><p id="para0031" class="elsevierStylePara elsevierViewall">Our mechanistic analysis showed that miR-431-5p was a target of circ&#95;0078710&#46; Previous studies found that the recovery of miR-431-5p eliminated the cancer-promoting effect of ATG3 in colon cancer <a class="elsevierStyleCrossRef" href="#bib0023">&#91;23&#93;</a>&#46; In addition&#44; miR-431-5p was significantly down-regulated in both HCC cells and tissues&#44; and overexpression of miR-431-5p significantly inhibited the activity and metastasis of HCC cells by inhibiting UROC28 gene <a class="elsevierStyleCrossRef" href="#bib0016">&#91;16&#93;</a>&#46; Consistently with the above study results&#44; we found that inhibition of miR-431-5p recovered the prohibitive effects of silencing circ&#95;0078710 on proliferation&#44; migration&#44; invasion and glycolytic metabolism of HCC cells&#46; These showed that miR-431-5p may interact with circ&#95;0078710 to play a role in liver cancer&#46;</p><p id="para0032" class="elsevierStylePara elsevierViewall">It is well known that TXNDC5 is an oncogene that is up-regulated in many malignant tumors&#44; such as HCC&#44; castration-resistant prostate cancer&#44; and esophageal squamous cell carcinoma &#91;<a class="elsevierStyleCrossRef" href="#bib0019">19</a>&#44;<a class="elsevierStyleCrossRefs" href="#bib0024">24-26</a>&#93;&#46; In this study&#44; we demonstrated that TXNDC5 is a target of miR-431-5p&#46; Similarly&#44; Zang and colleagues found that miR-1296-5p plays a tumor-promoting role in HCC by targeting TXNDC5&#44; and TXNDC5 is highly expressed in HCC&#44; which is consistent with our results <a class="elsevierStyleCrossRef" href="#bib0019">&#91;19&#93;</a>&#46; Similarly&#44; Yu et&#160;al<span class="elsevierStyleItalic">&#46;</span> found that TXNDC5 was highly expressed in HCC&#44; and that TXNDC5 overexpression played a catalytic role in malignant behavior of HCC cells <a class="elsevierStyleCrossRef" href="#bib0024">&#91;24&#93;</a>&#46; Our results also support this conclusion&#44; TXNDC5 unusual increased restored the inhibition of miR-431-5p on the proliferation&#44; migration&#44; invasion and glycolytic metabolism of huh7 and Hep3B cells&#46; More importantly&#44; circ&#95;0078710 knockdown significantly weakened TXNDC5 expression by releasing miR-431-5p&#44; suggesting that circ&#95;0078710 regulates the miR-431-5p&#47;TXNDC5 pathway&#46;</p><p id="para0033" class="elsevierStylePara elsevierViewall">In summary&#44; we found that the expression of circ&#95;0078710 was up-regulated in liver cancer&#46; Circ&#95;0078710 knockdown inhibited the malignant behavior of HCC cells&#46; We demonstrated that down-regulation of circ&#95;0078710 partially inhibits the progression of liver cancer by regulating the miR-431-5p&#47;TXNDC5 pathway&#46; This study suggests that inhibition of circ&#95;0078710 may be a promising strategy for the treatment of HCC&#46;</p></span><span id="sec0024" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0031">Funding</span><p id="para0034" class="elsevierStylePara elsevierViewall">None&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:3 [
          "identificador" => "xres1716463"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abss0001"
              "titulo" => "Introduction and objectives"
            ]
            1 => array:2 [
              "identificador" => "abss0002"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abss0003"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abss0004"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1517072"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1517073"
          "titulo" => "Abbreviations"
        ]
        3 => array:2 [
          "identificador" => "sec0001"
          "titulo" => "Introduction"
        ]
        4 => array:3 [
          "identificador" => "sec0002"
          "titulo" => "Methods"
          "secciones" => array:12 [
            0 => array:2 [
              "identificador" => "sec0003"
              "titulo" => "Patients and cell lines"
            ]
            1 => array:2 [
              "identificador" => "sec0004"
              "titulo" => "Cell transfection"
            ]
            2 => array:2 [
              "identificador" => "sec0005"
              "titulo" => "Quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;"
            ]
            3 => array:2 [
              "identificador" => "sec0006"
              "titulo" => "Western blot analysis"
            ]
            4 => array:2 [
              "identificador" => "sec0007"
              "titulo" => "Cell counting Kit-8 assay"
            ]
            5 => array:2 [
              "identificador" => "sec0008"
              "titulo" => "Flow cytometry assay"
            ]
            6 => array:2 [
              "identificador" => "sec0009"
              "titulo" => "Transwell assay"
            ]
            7 => array:2 [
              "identificador" => "sec0010"
              "titulo" => "Glycolysis analyses"
            ]
            8 => array:2 [
              "identificador" => "sec0011"
              "titulo" => "Dual-luciferase reporter assay"
            ]
            9 => array:2 [
              "identificador" => "sec0012"
              "titulo" => "Immunohistochemical &#40;IHC&#41; staining analysis"
            ]
            10 => array:2 [
              "identificador" => "sec0013"
              "titulo" => "Animal experiment"
            ]
            11 => array:2 [
              "identificador" => "sec0014"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        5 => array:3 [
          "identificador" => "sec0015"
          "titulo" => "Results"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0016"
              "titulo" => "Circ&#95;0078710 and TXNDC5 were highly expressed in liver cancer"
            ]
            1 => array:2 [
              "identificador" => "sec0017"
              "titulo" => "Silencing circ&#95;0078710 inhibits the growth of HCC cells"
            ]
            2 => array:2 [
              "identificador" => "sec0018"
              "titulo" => "Silencing TXNDC5 inhibits the growth of HCC cells"
            ]
            3 => array:2 [
              "identificador" => "sec0019"
              "titulo" => "MiR-431-5p was target of both circ&#95;0078710 and TXNDC5"
            ]
            4 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "The miR-431-5p inhibitor recovered the inhibition of cell behavior caused by circ&#95;0078710 knockdown"
            ]
            5 => array:2 [
              "identificador" => "sec0021"
              "titulo" => "Overexpression of TXNDC5 recovered the inhibition of cell behavior caused by miR-431-5p"
            ]
            6 => array:2 [
              "identificador" => "sec0022"
              "titulo" => "Circ&#95;0078710 affects the growth of liver cancer tumor in vivo"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0023"
          "titulo" => "Discussion"
        ]
        7 => array:2 [
          "identificador" => "sec0024"
          "titulo" => "Funding"
        ]
        8 => array:2 [
          "identificador" => "xack605496"
          "titulo" => "Acknowledgment"
        ]
        9 => array:1 [
          "titulo" => "Reference"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2021-06-14"
    "fechaAceptado" => "2021-08-17"
    "PalabrasClave" => array:1 [
      "en" => array:2 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1517072"
          "palabras" => array:5 [
            0 => "Circ&#95;0078710"
            1 => "miR-431-5p"
            2 => "TXNDC5"
            3 => "Liver cancer"
            4 => "Glycolysis"
          ]
        ]
        1 => array:4 [
          "clase" => "abr"
          "titulo" => "Abbreviations"
          "identificador" => "xpalclavsec1517073"
          "palabras" => array:2 [
            0 => "TXNDC5"
            1 => "HCC"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0002">Introduction and objectives</span><p id="spara008" class="elsevierStyleSimplePara elsevierViewall">Liver cancer&#44; with high recurrence and metastasis rate&#44; is a common malignant tumor&#46; Circular RNA&#95;0078710 &#40;circ&#95;0078710&#41; has been shown to be take part in the advance of hepatocellular carcinoma&#46; However&#44; the interaction between circ&#95;0091579 and microRNA-431-5p &#40;miR-431-5p&#41; in liver cancer has not been studied&#46;</p></span> <span id="abss0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0003">Materials and methods</span><p id="spara009" class="elsevierStyleSimplePara elsevierViewall">The expressions of circ&#95;0078710&#44; miR-431-5p and Thioredoxin domain-containing 5 &#40;TXNDC5&#41; in liver cancer tissues and cells were detected by quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;&#46; The effect of cric&#95;0078710 in liver cancer cells was assessed by Cell Counting Kit-8 &#40;CCK-8&#41; assay&#44; Transwell&#44; flow cytometry and Dual-luciferase reporter assay&#46; Glycolysis metabolism was examined by lactate production&#44; glucose uptake and ATP level&#46; The protein levels of ki-67&#44; bax and TXNEC5 were tested by western blot&#46; The role of circ&#95;0078710 <span class="elsevierStyleItalic">in vivo</span> was determined by animal study&#46;</p></span> <span id="abss0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Results</span><p id="spara010" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 and TXNDC5 were notably expressed in liver cancer tissues and cells&#46; Circ&#95;0078710 knockdown diminished proliferation&#44; migration&#44; invasion and glycolytic metabolism of huh7 and Hep3B cells&#44; and accelerated cell apoptosis&#46; MiR-431-5p is the target of circ&#95;0078710&#44; and silence circ&#95;0078710 can inhibit the malignant behavior and glycolysis of hepatocellular carcinoma &#40;HCC&#41; cells by releasing miR-431-5p&#46; In addition&#44; TXNDC5 was a target of miR-431-5p&#44; and overexpression of TXNDC5 restored cell proliferation and glycolysis inhibition due to miR-431-5p&#46; Animal experiments made clear the anti-tumor effect of circ&#95;0078710 knockdown&#46;</p></span> <span id="abss0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Conclusion</span><p id="spara011" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 promotes the progression of liver cancer by regulating TXNDC5 expression by targeting miR-431-5p&#46; These results demonstrate that circ&#95;0078710 could be a remedy target for liver cancer&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abss0001"
            "titulo" => "Introduction and objectives"
          ]
          1 => array:2 [
            "identificador" => "abss0002"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abss0003"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abss0004"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1897
            "Ancho" => 3583
            "Tamanyo" => 339140
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 and TXNDC5 were up-regulated in liver cancer&#46; &#40;A&#44; B&#41; The expression of circ&#95;0078710 and TXNDC5 in liver cancer tissues &#40;<span class="elsevierStyleItalic">n&#160;&#61;</span>&#160;30&#41; were tested by qRT-PCR&#46; &#40;C&#41; Western blot assay detected the expression of TXNDC5 protein&#46; &#40;D&#41; The correlation between circ&#95;0078710 and TXNDC5 expression in liver cancer tissues was analyzed by Pearson&#39;s correlation analysis&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 4208
            "Ancho" => 3583
            "Tamanyo" => 1569530
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 knockdown can inhibit the viability&#44; migration and invasion of HCC cells&#46; &#40;A&#41; QRT-PCR was used to detect the expression of circ&#95;0078710 in three different HCC cells&#46; &#40;B&#41; The transfection efficiency of si-circ&#95;0078710 was detected by qRT-PCR&#46; &#40;C&#44; D&#41; CCK-8 was used to detect cell viability&#46; &#40;E&#41; Flow cytometry was used to detect huh7 and Hep3B cells apoptosis&#46; &#40;F&#44; G&#41; Transwell assay was used to assess cell migration and invasion&#46; &#40;H-J&#41; Glucose uptake&#44; lactic acid production&#44; and ATP levels were measured to assess glycolysis metabolism using commercial kits&#46; &#40;K&#44; L&#41; Western blot assay detected the expression of ki-67 and bax protein&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0003"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2477
            "Ancho" => 3583
            "Tamanyo" => 523466
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0003"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">TXNDC5 knockdown can inhibit the viability&#44; migration and invasion of HCC cells&#46; &#40;A&#41; QRT-PCR was used to detect the expression of TXNDC5 in HCCLM3&#44; huh7 and Hep3B cells&#46; &#40;B&#41; The transfection efficiency of si-TXNDC5 was detected by qRT-PCR&#46; &#40;C&#44; D&#41; CCK-8 was used to detect cell viability&#46; &#40;E&#41; Flow cytometry was used to detect huh7 and Hep3B cells apoptosis&#46; &#40;F&#44; G&#41; Transwell assay was used to assess cell migration and invasion&#46; &#40;H-J&#41; Glucose uptake&#44; lactic acid production&#44; and ATP levels were measured to assess glycolysis metabolism using commercial kits&#46; &#40;K&#44; L&#41; Western blot assay detected the expression of ki67 and bax protein&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0004"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1539
            "Ancho" => 3583
            "Tamanyo" => 349949
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0004"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara004" class="elsevierStyleSimplePara elsevierViewall">MiR-431-5p was target of both circ&#95;0078710 and TXNDC5&#46; &#40;A&#44; F&#41; The binding site of circ&#95;0078710 and miR-431-5p&#44; and the binding sites of miR-431-5p and TXNDC5&#46; &#40;B&#44; C&#44; G&#44; H&#41; Dual-luciferase reporter assays were performed to confirm the association between circ&#95;0078710 and miR-431-5p&#44; and miR-431-5p and TXNDC5 in huh7 and Hep3B cells&#46; &#40;D&#44; E&#41; qRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells&#46; &#40;I&#44; J&#41; the protein expression of TXNDC5 in transfected huh7 and Hep3B cells was detected by Western blot&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 3161
            "Ancho" => 3583
            "Tamanyo" => 897870
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara005" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 regulate the proliferation&#44; migration&#44; and invasion by targeting miR-431-5p in liver cancer cells&#46; &#40;A&#44; B&#41; qRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells&#46; &#40;C&#44; D&#41; CCK-8 was used to detect cell viability in transfected huh7 and Hep3B cells&#46; &#40;E&#44; F&#41; Flow cytometry was used to detect huh7 and Hep3B cells apoptosis&#46; &#40;G&#44; H&#41; Transwell assay was used to assess cell migration and cell invasion&#46; &#40;I-K&#41; Glucose uptake&#44; lactic acid production&#44; and ATP levels were measured to assess glycolysis metabolism using commercial kits&#46; &#40;L&#44; M&#41; The protein levels of ki67 and bax were measured by Western blot&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "fig0006"
        "etiqueta" => "Fig&#46; 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 2944
            "Ancho" => 3583
            "Tamanyo" => 863398
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0006"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara006" class="elsevierStyleSimplePara elsevierViewall">TXNDC5 regulate the proliferation&#44; migration&#44; and invasion by targeting miR-431-5p in liver cancer cells&#46; &#40;A&#41; QRT-PCR was used to detect the expression of miR-431-5p in transfected huh7 and Hep3B cells&#46; &#40;B&#44; C&#41; Western blot was used to detect the expression of TXNDC5 in transfected huh7 and Hep3B cells&#46; &#40;D&#44; E&#41; CCK-8 was used to detect cell viability in transfected huh7 and Hep3B cells&#46; &#40;F&#44; G&#41; Flow cytometry was used to detect huh7 and Hep3B cells apoptosis&#46; &#40;H&#44; I&#41; Transwell assay was used to assess cell migration and cell invasion&#46; &#40;J-L&#41; Glucose uptake&#44; lactic acid production&#44; and ATP levels were measured to assess glycolysis metabolism using commercial kits&#46; &#40;M&#44; N&#41; The protein levels of ki67 and bax were measured by Western blot&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "fig0007"
        "etiqueta" => "Fig&#46; 7"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr7.jpeg"
            "Alto" => 1981
            "Ancho" => 3583
            "Tamanyo" => 507223
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0007"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara007" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0078710 knockdown inhibited tumor growth <span class="elsevierStyleItalic">in vivo&#46;</span> &#40;A&#44; B&#41; Tumor volume and weight after circ&#95;0078710 knockdown <span class="elsevierStyleItalic">in vivo</span>&#46; &#40;C&#44; D&#41; Relative expression levels of circ&#95;0078710 and miR-431-5p in xenografts were detected by qRT-PCR&#46; &#40;E&#41; TXNDC5 protein level tested by western blot in xenografts&#46; &#40;F&#41; The levels of TXNDC5 was evaluated by immunohistochemical staining in tumor samples&#46; &#42;&#42;&#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;001&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "Reference"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec1"
          "bibliografiaReferencia" => array:26 [
            0 => array:3 [
              "identificador" => "bib0001"
              "etiqueta" => "&#91;1&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Current state of liver-directed therapies and combinatory approaches with systemic therapy in hepatocellular carcinoma &#40;HCC&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P Viveiros"
                            1 => "A Riaz"
                            2 => "RJ Lewandowski"
                            3 => "D Mahalingam"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Cancers &#40;Basel&#41;"
                        "fecha" => "2019"
                        "volumen" => "11"
                        "itemHostRev" => array:3 [
                          "pii" => "S0165587618305275"
                          "estado" => "S300"
                          "issn" => "01655876"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0002"
              "etiqueta" => "&#91;2&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "JM Llovet"
                            1 => "J Zucman-Rossi"
                            2 => "E Pikarsky"
                            3 => "B Sangro"
                            4 => "M Schwartz"
                            5 => "M Sherman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrdp.2016.18"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Rev Dis Primers"
                        "fecha" => "2016"
                        "volumen" => "2"
                        "paginaInicial" => "16018"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27158749"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0003"
              "etiqueta" => "&#91;3&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Liver cancer cell of origin&#44; molecular class&#44; and effects on patient prognosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D Sia"
                            1 => "A Villanueva"
                            2 => "SL Friedman"
                            3 => "JM Llovet"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1053/j.gastro.2016.11.048"
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "2017"
                        "volumen" => "152"
                        "paginaInicial" => "745"
                        "paginaFinal" => "761"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28043904"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0004"
              "etiqueta" => "&#91;4&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of cancer-associated fibroblasts and fibrosis in liver cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S Affo"
                            1 => "LX Yu"
                            2 => "RF Schwabe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1146/annurev-pathol-052016-100322"
                      "Revista" => array:6 [
                        "tituloSerie" => "Annu Rev Pathol"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "153"
                        "paginaFinal" => "186"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27959632"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "&#91;5&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNAs and cancer&#58; biomarkers and master regulators"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "E Arnaiz"
                            1 => "C Sole"
                            2 => "L Manterola"
                            3 => "L Iparraguirre"
                            4 => "D Otaegui"
                            5 => "CH&#46; Lawrie"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.semcancer.2018.12.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Semin Cancer Biol"
                        "fecha" => "2019"
                        "volumen" => "58"
                        "paginaInicial" => "90"
                        "paginaFinal" => "99"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30550956"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0006"
              "etiqueta" => "&#91;6&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNAs are a large class of animal RNAs with regulatory potency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Memczak"
                            1 => "M Jens"
                            2 => "A Elefsinioti"
                            3 => "F Torti"
                            4 => "J Krueger"
                            5 => "A Rybak"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nature11928"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2013"
                        "volumen" => "495"
                        "paginaInicial" => "333"
                        "paginaFinal" => "338"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23446348"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0007"
              "etiqueta" => "&#91;7&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circles reshaping the RNA world&#58; from waste to treasure"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J Liu"
                            1 => "T Liu"
                            2 => "X Wang"
                            3 => "A&#46; He"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-017-0630-y"
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2017"
                        "volumen" => "16"
                        "paginaInicial" => "58"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28279183"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0008"
              "etiqueta" => "&#91;8&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ&#95;0000105 promotes liver cancer by regulating miR-498&#47;PIK3R1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Y Sun"
                            1 => "X Sun"
                            2 => "Q&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jgm.3256"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Gene Med"
                        "fecha" => "2020"
                        "volumen" => "22"
                        "paginaInicial" => "e3256"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32729955"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0009"
              "etiqueta" => "&#91;9&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA circRHOT1 promotes hepatocellular carcinoma progression by initiation of NR2F6 expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L Wang"
                            1 => "H Long"
                            2 => "Q Zheng"
                            3 => "X Bo"
                            4 => "X Xiao"
                            5 => "B&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-019-1046-7"
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2019"
                        "volumen" => "18"
                        "paginaInicial" => "119"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31324186"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "&#91;10&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNA has&#95;circ&#95;0078710 acts as the sponge of microRNA-31 involved in hepatocellular carcinoma progression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "B Xie"
                            1 => "Z Zhao"
                            2 => "Q Liu"
                            3 => "X Wang"
                            4 => "Z Ma"
                            5 => "H&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.gene.2018.10.043"
                      "Revista" => array:6 [
                        "tituloSerie" => "Gene"
                        "fecha" => "2019"
                        "volumen" => "683"
                        "paginaInicial" => "253"
                        "paginaFinal" => "261"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30342168"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0011"
              "etiqueta" => "&#91;11&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The widespread regulation of microRNA biogenesis&#44; function and decay"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J Krol"
                            1 => "I Loedige"
                            2 => "W&#46; Filipowicz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrg2843"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Genet"
                        "fecha" => "2010"
                        "volumen" => "11"
                        "paginaInicial" => "597"
                        "paginaFinal" => "610"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20661255"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0012"
              "etiqueta" => "&#91;12&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Disruption of microRNA nuclear transport in human cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "SA Melo"
                            1 => "M&#46; Esteller"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.semcancer.2014.02.012"
                      "Revista" => array:6 [
                        "tituloSerie" => "Semin Cancer Biol"
                        "fecha" => "2014"
                        "volumen" => "27"
                        "paginaInicial" => "46"
                        "paginaFinal" => "51"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24607282"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0013"
              "etiqueta" => "&#91;13&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA and miR-7 in cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "TB Hansen"
                            1 => "J Kjems"
                            2 => "CK&#46; Damgaard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1158/0008-5472.CAN-13-1568"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Res"
                        "fecha" => "2013"
                        "volumen" => "73"
                        "paginaInicial" => "5609"
                        "paginaFinal" => "5612"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24014594"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0014"
              "etiqueta" => "&#91;14&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Natural RNA circles function as efficient microRNA sponges"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "TB Hansen"
                            1 => "TI Jensen"
                            2 => "BH Clausen"
                            3 => "JB Bramsen"
                            4 => "B Finsen"
                            5 => "CK Damgaard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nature11993"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2013"
                        "volumen" => "495"
                        "paginaInicial" => "384"
                        "paginaFinal" => "388"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23446346"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "&#91;15&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ&#95;0001742 promotes tongue squamous cell carcinoma progression via miR-431-5p&#47;ATF3 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "YT Hu"
                            1 => "XX Li"
                            2 => "LW Zeng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.26355/eurrev_201912_19668"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Rev Med Pharmacol Sci"
                        "fecha" => "2019"
                        "volumen" => "23"
                        "paginaInicial" => "10300"
                        "paginaFinal" => "10312"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31841185"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0016"
              "etiqueta" => "&#91;16&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-431-5p alters the epithelial-to-mesenchymal transition markers by targeting UROC28 in hepatoma cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Q Kong"
                            1 => "J Han"
                            2 => "H Deng"
                            3 => "F Wu"
                            4 => "S Guo"
                            5 => "Z Ye"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/OTT.S173840"
                      "Revista" => array:6 [
                        "tituloSerie" => "Onco Targets Ther"
                        "fecha" => "2018"
                        "volumen" => "11"
                        "paginaInicial" => "6489"
                        "paginaFinal" => "6503"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30323624"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0017"
              "etiqueta" => "&#91;17&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fibroblast-enriched endoplasmic reticulum protein TXNDC5 promotes pulmonary fibrosis by augmenting TGFbeta signaling through TGFBR1 stabilization"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "TH Lee"
                            1 => "CF Yeh"
                            2 => "YT Lee"
                            3 => "YC Shih"
                            4 => "YT Chen"
                            5 => "CT Hung"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-020-18047-x"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2020"
                        "volumen" => "11"
                        "paginaInicial" => "4254"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32848143"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0018"
              "etiqueta" => "&#91;18&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of TXNDC5 in tumorigenesis of colorectal cancer cells&#58; in vivo and in vitro evidence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F Tan"
                            1 => "H Zhu"
                            2 => "X He"
                            3 => "N Yu"
                            4 => "X Zhang"
                            5 => "H Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ijmm.2018.3664"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Med"
                        "fecha" => "2018"
                        "volumen" => "42"
                        "paginaInicial" => "935"
                        "paginaFinal" => "945"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29749460"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0019"
              "etiqueta" => "&#91;19&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ&#95;0000517 contributes to hepatocellular carcinoma progression by upregulating TXNDC5 via sponging miR-1296-5p"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H Zang"
                            1 => "Y Li"
                            2 => "X Zhang"
                            3 => "G&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/CMAR.S244024"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Manag Res"
                        "fecha" => "2020"
                        "volumen" => "12"
                        "paginaInicial" => "3457"
                        "paginaFinal" => "3468"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32523376"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "&#91;20&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA circPLK1 promotes breast cancer cell proliferation&#44; migration and invasion by regulating miR-4500&#47;IGF1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G Lin"
                            1 => "S Wang"
                            2 => "X Zhang"
                            3 => "D&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12935-020-01694-x"
                      "Revista" => array:5 [
                        "tituloSerie" => "Cancer Cell Int"
                        "fecha" => "2020"
                        "volumen" => "20"
                        "paginaInicial" => "593"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33298061"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0021"
              "etiqueta" => "&#91;21&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ&#95;0025033 promotes the progression of ovarian cancer by activating the expression of LSM4 via targeting miR-184"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "W Hou"
                            1 => "Y&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Pathol Res Pract"
                        "fecha" => "2020"
                        "volumen" => "217"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0022"
              "etiqueta" => "&#91;22&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ0120816 acts as an oncogene of esophageal squamous cell carcinoma by inhibiting miR-1305 and releasing TXNRD1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "X Li"
                            1 => "L Song"
                            2 => "B Wang"
                            3 => "C Tao"
                            4 => "L Shi"
                            5 => "M&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12935-020-01617-w"
                      "Revista" => array:5 [
                        "tituloSerie" => "Cancer Cell Int"
                        "fecha" => "2020"
                        "volumen" => "20"
                        "paginaInicial" => "526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33292234"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0023"
              "etiqueta" => "&#91;23&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ATG3&#44; a Target of miR-431-5p&#44; promotes proliferation and invasion of colon cancer via promoting autophagy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "W Huang"
                            1 => "C Zeng"
                            2 => "S Hu"
                            3 => "L Wang"
                            4 => "J&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/CMAR.S226828"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Manag Res"
                        "fecha" => "2019"
                        "volumen" => "11"
                        "paginaInicial" => "10275"
                        "paginaFinal" => "10285"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31849517"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0024"
              "etiqueta" => "&#91;24&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNA-104718 acts as competing endogenous RNA and promotes hepatocellular carcinoma progression through microRNA-218-5p&#47;TXNDC5 signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J Yu"
                            1 => "M Yang"
                            2 => "B Zhou"
                            3 => "J Luo"
                            4 => "Z Zhang"
                            5 => "W Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Sci &#40;Lond&#41;"
                        "fecha" => "2019"
                        "volumen" => "133"
                        "paginaInicial" => "1487"
                        "paginaFinal" => "1503"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "&#91;25&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of TXNDC5 in castration-resistant prostate cancer-involvement of androgen receptor signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L Wang"
                            1 => "G Song"
                            2 => "X Chang"
                            3 => "W Tan"
                            4 => "J Pan"
                            5 => "X Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/onc.2014.401"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "2015"
                        "volumen" => "34"
                        "paginaInicial" => "4735"
                        "paginaFinal" => "4745"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25500540"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0026"
              "etiqueta" => "&#91;26&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HERG1 promotes esophageal squamous cell carcinoma growth and metastasis through TXNDC5 by activating the PI3K&#47;AKT pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Wang"
                            1 => "X Yang"
                            2 => "Y Guo"
                            3 => "L Shui"
                            4 => "S Li"
                            5 => "Y Bai"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13046-019-1284-y"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Exp Clin Cancer Res"
                        "fecha" => "2019"
                        "volumen" => "38"
                        "paginaInicial" => "324"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31331361"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack605496"
        "titulo" => "Acknowledgment"
        "texto" => "<p id="para0036" class="elsevierStylePara elsevierViewall">None&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/16652681/0000002700000001/v2_202205211521/S1665268121002507/v2_202205211521/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "78265"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/16652681/0000002700000001/v2_202205211521/S1665268121002507/v2_202205211521/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268121002507?idApp=UINPBA00004N"
]

Article information

ISSN: 16652681
Original language: English

DOI:10.1016/j.aohep.2021.100551

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	4	1	5
2024 October	7	2	9
2024 September	25	1	26
2024 August	20	3	23
2024 July	18	3	21
2024 June	27	4	31
2024 May	31	4	35
2024 April	22	5	27
2024 March	39	3	42
2024 February	54	4	58
2024 January	18	5	23
2023 December	13	6	19
2023 November	10	6	16
2023 October	18	10	28
2023 September	24	5	29
2023 August	26	4	30
2023 July	14	3	17
2023 June	20	2	22
2023 May	51	4	55
2023 April	64	5	69
2023 March	32	6	38
2023 February	32	1	33
2023 January	20	12	32
2022 December	33	4	37
2022 November	26	5	31
2022 October	13	7	20
2022 September	55	5	60
2022 August	29	13	42
2022 July	14	10	24
2022 June	11	10	21
2022 May	14	8	22
2022 April	25	14	39
2022 March	13	6	19
2022 February	17	5	22
2022 January	8	2	10
2021 December	10	6	16
2021 November	3	9	12
2021 October	4	18	22

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter