Circ_0008285 knockdown represses tumor development by miR-384/RRM2 axis in hepatocellular carcinoma

array:23 ["pii" => "S1665268122000850" "issn" => "16652681" "doi" => "10.1016/j.aohep.2022.100743" "estado" => "S300" "fechaPublicacion" => "2022-11-01" "aid" => "100743" "copyright" => "Fundación Clínica Médica Sur, A.C." "copyrightAnyo" => "2022" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:17 [ "pii" => "S1665268122001235" "issn" => "16652681" "doi" => "10.1016/j.aohep.2022.100781" "estado" => "S300" "fechaPublicacion" => "2022-11-01" "aid" => "100781" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "ind" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:5 [ "idiomaDefecto" => true "titulo" => "An Acknowledgement" "tienePdf" => "en" "tieneTextoCompleto" => 0 "contienePdf" => array:1 [ "en" => true ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122001235?idApp=UINPBA00004N" "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122001235/v3_202307180533/en/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S1665268122000989" "issn" => "16652681" "doi" => "10.1016/j.aohep.2022.100756" "estado" => "S300" "fechaPublicacion" => "2022-11-01" "aid" => "100756" "copyright" => "Fundación Clínica Médica Sur, A.C." "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Ann Hepatol. 2022;27:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Hepatic mir-122-3p, mir-140-5p and mir-148b-5p expressions are correlated with cytokeratin-18 serum levels in MAFLD" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2333 "Ancho" => 3333 "Tamanyo" => 516988 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Liver histology, potential MAFLD biomarkers and microRNA expression from liver biopsies. A) Liver without steatosis, B) Liver with MAFLD, representative images of sixteen hepatic tissues obtained from human biopsies, stained with H&E. Original magnification 100×. C) Cytokeratin-18 (CK-18) serum levels in patients with and without MAFLD, D) hsa-miR-122-3p change rate, E) hsa-miR-140-5p change rate, and F) hsa-miR-148-5p change rate (2−ΔΔCT) between patients with and without MAFLD. The differences (*) in the mean ± standard deviation were considered significant with a p ≤ 0.001 between groups. Fold Change (FC)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Guillermo N. López-Sánchez, Eduardo Montalvo-Javé, Mayra Domínguez-Perez, Barbara Antuna-Puente, Fredy O. Beltrán-Anaya, Alfredo Hidalgo-Miranda, Norberto C. Chávez-Tapia, Misael Uribe, Natalia Nuño- Lámbarri" "autores" => array:9 [ 0 => array:2 [ "nombre" => "Guillermo N." "apellidos" => "López-Sánchez" ] 1 => array:2 [ "nombre" => "Eduardo" "apellidos" => "Montalvo-Javé" ] 2 => array:2 [ "nombre" => "Mayra" "apellidos" => "Domínguez-Perez" ] 3 => array:2 [ "nombre" => "Barbara" "apellidos" => "Antuna-Puente" ] 4 => array:2 [ "nombre" => "Fredy O." "apellidos" => "Beltrán-Anaya" ] 5 => array:2 [ "nombre" => "Alfredo" "apellidos" => "Hidalgo-Miranda" ] 6 => array:2 [ "nombre" => "Norberto C." "apellidos" => "Chávez-Tapia" ] 7 => array:2 [ "nombre" => "Misael" "apellidos" => "Uribe" ] 8 => array:2 [ "nombre" => "Natalia" "apellidos" => "Nuño- Lámbarri" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122000989?idApp=UINPBA00004N" "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122000989/v3_202307180533/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Circ_0008285 knockdown represses tumor development by miR-384/RRM2 axis in hepatocellular carcinoma" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Shuang Peng, Lai Yi, Lingzhi Liao, Yuling Bin, Weiming Qu, Hongsai Hu" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Shuang" "apellidos" => "Peng" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0001" ] 1 => array:2 [ "etiqueta" => "1" "identificador" => "fn1" ] ] ] 1 => array:3 [ "nombre" => "Lai" "apellidos" => "Yi" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0002" ] 1 => array:2 [ "etiqueta" => "1" "identificador" => "fn1" ] ] ] 2 => array:3 [ "nombre" => "Lingzhi" "apellidos" => "Liao" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0003" ] ] ] 3 => array:3 [ "nombre" => "Yuling" "apellidos" => "Bin" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0004" ] ] ] 4 => array:3 [ "nombre" => "Weiming" "apellidos" => "Qu" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0004" ] ] ] 5 => array:4 [ "nombre" => "Hongsai" "apellidos" => "Hu" "email" => array:1 [ 0 => "hhs716@126.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0004" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0001" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Department of Infectious, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China" "etiqueta" => "a" "identificador" => "aff0001" ] 1 => array:3 [ "entidad" => "Department of Hematology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China" "etiqueta" => "b" "identificador" => "aff0002" ] 2 => array:3 [ "entidad" => "Department of Pathology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China" "etiqueta" => "c" "identificador" => "aff0003" ] 3 => array:3 [ "entidad" => "Department of Gastroenterology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China" "etiqueta" => "d" "identificador" => "aff0004" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0001" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 3008 "Ancho" => 3500 "Tamanyo" => 853764 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0005" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "MiR-384 targeted RRM2 (A) The binding sites between miR-384 and RRM2 were predicted by online prediction tools (TargetScanHuman, miRWALK, and GEPIA). (B) Expression of RRM2 in HCC tissues was analyzed according to the GEPIA database. (C-D) The overall survival and disease-free survival analysis of RRM2 gene of interest can be presented. (F) Dual luciferase reporter assay to verify the binding relationship between miR-384 and RRM2. (G) RIP assays were used to detect the enrichment of miR-384 and RRM2 in anti-Ago2 groups. (H-I) qRT-PCR and Western blot analysis were performed to determine the effects of miR-384 mimics and inhibitors on RRM2 mRNA and protein levels. (J-K) qRT-PCR and Western blot was used to detect RRM2 mRNA and protein levels in tumor tissues and paracancerous tissues. (L-M) qRT-PCR and Western blot analysis was performed to detect RRM2 mRNA and protein levels in THLE-3, Huh7 and HCCLM3 cells. *P < 0.05." ] ] ] "textoCompleto" => "1IntroductionHepatocellular carcinoma (HCC) is a malignant tumor originating from hepatocytes and hepatic bile duct cells. HCC is the most common form of primary liver cancer and is the second-leading cause of cancer-associated death <a class="elsevierStyleCrossRef" href="#bib0001">[1]</a>. Multiple risk factors for the development of HCC have been identified, including alcohol, smoking, and hepatitis virus <a class="elsevierStyleCrossRef" href="#bib0002">[2]</a>. Most HCC is detected at an advanced stage, but treatment options are lacking at this point. HCC patients at an early stage can be treated with local ablation, surgical resection, or liver transplantation <a class="elsevierStyleCrossRef" href="#bib0003">[3]</a>. Therefore, early detection and prevention of HCC development are the most influential strategy to improve patient outcomes <a class="elsevierStyleCrossRef" href="#bib0004">[4]</a>. The development of HCC is a multi-step transformational process involving many genes and epigenetics <a class="elsevierStyleCrossRef" href="#bib0005">[5]</a>. The specific molecular mechanisms regarding the occurrence and development of HCC have not been fully elucidated. Therefore, it is particularly important to explore new biomarkers and oncogenic molecules for HCC.Among the family of non-coding RNAs, circRNA is a new RNA molecule that can exist stably on cells due to the absence of 3’-tail and 5’-cap structures, thus avoiding RNase R digestion [<a class="elsevierStyleCrossRef" href="#bib0006">6</a>, <a class="elsevierStyleCrossRef" href="#bib0007">7</a>]. CircRNAs were found to be specifically expressed for disease stages and selectively enriched in different types of tissues <a class="elsevierStyleCrossRef" href="#bib0008">[8]</a>. A growing number of studies have signified a robust link between abnormal circRNA expression and the development and occurrence of cancers, including HCC <a class="elsevierStyleCrossRefs" href="#bib0009">[9–11]</a>. CircRNA can affect gene expression mainly by sponging miRNA <a class="elsevierStyleCrossRef" href="#bib0012">[12]</a>. For example, circ_001680 can mediate the growth and migration of colorectal cancer tumors, while circ_001680 can reinforce the cancer stem cell (CSC) population in colorectal cancer by regulating miR-340/BMI1 axis <a class="elsevierStyleCrossRef" href="#bib0013">[13]</a>. Circ_0067934 targeted miR-545-3p/SLC7A11 axis to weaken ferroptosis in thyroid cancer <a class="elsevierStyleCrossRef" href="#bib0014">[14]</a>. Circ_0014130 acted as a sponge for miR-132-3p and promoted tumorigenesis and metastasis in bladder cancer by regulating the expression of KCNJ12 <a class="elsevierStyleCrossRef" href="#bib0015">[15]</a>. Circ_0008285 is derived from the CDYL gene and located at chr6:4891946-4892613, with a length of 667 bp. Circ_0008285 was significantly enhanced in cervical cancer and promoted cervical cancer progression by acting as a ceRNA for miR-211-5p to release SOX4 expression <a class="elsevierStyleCrossRef" href="#bib0016">[16]</a>. In addition, circ_0008285 is upregulated in HCC and is involved in apoptosis, proliferation and stemness of HCC cells <a class="elsevierStyleCrossRef" href="#bib0017">[17]</a>. However, the molecular mechanism of circ_0008285 in hepatocellular carcinogenesis was still not fully understood.Our study revealed that circ_0008285 silencing hindered the proliferation, migration and invasion but triggered apoptosis in HCC cells. Furthermore, circ_0008285affected the development of HCC through miR-384/ribonucleotide reductase subunit M2 (RRM2) axis.2Materials and methods2.1SubjectsCancer tissues and paired paracancerous tissues (>2 cm from the edge of cancerous tissues) of 55 HCC patients were surgically resected from HCC specimens and collected at The Affiliated Zhuzhou Hospital Xiangya Medical College CSU from 2019 to 2020. All tissues were frozen in liquid nitrogen urgently after resection and transferred to a -80°C refrigerator for storage. All patients were not treated with antitumor therapy such as radiotherapy, chemotherapy, or targeted drug therapy before surgery, and HCC tissues were postoperative histopathology confirmed.2.2Cell culture and transfectionNormal hepatocyte cell lines (THLE-3) and HCC cell lines (Huh 7 and HCCLM3) were purchased from the ATCC (Manassas, VA, USA) and cultured in DMEM medium (including 10% fetal bovine serum (FBS) + 100 U/ml penicillin + 100 μg/ ml streptomycin) in an incubator with 5% CO2, 95 % relative humidity at 37°C.Small interfering RNA targeting circ_0008285 (si-circ_0008285), miR-384 mimics (miR-384), miR-384 inhibitors (anti-miR-384), overexpression plasmids of RRM2 (pcDNA-RRM2) and negative controls (si-NC, miR-NC, anti-NC and pcDNA) were provided by GenePharma (Shanghai, China). Huh7 and HCCLM3 cells were inoculated in 6-well plates (5 × 105/well) and grown to 50% confluence, and the cultured cells were transfected using Lipofectamine™ 6000 (Beyotime, Shanghai, China).2.3RNA extraction and qRT-PCRRNA was extracted from total cells and tissues using the Trizol (Beyotime) reagent. The extracted total RNA was reversely transcribed into cDNA according to the instruction manual of miScript RT Kit (TaKaRa, Dalian, China). cDNA was used as a template for qRT-PCR by using SYBR Premix Ex Taq II (TaKaRa). U6 (for miRNA or nucleus) or GAPDH (for circRNA, mRNA, or cytoplasm) was used as an internal control. Relative RNA levels were calculated by using 2−ΔΔCT method. The specific primer sequences are shown in <a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>.<elsevierMultimedia ident="tbl0001"></elsevierMultimedia>2.4Subcellular fractionation locationCytoplasmic and nuclear RNA from HCC cells were isolated according to the instructions of the Cytoplasmic and Nuclear RNA Purification Kit (Beyotime), and the expression of circ_0008285 was detected by qRT-PCR.2.5Cell counting kit-8 (CCK-8) assayThe transfected cells were planted on 96-well plates. 10 μL CCK-8 solution (Beyotime) was added after 0 h, 24 h, 48 h and 72 h of incubation, and the optical density values at 450 nm were tested by a microplate reader.2.65-ethynyl-2’-deoxyuridine (Edu) stainingEdU Staining Proliferation Kit (Beyotime) was employed for the analysis of cell proliferation. The transfected cells were inoculated into 96-well plates, and each well was incubated with 50 μmol/L Edu solution for 2 h. The nuclear was then incubated with DAPI reaction solution for 30 min. The cells were observed under a fluorescence microscope.2.7Cell apoptosis assayAnnexin V-FITC/PI apoptosis detection kit (Solarbio, Beijing, China) was utilized to analyze cell apoptosis. The cells were resuspended with Annexin V binding buffer and incubated with Annexin V-FITC and PI solution in the dark. Cell apoptosis was examined by a flow cytometer.2.8Transwell assayTranswell chambers (Corning, Tewksbury, MA, USA) that precoated with (for invasion assay) or without (for migration assay) Matrigel matrix (Corning) were employed to detect cell migration and invasion. In brief, cells in non-serum medium were inoculated into the upper chamber of the transwell, and 10 % fetal bovine serum was added to the lower chamber and incubated for 24 h. Cells that migrated or invaded through the membranes were stained with 0.1% crystal violet solution for 30 minutes, and the results were analyzed by counting the number of migrated or invaded cells under the microscope.2.9Western blottingTissues and cells were fully lysed using RIPA lysis solution (Beyotime) and total proteins were extracted. The total proteins were subjected to SDS-PAGE gel electrophoresis, and then the separated proteins were electro-transferred onto the PVDF membrane (Millipore, Billerica, MA, USA), and the membrane was blocked with 10% skim milk powder for 2 h. The membranes were incubated with primary antibodies including: anti-Bax (ab53154, 1:1000), anti-Bcl-2 (ab196495, 1:1000), anti-E-cadherin (ab133597, 1:2000), anti-Vimentin (ab137321, 1:2000), anti-N-cadherin (ab211126, 1:2000), anti-RRM2 (ab154964, 1:1000) and anti-β-actin (ab8227, 1:2000), overnight at 4°C. Then, the membranes were incubated with Goat Anti-Rabbit IgG H&L (HRP) second antibody (ab205718, 1:10000). Finally, the membranes were developed using ECL reagent (Millipore) and analyzed semi-quantitatively using ImageJ software. The antibodies used in this experiment were obtained from Abcam (Cambridge, MA, USA).2.10Luciferase reporter assayBioinformatics was employed for the prediction of binding targets of circ_0008285 and RRM2. The wild-type (WT) sequences of circ_0008285 or RRM2 3′UTR containing miR-384 binding sequences were cloned into the pmirGLO vector (Promega, Madison, WI, USA), respectively, and the recombinant vectors were named circ_0008285-WT, RRM2 3′UTR-WT, circ_0008285-MUT and RRM2 3′UTR-MUT. The constructed plasmids and miR-384 mimics or miR-NC were co-transfected into HCC cells. The luciferase activity was measured at 48 h after transfection.2.11RNA immunoprecipitation (RIP) assayMagna RNA immunoprecipitation kit (Millipore) was employed for RIP assay. HCC cells were lysed in RIP lysis buffer; then, cell lysates were incubated with magnetic beads labeled with anti-IgG (ab190475, Abcam) and anti-Ago2 (ab186733, Abcam). Then, qRT-PCR was applied to test the relative expression of circ_0008285, miR-384 and RRM2 in the precipitates.2.12Xenograft mice modelShort hairpin RNA targeting circ_0008285 (sh-circ_0008285) or negative control (sh-NC) were packaged by lentivirus packaging to construct a stable transduced Huh7 cell line. The transfected Huh7 cells were adjusted to a concentration of 5 × 106/mL, inoculated into the right side of the back side of nude mice and then divided into 2 groups (6 nude mice for each group). The mice were placed in a specific pathogen-free room, and the general condition, time of graft tumor formation and size of the nude mice were recorded and observed. The longest diameter (L) and shortest diameter (W) of the xenograft tumors were measured every 7 days for 35 days with a vernier caliper, and their tumor volume (V) was calculated by using the formula: V = (L × W2)/2. The growth curve of the transplanted tumor was generated. 35 days later, the nude mice were killed, the tumor tissues were removed, tumor weights were measured, and subsequent experiments were performed. All animal experiments were approved by the Animal Care and Use Committee of The Affiliated Zhuzhou Hospital Xiangya Medical College CSU NO. ZX19617 and complied with the guidelines of the National Institutes of Health2.13Statistical analysisThe experimental data of 3 replicates were statistically analyzed and statistical images were plotted using GraphPad Prism 7.0 software. The measurement data were presented as mean ±standard deviation. The linear relationship between the expression levels of circ_0008285, miR-384 and RRM2 in cancer tissues was assessed by Spearman's correlation test. Student t-test or one-way analysis of variance (ANOVA) was used to compare the differences between the groups. Statistical significance was deemed when P<0.05.2.14Ethical statementsWritten informed consent was obtained from all participants and this study was permitted by the Ethics Committee of The Affiliated Zhuzhou Hospital Xiangya Medical College (CSU. NO. ZX19617).3Results3.1Circ_0008285 was highly expressed in the tissues and cells of HCCFirst, 55 pairs of HCC tissues and non-cancerous tissues were analyzed by qRT-PCR analysis. Results showed that circ_0008285 expression was significantly increased in HCC tissues compared to paraneoplastic tissues (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>A). Similarly, circ_0008285 expression was significantly upregulated in HCC cells (Huh7 and HCCLM3) compared to normal hepatocytes (THLE-3) (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>B). Cytoplasmic and nuclear RNA analysis showed that circ_00008285 was mainly presented in the cytoplasm (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>C-D). These results suggested that the aberrant expression of circ_0008285 in HCC tissues and cell lines may be closely associated with the progression of HCC.<elsevierMultimedia ident="fig0001"></elsevierMultimedia>3.2Circ_0008285 knockdown impeded cell proliferation, migration and invasion while promoted cell apoptosis in HCC cellsNext, to further explore the biological function of circ_0008285 in HCC, the expression of circ_0008285 was silenced in Huh7 and HCCLM3 cells. First, the cells were transfected with si-NC (as control) or si-circ_0008285. qRT-PCR was applied to analyze the transfection efficiency, and the results showed that transfection of si-circ_0008285 significantly decreased the expression of circ_0008285 in the cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>A). CCK8 and Edu assays showed that circ_0008285 silencing significantly inhibited the proliferative ability of cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>B-D). Flow cytometry analysis showed that knockdown of circ_0008285 significantly increased the apoptosis rate of Huh7 and HCCLM3 cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>E). The expression levels of pro-apoptotic protein Bax and anti-apoptotic protein Bcl-2 in HCC cells were detected by Western blot. In HCC cells with silencing of circ_0008285, the expression level of Bax was significantly upregulated and Bcl-2 expression level was significantly down-regulated in cells, clarifying that circ_0008285 interference promoted apoptosis in HCC cells (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>F). In addition, knockdown of circ_0008285 significantly inhibited cell migration and invasion (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>G-H). Epithelial-mesenchymal transition (EMT), which represents the metastatic tumor process, was examined by Western blot. The results showed that silencing of circ_0008285 significantly increased E-cadherin protein levels and decreased Vimentin and N-cadherin protein levels (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>I). In summary, we concluded that circ_0008285 silencing inhibited the proliferation, migration, invasion and EMT, but promoted apoptosis in HCC cells.<elsevierMultimedia ident="fig0002"></elsevierMultimedia>3.3Circ_0008285 directly targeted miR-384To further explore the regulatory mechanism of circ_0008285 in HCC, bioinformatics software was used to predict the potential miRNAs interacted with circ_0008285. Circinteractome database predicted the existence of complementary binding sites between circ_0008285 and miR-384 (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>A). To confirm the targeting relationship between circ_0008285 and miR-384, the overexpression efficiency of miR-384 mimics was first examined. qRT-PCR results showed that miR-384 expression was dramatically increased in HCC cells after transfection with miR-384 mimics (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>B). Subsequently, dual luciferase reporter assay showed that miR-384 overexpression significantly inhibited the luciferase activity of circ_0008285-WT group, while it had no significant effect on the luciferase activity of circ_0008285-MUT group (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>C). RIP analysis showed that compared with the anti-IgG group, circ_0008285 and miR-384 were significantly enriched in the immunoprecipitation of the anti-Ago2 group (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>D). It was found that miR-384 expression was significantly downregulated in HCC tissues and cell lines compared with adjacent normal tissues and normal hepatocytes (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>E-F). The above results suggested that miR-384 was targeted by circ_0008285.<elsevierMultimedia ident="fig0003"></elsevierMultimedia>3.4MiR-384 downregulation attenuated the influence of circ_0008285 interference on cell proliferation, migration, invasion, and apoptosis in HCC cellsCircRNAs are extremely rich in binding sites for miRNAs and therefore act like sponges by absorbing miRNAs <a class="elsevierStyleCrossRef" href="#bib0018">[18]</a>. The relationship between circ_0008285 and miR-384 has been demonstrated; however, the biological behavior of HCC that they regulate still needs to be determined. We transfected si-NC, si-circ_0008285, si-circ_0008285+anti-NC, or si-circ_0008285+anti-miR-384 in Huh7 and HCCLM3 cells and then performed a series of rescue experiments. First, the effectiveness of miR-384 inhibitor was verified by qRT-PCR (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>A). CCK8 and Edu assays showed that miR-384 inhibitor partially attenuated the inhibition effect of circ_0008285 interference on cell proliferation (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>B-D). In addition, miR-384 knockdown attenuated promoting effect of circ_0008285 downregulation on cell apoptosis (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>E). Western blot results showed that miR-384 deletion reversed the effect of circ_0008285 silencing on Bax and Bcl-2 protein levels (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>F). Transwell assay results showed that silencing of circ_0008285 resulted in a significant inhibition in cell migration and invasion, while the addition of anti-miR-384 resulted in a significant increase in cell migration and invasion (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>G-H). Downregulation of miR-384 reversed the effects of si-circ_0008285 on E-cadherin, Vimentin and N-cadherin levels (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>I). Overall, circ_0008285 silencing suppressed the malignant phenotype of HCC cells by targeting miR-384.<elsevierMultimedia ident="fig0004"></elsevierMultimedia>3.5MiR-384 targeted RRM2To further clarify the mechanism of miR-384, the target genes of miR-384 were predicted by online bioinformatics databases. We predicted the target gene RRM2 by TargetScanHuman, miRWALK and GEPIA simultaneously (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>A). RRM2 was found to be highly expressed in HCC tissues in the GEPIA database (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>B). Besides, according to the disease-free survival and overall survival data of the GEPIA database, we found that high RRM2 expression is associated with poorer disease-free survival and overall survival (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>C-D). MiR-384 and RRM2 were shown to contain complementary binding sites in the TargetScanHuman online database (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>E). Dual luciferase reporter assay showed that miR-384 overexpression significantly inhibited the luciferase activity of RRM2 3’UTR-WT group, while it had no significant effect on the luciferase activity of RRM2 3’UTR-MUT group (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>F). It has been widely known that miRNAs modulate the expression of target gene by binding to Ago2, the key component of RNA-induced silencing complex (RISC). Then RIP analysis was conducted, and the results showed that compared to the anti-IgG group, miR-384 and RRM2 were significantly enriched in the anti-Ago2 immunoprecipitation group (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>G). In addition, RRM2 mRNA and protein levels were significantly elevated by miR-384 inhibitor and were significantly down-regulated by miR-384 mimics (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>H-I). As expected, RRM2 mRNA and protein levels were significantly upregulated in HCC tissues and cell lines compared to adjacent normal tissues and normal hepatocytes (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>J-M). These results suggested that miR-384 could target RRM2.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>3.6RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation, migration, invasion, and apoptosis of HCC cellsMiRNAs could regulate the expression of their target genes through post-transcriptional regulation [<a class="elsevierStyleCrossRef" href="#bib0018">18</a>, <a class="elsevierStyleCrossRef" href="#bib0019">19</a>]. To determine whether RRM2 is involved in miR-384-mediated biological functions, we transfected miR-NC, miR-384, miR-384+pcDNA, or miR-384+pcDNA-RRM2 in Huh7 and HCCLM3 cells, and then performed a series of rescue experiments. First, qRT-PCR and Western blot results showed that RRM2 mRNA and protein levels were significantly elevated in the pcDNA-RRM2 group compared to the pcDNA group (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>A-B). In addition, overexpression of miR-384 significantly inhibited cell proliferation and promoted apoptosis, which were reversed by overexpression of RRM2 (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>B-F). Overexpression of miR-384 expression elevated the expression level of Bax and decreased the expression level of Bcl-2, which could be restored by RRM2 overexpression (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>G). Cell migration and invasion were inhibited by miR-384 mimics, and RRM2 overexpression impeded these effects (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>H-I). Furthermore, overexpression of RRM2 reversed the effects of miR-384 mimics on E-cadherin, Vimentin and N-cadherin protein levels (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>J). Taken together, miR-384 overexpression inhibited the malignant behaviors of HCC cells by targeting RRM2.<elsevierMultimedia ident="fig0006"></elsevierMultimedia>3.7Circ_0008285 regulated RRM2 expression by targeting miR-384Next, we further explored whether circ_0008285 could act as a miR-384 sponge to regulate RRM2 expression. The results showed that in Huh7 and HCCLM3 cells, circ_0008285 silencing caused a great reduction in RRM2 mRNA and protein levels, and miR-384 inhibitor attenuated these effects (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>A-B). Furthermore, in HCC tissues, miR-384 expression was negatively correlated with circ_0008285 and RRM2 expression levels, while circ_0008285 expression was positively correlated with RRM2 expression (<a class="elsevierStyleCrossRef" href="#fig0007">Fig. 7</a>C-E). These results implied that circ_0008285 can regulate the expression of RRM2 by sponging miR-384.<elsevierMultimedia ident="fig0007"></elsevierMultimedia>3.8Silencing of hsa_circ_0008285 inhibited tumor growth in vivoFinally, the effect of circ_0008285 silencing on tumor growth was investigated by in vivo tumorigenesis assay. The results showed that tumor volume and weight were suppressed in the sh-circ_0008285 group compared to the sh-NC group (<a class="elsevierStyleCrossRef" href="#fig0008">Fig. 8</a>A-B). qRT-PCR results showed that the levels of circ_0008285 and RRM2 mRNA were significantly reduced, and miR-140-3p level was significantly increased in xenograft tumor tissues with circ_0008285 knockdown (<a class="elsevierStyleCrossRef" href="#fig0008">Fig. 8</a>C-E). In addition, silencing of circ_0008285 significantly suppressed the expression levels of RRM2, Bcl-2, Vimentin and N-cadherin but elevated the expression levels of Bax and E-cadherin in xenograft tumor tissues (<a class="elsevierStyleCrossRef" href="#fig0008">Fig. 8</a>F). Altogether, circ_008285 silence inhibited tumor growth by miR-384/RRM2 axis.<elsevierMultimedia ident="fig0008"></elsevierMultimedia>4DiscussionIn the past few years, an accumulating body of research has established that circRNAs can be used as diagnostic or predictive biomarkers for certain diseases, particularly cancer. CircRNAs are aberrantly expressed in cancer and play an integral oncogenic or anti-oncogene effects in the progression of tumors <a class="elsevierStyleCrossRef" href="#bib0020">[20]</a>. In addition, circRNAs can significantly regulate the biological phenotype of cells, which might be new tumor markers [<a class="elsevierStyleCrossRef" href="#bib0021">21</a>, <a class="elsevierStyleCrossRef" href="#bib0022">22</a>]. For example, a low expression level of circ_0035445 in gastric cancer was associated with distant metastasis and tumor size; functionally, upregulation of circ_0035445 blocked cell migration, boosted apoptosis, and suppressed cell cycle progression <a class="elsevierStyleCrossRef" href="#bib0023">[23]</a>. In colorectal cancer, circ_001659 might be a useful serum biomarker for the detection and prognosis of colorectal cancer; in vitro experiments showed that circ_001659 could expedite cell invasion and migration <a class="elsevierStyleCrossRef" href="#bib0024">[24]</a>. In addition, circ_001569 boosted cell proliferation, migration and invasion of pancreatic cancer but curbed apoptosis <a class="elsevierStyleCrossRef" href="#bib0025">[25]</a>. A previous study has shown that circ-CDYL (circ_0008285) promoted the tumor-initiating properties and chemoresistance of HCC cells <a class="elsevierStyleCrossRef" href="#bib0017">[17]</a>. However, large-scale identifications of circ_0008285 expression in HCC tumorigenesis were not yet reported. In this study, we demonstrated that circ_0008285 was abnormally unregulated in HCC, and silencing of circ_0008285 significantly constrained proliferation, migration, invasion and EMT but impelled apoptosis in HCC cells. In vivo studies showed that silencing of circ_0008285 inhibited tumor growth in vivo. These studies revealed the oncogenic role of circ_0008285 in HCC, suggesting that it could be an important marker for the therapy of HCC.Studies show that miRNAs are engaging in a wide range of biological processes and have a significant correlation between cancer diagnosis and prognosis <a class="elsevierStyleCrossRef" href="#bib0026">[26]</a>. MiRNAs can directly bind to downstream target genes to induce mRNA degradation or inhibit translation, thereby participating in various physiological and pathological processes [<a class="elsevierStyleCrossRef" href="#bib0027">27</a>, <a class="elsevierStyleCrossRef" href="#bib0028">28</a>]. For example, miR-145 was found to be downregulated in prostate cancer and to be a putative tumor suppressor by reducing cell growth and increasing cell death <a class="elsevierStyleCrossRef" href="#bib0029">[29]</a>. In breast cancer cells, downregulation of miR-105-3p retarded cell proliferation, suppressed cell migration, invasion, and reinforced apoptosis <a class="elsevierStyleCrossRef" href="#bib0030">[30]</a>. It was found that miR-384 induced autophagy and apoptosis through negative control of COL10A1 in non-small cell lung cancer cells <a class="elsevierStyleCrossRef" href="#bib0031">[31]</a>. In this study, miR-384 expression was declined in HCC, and overexpression of miR-384 confined cell proliferation, migration, invasion and EMT but reinforced apoptosis in vitro.Notably, circRNAs can serve as miRNA sponges, thereby modulating gene expression <a class="elsevierStyleCrossRef" href="#bib0032">[32]</a>. Circ_0000517 could sponge miR-326 to retard its expression, and inhibition of miR-326 abolished the effect of circ_0000517 knockdown on the malignant behaviors of breast cancer cells <a class="elsevierStyleCrossRef" href="#bib0033">[33]</a>. Circ_0001017 acted as a sponge for miR-197 and inhibited the development of gastric cancer <a class="elsevierStyleCrossRef" href="#bib0034">[34]</a>. Circ_0007385 suppressed the malignant behaviors by targeting miR-519d-3p in non-small cell lung cancer cells <a class="elsevierStyleCrossRef" href="#bib0035">[35]</a>. We predicted the binding sites between circ_0008285 and miR-384, and also verified that circ_0008285 could adsorb miR-384. Circ_0008285 was negatively correlated with miR-384 expression in HCC tissues. In addition, anti-miR-384 reversed the effects of circ_0000218 silencing on the proliferation, migration, invasion and apoptosis of HCC cells. Besides, circ_0008285 reinforced HCC cell progression through sponging miR-384.It has been revealed that circRNA can adsorb miRNA to regulate mRNA, and the circRNA-miRNA-mRNA regulatory network has an important regulatory role in cancer. For example, Circ_0007841 accelerates ovarian cancer development by intensifying the expression of MEX3C through the inhibition of miR-151-3p activity <a class="elsevierStyleCrossRef" href="#bib0036">[36]</a>. RRM2 acts as a pro-oncogene in HCC, and high expression of RRM2 may be a helpful marker for predicting early recurrence and may be a marker of poor prognosis after curative resection in HCC <a class="elsevierStyleCrossRef" href="#bib0037">[37]</a>. In this study, RRM2 was identified and confirmed as a potential target for miR-384. And miR-384 negatively moderated RRM2 expression; furthermore, RRM2 mRNA and protein levels were significantly elevated in HCC. Overexpression of RRM2 was able to reverse the suppression effects of miR-384 mimics on the malignant phenotypes of HCC cells. These data suggested that miR-384 regulated the development of HCC by targeting RRM2. Furthermore, circ_0008285 expression was positively correlated with RRM2 in HCC. Circ_0008285 silencing decreased RRM2 expression, while miR-384 inhibitor attenuated this effect. This finding implied that circ_0008285 could regulate RRM2 expression by sponging miR-384. Besides that, previous studies also showed the downstream target mRNAs or pathways of RRM2 in multiple diseases. For instance, RRM2 binds to ANXA1 to activate AKT signaling in renal cancer, thus promoting tumor growth and sunitinib resistance <a class="elsevierStyleCrossRef" href="#bib0038">[38]</a>. Overexpression of RRM2 can improve the damage of cardiac structure and function by activating Hippo-YAP Pathway <a class="elsevierStyleCrossRef" href="#bib0039">[39]</a>. However, the lack of target gene detection of RRM2 is a certain limitation in our work, which will be studied in future research.5ConclusionCirc_0008285 could perform its vital functions in the progression of HCC by miR-384/RRM2 axis, which provided a new experimental basis for using circ_0008285 as a marker for the diagnosis and treatment of HCC.FundingThis study was supported by: the Natural Science Foundation of Hunan Province [2021JJ70076]Author's contributionsAll persons who meet authorship criteria are listed as authors, and all authors certify that they have participated sufficiently in work to take public responsibility for the content, including participation in the concept, design, analysis, writing, or revision of the manuscript. All the authors gave their final approval of the version to be published and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the article are appropriately investigated and resolved. Shuang Peng designed the research and wrote the manuscript. Lai Yi, Yiling Bin and Lingzhi Liao collected and analyzed the data. Weiming Qu and Hongsai Hu reviewed and edited the manuscript. All authors read and approved the final manuscript." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1935018" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0001" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abss0002" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abss0003" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0004" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1667821" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xpalclavsec1667820" "titulo" => "Abbreviations" ] 3 => array:2 [ "identificador" => "sec0001" "titulo" => "Introduction" ] 4 => array:3 [ "identificador" => "sec0002" "titulo" => "Materials and methods" "secciones" => array:14 [ 0 => array:2 [ "identificador" => "sec0003" "titulo" => "Subjects" ] 1 => array:2 [ "identificador" => "sec0004" "titulo" => "Cell culture and transfection" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "RNA extraction and qRT-PCR" ] 3 => array:2 [ "identificador" => "sec0006" "titulo" => "Subcellular fractionation location" ] 4 => array:2 [ "identificador" => "sec0007" "titulo" => "Cell counting kit-8 (CCK-8) assay" ] 5 => array:2 [ "identificador" => "sec0008" "titulo" => "5-ethynyl-2’-deoxyuridine (Edu) staining" ] 6 => array:2 [ "identificador" => "sec0009" "titulo" => "Cell apoptosis assay" ] 7 => array:2 [ "identificador" => "sec0010" "titulo" => "Transwell assay" ] 8 => array:2 [ "identificador" => "sec0011" "titulo" => "Western blotting" ] 9 => array:2 [ "identificador" => "sec0012" "titulo" => "Luciferase reporter assay" ] 10 => array:2 [ "identificador" => "sec0013" "titulo" => "RNA immunoprecipitation (RIP) assay" ] 11 => array:2 [ "identificador" => "sec0014" "titulo" => "Xenograft mice model" ] 12 => array:2 [ "identificador" => "sec0015" "titulo" => "Statistical analysis" ] 13 => array:2 [ "identificador" => "sec0015a" "titulo" => "Ethical statements" ] ] ] 5 => array:3 [ "identificador" => "sec0016" "titulo" => "Results" "secciones" => array:8 [ 0 => array:2 [ "identificador" => "sec0017" "titulo" => "Circ_0008285 was highly expressed in the tissues and cells of HCC" ] 1 => array:2 [ "identificador" => "sec0018" "titulo" => "Circ_0008285 knockdown impeded cell proliferation, migration and invasion while promoted cell apoptosis in HCC cells" ] 2 => array:2 [ "identificador" => "sec0019" "titulo" => "Circ_0008285 directly targeted miR-384" ] 3 => array:2 [ "identificador" => "sec0020" "titulo" => "MiR-384 downregulation attenuated the influence of circ_0008285 interference on cell proliferation, migration, invasion, and apoptosis in HCC cells" ] 4 => array:2 [ "identificador" => "sec0021" "titulo" => "MiR-384 targeted RRM2" ] 5 => array:2 [ "identificador" => "sec0022" "titulo" => "RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation, migration, invasion, and apoptosis of HCC cells" ] 6 => array:2 [ "identificador" => "sec0023" "titulo" => "Circ_0008285 regulated RRM2 expression by targeting miR-384" ] 7 => array:2 [ "identificador" => "sec0024" "titulo" => "Silencing of hsa_circ_0008285 inhibited tumor growth in vivo" ] ] ] 6 => array:2 [ "identificador" => "sec0025" "titulo" => "Discussion" ] 7 => array:2 [ "identificador" => "sec0026" "titulo" => "Conclusion" ] 8 => array:2 [ "identificador" => "sec0027" "titulo" => "Funding" ] 9 => array:2 [ "identificador" => "sec0028" "titulo" => "Author's contributions" ] 10 => array:2 [ "identificador" => "xack678042" "titulo" => "Acknowledgments" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2022-04-07" "fechaAceptado" => "2022-07-23" "PalabrasClave" => array:1 [ "en" => array:2 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1667821" "palabras" => array:3 [ 0 => "Liver cancer" 1 => "Molecular mechanism" 2 => "Cell lines" ] ] 1 => array:4 [ "clase" => "abr" "titulo" => "Abbreviations" "identificador" => "xpalclavsec1667820" "palabras" => array:5 [ 0 => "circRNA" 1 => "HCC" 2 => "RRM2" 3 => "qRT-PCR" 4 => "RIP" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "Introduction and objectivesCircular RNA (circRNA) has attracted extensive attention in studies related to the malignant progression of cancer, including hepatocellular carcinoma (HCC). Therefore, its molecular mechanism in HCC needs to be further explored. Materials and methodsThe expression levels of circ_0008285, microRNA (miR)-384 and ribonucleotide reductase subunit M2 (RRM2) mRNA were detected by quantitative real-time polymerase chain reaction (qRT-PCR). Cell proliferation was analyzed using cell counting kit-8 assay and 5-ethynyl-2’-deoxyuridine assay, cell apoptosis was analyzed by flow cytometry, and cell migration and invasion were detected by transwell assay. Protein level was detected by western blot. The relationships between miR-384 and circ_0008285 or RRM2 were predicted by bioinformatics software and validated by dual luciferase reporter assay and RNA immunoprecipitation (RIP) assay. ResultsCirc_0008285 expression is elevated to HCC tissues and cell lines. Silencing of circ_0008285 inhibited the proliferation, migration and invasion of HCC cells but accelerated cell apoptosis in vitro and impeded HCC tumorigenesis in vivo. Mechanistically, circ_0008285 directly interacted with miR-384, and miR-384 silencing attenuated the effects of circ_0008285 interference on cell proliferation, migration, invasion, and apoptosis. RRM2 was a direct target of miR-384, and RRM2 overexpression reversed the effects of miR-384 overexpression on cell proliferation, migration, invasion, and apoptosis. In addition, circ_0008285 regulated RRM2 expression by sponging miR-384. ConclusionIn this study, circ_0008285 could promote the malignant biological behaviors of HCC cells through miR-384/RRM2 axis and has the potential to become a therapeutic target for HCC, providing a new idea for targeted therapy of HCC." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0001" "titulo" => "Introduction and objectives" ] 1 => array:2 [ "identificador" => "abss0002" "titulo" => "Materials and methods" ] 2 => array:2 [ "identificador" => "abss0003" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0004" "titulo" => "Conclusion" ] ] ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "Shuang Peng and Lai Yi contributed equally to this work." "identificador" => "fn1" ] ] "multimedia" => array:9 [ 0 => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1973 "Ancho" => 2625 "Tamanyo" => 287870 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0008285 was highly expressed in HCC tissues and cells (A) qRT-PCR analysis of the expression level of circ_0008285 in the tissues of 55 patients with HCC and paracancerous tissues. (B) qRT-PCR assay was employed to detect the expression level of circ_0008285 in HCC cell lines (Huh7 and HCCLM3) and non-cancerous cell lines (THLE-3). (C-D) Subcellular fractionation location assay was used to analyze the distribution of circ_0008285 in the nucleus or cytoplasm. *P < 0.05." ] ] 1 => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2242 "Ancho" => 3150 "Tamanyo" => 1050509 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0008285 knockdown impeded cell proliferation, migration and invasion, while induced cell apoptosis in HCC cells Huh7 and HCCLM3 cells were transfected with si-circ_0008285 or si-NC. (A) qRT-PCR was performed to detect the expression of circ_0008285 in Huh7 and HCCLM3 cells. (B-D) CCK-8 and EdU assays were employed to detect the proliferation ability of transfected cells. (Magnification, 200 ×). (E) The Annexin-V FITC/PI staining was used to assess cell apoptotic rate. (F) Western blotting assay was used to assess the protein levels of Bax and Bcl-2 in transfected cells. (G-H) Transwell assay was used to determine cell migration and invasion abilities. (Magnification, 100 ×). (I) Western blotting assay was employed to assess the protein levels of E-cadherin, Vimentin and N-cadherin in transfected cells. *P < 0.05." ] ] 2 => array:8 [ "identificador" => "fig0003" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2587 "Ancho" => 3500 "Tamanyo" => 503085 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0003" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0008285 directly targeted miR-384 (A) The wild type or mutant type complementary binding sites between circ_0008285 and miR-384 were presented. (B) qRT-PCR was performed to detect the expression of miR-384 in Huh7 and HCCLM3 cells transfected with miR-NC or miR-384 mimics. (C) Dual luciferase reporter assay was used to verify the binding relationship between circ_0008285 and miR-384. (D) RIP assays were used to detect the enrichments of circ_0008285 and miR-384 in anti-Ago2 groups. (E) qRT-PCR was used to detect miR-384 level in tumor tissues and paracancerous tissues. (F) qRT-PCR assay was used to detect the expression level of miR-384 in THLE-3, Huh7 and HCCLM3 cells. *P < 0.05." ] ] 3 => array:8 [ "identificador" => "fig0004" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 2649 "Ancho" => 3500 "Tamanyo" => 792033 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0004" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "MiR-384 downregulation attenuated the influence of circ_0008285 interference on cell proliferation, migration, invasion, and apoptosis in HCC cells (A) The silencing efficiency of miR-384 inhibitor was detected by qRT-PCR. (B-I) Huh7 and HCCLM3 cells were transfected with si-NC, si-circ_0008285, si-circ_0008285+anti-NC or si-circ_0008285+anti-miR-384. (B-D) CCK-8 and EdU assays were employed to detect cell proliferation ability. (E) The Annexin-V FITC/PI staining was used to assess apoptotic rates. (F) Western blotting assay was utilized to assess the protein levels of Bax and Bcl-2. (G-H) Transwell assays were used to determine cell migration and invasion ability. (I) Western blotting was used to assess the protein levels of E-cadherin, Vimentin and N-cadherin. *P < 0.05." ] ] 4 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 3008 "Ancho" => 3500 "Tamanyo" => 853764 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0005" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "MiR-384 targeted RRM2 (A) The binding sites between miR-384 and RRM2 were predicted by online prediction tools (TargetScanHuman, miRWALK, and GEPIA). (B) Expression of RRM2 in HCC tissues was analyzed according to the GEPIA database. (C-D) The overall survival and disease-free survival analysis of RRM2 gene of interest can be presented. (F) Dual luciferase reporter assay to verify the binding relationship between miR-384 and RRM2. (G) RIP assays were used to detect the enrichment of miR-384 and RRM2 in anti-Ago2 groups. (H-I) qRT-PCR and Western blot analysis were performed to determine the effects of miR-384 mimics and inhibitors on RRM2 mRNA and protein levels. (J-K) qRT-PCR and Western blot was used to detect RRM2 mRNA and protein levels in tumor tissues and paracancerous tissues. (L-M) qRT-PCR and Western blot analysis was performed to detect RRM2 mRNA and protein levels in THLE-3, Huh7 and HCCLM3 cells. *P < 0.05." ] ] 5 => array:8 [ "identificador" => "fig0006" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1757 "Ancho" => 3500 "Tamanyo" => 655178 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0006" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation, migration, invasion, and apoptosis of HCC cells (A-B) qRT-PCR and Western blot analysis were used to detect the overexpression efficiency of RRM2. (C-J) Huh7 and HCCLM3 cells were transfected with miR-NC, miR-384, miR-384+pcDNA, or miR-384+pcDNA-RRM2. (C-E) CCK-8 and EdU assays were utilized to detect cell proliferation ability. (F) The Annexin-V FITC/PI staining was used to assess apoptotic rates. (G) Western blotting assay was employed to assess the protein levels of Bax and Bcl-2. (H-I) Transwell assays were used to determine cell migration and invasion ability. (J) Western blotting to assess the protein levels of E-cadherin, Vimentin and N-cadherin. *P < 0.05." ] ] 6 => array:8 [ "identificador" => "fig0007" "etiqueta" => "Fig. 7" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr7.jpeg" "Alto" => 1859 "Ancho" => 3500 "Tamanyo" => 497198 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0007" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Circ_0008285 regulated RRM2 expression by targeting miR-384 (A-C) Huh7 and HCCLM3 cells were transfected with si-NC, si-circ_0008285, si-circ_0008285+anti-NC or si-circ_0008285+anti-miR-384. And RRM2 mRNA and protein levels were detected by qRT-PCR and Western blot analysis. (C-E) Spearman correlation analysis for the correlation among circ_0008285, miR-384, and RRM2 mRNA in HCC tissues. *P < 0.05." ] ] 7 => array:8 [ "identificador" => "fig0008" "etiqueta" => "Fig. 8" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr8.jpeg" "Alto" => 2791 "Ancho" => 3500 "Tamanyo" => 505648 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0008" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Silencing of hsa_circ_0008285 inhibited tumor growth in vivo (A-B) Effect of circ_0008285 silencing on tumor volume and weight. (C-E) The effects of circ_0008285 silencing on circ_0008285, miR-384 and RRM2 mRNA expression levels in xenograft tumors were examined by qRT-PCR. (F) The protein levels of RRM2, Bax, Bcl-2, E-cadherin, vimentin, and N-cadherin were evaluated by western blot in xenograft tumors. *P < 0.05." ] ] 8 => array:8 [ "identificador" => "tbl0001" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0009" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Name \t\t\t\t\t\t\n \t\t\t\t\t\t</th><a name="en0002"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><a name="en0003"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Primers for PCR (5’-3’) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0004"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">hsa_circ_0008285</td><a name="en0005"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0006"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">GGCCCAGGATACACCCACTA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0008"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0009"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">AGCCTTTCCACCGAACCAAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0010"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">RRM2</td><a name="en0011"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0012"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">GGCGCGGGAGATTTAAAGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0014"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0015"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">TTAGTTTTCGGCTCCGTGGG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0016"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">miR-384</td><a name="en0017"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">GTATGAGATTCCTAGAAATT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0020"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0021"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">CTCAACTGGTGTCGTGGAG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0022"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">GAPDH</td><a name="en0023"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">GACAGTCAGCCGCATCTTCT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0026"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">GCGCCCAATACGACCAAATC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0028"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">U6</td><a name="en0029"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">CTCGCTTCGGCAGCACA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0032"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0033"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">AACGCTTCACGAATTTGCGT \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3223525.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Primers sequences used for PCR." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec1" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0001" "etiqueta" => "[1]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immunotherapies for hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "JM Llovet" 1 => "F Castet" 2 => "M Heikenwalder" 3 => "MK Maini" 4 => "V Mazzaferro" 5 => "DJ Pinato" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41571-021-00573-2" "Revista" => array:2 [ "tituloSerie" => "Nat Rev Clin Oncol" "fecha" => "2021" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0002" "etiqueta" => "[2]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk of HCC: genetic heterogeneity and complex genetics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "TA. Dragani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2009.11.015" "Revista" => array:7 [ "tituloSerie" => "J Hepatol" "fecha" => "2010" "volumen" => "52" "numero" => "2" "paginaInicial" => "252" "paginaFinal" => "257" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20022654" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0003" "etiqueta" => "[3]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A global view of hepatocellular carcinoma: trends, risk, prevention and management" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "JD Yang" 1 => "P Hainaut" 2 => "GJ Gores" 3 => "A Amadou" 4 => "A Plymoth" 5 => "LR. Roberts" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41575-019-0186-y" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Gastroenterol Hepatol" "fecha" => "2019" "volumen" => "16" "numero" => "10" "paginaInicial" => "589" "paginaFinal" => "604" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31439937" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0004" "etiqueta" => "[4]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors and prevention of hepatocellular carcinoma in the era of precision medicine" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "N Fujiwara" 1 => "SL Friedman" 2 => "N Goossens" 3 => "Y. Hoshida" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhep.2017.09.016" "Revista" => array:7 [ "tituloSerie" => "J Hepatol" "fecha" => "2018" "volumen" => "68" "numero" => "3" "paginaInicial" => "526" "paginaFinal" => "549" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28989095" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0005" "etiqueta" => "[5]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oncogenic hsa_circ_0091581 promotes the malignancy of HCC cell through blocking miR-526b from degrading c-MYC mRNA" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X Wei" 1 => "W Zheng" 2 => "P Tian" 3 => "Y He" 4 => "H Liu" 5 => "M Peng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/15384101.2020.1731945" "Revista" => array:7 [ "tituloSerie" => "Cell Cycle" "fecha" => "2020" "volumen" => "19" "numero" => "7" "paginaInicial" => "817" "paginaFinal" => "824" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32116112" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0006" "etiqueta" => "[6]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The biogenesis, biology and characterization of circular RNAs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "LS Kristensen" 1 => "MS Andersen" 2 => "LVW Stagsted" 3 => "KK Ebbesen" 4 => "TB Hansen" 5 => "J. Kjems" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41576-019-0158-7" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Genet" "fecha" => "2019" "volumen" => "20" "numero" => "11" "paginaInicial" => "675" "paginaFinal" => "691" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31395983" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0007" "etiqueta" => "[7]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA detection methods: a minireview" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Z Mi" 1 => "C Zhongqiang" 2 => "J Caiyun" 3 => "L Yanan" 4 => "W Jianhua" 5 => "L. Liang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.talanta.2021.123066" "Revista" => array:4 [ "tituloSerie" => "Talanta" "fecha" => "2022" "volumen" => "238" "numero" => "Pt 2" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0008" "etiqueta" => "[8]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNAs: potential regulators of treatment resistance in human cancers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S Jeyaraman" 1 => "EAM Hanif" 2 => "NS Ab Mutalib" 3 => "R Jamal" 4 => "N Abu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fgene.2019.01369" "Revista" => array:5 [ "tituloSerie" => "Front Genet" "fecha" => "2019" "volumen" => "10" "paginaInicial" => "1369" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32047511" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0009" "etiqueta" => "[9]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA: an emerging non-coding RNA as a regulator and biomarker in cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B Chen" 1 => "S. Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.canlet.2018.01.011" "Revista" => array:6 [ "tituloSerie" => "Cancer Lett" "fecha" => "2018" "volumen" => "418" "paginaInicial" => "41" "paginaFinal" => "50" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29330104" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0010" "etiqueta" => "[10]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA participates in the carcinogenesis and the malignant behavior of cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "ZJ Zhao" 1 => "J. Shen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/15476286.2015.1122162" "Revista" => array:7 [ "tituloSerie" => "RNA Biol" "fecha" => "2017" "volumen" => "14" "numero" => "5" "paginaInicial" => "514" "paginaFinal" => "521" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26649774" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0011" "etiqueta" => "[11]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Progress and prospects of circular RNAs in hepatocellular carcinoma: novel insights into their function" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J Hu" 1 => "P Li" 2 => "Y Song" 3 => "YX Ge" 4 => "XM Meng" 5 => "C Huang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcp.26154" "Revista" => array:7 [ "tituloSerie" => "J Cell Physiol" "fecha" => "2018" "volumen" => "233" "numero" => "6" "paginaInicial" => "4408" "paginaFinal" => "4422" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28833094" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0012" "etiqueta" => "[12]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNAs act as miRNA sponges" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "AC. Panda" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-981-13-1426-1_6" "Revista" => array:6 [ "tituloSerie" => "Adv Exp Med Biol" "fecha" => "2018" "volumen" => "1087" "paginaInicial" => "67" "paginaFinal" => "79" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30259358" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0013" "etiqueta" => "[13]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hsa_circ_001680 affects the proliferation and migration of CRC and mediates its chemoresistance by regulating BMI1 through miR-340" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X Jian" 1 => "H He" 2 => "J Zhu" 3 => "Q Zhang" 4 => "Z Zheng" 5 => "X Liang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-020-1134-8" "Revista" => array:7 [ "tituloSerie" => "Mol Cancer" "fecha" => "2020" "volumen" => "19" "numero" => "1" "paginaInicial" => "20" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32005118" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0211699515000302" "estado" => "S300" "issn" => "02116995" ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0014" "etiqueta" => "[14]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNA Circ_0067934 attenuates ferroptosis of thyroid cancer cells by miR-545-3p/SLC7A11 signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "HH Wang" 1 => "JN Ma" 2 => "XR. Zhan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fendo.2021.670031" "Revista" => array:3 [ "tituloSerie" => "Front Endocrinol" "fecha" => "2021" "volumen" => "12" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0015" "etiqueta" => "[15]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNA hsa_circ_0014130 function as a miR-132-3p sponge for playing oncogenic roles in bladder cancer via upregulating KCNJ12 expression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G Li" 1 => "BY Guo" 2 => "HD Wang" 3 => "GT Lin" 4 => "TJ Lan" 5 => "H Ying" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10565-021-09668-z" "Revista" => array:2 [ "tituloSerie" => "Cell Biol Toxicol" "fecha" => "2021" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0016" "etiqueta" => "[16]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "hsa_circ_0008285 Facilitates the progression of cervical cancer by targeting miR-211-5p/SOX4 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y Bai" 1 => "X. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/CMAR.S244317" "Revista" => array:5 [ "tituloSerie" => "Cancer Manage Res" "fecha" => "2020" "volumen" => "12" "paginaInicial" => "3927" "paginaFinal" => "3936" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0017" "etiqueta" => "[17]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A noncoding regulatory RNAs network driven by circ-CDYL acts specifically in the early stages hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y Wei" 1 => "X Chen" 2 => "C Liang" 3 => "Y Ling" 4 => "X Yang" 5 => "X Ye" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.30795" "Revista" => array:7 [ "tituloSerie" => "Hepatology" "fecha" => "2020" "volumen" => "71" "numero" => "1" "paginaInicial" => "130" "paginaFinal" => "147" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31148183" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0018" "etiqueta" => "[18]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNAs function as ceRNAs to regulate and control human cancer progression" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y Zhong" 1 => "Y Du" 2 => "X Yang" 3 => "Y Mo" 4 => "C Fan" 5 => "F Xiong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-018-0827-8" "Revista" => array:6 [ "tituloSerie" => "Mol Cancer" "fecha" => "2018" "volumen" => "17" "numero" => "1" "paginaInicial" => "79" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29626935" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0019" "etiqueta" => "[19]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ChrXq27.3 miRNA cluster functions in cancer development" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K Yoshida" 1 => "A Yokoi" 2 => "Y Yamamoto" 3 => "H. Kajiyama" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s13046-021-01910-0" "Revista" => array:6 [ "tituloSerie" => "J Exp Clin Cancer Res" "fecha" => "2021" "volumen" => "40" "numero" => "1" "paginaInicial" => "112" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33766100" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0020" "etiqueta" => "[20]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circular RNAs in cancer: biogenesis, function, and clinical significance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J Li" 1 => "D Sun" 2 => "W Pu" 3 => "J Wang" 4 => "Y. Peng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.trecan.2020.01.012" "Revista" => array:7 [ "tituloSerie" => "Trends Cancer" "fecha" => "2020" "volumen" => "6" "numero" => "4" "paginaInicial" => "319" "paginaFinal" => "336" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32209446" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0021" "etiqueta" => "[21]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Translation and functional roles of circular RNAs in human cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M Lei" 1 => "G Zheng" 2 => "Q Ning" 3 => "J Zheng" 4 => "D. Dong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-020-1135-7" "Revista" => array:6 [ "tituloSerie" => "Mol Cancer" "fecha" => "2020" "volumen" => "19" "numero" => "1" "paginaInicial" => "30" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32059672" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0022" "etiqueta" => "[22]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNA: functions and properties of a novel potential biomarker for cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S Meng" 1 => "H Zhou" 2 => "Z Feng" 3 => "Z Xu" 4 => "Y Tang" 5 => "P Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-017-0663-2" "Revista" => array:6 [ "tituloSerie" => "Mol Cancer" "fecha" => "2017" "volumen" => "16" "numero" => "1" "paginaInicial" => "94" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28535767" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0023" "etiqueta" => "[23]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumor suppressor role of hsa_circ_0035445 in gastric cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "W Sun" 1 => "H Zhang" 2 => "W Duan" 3 => "H Zhu" 4 => "C. Gu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcla.23727" "Revista" => array:7 [ "tituloSerie" => "J Clin Lab Anal" "fecha" => "2021" "volumen" => "35" "numero" => "6" "paginaInicial" => "e23727" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33830559" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0211699518302327" "estado" => "S300" "issn" => "02116995" ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0024" "etiqueta" => "[24]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hsa_circ_001659 serves as a novel diagnostic and prognostic biomarker for colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B He" 1 => "W Chao" 2 => "Z Huang" 3 => "J Zeng" 4 => "J Yang" 5 => "D Luo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2021.02.121" "Revista" => array:6 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2021" "volumen" => "551" "paginaInicial" => "100" "paginaFinal" => "106" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33725570" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0025" "etiqueta" => "[25]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of Circ_001569 as a potential biomarker in the diagnosis and prognosis of pancreatic cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "X Shen" 1 => "Y Chen" 2 => "J Li" 3 => "H Huang" 4 => "C Liu" 5 => "N. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/1533033820983302" "Revista" => array:4 [ "tituloSerie" => "Technol Cancer Res Treat" "fecha" => "2021" "volumen" => "20" "itemHostRev" => array:3 [ "pii" => "S0085253816300035" "estado" => "S300" "issn" => "00852538" ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0026" "etiqueta" => "[26]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging microRNAs in cancer diagnosis, progression, and immune surveillance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "AM Harrandah" 1 => "RA Mora" 2 => "EKL. Chan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.canlet.2018.09.019" "Revista" => array:6 [ "tituloSerie" => "Cancer Lett" "fecha" => "2018" "volumen" => "438" "paginaInicial" => "126" "paginaFinal" => "132" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30237038" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0027" "etiqueta" => "[27]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miRNA sponges: soaking up miRNAs for regulation of gene expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "RO Bak" 1 => "JG. Mikkelsen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/wrna.1213" "Revista" => array:7 [ "tituloSerie" => "Wiley Interdiscip Rev RNA" "fecha" => "2014" "volumen" => "5" "numero" => "3" "paginaInicial" => "317" "paginaFinal" => "333" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24375960" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0028" "etiqueta" => "[28]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "microRNA-messenger RNA regulatory network of esophageal squamous cell carcinoma and the identification of miR-1 as a biomarker of patient survival" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q Wei" 1 => "X Li" 2 => "W Yu" 3 => "K Zhao" 4 => "G Qin" 5 => "H Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcb.28166" "Revista" => array:7 [ "tituloSerie" => "J Cell Biochem" "fecha" => "2019" "volumen" => "120" "numero" => "8" "paginaInicial" => "12259" "paginaFinal" => "12272" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31017699" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0029" "etiqueta" => "[29]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-145 suppresses the motility of prostate cancer cells by targeting cadherin-2" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H Zeng" 1 => "Y Huang" 2 => "Q Liu" 3 => "H Liu" 4 => "T Long" 5 => "C Zhu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11010-021-04188-0" "Revista" => array:7 [ "tituloSerie" => "Mol Cell Biochem" "fecha" => "2021" "volumen" => "476" "numero" => "10" "paginaInicial" => "3635" "paginaFinal" => "3646" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34043125" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0030" "etiqueta" => "[30]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-105-3p acts as an oncogene to promote the proliferation and metastasis of breast cancer cells by targeting GOLIM4" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B Lin" 1 => "C Liu" 2 => "E Shi" 3 => "Q Jin" 4 => "W Zhao" 5 => "J Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12885-021-07909-2" "Revista" => array:6 [ "tituloSerie" => "BMC Cancer" "fecha" => "2021" "volumen" => "21" "numero" => "1" "paginaInicial" => "275" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33722196" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0031" "etiqueta" => "[31]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-384 induces apoptosis and autophagy of non-small cell lung cancer cells through the negative regulation of Collagen alpha-1(X) chain gene" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Q Guo" 1 => "M Zheng" 2 => "Y Xu" 3 => "N Wang" 4 => "W. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BSR20181523" "Revista" => array:4 [ "tituloSerie" => "Biosci Rep" "fecha" => "2019" "volumen" => "39" "numero" => "2" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0032" "etiqueta" => "[32]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNAs and their regulatory roles in cancers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M Tao" 1 => "M Zheng" 2 => "Y Xu" 3 => "S Ma" 4 => "W Zhang" 5 => "S. Ju" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s10020-021-00359-3" "Revista" => array:6 [ "tituloSerie" => "Mol Med" "fecha" => "2021" "volumen" => "27" "numero" => "1" "paginaInicial" => "94" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34445958" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0033" "etiqueta" => "[33]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The effects of hsa_circ_0000517/miR-326 axis on the progression of breast cancer cells and the prediction of miR-326 downstream targets in breast cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J Yu" 1 => "F Li" 2 => "Y Li" 3 => "Z Li" 4 => "G Jia" 5 => "B Ding" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.prp.2021.153638" "Revista" => array:3 [ "tituloSerie" => "Pathol Res Pract" "fecha" => "2021" "volumen" => "227" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0034" "etiqueta" => "[34]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CircRNA Hsa_circ_0001017 inhibited gastric cancer progression via acting as a sponge of miR-197" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H Li" 1 => "C Shan" 2 => "J Wang" 3 => "C. Hu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10620-020-06516-8" "Revista" => array:7 [ "tituloSerie" => "Dig Dis Sci" "fecha" => "2021" "volumen" => "66" "numero" => "7" "paginaInicial" => "2261" "paginaFinal" => "2271" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32740683" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0035" "etiqueta" => "[35]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "circ_0007385 served as competing endogenous RNA for miR-519d-3p to suppress malignant behaviors and cisplatin resistance of non-small cell lung cancer cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y Ye" 1 => "L Zhao" 2 => "Q Li" 3 => "C Xi" 4 => "Y Li" 5 => "Z. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/1759-7714.13527" "Revista" => array:7 [ "tituloSerie" => "Thoracic Cancer" "fecha" => "2020" "volumen" => "11" "numero" => "8" "paginaInicial" => "2196" "paginaFinal" => "2208" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32602212" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0036" "etiqueta" => "[36]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Circ_0007841 accelerates ovarian cancer development through facilitating MEX3C expression by restraining miR-151-3p activity" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "K Huang" 1 => "D Liu" 2 => "C. Su" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.18632/aging.202911" "Revista" => array:7 [ "tituloSerie" => "Aging" "fecha" => "2021" "volumen" => "13" "numero" => "8" "paginaInicial" => "12058" "paginaFinal" => "12066" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33896797" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0037" "etiqueta" => "[37]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "High expression of ribonucleotide reductase subunit M2 correlates with poor prognosis of hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B Lee" 1 => "SY Ha" 2 => "DH Song" 3 => "HW Lee" 4 => "SY Cho" 5 => "CK. Park" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.5009/gnl13392" "Revista" => array:7 [ "tituloSerie" => "Gut Liver" "fecha" => "2014" "volumen" => "8" "numero" => "6" "paginaInicial" => "662" "paginaFinal" => "668" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25368754" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0038" "etiqueta" => "[38]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "RRM2 regulates sensitivity to sunitinib and PD-1 blockade in renal cancer by stabilizing ANXA1 and activating the AKT pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "W Xiong" 1 => "B Zhang" 2 => "H Yu" 3 => "L Zhu" 4 => "L Yi" 5 => "X Jin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/advs.202100881" "Revista" => array:4 [ "tituloSerie" => "Adv Sci" "fecha" => "2021" "volumen" => "8" "numero" => "18" ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0039" "etiqueta" => "[39]" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "RRM2 improves cardiomyocyte proliferation after myocardial ischemia reperfusion injury through the Hippo-YAP pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H Yu" 1 => "H Tang" 2 => "C Deng" 3 => "Q Lin" 4 => "P Yu" 5 => "S Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1155/2021/5089872" "Revista" => array:4 [ "tituloSerie" => "Dis Markers" "fecha" => "2021" "volumen" => "2021" "itemHostRev" => array:3 [ "pii" => "S027263861500921X" "estado" => "S300" "issn" => "02726386" ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack678042" "titulo" => "Acknowledgments" "texto" => "None." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122000850/v3_202307180533/en/main.assets" "Apartado" => array:4 [ "identificador" => "78265" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/16652681/0000002700000006/v3_202307180533/S1665268122000850/v3_202307180533/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122000850?idApp=UINPBA00004N"]

Statistics

Original article

Shuang Penga,1, Lai Yib,1, Lingzhi Liaoc, Yuling Bind, Weiming Qud, Hongsai Hud,

Corresponding author

hhs716@126.com

Corresponding author.

a Department of Infectious, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China

b Department of Hematology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China

c Department of Pathology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China

d Department of Gastroenterology, The Affiliated Zhuzhou Hospital Xiangya Medical College CSU, Hunan, China

Read

594

Times
was read the article

143

Total PDF

451

Total HTML

Share statistics

 array:23 [
  "pii" => "S1665268122000850"
  "issn" => "16652681"
  "doi" => "10.1016/j.aohep.2022.100743"
  "estado" => "S300"
  "fechaPublicacion" => "2022-11-01"
  "aid" => "100743"
  "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Ann Hepatol. 2022;27:"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:17 [
    "pii" => "S1665268122001235"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2022.100781"
    "estado" => "S300"
    "fechaPublicacion" => "2022-11-01"
    "aid" => "100781"
    "documento" => "simple-article"
    "crossmark" => 0
    "subdocumento" => "ind"
    "cita" => "Ann Hepatol. 2022;27:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:5 [
      "idiomaDefecto" => true
      "titulo" => "An Acknowledgement"
      "tienePdf" => "en"
      "tieneTextoCompleto" => 0
      "contienePdf" => array:1 [
        "en" => true
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122001235?idApp=UINPBA00004N"
    "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122001235/v3_202307180533/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S1665268122000989"
    "issn" => "16652681"
    "doi" => "10.1016/j.aohep.2022.100756"
    "estado" => "S300"
    "fechaPublicacion" => "2022-11-01"
    "aid" => "100756"
    "copyright" => "Fundaci&#243;n Cl&#237;nica M&#233;dica Sur&#44; A&#46;C&#46;"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Ann Hepatol. 2022;27:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Hepatic mir-122-3p&#44; mir-140-5p and mir-148b-5p expressions are correlated with cytokeratin-18 serum levels in MAFLD"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0001"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 2333
              "Ancho" => 3333
              "Tamanyo" => 516988
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0001"
              "detalle" => "Fig "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">Liver histology&#44; potential MAFLD biomarkers and microRNA expression from liver biopsies</span>&#46; A&#41; Liver without steatosis&#44; B&#41; Liver with MAFLD&#44; representative images of sixteen hepatic tissues obtained from human biopsies&#44; stained with H&#38;E&#46; Original magnification 100&#215;&#46; C&#41; Cytokeratin-18 &#40;CK-18&#41; serum levels in patients with and without MAFLD&#44; D&#41; hsa-miR-122-3p change rate&#44; E&#41; hsa-miR-140-5p change rate&#44; and F&#41; hsa-miR-148-5p change rate &#40;2<span class="elsevierStyleSup">&#8722;&#916;&#916;CT</span>&#41; between patients with and without MAFLD&#46; The differences &#40;&#42;&#41; in the mean &#177; standard deviation were considered significant with a p &#8804; 0&#46;001 between groups&#46; Fold Change &#40;FC&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Guillermo N&#46; L&#243;pez-S&#225;nchez, Eduardo Montalvo-Jav&#233;, Mayra Dom&#237;nguez-Perez, Barbara Antuna-Puente, Fredy O&#46; Beltr&#225;n-Anaya, Alfredo Hidalgo-Miranda, Norberto C&#46; Ch&#225;vez-Tapia, Misael Uribe, Natalia Nu&#241;o- L&#225;mbarri"
          "autores" => array:9 [
            0 => array:2 [
              "nombre" => "Guillermo N&#46;"
              "apellidos" => "L&#243;pez-S&#225;nchez"
            ]
            1 => array:2 [
              "nombre" => "Eduardo"
              "apellidos" => "Montalvo-Jav&#233;"
            ]
            2 => array:2 [
              "nombre" => "Mayra"
              "apellidos" => "Dom&#237;nguez-Perez"
            ]
            3 => array:2 [
              "nombre" => "Barbara"
              "apellidos" => "Antuna-Puente"
            ]
            4 => array:2 [
              "nombre" => "Fredy O&#46;"
              "apellidos" => "Beltr&#225;n-Anaya"
            ]
            5 => array:2 [
              "nombre" => "Alfredo"
              "apellidos" => "Hidalgo-Miranda"
            ]
            6 => array:2 [
              "nombre" => "Norberto C&#46;"
              "apellidos" => "Ch&#225;vez-Tapia"
            ]
            7 => array:2 [
              "nombre" => "Misael"
              "apellidos" => "Uribe"
            ]
            8 => array:2 [
              "nombre" => "Natalia"
              "apellidos" => "Nu&#241;o- L&#225;mbarri"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122000989?idApp=UINPBA00004N"
    "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122000989/v3_202307180533/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Circ&#95;0008285 knockdown represses tumor development by miR-384&#47;RRM2 axis in hepatocellular carcinoma"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Shuang Peng, Lai Yi, Lingzhi Liao, Yuling Bin, Weiming Qu, Hongsai Hu"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Shuang"
            "apellidos" => "Peng"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0001"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn1"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Lai"
            "apellidos" => "Yi"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0002"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn1"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Lingzhi"
            "apellidos" => "Liao"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0003"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Yuling"
            "apellidos" => "Bin"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0004"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Weiming"
            "apellidos" => "Qu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0004"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Hongsai"
            "apellidos" => "Hu"
            "email" => array:1 [
              0 => "hhs716@126.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0004"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0001"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Department of Infectious&#44; The Affiliated Zhuzhou Hospital Xiangya Medical College CSU&#44; Hunan&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0001"
          ]
          1 => array:3 [
            "entidad" => "Department of Hematology&#44; The Affiliated Zhuzhou Hospital Xiangya Medical College CSU&#44; Hunan&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0002"
          ]
          2 => array:3 [
            "entidad" => "Department of Pathology&#44; The Affiliated Zhuzhou Hospital Xiangya Medical College CSU&#44; Hunan&#44; China"
            "etiqueta" => "c"
            "identificador" => "aff0003"
          ]
          3 => array:3 [
            "entidad" => "Department of Gastroenterology&#44; The Affiliated Zhuzhou Hospital Xiangya Medical College CSU&#44; Hunan&#44; China"
            "etiqueta" => "d"
            "identificador" => "aff0004"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0001"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 3008
            "Ancho" => 3500
            "Tamanyo" => 853764
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara009" class="elsevierStyleSimplePara elsevierViewall">MiR-384 targeted RRM2</p> <p id="spara010" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; The binding sites between miR-384 and RRM2 were predicted by online prediction tools &#40;TargetScanHuman&#44; miRWALK&#44; and GEPIA&#41;&#46; &#40;B&#41; Expression of RRM2 in HCC tissues was analyzed according to the GEPIA database&#46; &#40;C-D&#41; The overall survival and disease-free survival analysis of RRM2 gene of interest can be presented&#46; &#40;F&#41; Dual luciferase reporter assay to verify the binding relationship between miR-384 and RRM2&#46; &#40;G&#41; RIP assays were used to detect the enrichment of miR-384 and RRM2 in anti-Ago2 groups&#46; &#40;H-I&#41; qRT-PCR and Western blot analysis were performed to determine the effects of miR-384 mimics and inhibitors on RRM2 mRNA and protein levels&#46; &#40;J-K&#41; qRT-PCR and Western blot was used to detect RRM2 mRNA and protein levels in tumor tissues and paracancerous tissues&#46; &#40;L-M&#41; qRT-PCR and Western blot analysis was performed to detect RRM2 mRNA and protein levels in THLE-3&#44; Huh7 and HCCLM3 cells&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">1</span><span class="elsevierStyleSectionTitle" id="cesectitle0008">Introduction</span><p id="para0006" class="elsevierStylePara elsevierViewall">Hepatocellular carcinoma &#40;HCC&#41; is a malignant tumor originating from hepatocytes and hepatic bile duct cells&#46; HCC is the most common form of primary liver cancer and is the second-leading cause of cancer-associated death <a class="elsevierStyleCrossRef" href="#bib0001">&#91;1&#93;</a>&#46; Multiple risk factors for the development of HCC have been identified&#44; including alcohol&#44; smoking&#44; and hepatitis virus <a class="elsevierStyleCrossRef" href="#bib0002">&#91;2&#93;</a>&#46; Most HCC is detected at an advanced stage&#44; but treatment options are lacking at this point&#46; HCC patients at an early stage can be treated with local ablation&#44; surgical resection&#44; or liver transplantation <a class="elsevierStyleCrossRef" href="#bib0003">&#91;3&#93;</a>&#46; Therefore&#44; early detection and prevention of HCC development are the most influential strategy to improve patient outcomes <a class="elsevierStyleCrossRef" href="#bib0004">&#91;4&#93;</a>&#46; The development of HCC is a multi-step transformational process involving many genes and epigenetics <a class="elsevierStyleCrossRef" href="#bib0005">&#91;5&#93;</a>&#46; The specific molecular mechanisms regarding the occurrence and development of HCC have not been fully elucidated&#46; Therefore&#44; it is particularly important to explore new biomarkers and oncogenic molecules for HCC&#46;</p><p id="para0007" class="elsevierStylePara elsevierViewall">Among the family of non-coding RNAs&#44; circRNA is a new RNA molecule that can exist stably on cells due to the absence of 3&#8217;-tail and 5&#8217;-cap structures&#44; thus avoiding RNase R digestion &#91;<a class="elsevierStyleCrossRef" href="#bib0006">6</a>&#44; <a class="elsevierStyleCrossRef" href="#bib0007">7</a>&#93;&#46; CircRNAs were found to be specifically expressed for disease stages and selectively enriched in different types of tissues <a class="elsevierStyleCrossRef" href="#bib0008">&#91;8&#93;</a>&#46; A growing number of studies have signified a robust link between abnormal circRNA expression and the development and occurrence of cancers&#44; including HCC <a class="elsevierStyleCrossRefs" href="#bib0009">&#91;9&#8211;11&#93;</a>&#46; CircRNA can affect gene expression mainly by sponging miRNA <a class="elsevierStyleCrossRef" href="#bib0012">&#91;12&#93;</a>&#46; For example&#44; circ&#95;001680 can mediate the growth and migration of colorectal cancer tumors&#44; while circ&#95;001680 can reinforce the cancer stem cell &#40;CSC&#41; population in colorectal cancer by regulating miR-340&#47;BMI1 axis <a class="elsevierStyleCrossRef" href="#bib0013">&#91;13&#93;</a>&#46; Circ&#95;0067934 targeted miR-545-3p&#47;SLC7A11 axis to weaken ferroptosis in thyroid cancer <a class="elsevierStyleCrossRef" href="#bib0014">&#91;14&#93;</a>&#46; Circ&#95;0014130 acted as a sponge for miR-132-3p and promoted tumorigenesis and metastasis in bladder cancer by regulating the expression of KCNJ12 <a class="elsevierStyleCrossRef" href="#bib0015">&#91;15&#93;</a>&#46; Circ&#95;0008285 is derived from the CDYL gene and located at chr6&#58;4891946-4892613&#44; with a length of 667 bp&#46; Circ&#95;0008285 was significantly enhanced in cervical cancer and promoted cervical cancer progression by acting as a ceRNA for miR-211-5p to release SOX4 expression <a class="elsevierStyleCrossRef" href="#bib0016">&#91;16&#93;</a>&#46; In addition&#44; circ&#95;0008285 is upregulated in HCC and is involved in apoptosis&#44; proliferation and stemness of HCC cells <a class="elsevierStyleCrossRef" href="#bib0017">&#91;17&#93;</a>&#46; However&#44; the molecular mechanism of circ&#95;0008285 in hepatocellular carcinogenesis was still not fully understood&#46;</p><p id="para0008" class="elsevierStylePara elsevierViewall">Our study revealed that circ&#95;0008285 silencing hindered the proliferation&#44; migration and invasion but triggered apoptosis in HCC cells&#46; Furthermore&#44; circ&#95;0008285affected the development of HCC through miR-384&#47;ribonucleotide reductase subunit M2 &#40;RRM2&#41; axis&#46;</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2</span><span class="elsevierStyleSectionTitle" id="cesectitle0009">Materials and methods</span><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;1</span><span class="elsevierStyleSectionTitle" id="cesectitle0010">Subjects</span><p id="para0009" class="elsevierStylePara elsevierViewall">Cancer tissues and paired paracancerous tissues &#40;&#62;2 cm from the edge of cancerous tissues&#41; of 55 HCC patients were surgically resected from HCC specimens and collected at The Affiliated Zhuzhou Hospital Xiangya Medical College CSU from 2019 to 2020&#46; All tissues were frozen in liquid nitrogen urgently after resection and transferred to a -80&#176;C refrigerator for storage&#46; All patients were not treated with antitumor therapy such as radiotherapy&#44; chemotherapy&#44; or targeted drug therapy before surgery&#44; and HCC tissues were postoperative histopathology confirmed&#46;</p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;2</span><span class="elsevierStyleSectionTitle" id="cesectitle0011">Cell culture and transfection</span><p id="para0010" class="elsevierStylePara elsevierViewall">Normal hepatocyte cell lines &#40;THLE-3&#41; and HCC cell lines &#40;Huh 7 and HCCLM3&#41; were purchased from the ATCC &#40;Manassas&#44; VA&#44; USA&#41; and cultured in DMEM medium &#40;including 10&#37; fetal bovine serum &#40;FBS&#41; &#43; 100 U&#47;ml penicillin &#43; 100 &#956;g&#47; ml streptomycin&#41; in an incubator with 5&#37; CO<span class="elsevierStyleInf">2</span>&#44; 95 &#37; relative humidity at 37&#176;C&#46;</p><p id="para0011" class="elsevierStylePara elsevierViewall">Small interfering RNA targeting circ&#95;0008285 &#40;si-circ&#95;0008285&#41;&#44; miR-384 mimics &#40;miR-384&#41;&#44; miR-384 inhibitors &#40;anti-miR-384&#41;&#44; overexpression plasmids of RRM2 &#40;pcDNA-RRM2&#41; and negative controls &#40;si-NC&#44; miR-NC&#44; anti-NC and pcDNA&#41; were provided by GenePharma &#40;Shanghai&#44; China&#41;&#46; Huh7 and HCCLM3 cells were inoculated in 6-well plates &#40;5 &#215; 10<span class="elsevierStyleSup">5</span>&#47;well&#41; and grown to 50&#37; confluence&#44; and the cultured cells were transfected using Lipofectamine&#8482; 6000 &#40;Beyotime&#44; Shanghai&#44; China&#41;&#46;</p></span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;3</span><span class="elsevierStyleSectionTitle" id="cesectitle0012">RNA extraction and qRT-PCR</span><p id="para0012" class="elsevierStylePara elsevierViewall">RNA was extracted from total cells and tissues using the Trizol &#40;Beyotime&#41; reagent&#46; The extracted total RNA was reversely transcribed into cDNA according to the instruction manual of miScript RT Kit &#40;TaKaRa&#44; Dalian&#44; China&#41;&#46; cDNA was used as a template for qRT-PCR by using SYBR Premix Ex Taq II &#40;TaKaRa&#41;&#46; U6 &#40;for miRNA or nucleus&#41; or GAPDH &#40;for circRNA&#44; mRNA&#44; or cytoplasm&#41; was used as an internal control&#46; Relative RNA levels were calculated by using 2<span class="elsevierStyleSup">&#8722;&#916;&#916;CT</span> method&#46; The specific primer sequences are shown in <a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0001"></elsevierMultimedia></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;4</span><span class="elsevierStyleSectionTitle" id="cesectitle0013">Subcellular fractionation location</span><p id="para0013" class="elsevierStylePara elsevierViewall">Cytoplasmic and nuclear RNA from HCC cells were isolated according to the instructions of the Cytoplasmic and Nuclear RNA Purification Kit &#40;Beyotime&#41;&#44; and the expression of circ&#95;0008285 was detected by qRT-PCR&#46;</p></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;5</span><span class="elsevierStyleSectionTitle" id="cesectitle0014">Cell counting kit-8 &#40;CCK-8&#41; assay</span><p id="para0014" class="elsevierStylePara elsevierViewall">The transfected cells were planted on 96-well plates&#46; 10 &#956;L CCK-8 solution &#40;Beyotime&#41; was added after 0 h&#44; 24 h&#44; 48 h and 72 h of incubation&#44; and the optical density values at 450 nm were tested by a microplate reader&#46;</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;6</span><span class="elsevierStyleSectionTitle" id="cesectitle0015">5-ethynyl-2&#8217;-deoxyuridine &#40;Edu&#41; staining</span><p id="para0015" class="elsevierStylePara elsevierViewall">EdU Staining Proliferation Kit &#40;Beyotime&#41; was employed for the analysis of cell proliferation&#46; The transfected cells were inoculated into 96-well plates&#44; and each well was incubated with 50 &#956;mol&#47;L Edu solution for 2 h&#46; The nuclear was then incubated with DAPI reaction solution for 30 min&#46; The cells were observed under a fluorescence microscope&#46;</p></span><span id="sec0009" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;7</span><span class="elsevierStyleSectionTitle" id="cesectitle0016">Cell apoptosis assay</span><p id="para0016" class="elsevierStylePara elsevierViewall">Annexin V-FITC&#47;PI apoptosis detection kit &#40;Solarbio&#44; Beijing&#44; China&#41; was utilized to analyze cell apoptosis&#46; The cells were resuspended with Annexin V binding buffer and incubated with Annexin V-FITC and PI solution in the dark&#46; Cell apoptosis was examined by a flow cytometer&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;8</span><span class="elsevierStyleSectionTitle" id="cesectitle0017">Transwell assay</span><p id="para0017" class="elsevierStylePara elsevierViewall">Transwell chambers &#40;Corning&#44; Tewksbury&#44; MA&#44; USA&#41; that precoated with &#40;for invasion assay&#41; or without &#40;for migration assay&#41; Matrigel matrix &#40;Corning&#41; were employed to detect cell migration and invasion&#46; In brief&#44; cells in non-serum medium were inoculated into the upper chamber of the transwell&#44; and 10 &#37; fetal bovine serum was added to the lower chamber and incubated for 24 h&#46; Cells that migrated or invaded through the membranes were stained with 0&#46;1&#37; crystal violet solution for 30 minutes&#44; and the results were analyzed by counting the number of migrated or invaded cells under the microscope&#46;</p></span><span id="sec0011" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;9</span><span class="elsevierStyleSectionTitle" id="cesectitle0018">Western blotting</span><p id="para0018" class="elsevierStylePara elsevierViewall">Tissues and cells were fully lysed using RIPA lysis solution &#40;Beyotime&#41; and total proteins were extracted&#46; The total proteins were subjected to SDS-PAGE gel electrophoresis&#44; and then the separated proteins were electro-transferred onto the PVDF membrane &#40;Millipore&#44; Billerica&#44; MA&#44; USA&#41;&#44; and the membrane was blocked with 10&#37; skim milk powder for 2 h&#46; The membranes were incubated with primary antibodies including&#58; anti-Bax &#40;ab53154&#44; 1&#58;1000&#41;&#44; anti-Bcl-2 &#40;ab196495&#44; 1&#58;1000&#41;&#44; anti-E-cadherin &#40;ab133597&#44; 1&#58;2000&#41;&#44; anti-Vimentin &#40;ab137321&#44; 1&#58;2000&#41;&#44; anti-N-cadherin &#40;ab211126&#44; 1&#58;2000&#41;&#44; anti-RRM2 &#40;ab154964&#44; 1&#58;1000&#41; and anti-&#946;-actin &#40;ab8227&#44; 1&#58;2000&#41;&#44; overnight at 4&#176;C&#46; Then&#44; the membranes were incubated with Goat Anti-Rabbit IgG H&#38;L &#40;HRP&#41; second antibody &#40;ab205718&#44; 1&#58;10000&#41;&#46; Finally&#44; the membranes were developed using ECL reagent &#40;Millipore&#41; and analyzed semi-quantitatively using ImageJ software&#46; The antibodies used in this experiment were obtained from Abcam &#40;Cambridge&#44; MA&#44; USA&#41;&#46;</p></span><span id="sec0012" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;10</span><span class="elsevierStyleSectionTitle" id="cesectitle0019">Luciferase reporter assay</span><p id="para0019" class="elsevierStylePara elsevierViewall">Bioinformatics was employed for the prediction of binding targets of circ&#95;0008285 and RRM2&#46; The wild-type &#40;WT&#41; sequences of circ&#95;0008285 or RRM2 3&#8242;UTR containing miR-384 binding sequences were cloned into the pmirGLO vector &#40;Promega&#44; Madison&#44; WI&#44; USA&#41;&#44; respectively&#44; and the recombinant vectors were named circ&#95;0008285-WT&#44; RRM2 3&#8242;UTR-WT&#44; circ&#95;0008285-MUT and RRM2 3&#8242;UTR-MUT&#46; The constructed plasmids and miR-384 mimics or miR-NC were co-transfected into HCC cells&#46; The luciferase activity was measured at 48 h after transfection&#46;</p></span><span id="sec0013" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;11</span><span class="elsevierStyleSectionTitle" id="cesectitle0020">RNA immunoprecipitation &#40;RIP&#41; assay</span><p id="para0020" class="elsevierStylePara elsevierViewall">Magna RNA immunoprecipitation kit &#40;Millipore&#41; was employed for RIP assay&#46; HCC cells were lysed in RIP lysis buffer&#59; then&#44; cell lysates were incubated with magnetic beads labeled with anti-IgG &#40;ab190475&#44; Abcam&#41; and anti-Ago2 &#40;ab186733&#44; Abcam&#41;&#46; Then&#44; qRT-PCR was applied to test the relative expression of circ&#95;0008285&#44; miR-384 and RRM2 in the precipitates&#46;</p></span><span id="sec0014" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;12</span><span class="elsevierStyleSectionTitle" id="cesectitle0021">Xenograft mice model</span><p id="para0021" class="elsevierStylePara elsevierViewall">Short hairpin RNA targeting circ&#95;0008285 &#40;sh-circ&#95;0008285&#41; or negative control &#40;sh-NC&#41; were packaged by lentivirus packaging to construct a stable transduced Huh7 cell line&#46; The transfected Huh7 cells were adjusted to a concentration of 5&#160;&#215;&#160;10<span class="elsevierStyleSup">6</span>&#47;mL&#44; inoculated into the right side of the back side of nude mice and then divided into 2 groups &#40;6 nude mice for each group&#41;&#46; The mice were placed in a specific pathogen-free room&#44; and the general condition&#44; time of graft tumor formation and size of the nude mice were recorded and observed&#46; The longest diameter &#40;L&#41; and shortest diameter &#40;W&#41; of the xenograft tumors were measured every 7 days for 35 days with a vernier caliper&#44; and their tumor volume &#40;V&#41; was calculated by using the formula&#58; V&#160;&#61;&#160;&#40;L&#160;&#215;&#160;W<span class="elsevierStyleSup">2</span>&#41;&#47;2&#46; The growth curve of the transplanted tumor was generated&#46; 35 days later&#44; the nude mice were killed&#44; the tumor tissues were removed&#44; tumor weights were measured&#44; and subsequent experiments were performed&#46; All animal experiments were approved by the Animal Care and Use Committee of The Affiliated Zhuzhou Hospital Xiangya Medical College CSU NO&#46; ZX19617 and complied with the guidelines of the National Institutes of Health</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;13</span><span class="elsevierStyleSectionTitle" id="cesectitle0022">Statistical analysis</span><p id="para0022" class="elsevierStylePara elsevierViewall">The experimental data of 3 replicates were statistically analyzed and statistical images were plotted using GraphPad Prism 7&#46;0 software&#46; The measurement data were presented as mean &#177;standard deviation&#46; The linear relationship between the expression levels of circ&#95;0008285&#44; miR-384 and RRM2 in cancer tissues was assessed by Spearman&#39;s correlation test&#46; Student t-test or one-way analysis of variance &#40;ANOVA&#41; was used to compare the differences between the groups&#46; Statistical significance was deemed when <span class="elsevierStyleItalic">P</span>&#60;0&#46;05&#46;</p></span><span id="sec0015a" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">2&#46;14</span><span class="elsevierStyleSectionTitle" id="cesectitle0022a">Ethical statements</span><p id="para0022a" class="elsevierStylePara elsevierViewall">Written informed consent was obtained from all participants and this study was permitted by the Ethics Committee of The Affiliated Zhuzhou Hospital Xiangya Medical College &#40;CSU&#46; NO&#46; ZX19617&#41;&#46;</p></span></span><span id="sec0016" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3</span><span class="elsevierStyleSectionTitle" id="cesectitle0023">Results</span><span id="sec0017" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;1</span><span class="elsevierStyleSectionTitle" id="cesectitle0024">Circ&#95;0008285 was highly expressed in the tissues and cells of HCC</span><p id="para0023" class="elsevierStylePara elsevierViewall">First&#44; 55 pairs of HCC tissues and non-cancerous tissues were analyzed by qRT-PCR analysis&#46; Results showed that circ&#95;0008285 expression was significantly increased in HCC tissues compared to paraneoplastic tissues &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>A&#41;&#46; Similarly&#44; circ&#95;0008285 expression was significantly upregulated in HCC cells &#40;Huh7 and HCCLM3&#41; compared to normal hepatocytes &#40;THLE-3&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>B&#41;&#46; Cytoplasmic and nuclear RNA analysis showed that circ&#95;00008285 was mainly presented in the cytoplasm &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>C-D&#41;&#46; These results suggested that the aberrant expression of circ&#95;0008285 in HCC tissues and cell lines may be closely associated with the progression of HCC&#46;</p><elsevierMultimedia ident="fig0001"></elsevierMultimedia></span><span id="sec0018" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;2</span><span class="elsevierStyleSectionTitle" id="cesectitle0025">Circ&#95;0008285 knockdown impeded cell proliferation&#44; migration and invasion while promoted cell apoptosis in HCC cells</span><p id="para0024" class="elsevierStylePara elsevierViewall">Next&#44; to further explore the biological function of circ&#95;0008285 in HCC&#44; the expression of circ&#95;0008285 was silenced in Huh7 and HCCLM3 cells&#46; First&#44; the cells were transfected with si-NC &#40;as control&#41; or si-circ&#95;0008285&#46; qRT-PCR was applied to analyze the transfection efficiency&#44; and the results showed that transfection of si-circ&#95;0008285 significantly decreased the expression of circ&#95;0008285 in the cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>A&#41;&#46; CCK8 and Edu assays showed that circ&#95;0008285 silencing significantly inhibited the proliferative ability of cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>B-D&#41;&#46; Flow cytometry analysis showed that knockdown of circ&#95;0008285 significantly increased the apoptosis rate of Huh7 and HCCLM3 cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>E&#41;&#46; The expression levels of pro-apoptotic protein Bax and anti-apoptotic protein Bcl-2 in HCC cells were detected by Western blot&#46; In HCC cells with silencing of circ&#95;0008285&#44; the expression level of Bax was significantly upregulated and Bcl-2 expression level was significantly down-regulated in cells&#44; clarifying that circ&#95;0008285 interference promoted apoptosis in HCC cells &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>F&#41;&#46; In addition&#44; knockdown of circ&#95;0008285 significantly inhibited cell migration and invasion &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>G-H&#41;&#46; Epithelial-mesenchymal transition &#40;EMT&#41;&#44; which represents the metastatic tumor process&#44; was examined by Western blot&#46; The results showed that silencing of circ&#95;0008285 significantly increased E-cadherin protein levels and decreased Vimentin and N-cadherin protein levels &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>I&#41;&#46; In summary&#44; we concluded that circ&#95;0008285 silencing inhibited the proliferation&#44; migration&#44; invasion and EMT&#44; but promoted apoptosis in HCC cells&#46;</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia></span><span id="sec0019" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;3</span><span class="elsevierStyleSectionTitle" id="cesectitle0026">Circ&#95;0008285 directly targeted miR-384</span><p id="para0025" class="elsevierStylePara elsevierViewall">To further explore the regulatory mechanism of circ&#95;0008285 in HCC&#44; bioinformatics software was used to predict the potential miRNAs interacted with circ&#95;0008285&#46; Circinteractome database predicted the existence of complementary binding sites between circ&#95;0008285 and miR-384 &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>A&#41;&#46; To confirm the targeting relationship between circ&#95;0008285 and miR-384&#44; the overexpression efficiency of miR-384 mimics was first examined&#46; qRT-PCR results showed that miR-384 expression was dramatically increased in HCC cells after transfection with miR-384 mimics &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>B&#41;&#46; Subsequently&#44; dual luciferase reporter assay showed that miR-384 overexpression significantly inhibited the luciferase activity of circ&#95;0008285-WT group&#44; while it had no significant effect on the luciferase activity of circ&#95;0008285-MUT group &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>C&#41;&#46; RIP analysis showed that compared with the anti-IgG group&#44; circ&#95;0008285 and miR-384 were significantly enriched in the immunoprecipitation of the anti-Ago2 group &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>D&#41;&#46; It was found that miR-384 expression was significantly downregulated in HCC tissues and cell lines compared with adjacent normal tissues and normal hepatocytes &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>E-F&#41;&#46; The above results suggested that miR-384 was targeted by circ&#95;0008285&#46;</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;4</span><span class="elsevierStyleSectionTitle" id="cesectitle0027">MiR-384 downregulation attenuated the influence of circ&#95;0008285 interference on cell proliferation&#44; migration&#44; invasion&#44; and apoptosis in HCC cells</span><p id="para0026" class="elsevierStylePara elsevierViewall">CircRNAs are extremely rich in binding sites for miRNAs and therefore act like sponges by absorbing miRNAs <a class="elsevierStyleCrossRef" href="#bib0018">&#91;18&#93;</a>&#46; The relationship between circ&#95;0008285 and miR-384 has been demonstrated&#59; however&#44; the biological behavior of HCC that they regulate still needs to be determined&#46; We transfected si-NC&#44; si-circ&#95;0008285&#44; si-circ&#95;0008285&#43;anti-NC&#44; or si-circ&#95;0008285&#43;anti-miR-384 in Huh7 and HCCLM3 cells and then performed a series of rescue experiments&#46; First&#44; the effectiveness of miR-384 inhibitor was verified by qRT-PCR &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>A&#41;&#46; CCK8 and Edu assays showed that miR-384 inhibitor partially attenuated the inhibition effect of circ&#95;0008285 interference on cell proliferation &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>B-D&#41;&#46; In addition&#44; miR-384 knockdown attenuated promoting effect of circ&#95;0008285 downregulation on cell apoptosis &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>E&#41;&#46; Western blot results showed that miR-384 deletion reversed the effect of circ&#95;0008285 silencing on Bax and Bcl-2 protein levels &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>F&#41;&#46; Transwell assay results showed that silencing of circ&#95;0008285 resulted in a significant inhibition in cell migration and invasion&#44; while the addition of anti-miR-384 resulted in a significant increase in cell migration and invasion &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>G-H&#41;&#46; Downregulation of miR-384 reversed the effects of si-circ&#95;0008285 on E-cadherin&#44; Vimentin and N-cadherin levels &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>I&#41;&#46; Overall&#44; circ&#95;0008285 silencing suppressed the malignant phenotype of HCC cells by targeting miR-384&#46;</p><elsevierMultimedia ident="fig0004"></elsevierMultimedia></span><span id="sec0021" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;5</span><span class="elsevierStyleSectionTitle" id="cesectitle0028">MiR-384 targeted RRM2</span><p id="para0027" class="elsevierStylePara elsevierViewall">To further clarify the mechanism of miR-384&#44; the target genes of miR-384 were predicted by online bioinformatics databases&#46; We predicted the target gene RRM2 by TargetScanHuman&#44; miRWALK and GEPIA simultaneously &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>A&#41;&#46; RRM2 was found to be highly expressed in HCC tissues in the GEPIA database &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>B&#41;&#46; Besides&#44; according to the disease-free survival and overall survival data of the GEPIA database&#44; we found that high RRM2 expression is associated with poorer disease-free survival and overall survival &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>C-D&#41;&#46; MiR-384 and RRM2 were shown to contain complementary binding sites in the TargetScanHuman online database &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>E&#41;&#46; Dual luciferase reporter assay showed that miR-384 overexpression significantly inhibited the luciferase activity of RRM2 3&#8217;UTR-WT group&#44; while it had no significant effect on the luciferase activity of RRM2 3&#8217;UTR-MUT group &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>F&#41;&#46; It has been widely known that miRNAs modulate the expression of target gene by binding to Ago2&#44; the key component of RNA-induced silencing complex &#40;RISC&#41;&#46; Then RIP analysis was conducted&#44; and the results showed that compared to the anti-IgG group&#44; miR-384 and RRM2 were significantly enriched in the anti-Ago2 immunoprecipitation group &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>G&#41;&#46; In addition&#44; RRM2 mRNA and protein levels were significantly elevated by miR-384 inhibitor and were significantly down-regulated by miR-384 mimics &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>H-I&#41;&#46; As expected&#44; RRM2 mRNA and protein levels were significantly upregulated in HCC tissues and cell lines compared to adjacent normal tissues and normal hepatocytes &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>J-M&#41;&#46; These results suggested that miR-384 could target RRM2&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0022" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;6</span><span class="elsevierStyleSectionTitle" id="cesectitle0029">RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation&#44; migration&#44; invasion&#44; and apoptosis of HCC cells</span><p id="para0028" class="elsevierStylePara elsevierViewall">MiRNAs could regulate the expression of their target genes through post-transcriptional regulation &#91;<a class="elsevierStyleCrossRef" href="#bib0018">18</a>&#44; <a class="elsevierStyleCrossRef" href="#bib0019">19</a>&#93;&#46; To determine whether RRM2 is involved in miR-384-mediated biological functions&#44; we transfected miR-NC&#44; miR-384&#44; miR-384&#43;pcDNA&#44; or miR-384&#43;pcDNA-RRM2 in Huh7 and HCCLM3 cells&#44; and then performed a series of rescue experiments&#46; First&#44; qRT-PCR and Western blot results showed that RRM2 mRNA and protein levels were significantly elevated in the pcDNA-RRM2 group compared to the pcDNA group &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>A-B&#41;&#46; In addition&#44; overexpression of miR-384 significantly inhibited cell proliferation and promoted apoptosis&#44; which were reversed by overexpression of RRM2 &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>B-F&#41;&#46; Overexpression of miR-384 expression elevated the expression level of Bax and decreased the expression level of Bcl-2&#44; which could be restored by RRM2 overexpression &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>G&#41;&#46; Cell migration and invasion were inhibited by miR-384 mimics&#44; and RRM2 overexpression impeded these effects &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>H-I&#41;&#46; Furthermore&#44; overexpression of RRM2 reversed the effects of miR-384 mimics on E-cadherin&#44; Vimentin and N-cadherin protein levels &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>J&#41;&#46; Taken together&#44; miR-384 overexpression inhibited the malignant behaviors of HCC cells by targeting RRM2&#46;</p><elsevierMultimedia ident="fig0006"></elsevierMultimedia></span><span id="sec0023" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;7</span><span class="elsevierStyleSectionTitle" id="cesectitle0030">Circ&#95;0008285 regulated RRM2 expression by targeting miR-384</span><p id="para0029" class="elsevierStylePara elsevierViewall">Next&#44; we further explored whether circ&#95;0008285 could act as a miR-384 sponge to regulate RRM2 expression&#46; The results showed that in Huh7 and HCCLM3 cells&#44; circ&#95;0008285 silencing caused a great reduction in RRM2 mRNA and protein levels&#44; and miR-384 inhibitor attenuated these effects &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46; 7</a>A-B&#41;&#46; Furthermore&#44; in HCC tissues&#44; miR-384 expression was negatively correlated with circ&#95;0008285 and RRM2 expression levels&#44; while circ&#95;0008285 expression was positively correlated with RRM2 expression &#40;<a class="elsevierStyleCrossRef" href="#fig0007">Fig&#46; 7</a>C-E&#41;&#46; These results implied that circ&#95;0008285 can regulate the expression of RRM2 by sponging miR-384&#46;</p><elsevierMultimedia ident="fig0007"></elsevierMultimedia></span><span id="sec0024" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">3&#46;8</span><span class="elsevierStyleSectionTitle" id="cesectitle0031">Silencing of hsa&#95;circ&#95;0008285 inhibited tumor growth in vivo</span><p id="para0030" class="elsevierStylePara elsevierViewall">Finally&#44; the effect of circ&#95;0008285 silencing on tumor growth was investigated by <span class="elsevierStyleItalic">in vivo</span> tumorigenesis assay&#46; The results showed that tumor volume and weight were suppressed in the sh-circ&#95;0008285 group compared to the sh-NC group &#40;<a class="elsevierStyleCrossRef" href="#fig0008">Fig&#46; 8</a>A-B&#41;&#46; qRT-PCR results showed that the levels of circ&#95;0008285 and RRM2 mRNA were significantly reduced&#44; and miR-140-3p level was significantly increased in xenograft tumor tissues with circ&#95;0008285 knockdown &#40;<a class="elsevierStyleCrossRef" href="#fig0008">Fig&#46; 8</a>C-E&#41;&#46; In addition&#44; silencing of circ&#95;0008285 significantly suppressed the expression levels of RRM2&#44; Bcl-2&#44; Vimentin and N-cadherin but elevated the expression levels of Bax and E-cadherin in xenograft tumor tissues &#40;<a class="elsevierStyleCrossRef" href="#fig0008">Fig&#46; 8</a>F&#41;&#46; Altogether&#44; circ&#95;008285 silence inhibited tumor growth by miR-384&#47;RRM2 axis&#46;</p><elsevierMultimedia ident="fig0008"></elsevierMultimedia></span></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">4</span><span class="elsevierStyleSectionTitle" id="cesectitle0032">Discussion</span><p id="para0031" class="elsevierStylePara elsevierViewall">In the past few years&#44; an accumulating body of research has established that circRNAs can be used as diagnostic or predictive biomarkers for certain diseases&#44; particularly cancer&#46; CircRNAs are aberrantly expressed in cancer and play an integral oncogenic or anti-oncogene effects in the progression of tumors <a class="elsevierStyleCrossRef" href="#bib0020">&#91;20&#93;</a>&#46; In addition&#44; circRNAs can significantly regulate the biological phenotype of cells&#44; which might be new tumor markers &#91;<a class="elsevierStyleCrossRef" href="#bib0021">21</a>&#44; <a class="elsevierStyleCrossRef" href="#bib0022">22</a>&#93;&#46; For example&#44; a low expression level of circ&#95;0035445 in gastric cancer was associated with distant metastasis and tumor size&#59; functionally&#44; upregulation of circ&#95;0035445 blocked cell migration&#44; boosted apoptosis&#44; and suppressed cell cycle progression <a class="elsevierStyleCrossRef" href="#bib0023">&#91;23&#93;</a>&#46; In colorectal cancer&#44; circ&#95;001659 might be a useful serum biomarker for the detection and prognosis of colorectal cancer&#59; <span class="elsevierStyleItalic">in vitro</span> experiments showed that circ&#95;001659 could expedite cell invasion and migration <a class="elsevierStyleCrossRef" href="#bib0024">&#91;24&#93;</a>&#46; In addition&#44; circ&#95;001569 boosted cell proliferation&#44; migration and invasion of pancreatic cancer but curbed apoptosis <a class="elsevierStyleCrossRef" href="#bib0025">&#91;25&#93;</a>&#46; A previous study has shown that circ-CDYL &#40;circ&#95;0008285&#41; promoted the tumor-initiating properties and chemoresistance of HCC cells <a class="elsevierStyleCrossRef" href="#bib0017">&#91;17&#93;</a>&#46; However&#44; large-scale identifications of circ&#95;0008285 expression in HCC tumorigenesis were not yet reported&#46; In this study&#44; we demonstrated that circ&#95;0008285 was abnormally unregulated in HCC&#44; and silencing of circ&#95;0008285 significantly constrained proliferation&#44; migration&#44; invasion and EMT but impelled apoptosis in HCC cells&#46; <span class="elsevierStyleItalic">In vivo</span> studies showed that silencing of circ&#95;0008285 inhibited tumor growth <span class="elsevierStyleItalic">in vivo</span>&#46; These studies revealed the oncogenic role of circ&#95;0008285 in HCC&#44; suggesting that it could be an important marker for the therapy of HCC&#46;</p><p id="para0032" class="elsevierStylePara elsevierViewall">Studies show that miRNAs are engaging in a wide range of biological processes and have a significant correlation between cancer diagnosis and prognosis <a class="elsevierStyleCrossRef" href="#bib0026">&#91;26&#93;</a>&#46; MiRNAs can directly bind to downstream target genes to induce mRNA degradation or inhibit translation&#44; thereby participating in various physiological and pathological processes &#91;<a class="elsevierStyleCrossRef" href="#bib0027">27</a>&#44; <a class="elsevierStyleCrossRef" href="#bib0028">28</a>&#93;&#46; For example&#44; miR-145 was found to be downregulated in prostate cancer and to be a putative tumor suppressor by reducing cell growth and increasing cell death <a class="elsevierStyleCrossRef" href="#bib0029">&#91;29&#93;</a>&#46; In breast cancer cells&#44; downregulation of miR-105-3p retarded cell proliferation&#44; suppressed cell migration&#44; invasion&#44; and reinforced apoptosis <a class="elsevierStyleCrossRef" href="#bib0030">&#91;30&#93;</a>&#46; It was found that miR-384 induced autophagy and apoptosis through negative control of COL10A1 in non-small cell lung cancer cells <a class="elsevierStyleCrossRef" href="#bib0031">&#91;31&#93;</a>&#46; In this study&#44; miR-384 expression was declined in HCC&#44; and overexpression of miR-384 confined cell proliferation&#44; migration&#44; invasion and EMT but reinforced apoptosis <span class="elsevierStyleItalic">in vitro</span>&#46;</p><p id="para0033" class="elsevierStylePara elsevierViewall">Notably&#44; circRNAs can serve as miRNA sponges&#44; thereby modulating gene expression <a class="elsevierStyleCrossRef" href="#bib0032">&#91;32&#93;</a>&#46; Circ&#95;0000517 could sponge miR-326 to retard its expression&#44; and inhibition of miR-326 abolished the effect of circ&#95;0000517 knockdown on the malignant behaviors of breast cancer cells <a class="elsevierStyleCrossRef" href="#bib0033">&#91;33&#93;</a>&#46; Circ&#95;0001017 acted as a sponge for miR-197 and inhibited the development of gastric cancer <a class="elsevierStyleCrossRef" href="#bib0034">&#91;34&#93;</a>&#46; Circ&#95;0007385 suppressed the malignant behaviors by targeting miR-519d-3p in non-small cell lung cancer cells <a class="elsevierStyleCrossRef" href="#bib0035">&#91;35&#93;</a>&#46; We predicted the binding sites between circ&#95;0008285 and miR-384&#44; and also verified that circ&#95;0008285 could adsorb miR-384&#46; Circ&#95;0008285 was negatively correlated with miR-384 expression in HCC tissues&#46; In addition&#44; anti-miR-384 reversed the effects of circ&#95;0000218 silencing on the proliferation&#44; migration&#44; invasion and apoptosis of HCC cells&#46; Besides&#44; circ&#95;0008285 reinforced HCC cell progression through sponging miR-384&#46;</p><p id="para0034" class="elsevierStylePara elsevierViewall">It has been revealed that circRNA can adsorb miRNA to regulate mRNA&#44; and the circRNA-miRNA-mRNA regulatory network has an important regulatory role in cancer&#46; For example&#44; Circ&#95;0007841 accelerates ovarian cancer development by intensifying the expression of MEX3C through the inhibition of miR-151-3p activity <a class="elsevierStyleCrossRef" href="#bib0036">&#91;36&#93;</a>&#46; RRM2 acts as a pro-oncogene in HCC&#44; and high expression of RRM2 may be a helpful marker for predicting early recurrence and may be a marker of poor prognosis after curative resection in HCC <a class="elsevierStyleCrossRef" href="#bib0037">&#91;37&#93;</a>&#46; In this study&#44; RRM2 was identified and confirmed as a potential target for miR-384&#46; And miR-384 negatively moderated RRM2 expression&#59; furthermore&#44; RRM2 mRNA and protein levels were significantly elevated in HCC&#46; Overexpression of RRM2 was able to reverse the suppression effects of miR-384 mimics on the malignant phenotypes of HCC cells&#46; These data suggested that miR-384 regulated the development of HCC by targeting RRM2&#46; Furthermore&#44; circ&#95;0008285 expression was positively correlated with RRM2 in HCC&#46; Circ&#95;0008285 silencing decreased RRM2 expression&#44; while miR-384 inhibitor attenuated this effect&#46; This finding implied that circ&#95;0008285 could regulate RRM2 expression by sponging miR-384&#46; Besides that&#44; previous studies also showed the downstream target mRNAs or pathways of RRM2 in multiple diseases&#46; For instance&#44; RRM2 binds to ANXA1 to activate AKT signaling in renal cancer&#44; thus promoting tumor growth and sunitinib resistance <a class="elsevierStyleCrossRef" href="#bib0038">&#91;38&#93;</a>&#46; Overexpression of RRM2 can improve the damage of cardiac structure and function by activating Hippo-YAP Pathway <a class="elsevierStyleCrossRef" href="#bib0039">&#91;39&#93;</a>&#46; However&#44; the lack of target gene detection of RRM2 is a certain limitation in our work&#44; which will be studied in future research&#46;</p></span><span id="sec0026" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleLabel">5</span><span class="elsevierStyleSectionTitle" id="cesectitle0033">Conclusion</span><p id="para0035" class="elsevierStylePara elsevierViewall">Circ&#95;0008285 could perform its vital functions in the progression of HCC by miR-384&#47;RRM2 axis&#44; which provided a new experimental basis for using circ&#95;0008285 as a marker for the diagnosis and treatment of HCC&#46;</p></span><span id="sec0027" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0034">Funding</span><p id="para0036" class="elsevierStylePara elsevierViewall">This study was supported by&#58; the <span class="elsevierStyleGrantSponsor" id="gs0001">Natural Science Foundation of Hunan Province</span> &#91;<span class="elsevierStyleGrantNumber" refid="gs0001">2021JJ70076</span>&#93;</p></span><span id="sec0028" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0035">Author&#39;s contributions</span><p id="para0037" class="elsevierStylePara elsevierViewall">All persons who meet authorship criteria are listed as authors&#44; and all authors certify that they have participated sufficiently in work to take public responsibility for the content&#44; including participation in the concept&#44; design&#44; analysis&#44; writing&#44; or revision of the manuscript&#46; All the authors gave their final approval of the version to be published and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the article are appropriately investigated and resolved&#46; Shuang Peng designed the research and wrote the manuscript&#46; Lai Yi&#44; Yiling Bin and Lingzhi Liao collected and analyzed the data&#46; Weiming Qu and Hongsai Hu reviewed and edited the manuscript&#46; All authors read and approved the final manuscript&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1935018"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abss0001"
              "titulo" => "Introduction and objectives"
            ]
            1 => array:2 [
              "identificador" => "abss0002"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abss0003"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abss0004"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1667821"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1667820"
          "titulo" => "Abbreviations"
        ]
        3 => array:2 [
          "identificador" => "sec0001"
          "titulo" => "Introduction"
        ]
        4 => array:3 [
          "identificador" => "sec0002"
          "titulo" => "Materials and methods"
          "secciones" => array:14 [
            0 => array:2 [
              "identificador" => "sec0003"
              "titulo" => "Subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0004"
              "titulo" => "Cell culture and transfection"
            ]
            2 => array:2 [
              "identificador" => "sec0005"
              "titulo" => "RNA extraction and qRT-PCR"
            ]
            3 => array:2 [
              "identificador" => "sec0006"
              "titulo" => "Subcellular fractionation location"
            ]
            4 => array:2 [
              "identificador" => "sec0007"
              "titulo" => "Cell counting kit-8 &#40;CCK-8&#41; assay"
            ]
            5 => array:2 [
              "identificador" => "sec0008"
              "titulo" => "5-ethynyl-2&#8217;-deoxyuridine &#40;Edu&#41; staining"
            ]
            6 => array:2 [
              "identificador" => "sec0009"
              "titulo" => "Cell apoptosis assay"
            ]
            7 => array:2 [
              "identificador" => "sec0010"
              "titulo" => "Transwell assay"
            ]
            8 => array:2 [
              "identificador" => "sec0011"
              "titulo" => "Western blotting"
            ]
            9 => array:2 [
              "identificador" => "sec0012"
              "titulo" => "Luciferase reporter assay"
            ]
            10 => array:2 [
              "identificador" => "sec0013"
              "titulo" => "RNA immunoprecipitation &#40;RIP&#41; assay"
            ]
            11 => array:2 [
              "identificador" => "sec0014"
              "titulo" => "Xenograft mice model"
            ]
            12 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Statistical analysis"
            ]
            13 => array:2 [
              "identificador" => "sec0015a"
              "titulo" => "Ethical statements"
            ]
          ]
        ]
        5 => array:3 [
          "identificador" => "sec0016"
          "titulo" => "Results"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0017"
              "titulo" => "Circ&#95;0008285 was highly expressed in the tissues and cells of HCC"
            ]
            1 => array:2 [
              "identificador" => "sec0018"
              "titulo" => "Circ&#95;0008285 knockdown impeded cell proliferation&#44; migration and invasion while promoted cell apoptosis in HCC cells"
            ]
            2 => array:2 [
              "identificador" => "sec0019"
              "titulo" => "Circ&#95;0008285 directly targeted miR-384"
            ]
            3 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "MiR-384 downregulation attenuated the influence of circ&#95;0008285 interference on cell proliferation&#44; migration&#44; invasion&#44; and apoptosis in HCC cells"
            ]
            4 => array:2 [
              "identificador" => "sec0021"
              "titulo" => "MiR-384 targeted RRM2"
            ]
            5 => array:2 [
              "identificador" => "sec0022"
              "titulo" => "RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation&#44; migration&#44; invasion&#44; and apoptosis of HCC cells"
            ]
            6 => array:2 [
              "identificador" => "sec0023"
              "titulo" => "Circ&#95;0008285 regulated RRM2 expression by targeting miR-384"
            ]
            7 => array:2 [
              "identificador" => "sec0024"
              "titulo" => "Silencing of hsa&#95;circ&#95;0008285 inhibited tumor growth in vivo"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0025"
          "titulo" => "Discussion"
        ]
        7 => array:2 [
          "identificador" => "sec0026"
          "titulo" => "Conclusion"
        ]
        8 => array:2 [
          "identificador" => "sec0027"
          "titulo" => "Funding"
        ]
        9 => array:2 [
          "identificador" => "sec0028"
          "titulo" => "Author&#39;s contributions"
        ]
        10 => array:2 [
          "identificador" => "xack678042"
          "titulo" => "Acknowledgments"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-04-07"
    "fechaAceptado" => "2022-07-23"
    "PalabrasClave" => array:1 [
      "en" => array:2 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1667821"
          "palabras" => array:3 [
            0 => "Liver cancer"
            1 => "Molecular mechanism"
            2 => "Cell lines"
          ]
        ]
        1 => array:4 [
          "clase" => "abr"
          "titulo" => "Abbreviations"
          "identificador" => "xpalclavsec1667820"
          "palabras" => array:5 [
            0 => "circRNA"
            1 => "HCC"
            2 => "RRM2"
            3 => "qRT-PCR"
            4 => "RIP"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0002">Introduction and objectives</span><p id="spara018" class="elsevierStyleSimplePara elsevierViewall">Circular RNA &#40;circRNA&#41; has attracted extensive attention in studies related to the malignant progression of cancer&#44; including hepatocellular carcinoma &#40;HCC&#41;&#46; Therefore&#44; its molecular mechanism in HCC needs to be further explored&#46;</p></span> <span id="abss0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0003">Materials and methods</span><p id="spara019" class="elsevierStyleSimplePara elsevierViewall">The expression levels of circ&#95;0008285&#44; microRNA &#40;miR&#41;-384 and ribonucleotide reductase subunit M2 &#40;RRM2&#41; mRNA were detected by quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;&#46; Cell proliferation was analyzed using cell counting kit-8 assay and 5-ethynyl-2&#8217;-deoxyuridine assay&#44; cell apoptosis was analyzed by flow cytometry&#44; and cell migration and invasion were detected by transwell assay&#46; Protein level was detected by western blot&#46; The relationships between miR-384 and circ&#95;0008285 or RRM2 were predicted by bioinformatics software and validated by dual luciferase reporter assay and RNA immunoprecipitation &#40;RIP&#41; assay&#46;</p></span> <span id="abss0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Results</span><p id="spara020" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0008285 expression is elevated to HCC tissues and cell lines&#46; Silencing of circ&#95;0008285 inhibited the proliferation&#44; migration and invasion of HCC cells but accelerated cell apoptosis <span class="elsevierStyleItalic">in vitro</span> and impeded HCC tumorigenesis <span class="elsevierStyleItalic">in vivo</span>&#46; Mechanistically&#44; circ&#95;0008285 directly interacted with miR-384&#44; and miR-384 silencing attenuated the effects of circ&#95;0008285 interference on cell proliferation&#44; migration&#44; invasion&#44; and apoptosis&#46; RRM2 was a direct target of miR-384&#44; and RRM2 overexpression reversed the effects of miR-384 overexpression on cell proliferation&#44; migration&#44; invasion&#44; and apoptosis&#46; In addition&#44; circ&#95;0008285 regulated RRM2 expression by sponging miR-384&#46;</p></span> <span id="abss0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Conclusion</span><p id="spara021" class="elsevierStyleSimplePara elsevierViewall">In this study&#44; circ&#95;0008285 could promote the malignant biological behaviors of HCC cells through miR-384&#47;RRM2 axis and has the potential to become a therapeutic target for HCC&#44; providing a new idea for targeted therapy of HCC&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abss0001"
            "titulo" => "Introduction and objectives"
          ]
          1 => array:2 [
            "identificador" => "abss0002"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abss0003"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abss0004"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="notep0001">Shuang Peng and Lai Yi contributed equally to this work&#46;</p>"
        "identificador" => "fn1"
      ]
    ]
    "multimedia" => array:9 [
      0 => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1973
            "Ancho" => 2625
            "Tamanyo" => 287870
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0008285 was highly expressed in HCC tissues and cells</p> <p id="spara002" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; qRT-PCR analysis of the expression level of circ&#95;0008285 in the tissues of 55 patients with HCC and paracancerous tissues&#46; &#40;B&#41; qRT-PCR assay was employed to detect the expression level of circ&#95;0008285 in HCC cell lines &#40;Huh7 and HCCLM3&#41; and non-cancerous cell lines &#40;THLE-3&#41;&#46; &#40;C-D&#41; Subcellular fractionation location assay was used to analyze the distribution of circ&#95;0008285 in the nucleus or cytoplasm&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2242
            "Ancho" => 3150
            "Tamanyo" => 1050509
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0008285 knockdown impeded cell proliferation&#44; migration and invasion&#44; while induced cell apoptosis in HCC cells</p> <p id="spara004" class="elsevierStyleSimplePara elsevierViewall">Huh7 and HCCLM3 cells were transfected with si-circ&#95;0008285 or si-NC&#46; &#40;A&#41; qRT-PCR was performed to detect the expression of circ&#95;0008285 in Huh7 and HCCLM3 cells&#46; &#40;B-D&#41; CCK-8 and EdU assays were employed to detect the proliferation ability of transfected cells&#46; &#40;Magnification&#44; 200 &#215;&#41;&#46; &#40;E&#41; The Annexin-V FITC&#47;PI staining was used to assess cell apoptotic rate&#46; &#40;F&#41; Western blotting assay was used to assess the protein levels of Bax and Bcl-2 in transfected cells&#46; &#40;G-H&#41; Transwell assay was used to determine cell migration and invasion abilities&#46; &#40;Magnification&#44; 100 &#215;&#41;&#46; &#40;I&#41; Western blotting assay was employed to assess the protein levels of E-cadherin&#44; Vimentin and N-cadherin in transfected cells&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0003"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2587
            "Ancho" => 3500
            "Tamanyo" => 503085
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0003"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara005" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0008285 directly targeted miR-384</p> <p id="spara006" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; The wild type or mutant type complementary binding sites between circ&#95;0008285 and miR-384 were presented&#46; &#40;B&#41; qRT-PCR was performed to detect the expression of miR-384 in Huh7 and HCCLM3 cells transfected with miR-NC or miR-384 mimics&#46; &#40;C&#41; Dual luciferase reporter assay was used to verify the binding relationship between circ&#95;0008285 and miR-384&#46; &#40;D&#41; RIP assays were used to detect the enrichments of circ&#95;0008285 and miR-384 in anti-Ago2 groups&#46; &#40;E&#41; qRT-PCR was used to detect miR-384 level in tumor tissues and paracancerous tissues&#46; &#40;F&#41; qRT-PCR assay was used to detect the expression level of miR-384 in THLE-3&#44; Huh7 and HCCLM3 cells&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0004"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 2649
            "Ancho" => 3500
            "Tamanyo" => 792033
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0004"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara007" class="elsevierStyleSimplePara elsevierViewall">MiR-384 downregulation attenuated the influence of circ&#95;0008285 interference on cell proliferation&#44; migration&#44; invasion&#44; and apoptosis in HCC cells</p> <p id="spara008" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; The silencing efficiency of miR-384 inhibitor was detected by qRT-PCR&#46; &#40;B-I&#41; Huh7 and HCCLM3 cells were transfected with si-NC&#44; si-circ&#95;0008285&#44; si-circ&#95;0008285&#43;anti-NC or si-circ&#95;0008285&#43;anti-miR-384&#46; &#40;B-D&#41; CCK-8 and EdU assays were employed to detect cell proliferation ability&#46; &#40;E&#41; The Annexin-V FITC&#47;PI staining was used to assess apoptotic rates&#46; &#40;F&#41; Western blotting assay was utilized to assess the protein levels of Bax and Bcl-2&#46; &#40;G-H&#41; Transwell assays were used to determine cell migration and invasion ability&#46; &#40;I&#41; Western blotting was used to assess the protein levels of E-cadherin&#44; Vimentin and N-cadherin&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 3008
            "Ancho" => 3500
            "Tamanyo" => 853764
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara009" class="elsevierStyleSimplePara elsevierViewall">MiR-384 targeted RRM2</p> <p id="spara010" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; The binding sites between miR-384 and RRM2 were predicted by online prediction tools &#40;TargetScanHuman&#44; miRWALK&#44; and GEPIA&#41;&#46; &#40;B&#41; Expression of RRM2 in HCC tissues was analyzed according to the GEPIA database&#46; &#40;C-D&#41; The overall survival and disease-free survival analysis of RRM2 gene of interest can be presented&#46; &#40;F&#41; Dual luciferase reporter assay to verify the binding relationship between miR-384 and RRM2&#46; &#40;G&#41; RIP assays were used to detect the enrichment of miR-384 and RRM2 in anti-Ago2 groups&#46; &#40;H-I&#41; qRT-PCR and Western blot analysis were performed to determine the effects of miR-384 mimics and inhibitors on RRM2 mRNA and protein levels&#46; &#40;J-K&#41; qRT-PCR and Western blot was used to detect RRM2 mRNA and protein levels in tumor tissues and paracancerous tissues&#46; &#40;L-M&#41; qRT-PCR and Western blot analysis was performed to detect RRM2 mRNA and protein levels in THLE-3&#44; Huh7 and HCCLM3 cells&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "fig0006"
        "etiqueta" => "Fig&#46; 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 1757
            "Ancho" => 3500
            "Tamanyo" => 655178
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0006"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara011" class="elsevierStyleSimplePara elsevierViewall">RRM2 overexpression impaired the effect of miR-384 overexpression on proliferation&#44; migration&#44; invasion&#44; and apoptosis of HCC cells</p> <p id="spara012" class="elsevierStyleSimplePara elsevierViewall">&#40;A-B&#41; qRT-PCR and Western blot analysis were used to detect the overexpression efficiency of RRM2&#46; &#40;C-J&#41; Huh7 and HCCLM3 cells were transfected with miR-NC&#44; miR-384&#44; miR-384&#43;pcDNA&#44; or miR-384&#43;pcDNA-RRM2&#46; &#40;C-E&#41; CCK-8 and EdU assays were utilized to detect cell proliferation ability&#46; &#40;F&#41; The Annexin-V FITC&#47;PI staining was used to assess apoptotic rates&#46; &#40;G&#41; Western blotting assay was employed to assess the protein levels of Bax and Bcl-2&#46; &#40;H-I&#41; Transwell assays were used to determine cell migration and invasion ability&#46; &#40;J&#41; Western blotting to assess the protein levels of E-cadherin&#44; Vimentin and N-cadherin&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "fig0007"
        "etiqueta" => "Fig&#46; 7"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr7.jpeg"
            "Alto" => 1859
            "Ancho" => 3500
            "Tamanyo" => 497198
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0007"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara013" class="elsevierStyleSimplePara elsevierViewall">Circ&#95;0008285 regulated RRM2 expression by targeting miR-384</p> <p id="spara014" class="elsevierStyleSimplePara elsevierViewall">&#40;A-C&#41; Huh7 and HCCLM3 cells were transfected with si-NC&#44; si-circ&#95;0008285&#44; si-circ&#95;0008285&#43;anti-NC or si-circ&#95;0008285&#43;anti-miR-384&#46; And RRM2 mRNA and protein levels were detected by qRT-PCR and Western blot analysis&#46; &#40;C-E&#41; Spearman correlation analysis for the correlation among circ&#95;0008285&#44; miR-384&#44; and RRM2 mRNA in HCC tissues&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "fig0008"
        "etiqueta" => "Fig&#46; 8"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr8.jpeg"
            "Alto" => 2791
            "Ancho" => 3500
            "Tamanyo" => 505648
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0008"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara015" class="elsevierStyleSimplePara elsevierViewall">Silencing of hsa&#95;circ&#95;0008285 inhibited tumor growth in vivo</p> <p id="spara016" class="elsevierStyleSimplePara elsevierViewall">&#40;A-B&#41; Effect of circ&#95;0008285 silencing on tumor volume and weight&#46; &#40;C-E&#41; The effects of circ&#95;0008285 silencing on circ&#95;0008285&#44; miR-384 and RRM2 mRNA expression levels in xenograft tumors were examined by qRT-PCR&#46; &#40;F&#41; The protein levels of RRM2&#44; Bax&#44; Bcl-2&#44; E-cadherin&#44; vimentin&#44; and N-cadherin were evaluated by western blot in xenograft tumors&#46; &#42;<span class="elsevierStyleItalic">P</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      8 => array:8 [
        "identificador" => "tbl0001"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0009"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Name&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0002"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0003"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Primers for PCR &#40;5&#8217;-3&#8217;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0004"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">hsa&#95;circ&#95;0008285</td><a name="en0005"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0006"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GGCCCAGGATACACCCACTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0008"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0009"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">AGCCTTTCCACCGAACCAAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0010"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">RRM2</td><a name="en0011"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0012"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GGCGCGGGAGATTTAAAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0014"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0015"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">TTAGTTTTCGGCTCCGTGGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0016"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">miR-384</td><a name="en0017"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GTATGAGATTCCTAGAAATT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0020"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0021"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">CTCAACTGGTGTCGTGGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0022"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">GAPDH</td><a name="en0023"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GACAGTCAGCCGCATCTTCT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0026"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GCGCCCAATACGACCAAATC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0028"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">U6</td><a name="en0029"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">CTCGCTTCGGCAGCACA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0032"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0033"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">AACGCTTCACGAATTTGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3223525.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara017" class="elsevierStyleSimplePara elsevierViewall">Primers sequences used for PCR&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec1"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0001"
              "etiqueta" => "&#91;1&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immunotherapies for hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "JM Llovet"
                            1 => "F Castet"
                            2 => "M Heikenwalder"
                            3 => "MK Maini"
                            4 => "V Mazzaferro"
                            5 => "DJ Pinato"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41571-021-00573-2"
                      "Revista" => array:2 [
                        "tituloSerie" => "Nat Rev Clin Oncol"
                        "fecha" => "2021"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0002"
              "etiqueta" => "&#91;2&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk of HCC&#58; genetic heterogeneity and complex genetics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "TA&#46; Dragani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2009.11.015"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2010"
                        "volumen" => "52"
                        "numero" => "2"
                        "paginaInicial" => "252"
                        "paginaFinal" => "257"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20022654"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0003"
              "etiqueta" => "&#91;3&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A global view of hepatocellular carcinoma&#58; trends&#44; risk&#44; prevention and management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "JD Yang"
                            1 => "P Hainaut"
                            2 => "GJ Gores"
                            3 => "A Amadou"
                            4 => "A Plymoth"
                            5 => "LR&#46; Roberts"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41575-019-0186-y"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Gastroenterol Hepatol"
                        "fecha" => "2019"
                        "volumen" => "16"
                        "numero" => "10"
                        "paginaInicial" => "589"
                        "paginaFinal" => "604"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31439937"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0004"
              "etiqueta" => "&#91;4&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk factors and prevention of hepatocellular carcinoma in the era of precision medicine"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "N Fujiwara"
                            1 => "SL Friedman"
                            2 => "N Goossens"
                            3 => "Y&#46; Hoshida"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2017.09.016"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2018"
                        "volumen" => "68"
                        "numero" => "3"
                        "paginaInicial" => "526"
                        "paginaFinal" => "549"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28989095"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "&#91;5&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oncogenic hsa&#95;circ&#95;0091581 promotes the malignancy of HCC cell through blocking miR-526b from degrading c-MYC mRNA"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X Wei"
                            1 => "W Zheng"
                            2 => "P Tian"
                            3 => "Y He"
                            4 => "H Liu"
                            5 => "M Peng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/15384101.2020.1731945"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cell Cycle"
                        "fecha" => "2020"
                        "volumen" => "19"
                        "numero" => "7"
                        "paginaInicial" => "817"
                        "paginaFinal" => "824"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32116112"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0006"
              "etiqueta" => "&#91;6&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The biogenesis&#44; biology and characterization of circular RNAs"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "LS Kristensen"
                            1 => "MS Andersen"
                            2 => "LVW Stagsted"
                            3 => "KK Ebbesen"
                            4 => "TB Hansen"
                            5 => "J&#46; Kjems"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41576-019-0158-7"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Genet"
                        "fecha" => "2019"
                        "volumen" => "20"
                        "numero" => "11"
                        "paginaInicial" => "675"
                        "paginaFinal" => "691"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31395983"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0007"
              "etiqueta" => "&#91;7&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA detection methods&#58; a minireview"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Z Mi"
                            1 => "C Zhongqiang"
                            2 => "J Caiyun"
                            3 => "L Yanan"
                            4 => "W Jianhua"
                            5 => "L&#46; Liang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.talanta.2021.123066"
                      "Revista" => array:4 [
                        "tituloSerie" => "Talanta"
                        "fecha" => "2022"
                        "volumen" => "238"
                        "numero" => "Pt 2"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0008"
              "etiqueta" => "&#91;8&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNAs&#58; potential regulators of treatment resistance in human cancers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S Jeyaraman"
                            1 => "EAM Hanif"
                            2 => "NS Ab Mutalib"
                            3 => "R Jamal"
                            4 => "N Abu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fgene.2019.01369"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Genet"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "1369"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32047511"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0009"
              "etiqueta" => "&#91;9&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA&#58; an emerging non-coding RNA as a regulator and biomarker in cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "B Chen"
                            1 => "S&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.canlet.2018.01.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Lett"
                        "fecha" => "2018"
                        "volumen" => "418"
                        "paginaInicial" => "41"
                        "paginaFinal" => "50"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29330104"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "&#91;10&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA participates in the carcinogenesis and the malignant behavior of cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "ZJ Zhao"
                            1 => "J&#46; Shen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/15476286.2015.1122162"
                      "Revista" => array:7 [
                        "tituloSerie" => "RNA Biol"
                        "fecha" => "2017"
                        "volumen" => "14"
                        "numero" => "5"
                        "paginaInicial" => "514"
                        "paginaFinal" => "521"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26649774"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0011"
              "etiqueta" => "&#91;11&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Progress and prospects of circular RNAs in hepatocellular carcinoma&#58; novel insights into their function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J Hu"
                            1 => "P Li"
                            2 => "Y Song"
                            3 => "YX Ge"
                            4 => "XM Meng"
                            5 => "C Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcp.26154"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Cell Physiol"
                        "fecha" => "2018"
                        "volumen" => "233"
                        "numero" => "6"
                        "paginaInicial" => "4408"
                        "paginaFinal" => "4422"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28833094"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0012"
              "etiqueta" => "&#91;12&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNAs act as miRNA sponges"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "AC&#46; Panda"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-981-13-1426-1_6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Adv Exp Med Biol"
                        "fecha" => "2018"
                        "volumen" => "1087"
                        "paginaInicial" => "67"
                        "paginaFinal" => "79"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30259358"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0013"
              "etiqueta" => "&#91;13&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hsa&#95;circ&#95;001680 affects the proliferation and migration of CRC and mediates its chemoresistance by regulating BMI1 through miR-340"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X Jian"
                            1 => "H He"
                            2 => "J Zhu"
                            3 => "Q Zhang"
                            4 => "Z Zheng"
                            5 => "X Liang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-020-1134-8"
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2020"
                        "volumen" => "19"
                        "numero" => "1"
                        "paginaInicial" => "20"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32005118"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0211699515000302"
                          "estado" => "S300"
                          "issn" => "02116995"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0014"
              "etiqueta" => "&#91;14&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNA Circ&#95;0067934 attenuates ferroptosis of thyroid cancer cells by miR-545-3p&#47;SLC7A11 signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "HH Wang"
                            1 => "JN Ma"
                            2 => "XR&#46; Zhan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fendo.2021.670031"
                      "Revista" => array:3 [
                        "tituloSerie" => "Front Endocrinol"
                        "fecha" => "2021"
                        "volumen" => "12"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "&#91;15&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNA hsa&#95;circ&#95;0014130 function as a miR-132-3p sponge for playing oncogenic roles in bladder cancer via upregulating KCNJ12 expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G Li"
                            1 => "BY Guo"
                            2 => "HD Wang"
                            3 => "GT Lin"
                            4 => "TJ Lan"
                            5 => "H Ying"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10565-021-09668-z"
                      "Revista" => array:2 [
                        "tituloSerie" => "Cell Biol Toxicol"
                        "fecha" => "2021"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0016"
              "etiqueta" => "&#91;16&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "hsa&#95;circ&#95;0008285 Facilitates the progression of cervical cancer by targeting miR-211-5p&#47;SOX4 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y Bai"
                            1 => "X&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/CMAR.S244317"
                      "Revista" => array:5 [
                        "tituloSerie" => "Cancer Manage Res"
                        "fecha" => "2020"
                        "volumen" => "12"
                        "paginaInicial" => "3927"
                        "paginaFinal" => "3936"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0017"
              "etiqueta" => "&#91;17&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A noncoding regulatory RNAs network driven by circ-CDYL acts specifically in the early stages hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Wei"
                            1 => "X Chen"
                            2 => "C Liang"
                            3 => "Y Ling"
                            4 => "X Yang"
                            5 => "X Ye"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/hep.30795"
                      "Revista" => array:7 [
                        "tituloSerie" => "Hepatology"
                        "fecha" => "2020"
                        "volumen" => "71"
                        "numero" => "1"
                        "paginaInicial" => "130"
                        "paginaFinal" => "147"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31148183"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0018"
              "etiqueta" => "&#91;18&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNAs function as ceRNAs to regulate and control human cancer progression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Zhong"
                            1 => "Y Du"
                            2 => "X Yang"
                            3 => "Y Mo"
                            4 => "C Fan"
                            5 => "F Xiong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-018-0827-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2018"
                        "volumen" => "17"
                        "numero" => "1"
                        "paginaInicial" => "79"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29626935"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0019"
              "etiqueta" => "&#91;19&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ChrXq27&#46;3 miRNA cluster functions in cancer development"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K Yoshida"
                            1 => "A Yokoi"
                            2 => "Y Yamamoto"
                            3 => "H&#46; Kajiyama"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13046-021-01910-0"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Exp Clin Cancer Res"
                        "fecha" => "2021"
                        "volumen" => "40"
                        "numero" => "1"
                        "paginaInicial" => "112"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33766100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "&#91;20&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circular RNAs in cancer&#58; biogenesis&#44; function&#44; and clinical significance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J Li"
                            1 => "D Sun"
                            2 => "W Pu"
                            3 => "J Wang"
                            4 => "Y&#46; Peng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.trecan.2020.01.012"
                      "Revista" => array:7 [
                        "tituloSerie" => "Trends Cancer"
                        "fecha" => "2020"
                        "volumen" => "6"
                        "numero" => "4"
                        "paginaInicial" => "319"
                        "paginaFinal" => "336"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32209446"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0021"
              "etiqueta" => "&#91;21&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Translation and functional roles of circular RNAs in human cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M Lei"
                            1 => "G Zheng"
                            2 => "Q Ning"
                            3 => "J Zheng"
                            4 => "D&#46; Dong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-020-1135-7"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2020"
                        "volumen" => "19"
                        "numero" => "1"
                        "paginaInicial" => "30"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32059672"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0022"
              "etiqueta" => "&#91;22&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNA&#58; functions and properties of a novel potential biomarker for cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Meng"
                            1 => "H Zhou"
                            2 => "Z Feng"
                            3 => "Z Xu"
                            4 => "Y Tang"
                            5 => "P Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-017-0663-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2017"
                        "volumen" => "16"
                        "numero" => "1"
                        "paginaInicial" => "94"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28535767"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0023"
              "etiqueta" => "&#91;23&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Tumor suppressor role of hsa&#95;circ&#95;0035445 in gastric cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "W Sun"
                            1 => "H Zhang"
                            2 => "W Duan"
                            3 => "H Zhu"
                            4 => "C&#46; Gu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcla.23727"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Lab Anal"
                        "fecha" => "2021"
                        "volumen" => "35"
                        "numero" => "6"
                        "paginaInicial" => "e23727"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33830559"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0211699518302327"
                          "estado" => "S300"
                          "issn" => "02116995"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0024"
              "etiqueta" => "&#91;24&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hsa&#95;circ&#95;001659 serves as a novel diagnostic and prognostic biomarker for colorectal cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B He"
                            1 => "W Chao"
                            2 => "Z Huang"
                            3 => "J Zeng"
                            4 => "J Yang"
                            5 => "D Luo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2021.02.121"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2021"
                        "volumen" => "551"
                        "paginaInicial" => "100"
                        "paginaFinal" => "106"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33725570"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "&#91;25&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of Circ&#95;001569 as a potential biomarker in the diagnosis and prognosis of pancreatic cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "X Shen"
                            1 => "Y Chen"
                            2 => "J Li"
                            3 => "H Huang"
                            4 => "C Liu"
                            5 => "N&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1177/1533033820983302"
                      "Revista" => array:4 [
                        "tituloSerie" => "Technol Cancer Res Treat"
                        "fecha" => "2021"
                        "volumen" => "20"
                        "itemHostRev" => array:3 [
                          "pii" => "S0085253816300035"
                          "estado" => "S300"
                          "issn" => "00852538"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0026"
              "etiqueta" => "&#91;26&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Emerging microRNAs in cancer diagnosis&#44; progression&#44; and immune surveillance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "AM Harrandah"
                            1 => "RA Mora"
                            2 => "EKL&#46; Chan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.canlet.2018.09.019"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Lett"
                        "fecha" => "2018"
                        "volumen" => "438"
                        "paginaInicial" => "126"
                        "paginaFinal" => "132"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30237038"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0027"
              "etiqueta" => "&#91;27&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miRNA sponges&#58; soaking up miRNAs for regulation of gene expression"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "RO Bak"
                            1 => "JG&#46; Mikkelsen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/wrna.1213"
                      "Revista" => array:7 [
                        "tituloSerie" => "Wiley Interdiscip Rev RNA"
                        "fecha" => "2014"
                        "volumen" => "5"
                        "numero" => "3"
                        "paginaInicial" => "317"
                        "paginaFinal" => "333"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24375960"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0028"
              "etiqueta" => "&#91;28&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "microRNA-messenger RNA regulatory network of esophageal squamous cell carcinoma and the identification of miR-1 as a biomarker of patient survival"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q Wei"
                            1 => "X Li"
                            2 => "W Yu"
                            3 => "K Zhao"
                            4 => "G Qin"
                            5 => "H Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcb.28166"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Cell Biochem"
                        "fecha" => "2019"
                        "volumen" => "120"
                        "numero" => "8"
                        "paginaInicial" => "12259"
                        "paginaFinal" => "12272"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31017699"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0029"
              "etiqueta" => "&#91;29&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-145 suppresses the motility of prostate cancer cells by targeting cadherin-2"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Zeng"
                            1 => "Y Huang"
                            2 => "Q Liu"
                            3 => "H Liu"
                            4 => "T Long"
                            5 => "C Zhu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11010-021-04188-0"
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Cell Biochem"
                        "fecha" => "2021"
                        "volumen" => "476"
                        "numero" => "10"
                        "paginaInicial" => "3635"
                        "paginaFinal" => "3646"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34043125"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "&#91;30&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-105-3p acts as an oncogene to promote the proliferation and metastasis of breast cancer cells by targeting GOLIM4"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B Lin"
                            1 => "C Liu"
                            2 => "E Shi"
                            3 => "Q Jin"
                            4 => "W Zhao"
                            5 => "J Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12885-021-07909-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMC Cancer"
                        "fecha" => "2021"
                        "volumen" => "21"
                        "numero" => "1"
                        "paginaInicial" => "275"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33722196"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0031"
              "etiqueta" => "&#91;31&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-384 induces apoptosis and autophagy of non-small cell lung cancer cells through the negative regulation of Collagen alpha-1&#40;X&#41; chain gene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Q Guo"
                            1 => "M Zheng"
                            2 => "Y Xu"
                            3 => "N Wang"
                            4 => "W&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BSR20181523"
                      "Revista" => array:4 [
                        "tituloSerie" => "Biosci Rep"
                        "fecha" => "2019"
                        "volumen" => "39"
                        "numero" => "2"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0032"
              "etiqueta" => "&#91;32&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNAs and their regulatory roles in cancers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M Tao"
                            1 => "M Zheng"
                            2 => "Y Xu"
                            3 => "S Ma"
                            4 => "W Zhang"
                            5 => "S&#46; Ju"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s10020-021-00359-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Med"
                        "fecha" => "2021"
                        "volumen" => "27"
                        "numero" => "1"
                        "paginaInicial" => "94"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34445958"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0033"
              "etiqueta" => "&#91;33&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effects of hsa&#95;circ&#95;0000517&#47;miR-326 axis on the progression of breast cancer cells and the prediction of miR-326 downstream targets in breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J Yu"
                            1 => "F Li"
                            2 => "Y Li"
                            3 => "Z Li"
                            4 => "G Jia"
                            5 => "B Ding"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.prp.2021.153638"
                      "Revista" => array:3 [
                        "tituloSerie" => "Pathol Res Pract"
                        "fecha" => "2021"
                        "volumen" => "227"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0034"
              "etiqueta" => "&#91;34&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CircRNA Hsa&#95;circ&#95;0001017 inhibited gastric cancer progression via acting as a sponge of miR-197"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H Li"
                            1 => "C Shan"
                            2 => "J Wang"
                            3 => "C&#46; Hu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10620-020-06516-8"
                      "Revista" => array:7 [
                        "tituloSerie" => "Dig Dis Sci"
                        "fecha" => "2021"
                        "volumen" => "66"
                        "numero" => "7"
                        "paginaInicial" => "2261"
                        "paginaFinal" => "2271"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32740683"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "&#91;35&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "circ&#95;0007385 served as competing endogenous RNA for miR-519d-3p to suppress malignant behaviors and cisplatin resistance of non-small cell lung cancer cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y Ye"
                            1 => "L Zhao"
                            2 => "Q Li"
                            3 => "C Xi"
                            4 => "Y Li"
                            5 => "Z&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/1759-7714.13527"
                      "Revista" => array:7 [
                        "tituloSerie" => "Thoracic Cancer"
                        "fecha" => "2020"
                        "volumen" => "11"
                        "numero" => "8"
                        "paginaInicial" => "2196"
                        "paginaFinal" => "2208"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32602212"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0036"
              "etiqueta" => "&#91;36&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circ&#95;0007841 accelerates ovarian cancer development through facilitating MEX3C expression by restraining miR-151-3p activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K Huang"
                            1 => "D Liu"
                            2 => "C&#46; Su"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/aging.202911"
                      "Revista" => array:7 [
                        "tituloSerie" => "Aging"
                        "fecha" => "2021"
                        "volumen" => "13"
                        "numero" => "8"
                        "paginaInicial" => "12058"
                        "paginaFinal" => "12066"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33896797"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0037"
              "etiqueta" => "&#91;37&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "High expression of ribonucleotide reductase subunit M2 correlates with poor prognosis of hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "B Lee"
                            1 => "SY Ha"
                            2 => "DH Song"
                            3 => "HW Lee"
                            4 => "SY Cho"
                            5 => "CK&#46; Park"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5009/gnl13392"
                      "Revista" => array:7 [
                        "tituloSerie" => "Gut Liver"
                        "fecha" => "2014"
                        "volumen" => "8"
                        "numero" => "6"
                        "paginaInicial" => "662"
                        "paginaFinal" => "668"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25368754"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0038"
              "etiqueta" => "&#91;38&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "RRM2 regulates sensitivity to sunitinib and PD-1 blockade in renal cancer by stabilizing ANXA1 and activating the AKT pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "W Xiong"
                            1 => "B Zhang"
                            2 => "H Yu"
                            3 => "L Zhu"
                            4 => "L Yi"
                            5 => "X Jin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/advs.202100881"
                      "Revista" => array:4 [
                        "tituloSerie" => "Adv Sci"
                        "fecha" => "2021"
                        "volumen" => "8"
                        "numero" => "18"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0039"
              "etiqueta" => "&#91;39&#93;"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "RRM2 improves cardiomyocyte proliferation after myocardial ischemia reperfusion injury through the Hippo-YAP pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Yu"
                            1 => "H Tang"
                            2 => "C Deng"
                            3 => "Q Lin"
                            4 => "P Yu"
                            5 => "S Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2021/5089872"
                      "Revista" => array:4 [
                        "tituloSerie" => "Dis Markers"
                        "fecha" => "2021"
                        "volumen" => "2021"
                        "itemHostRev" => array:3 [
                          "pii" => "S027263861500921X"
                          "estado" => "S300"
                          "issn" => "02726386"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack678042"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="para0039" class="elsevierStylePara elsevierViewall">None&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/16652681/0000002700000006/v3_202307180533/S1665268122000850/v3_202307180533/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "78265"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/16652681/0000002700000006/v3_202307180533/S1665268122000850/v3_202307180533/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1665268122000850?idApp=UINPBA00004N"
]

Article information

ISSN: 16652681
Original language: English

DOI:10.1016/j.aohep.2022.100743

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	2	0	2
2024 October	17	5	22
2024 September	18	1	19
2024 August	28	4	32
2024 July	15	5	20
2024 June	8	5	13
2024 May	10	3	13
2024 April	13	5	18
2024 March	30	8	38
2024 February	64	12	76
2024 January	23	4	27
2023 December	14	8	22
2023 November	11	16	27
2023 October	24	3	27
2023 September	35	2	37
2023 August	12	2	14
2023 July	13	1	14
2023 June	17	4	21
2023 May	9	6	15
2023 April	9	8	17
2023 March	11	1	12
2023 February	15	4	19
2023 January	12	12	24
2022 December	17	6	23
2022 November	24	15	39
2022 September	0	0	0
2022 August	0	3	3

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter