was read the article
array:24 [ "pii" => "S1807593222003283" "issn" => "18075932" "doi" => "10.6061/clinics/2020/e1656" "estado" => "S300" "fechaPublicacion" => "2020-01-01" "aid" => "328" "copyright" => "CLINICS" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "fla" "cita" => "Clinics. 2020;75C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1807593222003295" "issn" => "18075932" "doi" => "10.6061/clinics/2020/e1658" "estado" => "S300" "fechaPublicacion" => "2020-01-01" "aid" => "329" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "dis" "cita" => "Clinics. 2020;75C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:8 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">COMMENT</span>" "titulo" => "Reproducibility of a nylon fishing line as a screening test for diabetic foot ulceration risk" "tienePdf" => "en" "tieneTextoCompleto" => "en" "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Mozânia Reis de Matos, Daniele Pereira Santos‐Bezerra, Maria Lucia Correa-Giannella" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Mozânia Reis" "apellidos" => "de Matos" ] 1 => array:2 [ "nombre" => "Daniele Pereira" "apellidos" => "Santos‐Bezerra" ] 2 => array:2 [ "nombre" => "Maria Lucia" "apellidos" => "Correa-Giannella" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222003295?idApp=UINPBA00004N" "url" => "/18075932/000000750000000C/v1_202211290815/S1807593222003295/v1_202211290815/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1807593222004653" "issn" => "18075932" "doi" => "10.6061/clinics/2020/e1644" "estado" => "S300" "fechaPublicacion" => "2020-01-01" "aid" => "465" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "rev" "cita" => "Clinics. 2020;75C:" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">REVIEW ARTICLE</span>" "titulo" => "Palliative radiotherapy for gastric cancer: Is there a dose relationship between bleeding response and radiotherapy?" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 808 "Ancho" => 1495 "Tamanyo" => 86169 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">1(a). Flowchart according to PRISMA. 1(b). Minors score rating of each study.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Gustavo Arruda Viani, Caio Viani Arruda, Ana Carolina Hamamura, Alexandre Ciufi Faustino, Anielle Freitas Bendo Danelichen, Fernando Kojo Matsuura, Leonardo Vicente Fay Neves" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Gustavo Arruda" "apellidos" => "Viani" ] 1 => array:2 [ "nombre" => "Caio Viani" "apellidos" => "Arruda" ] 2 => array:2 [ "nombre" => "Ana Carolina" "apellidos" => "Hamamura" ] 3 => array:2 [ "nombre" => "Alexandre Ciufi" "apellidos" => "Faustino" ] 4 => array:2 [ "nombre" => "Anielle Freitas Bendo" "apellidos" => "Danelichen" ] 5 => array:2 [ "nombre" => "Fernando Kojo" "apellidos" => "Matsuura" ] 6 => array:2 [ "nombre" => "Leonardo Vicente Fay" "apellidos" => "Neves" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222004653?idApp=UINPBA00004N" "url" => "/18075932/000000750000000C/v1_202211290815/S1807593222004653/v1_202211290815/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">ORIGINAL ARTICLE</span>" "titulo" => "Effects and mechanism of stem cells from human exfoliated deciduous teeth combined with hyperbaric oxygen therapy in type 2 diabetic rats" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Yifeng Xu, Jin Chen, Hui Zhou, Jing Wang, Jingyun Song, Junhao Xie, Qingjun Guo, Chaoqun Wang, Qin Huang" "autores" => array:9 [ 0 => array:3 [ "nombre" => "Yifeng" "apellidos" => "Xu" "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] 2 => array:2 [ "etiqueta" => "#" "identificador" => "fn1" ] ] ] 1 => array:3 [ "nombre" => "Jin" "apellidos" => "Chen" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "#" "identificador" => "fn1" ] ] ] 2 => array:3 [ "nombre" => "Hui" "apellidos" => "Zhou" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">III</span>" "identificador" => "aff3" ] ] ] 3 => array:3 [ "nombre" => "Jing" "apellidos" => "Wang" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">IV</span>" "identificador" => "aff4" ] ] ] 4 => array:3 [ "nombre" => "Jingyun" "apellidos" => "Song" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] ] ] 5 => array:3 [ "nombre" => "Junhao" "apellidos" => "Xie" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] ] ] 6 => array:3 [ "nombre" => "Qingjun" "apellidos" => "Guo" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] ] ] 7 => array:3 [ "nombre" => "Chaoqun" "apellidos" => "Wang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] ] ] 8 => array:4 [ "nombre" => "Qin" "apellidos" => "Huang" "email" => array:1 [ 0 => "qxinyi1220@163.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Department of Endocrinology, Changhai Hospital, the First Affiliated Hospital of the Naval Medical University, Shanghai 200433, China" "etiqueta" => "I" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Department of Endocrinology, Air Force Hospital of Northern Theater Command of PLA, Shenyang 110042, China" "etiqueta" => "II" "identificador" => "aff2" ] 2 => array:3 [ "entidad" => "Department of Out-patient, Changning retired cadre retreat of Shanghai garrison command, Shanghai 200050, China" "etiqueta" => "III" "identificador" => "aff3" ] 3 => array:3 [ "entidad" => "Department of Internal Medcine, Hotan Country People's Hospital of Xinjiang, Hotan Country 848000, China" "etiqueta" => "IV" "identificador" => "aff4" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig5" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:2 [ 0 => array:1 [ "imagen" => "gr5a.jpeg" ] 1 => array:1 [ "imagen" => "gr5b.jpeg" ] ] "descripcion" => array:1 [ "en" => "<p id="spara50" class="elsevierStyleSimplePara elsevierViewall">Apoptosis and proliferation of pancreatic islet cells after 6 weeks of therapy. A. Staining for apoptosis and proliferation analysis in islet cells: The brown cells in the islets shown by red arrows were positively stained cells. TUNEL staining showed that the number of positively stained cells in the islets of DM group was higher than that in the islets of NC group. Positive cells in the islets of SC+HBO and SC groups were lower than those in the islets of DM group. Ki67 and PCNA staining showed that positive cells in islets were slightly higher in DM group than in NC group, and obviously increased in SC+HBO and SC groups as compared with those in DM group. Scale bar: 20 μm, 400×. B. Apoptosis index (AI) and proliferation index (PI) of islet cells: TUNEL AI was lower for SC+HBO and SC groups than that for DM group. The AI for SC+HBO group was lower than that for HBO group; the PI of Ki67 and PCNA was higher for SC+HBO and SC groups than that for DM group, while the PI of SC+HBO group was higher than that of HBO group. **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group; <span class="elsevierStyleSup">△△</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> HBO group; <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups; <span class="elsevierStyleSup">★★</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> either SC or SC+HBO group.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="cesec10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle60">INTRODUCTION</span><p id="para10" class="elsevierStylePara elsevierViewall">Diabetes is the 11<span class="elsevierStyleSup">th</span> most common cause of disability worldwide, and serves as a high risk factor for cardiovascular disease. According to the International Diabetes Federation (IDF) (<a class="elsevierStyleCrossRef" href="#bib1">1</a>), more than 425 million people worldwide had diabetes in 2017 and this number is expected to increase to 625 million by 2045. In 2017 alone, diabetes and its complications killed more than 4 million people and were associated with a treatment cost of $727 billion. Diabetes has emerged as a serious global and social public health problem and is a heavy social and economic burden. Type 2 diabetes (T2DM) accounts for about 90 percent of all diabetes cases. It is mainly caused by insulin resistance and islet cell dysfunction. The current medicines and treatment regimens are ineffective in preventing the spread and development of diabetes and its complications. Stem cell and regenerative medicine technology has exploited the multi-directional differentiation, autocrine and paracrine, immune regulation, and other characteristics of mesenchymal stem cells (MSCs) to repair or replace the function of a damaged pancreatic tissue, thereby raising our hopes for diabetes treatment.</p><p id="para20" class="elsevierStylePara elsevierViewall">Dental pulp MSCs have been studied in animal models of different diseases (<a class="elsevierStyleCrossRef" href="#bib2">2</a>), including systemic lupus erythematosus, ischemic brain injury, spinal cord injury, and muscular atrophy. Stem cells from human exfoliated deciduous teeth (SHED) were shown to differentiate into insulin-secreting cells <span class="elsevierStyleItalic">in vitro</span> (<a class="elsevierStyleCrossRef" href="#bib3">3</a>), and may be potentially useful for the treatment of glucose metabolic disorders. Hyperbaric oxygen (HBO) therapy could increase the concentration of nitric oxide synthase, and promote mobilization of stem cells and release of endothelial progenitor cells (<a class="elsevierStyleCrossRef" href="#bib4">4</a>). These cells may migrate to inflammatory or injured sites in the presence of inflammatory factors or chemokines (<a class="elsevierStyleCrossRef" href="#bib5">5</a>). Oxygen regulation may also promote the maturation of pancreatic progenitor cells (<a class="elsevierStyleCrossRef" href="#bib6">6</a>), and HBO may promote the survival and growth of transplanted islet cells by improving local oxygen supply (<a class="elsevierStyleCrossRef" href="#bib7">7</a>). Therefore, the combination of stem cells and HBO therapy may play a plausible synergistic role in the therapy for diabetes (<a class="elsevierStyleCrossRef" href="#bib8">8</a>,<a class="elsevierStyleCrossRef" href="#bib9">9</a>).</p></span><span id="cesec20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle70">MATERIALS AND METHODS</span><span id="cesec30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle80">Animal model and groups</span><p id="para30" class="elsevierStylePara elsevierViewall">All animal experiments were approved by the Ethics Committee for Medical Laboratory Animal Sciences of Changhai Hospital of Shanghai (approval No. 201700632). Male Sprague Dawley (SD) rats weighing 90-100 g were obtained from the experimental animal center of Naval Medical University. All rats were housed at 25°C±1°C on a 12h light/dark cycle and fed <span class="elsevierStyleItalic">ad libitum</span> for 1 week before study inception. Animals were then fed with a high-fat diet (40% fat, 40% carbohydrate, and 20% protein) for 8 weeks, and a diabetic rat model was generated through a single intraperitoneal injection of streptozotocin (STZ, Sigma, USA) at 30 mg/kg body weight in sodium citrate buffer (pH 4.2) after overnight fasting. Blood glucose (BG) concentration was measured using a drop of tail capillary blood by a glucometer. Fasting blood glucose (FBG) ≥8.3mmol/L after 3 days, or BG 2h post oral glucose tolerance test (OGTT) after 3 days or a stable non-fasting BG concentration ≥11.1 mmol/L for 7 days, were indicative of the successful establishment of the T2DM rat model (<a class="elsevierStyleCrossRef" href="#bib10">10</a>).</p><p id="para40" class="elsevierStylePara elsevierViewall">T2DM rats were randomly divided into four groups as follows: Stem cell therapy group (SC, n=6), HBO therapy group (HBO, n=6), stem cells combined with HBO group (SC+HBO, n=6), and diabetes control group (DM, n=6). Normal rats on normal diet were set as the normal control group (NC, n=6).</p></span><span id="cesec40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle90">Stem cell therapy</span><p id="para50" class="elsevierStylePara elsevierViewall">SHED from P4 to P6 were supplied free of charge by CAR-T (Shanghai) Biotechnology Co., Ltd, at a density of 1×10<span class="elsevierStyleSup">7</span> cells/mL. The expression of surface marker CD90 on MSCs was analyzed (>95%) by flow cytometry; CD34 and HLA-DR expression was low but could be detected in about 0.5% cells. Rats from SC and SC+HBO groups were transfused with 0.5 mL SHED through their caudal veins in the first and third week (twice), while rats from the other groups were transfused with an equal volume of sodium chloride.</p></span><span id="cesec50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle100">HBO therapy</span><p id="para60" class="elsevierStylePara elsevierViewall">HBO therapy was performed in the diving medical laboratory of the department of marine medicine of Naval Medical University. Rats from HBO and SC+HBO groups received HBO therapy daily for a total of 28 sessions. Animals were exposed to an atmospheric pressure of 2 at an oxygen concentration of ≥85% for 1h daily in an HBO chamber (DWC-1000-2100, No. 701 Yangyuan Medical Oxygen Chamber Factory, Shanghai). The HBO chamber was first filled with pure oxygen for 3 min and then gradually pressurized for 10 min from 0 to 0.1 MPa. The pressure in the chamber was maintained at 0.1 MPa for 1h, after which the chamber was gradually decompressed for 15 min from 0.1 to 0 MPa.</p></span><span id="cesec60" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle110">Biochemical assays and enzyme-linked immunosorbent assay (ELISA)</span><p id="para70" class="elsevierStylePara elsevierViewall">Rats were sacrificed after 6 weeks of therapy. During treatment period, body weight of rats was measured every week and OGTT was performed every 2 weeks following overnight fasting. Glucose was intragastrically administered (2 g/kg body weight), and BG and serum insulin levels were detected at 0, 30, 60, 90, and 120 min. BG level was measured by a glucometer (Rightest GM300, Huaguang Biotech Co. LTD, Taiwan) using glucose oxidase assay. Serum insulin levels were measured using an ELISA (CUSABIO, Wuhan), while serum lipid (total cholesterol [TC], triglyceride [TG], low-density lipoprotein cholesterol [LDL-C], and high-density lipoprotein cholesterol [HDL-C]) and 24h urinary protein levels were measured using a fully automatic biochemical analyzer (Chemray 240, Rayto Life and Analytical Sciences Co., Ltd, Shenzhen) according to the manufacturer's protocols. Serum interleukin (IL)-6 and tumor necrosis factor (TNF)-α levels were measured using rat ELISA kits (Lianke Bio, Hangzhou). Area under the curves (<a class="elsevierStyleCrossRef" href="#bib11">11</a>) for BG or insulin were calculated as follows: AUC<span class="elsevierStyleInf">BG 0-120</span> (mmol/L · h) = ([BG0′ + BG30′] × 30/60)/2 + ([BG30′ + BG60′] × 30/60)/2 + ([BG60′ + BG90′] × 30/60)/2 + ([BG90′ + BG120′] × 30/60)/2; AUC<span class="elsevierStyleInf">INS0-120</span> (nIU/mL · h) = ([INS0′ + INS30′] × 30/60)/2 + ([INS30′ + INS60′] × 30/60)/2 + ([INS60′ + INS90′] × 30/60)/2 + ([INS90′+ INS120′] × 30/60)/2. Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated as follows: HOMA-IR = INS0′ (μU/mL) × BG0′ (mmol/L)/22.5.</p></span><span id="cesec70" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle120">Histopathological analysis</span><p id="para80" class="elsevierStylePara elsevierViewall">Sections of pancreas samples were stained with hematoxylin and eosin (H&E) and examined under a light microscope. Ultrastructure of intracellular organelles in β-cells was detected by transmission electron microscopy (HT7700, HITACHI), and particles were counted by Image-pro Plus 6.0 (IPP, Media Cybernetics, Inc.) software.</p><p id="para90" class="elsevierStylePara elsevierViewall">Insulin and glucagon in pancreatic islets were analyzed by immunohistochemical staining using insulin mouse mAb and glucagon rabbit mAb, respectively (Wuhan Servicebio technology), as well as by immunofluorescence staining using sheep anti-rabbit IgG-fluorescein isothiocyanate (FITC; Abcam), sheep anti-mouse IgG-CY3 (Sigma), and 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Staining was observed by fluorescence microscopy (DP80, Olympus bx-53). Image-pro Plus 6.0 (IPP, Media Cybernetics, Inc.) software was used to count positively stained cells, and integrated optical density (IOD) of positive staining for insulin or glucagon was calculated and analyzed in immunofluorescence sections of the pancreas. Mean optical density (MOD) was calculated (MOD = IOD SUM/area) and compared. After 6 weeks of therapy, three islets from each pancreas tissue were analyzed for MOD of insulin and glucagon.</p><p id="para100" class="elsevierStylePara elsevierViewall">The serial pancreatic sections were evaluated for apoptotic cells in islets by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay (In Situ Cell Death Detection Kit, Roche), while proliferative cells were detected with proliferating cell nuclear antigen (PCNA) and Ki67 (rabbit mAbs for anti-PCNA and anti-Ki67; Abcam). Apoptosis index (AI) and proliferation index (PI) were calculated as follows: AI = Number of apoptotic cells/(Number of apoptotic cells + Number of normal cells); PI = Number of proliferative cells/(Number of proliferative cells + Number of normal cells). After 6 weeks of therapy, three islets from rat pancreas were analyzed for AI and PI.</p></span><span id="cesec80" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle130">Real-time quantitative polymerase chain reaction (RT-qPCR)</span><p id="para110" class="elsevierStylePara elsevierViewall">The mRNA expression levels of <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Ngn3</span>, and <span class="elsevierStyleItalic">Pax4</span> in the pancreas were quantified by RT-qPCR using the SYBR Green method. Rats were sacrificed and their pancreas were excised and lysed using Trizol reagent (Invitrogen) to extract RNA. Total RNA was identified and measured using a spectrophotometer (Nanodrop 1000, USA). The genes were amplified using a 96-well gradient PCR amplification apparatus (ABI Veriti, USA). Target genes were quantified by a real-time detector (Roche LightCycler® 480II, Switzerland). Glyceraldehyde 3-phosphate dehydrogenase (<span class="elsevierStyleItalic">GAPDH</span>) was used as the reference gene. PCR primers were synthesized by Sangon Biotech Co. Ltd. Shanghai. PrimeScript reverse-transcription kit and Premix ExTaq were obtained from Takara, Japan.</p><p id="para120" class="elsevierStylePara elsevierViewall">Primer sequences were designed using the Oligo Primer Analysis Software (Version: 7.60, Wojciech & Piotr Rychlik, USA), and their specificity was verified on the website of Primer-blast.</p><p id="para130" class="elsevierStylePara elsevierViewall">Oligo Name:          <span class="elsevierStyleItalic">Pdx1</span> Sequence (5′ to 3′)</p><p id="para140" class="elsevierStylePara elsevierViewall">Forward primer    GCACAAGAGCCAGTTGGGTA     Plus</p><p id="para150" class="elsevierStylePara elsevierViewall">Reverse primer    ATTGTCCTCAGTTGGGAGCC       Minus</p><p id="para160" class="elsevierStylePara elsevierViewall">Product length    175</p><p id="para170" class="elsevierStylePara elsevierViewall">Oligo Name:         <span class="elsevierStyleItalic">Pax4</span></p><p id="para180" class="elsevierStylePara elsevierViewall">Forward primer    ACAGATGCCAGGTGCTTCTC      Plus</p><p id="para190" class="elsevierStylePara elsevierViewall">Reverse primer    ATGATGCACAGGATGGGTGG     Minus</p><p id="para200" class="elsevierStylePara elsevierViewall">Product length    292</p><p id="para210" class="elsevierStylePara elsevierViewall">Oligo Name:         <span class="elsevierStyleItalic">Ngn3</span></p><p id="para220" class="elsevierStylePara elsevierViewall">Forward primer    ATGACAGAAGGGGCCAAAGG     Plus</p><p id="para230" class="elsevierStylePara elsevierViewall">Reverse primer    GTAACGGAGTGGAACCAGCA      Minus</p><p id="para240" class="elsevierStylePara elsevierViewall">Product length      84</p><p id="para250" class="elsevierStylePara elsevierViewall">Oligo Name:         <span class="elsevierStyleItalic">GAPDH</span></p><p id="para260" class="elsevierStylePara elsevierViewall">Forward primer    AGTGCCAGCCTCGTCTCATA</p><p id="para270" class="elsevierStylePara elsevierViewall">Reverse primer    GATGGTGATGGGTTTCCCGT</p><p id="para280" class="elsevierStylePara elsevierViewall">Product length     248</p></span><span id="cesec90" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle140">Statistical analysis</span><p id="para290" class="elsevierStylePara elsevierViewall">All measurement data are expressed as the mean ± standard deviation. Before analysis, the data were tested for normality of distribution using the Kolmogorov-Smirnov test. For normally distributed data, differences between groups were analyzed using the least-significant difference test. A value of <span class="elsevierStyleItalic">p</span><0.05 was considered statistically significant. SPSS 22.0 (IBM) was used for statistical analyses.</p></span></span><span id="cesec100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle150">RESULTS</span><span id="cesec110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle160">General conditions and measurement indicators</span><p id="para300" class="elsevierStylePara elsevierViewall">All rats were included for analysis (n=6 in each group). After treatment, the mental state of the rats from SC+HBO and SC groups was better than that of rats from DM group. Water consumption and urination significantly reduced and body weights increased for the rats from SC+HBO and SC groups (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1A</a>). Further, BG level gradually decreased (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1B</a>), serum insulin secretion increased (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1C</a>), and HOMA-IR (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1D</a>), serum LDL-C and TG (<a class="elsevierStyleCrossRef" href="#fig2">Figure 2A</a>), 24h urinary protein (<a class="elsevierStyleCrossRef" href="#fig2">Figure 2B</a>), and serum TNF-α and IL-6 (<a class="elsevierStyleCrossRef" href="#fig2">Figure 2C, 2D</a>) reduced in these groups as compared with those in DM group. The therapeutic effect in SC+HBO group appeared earlier than that in SC group.</p><elsevierMultimedia ident="fig1"></elsevierMultimedia><elsevierMultimedia ident="fig2"></elsevierMultimedia></span><span id="cesec120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle170">Histopathology</span><span id="cesec130" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle180">Pancreatic islet morphology</span><p id="para310" class="elsevierStylePara elsevierViewall">After 6 weeks of therapy, the morphology of pancreatic islets was relatively intact and the number of inflammatory cells decreased in H&E-stained sections from SC+HBO and SC groups (<a class="elsevierStyleCrossRef" href="#fig3">Figure 3A</a>). Electron microscopy revealed the improvement in the nuclear membrane integrity of organelles and the significant increase in secretory particles for SC+HBO and SC groups as compared with those for DM group (<a class="elsevierStyleCrossRef" href="#fig3">Figure 3B</a>).</p><elsevierMultimedia ident="fig3"></elsevierMultimedia></span><span id="cesec140" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle190">Immunofluorescence staining for insulin or glucagon in pancreatic islets</span><p id="para320" class="elsevierStylePara elsevierViewall">After the 6-week therapy, the MOD for insulin immunofluorescence staining in pancreatic islets was significantly higher for SC+HBO and SC groups than that for DM group, while the MOD values for glucagon in SC+HBO and SC groups were lower than the value for DM group (<a class="elsevierStyleCrossRef" href="#fig4">Figure 4A, 4B</a>).</p><elsevierMultimedia ident="fig4"></elsevierMultimedia></span><span id="cesec150" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle200">Apoptosis and proliferation of pancreatic islet cells</span><p id="para330" class="elsevierStylePara elsevierViewall">After 6 weeks of therapy, apoptosis significantly reduced and proliferation significantly increased for the islet cells from SC+HBO and SC groups as compared with those for the islets cells from DM group (<a class="elsevierStyleCrossRef" href="#fig5">Figure 5A, 5B</a>).</p><elsevierMultimedia ident="fig5"></elsevierMultimedia></span><span id="cesec160" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle210">RT-qPCR</span><p id="para340" class="elsevierStylePara elsevierViewall">The quantitative expression of pancreatic <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Pax4</span>, and <span class="elsevierStyleItalic">Ngn3</span> mRNAs was analyzed after 6 weeks of therapy. All six rats from each group were used for RT-qPCR. Gene expression was significantly upregulated in the samples from SC+HBO and SC groups as compared with that in samples from DM group. The expression of these genes in SC+HBO group was higher than that reported in SC group (<a class="elsevierStyleCrossRef" href="#fig6">Figure 6</a>).</p><elsevierMultimedia ident="fig6"></elsevierMultimedia></span></span></span><span id="cesec170" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle220">DISCUSSION</span><p id="para350" class="elsevierStylePara elsevierViewall">In 2003, Professor Shi Songtao discovered dental pulp stem cells in his 6-year-old daughter's deciduous teeth and named them as SHED. These cells originate from the cranial neural crest and express surface molecules or antigens for MSCs such as CD29, CD44, CD73, CD90, CD105, CD166, STRO-1, CD146, and stage-specific embryonic antigen 4 (SSEA4) (<a class="elsevierStyleCrossRef" href="#bib12">12</a>). Differentiation may be induced in some cell types, including adipocytes, neurons, chondrocytes, and MSCs, using specific stimulation conditions (<a class="elsevierStyleCrossRefs" href="#bib13">13–15</a>). Unlike the umbilical cord or cord blood stem cells that need to be extracted at birth, dental pulp stem cells may be harvested from either deciduous or permanent teeth and easily collected without any risk of complications (<a class="elsevierStyleCrossRef" href="#bib16">16</a>). Humans bear 20 deciduous teeth that eventually fall off. Hence, there is no ethical issue involved in their collection. SHED exhibit high proliferation and differentiation potentials, and their expression of several genes encoding extracellular and cell surface proteins may be at least twice that reported for human bone marrow MSCs (<a class="elsevierStyleCrossRef" href="#bib11">11</a>,<a class="elsevierStyleCrossRef" href="#bib17">17</a>). In comparison with bone marrow MSCs and permanent tooth pulp stem cells, SHED exhibit a more stable expression of genes such as basic fibroblast growth factor (<span class="elsevierStyleItalic">bFGF</span>) and bone morphogenetic protein-2 (<span class="elsevierStyleItalic">BMP-2</span>) (<a class="elsevierStyleCrossRef" href="#bib18">18</a>,<a class="elsevierStyleCrossRef" href="#bib19">19</a>). In addition, the dental pulp can be easily cryopreserved for a long time (<a class="elsevierStyleCrossRef" href="#bib20">20</a>). SHED can retain their potential after cryopreservation and continue to differentiate into adult tissues after rewarming (<a class="elsevierStyleCrossRef" href="#bib21">21</a>). Moreover, SHED can be directly extracted and cultured from the living dental pulp at any time.</p><p id="para360" class="elsevierStylePara elsevierViewall">Although the exact mechanism underlying the pancreatic endocrine cell development is elusive, many key regulatory factors are known to play important roles in the development of the pancreas. Pdx1 is a homeodomain transcription factor that plays a regulatory role in early development and cell maturation in the pancreas and maintains the function of mature β-cells (<a class="elsevierStyleCrossRef" href="#bib22">22</a>,<a class="elsevierStyleCrossRef" href="#bib23">23</a>). Pdx1 acts as a transcriptional master switch during pancreatic cell differentiation (<a class="elsevierStyleCrossRef" href="#bib24">24</a>). It binds to the TATA box of the glucose transporter 2 (<span class="elsevierStyleItalic">GLUT2</span>) gene and participates in its transcription (<a class="elsevierStyleCrossRef" href="#bib25">25</a>,<a class="elsevierStyleCrossRef" href="#bib26">26</a>). Ngn3 serves as an important regulatory molecule involved in the embryonic development of β-cells of the pancreas. Ngn3 initiates the differentiation of endocrine progenitor cells (<a class="elsevierStyleCrossRefs" href="#bib27">27-30</a>) and is an important marker of islet progenitor cells (<a class="elsevierStyleCrossRef" href="#bib31">31</a>). Pax4 is an important transcription factor for the development and regulation of the endocrine differentiation of the pancreas. It promotes the expression of transcription factors such as MafA and Nkx6.1, and induces the differentiation of pancreatic progenitor cells into endocrine cells, thereby enhancing the transcription and biosynthesis of insulin (<a class="elsevierStyleCrossRef" href="#bib32">32</a>). Pax4 promotes the trans-differentiation of islet α-cells into β-cells (<a class="elsevierStyleCrossRef" href="#bib33">33</a>) and reduces glucagon expression (<a class="elsevierStyleCrossRef" href="#bib34">34</a>). It also facilitates the transformation of Pdx1-positive MSCs into islet β-cells through the regulation of the expression of Nkx6.1, MafA, and GLUT2 (<a class="elsevierStyleCrossRef" href="#bib35">35</a>). In our study, <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Ngn3</span>, and <span class="elsevierStyleItalic">Pax4</span> gene expression in the pancreas of SC+HBO and SC groups was significantly higher than that in the pancreas from DM group, suggesting that SHED may promote the transcription, differentiation, and development of pancreatic progenitor cells at various stages and mediate the transformation of α-cells into β-cells.</p><p id="para370" class="elsevierStylePara elsevierViewall">T2DM is thought to be partially associated with chronic low-grade inflammation (<a class="elsevierStyleCrossRef" href="#bib36">36</a>). Elevated chronic inflammatory factors may decrease insulin sensitivity and induce insulin resistance, which may further impair glucose tolerance (<a class="elsevierStyleCrossRef" href="#bib37">37</a>). Basic research and epidemiological investigation have shown the upregulated expression of TNF-α and IL-6 in subjects with T2DM (<a class="elsevierStyleCrossRefs" href="#bib38">38–40</a>). Similar changes have been observed in obese people (<a class="elsevierStyleCrossRef" href="#bib41">41</a>). These pro-inflammatory cytokines may cause insulin resistance by blocking insulin receptor phosphorylation signaling pathway and inhibiting glucose transport (<a class="elsevierStyleCrossRef" href="#bib42">42</a>,<a class="elsevierStyleCrossRef" href="#bib43">43</a>). Cytokines such as TNF-α and IL-6 are key factors in the initiation of inflammation and development of insulin resistance (<a class="elsevierStyleCrossRef" href="#bib44">44</a>,<a class="elsevierStyleCrossRef" href="#bib45">45</a>). TNF-α infusion into healthy young male volunteers was shown to increase serum TNF-α and IL-6 levels and elevate HOMA-IR index, consequently inducing insulin resistance (<a class="elsevierStyleCrossRef" href="#bib46">46</a>). In our study, both SC+HBO and SC groups showed significantly reduced levels of pro-inflammatory cytokines TNF-α and IL-6, consistent with the improvement in inflammatory state.</p><p id="para380" class="elsevierStylePara elsevierViewall">Positron emission tomography (PET) experiments using radiolabeled mouse MSCs intravenously injected in mice showed their predominant accumulation in the lungs along with a substantial level of (18)F-FDG elution from cells (<a class="elsevierStyleCrossRef" href="#bib47">47</a>). Similar results were reported by Sood (<a class="elsevierStyleCrossRef" href="#bib48">48</a>) in 2015. The distribution of allogeneic bone marrow-derived MSCs after intravenous injection was pathologically and bio-optically investigated by <span class="elsevierStyleItalic">ex vivo</span> imaging (using IVIS) using a fluorescent lipophilic tracer DiR; MSCs were found to be mainly distributed in the lungs and liver (<a class="elsevierStyleCrossRef" href="#bib49">49</a>). However, a study (<a class="elsevierStyleCrossRef" href="#bib50">50</a>) revealed the presence of BrdU-labeled MSCs in the islets after a 45-day therapy, suggestive of their pancreatic localization. In our research, SHED were not examined or found in the samples taken from rats after therapy; hence, it is unclear whether the therapeutic effect of SHED was mediated by their direct differentiation effect or secretory effect. We may speculate that SHED play therapeutic roles through secretory or immunoregulation effects by decreasing apoptosis and increasing proliferation. In our study, SHED therapy could improve the morphology of islets and β-cells, increase the number of β-cells and level of insulin secretion, and reduce α-cell number and glucagon secretion. The mechanism may involve SHED-mediated upregulation in <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Pax4</span>, and <span class="elsevierStyleItalic">Ngn3</span> gene expression that could promote pancreatic progenitor cell differentiation into endocrine progenitor cells and islet cells, induce α-cell trans-differentiation into β-cells, and decrease the damage or apoptosis of islets by systemic or local inflammation. Further researches are warranted to explore the precise mechanism using optical <span class="elsevierStyleItalic">in vivo</span> imaging to confirm the localization and survival conditions of SHED <span class="elsevierStyleItalic">in vivo</span> or examine the cytokines secreted from SHED <span class="elsevierStyleItalic">in vitro</span> or <span class="elsevierStyleItalic">in vivo</span>. The body weights of rats from the therapy group increased with the remission of insulin resistance during the experiment; hence, remission of insulin resistance was not associated with weight loss but probably with the decrease in TNF-α and IL-6 levels that improved the inflammatory status. The improvement in serum lipid and urine protein levels may also be related to the improvement in the inflammatory status of animals. A clinical trial (<a class="elsevierStyleCrossRef" href="#bib8">8</a>) in 2008 showed that the combined therapy with intrapancreatic autologous bone marrow stem cell infusion and HBO improved the metabolic control and reduced insulin requirements in patients with T2DM. Another clinical trial (<a class="elsevierStyleCrossRef" href="#bib51">51</a>) revealed the improvement in islet functions and metabolic control with mild adverse effects in T2DM patients subjected to autologous bone marrow mononuclear cell (BM-MNC) infusion in combination with HBO therapy; however, HBO did not synergize with BM-MNC infusion. In our experiment, HBO could reduce serum lipid, urinary protein, and serum pro-inflammatory cytokine TNF-α levels, and synergistically function with stem cells to accelerate their functions and increase the expression of pancreatic genes, thereby showing a tendency to increase therapeutic efficacy. The underlying mechanism might involve its anti-inflammatory effects, upregulation in oxidative metabolism, and improvement in oxygen supply to local hypoxic tissues.</p></span><span id="cesec180" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle230">CONCLUSION</span><p id="para390" class="elsevierStylePara elsevierViewall">SHED in combination with HBO therapy in T2D rats could reduce BG and HOMA-IR, increase serum insulin level, improve serum lipid level, and reduce urine protein content. The mechanism underlying the increase in insulin level may be related to the SHED-mediated upregulation in the expression of <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Ngn3</span>, and <span class="elsevierStyleItalic">Pax4</span> in the pancreas, increase in the proliferation and secretion of pancreatic islets, enhancement in the trans-differentiation of α-cells into β-cells, and decrease in the apoptosis of islet cells. Insulin resistance may be mediated by the anti-inflammatory effects of SHED via downregulation of TNF-α and IL-6 levels. SHED combined with HBO therapy may exert synergistic effects.</p></span><span id="cesec190" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle240">AUTHOR CONTRIBUTIONS</span><p id="para400" class="elsevierStylePara elsevierViewall">Xu Y designed the study, obtained the data and wrote the manuscript. Chen J designed and performed experiments. Zhou H, Wang J, Song J, Xie J, Wang C and Guo Q performed experiments. Huang Q designed the study, edited, supported, and critically revised the manuscript and contributed to Discussion. Xu Y and Chen J contributed equally to this work. All authors have approved the final version of the manuscript to be published.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:2 [ "identificador" => "xpalclavsec1580089" "titulo" => "KEYWORDS" ] 1 => array:2 [ "identificador" => "cesec10" "titulo" => "INTRODUCTION" ] 2 => array:3 [ "identificador" => "cesec20" "titulo" => "MATERIALS AND METHODS" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "cesec30" "titulo" => "Animal model and groups" ] 1 => array:2 [ "identificador" => "cesec40" "titulo" => "Stem cell therapy" ] 2 => array:2 [ "identificador" => "cesec50" "titulo" => "HBO therapy" ] 3 => array:2 [ "identificador" => "cesec60" "titulo" => "Biochemical assays and enzyme-linked immunosorbent assay (ELISA)" ] 4 => array:2 [ "identificador" => "cesec70" "titulo" => "Histopathological analysis" ] 5 => array:2 [ "identificador" => "cesec80" "titulo" => "Real-time quantitative polymerase chain reaction (RT-qPCR)" ] 6 => array:2 [ "identificador" => "cesec90" "titulo" => "Statistical analysis" ] ] ] 3 => array:3 [ "identificador" => "cesec100" "titulo" => "RESULTS" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "cesec110" "titulo" => "General conditions and measurement indicators" ] 1 => array:3 [ "identificador" => "cesec120" "titulo" => "Histopathology" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "cesec130" "titulo" => "Pancreatic islet morphology" ] 1 => array:2 [ "identificador" => "cesec140" "titulo" => "Immunofluorescence staining for insulin or glucagon in pancreatic islets" ] 2 => array:2 [ "identificador" => "cesec150" "titulo" => "Apoptosis and proliferation of pancreatic islet cells" ] 3 => array:2 [ "identificador" => "cesec160" "titulo" => "RT-qPCR" ] ] ] ] ] 4 => array:2 [ "identificador" => "cesec170" "titulo" => "DISCUSSION" ] 5 => array:2 [ "identificador" => "cesec180" "titulo" => "CONCLUSION" ] 6 => array:2 [ "identificador" => "cesec190" "titulo" => "AUTHOR CONTRIBUTIONS" ] 7 => array:2 [ "identificador" => "xack638096" "titulo" => "ACKNOWLEDGMENTS" ] 8 => array:1 [ "titulo" => "REFERENCES" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2019-11-28" "fechaAceptado" => "2020-02-10" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "KEYWORDS" "identificador" => "xpalclavsec1580089" "palabras" => array:5 [ 0 => "Type 2 Diabetic Rats" 1 => "SHED" 2 => "Stem Cell Therapy" 3 => "Hyperbaric Oxygen Therapy" 4 => "Immunoregulation" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "resumen" => "<span id="ceabs10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle10">OBJECTIVES:</span><p id="spara70" class="elsevierStyleSimplePara elsevierViewall">Mesenchymal stem cells (MSCs) are potentially ideal for type 2 diabetes treatment, owing to their multidirectional differentiation ability and immunomodulatory properties. Here we investigated whether the stem cells from human exfoliated deciduous teeth (SHED) in combination with hyperbaric oxygen (HBO) could treat type 2 diabetic rats, and explored the underlying mechanism.</p></span> <span id="ceabs20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle20">METHODS:</span><p id="spara80" class="elsevierStyleSimplePara elsevierViewall">SD rats were used to generate a type 2 diabetes model, which received stem cell therapy, HBO therapy, or both together. Before and after treatment, body weight, blood glucose, and serum insulin, blood lipid, pro-inflammatory cytokines (tumor necrosis factor-alpha and interleukin-6), and urinary proteins were measured and compared. After 6 weeks, rats were sacrificed and their organs were subjected to hematoxylin and eosin staining and immunofluorescence staining for insulin and glucagon; apoptosis and proliferation were analyzed in islet cells. Structural changes in islets were observed under an electron microscope. Expression levels of <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Ngn3</span>, and <span class="elsevierStyleItalic">Pax4</span> mRNAs in the pancreas were assessed by real-time quantitative polymerase chain reaction (RT-qPCR).</p></span> <span id="ceabs30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle30">RESULTS:</span><p id="spara90" class="elsevierStyleSimplePara elsevierViewall">In comparison with diabetic mice, those treated with the combination or SHE therapy showed decreased blood glucose, insulin resistance, serum lipids, and pro-inflammatory cytokines and increased body weight and serum insulin. The morphology and structure of pancreatic islets improved, as evident from an increase in insulin-positive cells and a decrease in glucagon-positive cells. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining of islet cells revealed the decreased apoptosis index, while Ki67 and proliferating cell nuclear antigen staining showed increased proliferation index. Pancreatic expression of <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Ngn3</span>, and <span class="elsevierStyleItalic">Pax4</span> was upregulated.</p></span> <span id="ceabs40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle40">CONCLUSION:</span><p id="spara100" class="elsevierStyleSimplePara elsevierViewall">SHED combined with HBO therapy was effective for treating type 2 diabetic rats. The underlying mechanism may involve SHED-mediated increase in the proliferation and trans-differentiation of islet β-cells and decrease in pro-inflammatory cytokines and apoptosis of islets.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs10" "titulo" => "OBJECTIVES:" ] 1 => array:2 [ "identificador" => "ceabs20" "titulo" => "METHODS:" ] 2 => array:2 [ "identificador" => "ceabs30" "titulo" => "RESULTS:" ] 3 => array:2 [ "identificador" => "ceabs40" "titulo" => "CONCLUSION:" ] ] ] ] "NotaPie" => array:2 [ 0 => array:3 [ "etiqueta" => "#" "nota" => "<p class="elsevierStyleNotepara" id="cenpara20">Co-first authors</p>" "identificador" => "fn1" ] 1 => array:1 [ "nota" => "<p class="elsevierStyleNotepara" id="cenpara10">No potential conflict of interest was reported.</p>" ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 952 "Ancho" => 1425 "Tamanyo" => 111681 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">Body weight and glucose metabolism indices of rats. <span class="elsevierStyleBold">A</span>. Body weight: After 3 weeks of therapy, the body weights of the rats from the SC+HBO group were higher than those of the rats from the DM group. After 5 weeks, the body weights of the rats from the SC+HBO group were higher than those of the rats from the HBO group. After 6 weeks, the SC group rats had higher body weight than the DM group rats. B. AUC of BG by OGTT: After 2 weeks of therapy, the AUC for the rats from the SC+HBO group was lower than that for the rats from the DM group. The AUC value decreased for SC group rats as compared with that for DM group rats after 4 weeks. The AUC of SC+HBO group rats was lower than that of HBO group rats. C. AUC of INS by OGTT: After 4 weeks, the AUC started to increase for the rats from SC+HBO and SC groups as compared with that for the rats from DM group. D. HOMA-IR: After 4 weeks, the HOMA-IR for SC+HBO and SC group rats was lower than that for DM group rats. *<span class="elsevierStyleItalic">p</span><0.05, **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group, <span class="elsevierStyleSup">△</span><span class="elsevierStyleItalic">p</span><0.05 <span class="elsevierStyleItalic">vs</span> HBO group. <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups.</p>" ] ] 1 => array:7 [ "identificador" => "fig2" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1052 "Ancho" => 1425 "Tamanyo" => 114280 ] ] "descripcion" => array:1 [ "en" => "<p id="spara20" class="elsevierStyleSimplePara elsevierViewall">Blood lipid, proinflammatory cytokine, and urine protein of rats. A. Blood lipid after 6 weeks of therapy: Serum TG and LDL levels were higher in SC+HBO, SC, and HBO groups than those in the DM group. B. 24h urine protein: After 4 weeks, urine protein levels began to decrease in SC+HBO and SC groups as compared with those in DM group. C. Serum TNF-α: After 2 weeks, serum TNF-α levels began to decrease in SC+HBO and SC groups as compared with those in the DM group. After 4 weeks, serum TNF-α level of the HBO group was lower than that of the DM group. D. Serum IL-6: After 2 weeks, serum IL-6 levels in the SC+HBO group were lower than those in DM and HBO groups. After 4 weeks, serum IL-6 levels in the SC group were lower than those in the DM group. *<span class="elsevierStyleItalic">p</span><0.05, **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group; <span class="elsevierStyleSup">△△</span><span class="elsevierStyleItalic">p</span><0.05 <span class="elsevierStyleItalic">vs</span> HBO group. <span class="elsevierStyleSup">⋇</span><span class="elsevierStyleItalic">p</span><0.05, <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups.</p>" ] ] 2 => array:7 [ "identificador" => "fig3" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1737 "Ancho" => 1503 "Tamanyo" => 466381 ] ] "descripcion" => array:1 [ "en" => "<p id="spara30" class="elsevierStyleSimplePara elsevierViewall">Pathologic morphology of rat pancreas after 6 weeks of therapy. A. H&E staining: In the DM group, islet cells decreased and swollen cells and cytoplasmic vacuolar changes were observed; hyaline deposits were noted under the basement membrane of some islet capillaries, and inflammatory cells were scattered in the islets. The islet morphology in SC+HBO and SC groups was better than that in DM group. Scale bar: 20 μm, 400×. B. C. Electron microscopy of islet β-cells: In comparison with the β-cells in DM group, those from SC+HBO and SC groups showed decreased nuclear deformation, less swollen mitochondria, reduced lipid droplet accumulation, and significantly increased secretory granules. a. Nucleus; b. Mitochondria; c. Secretory granule; d. Ribosome. Scale bar: B.1 μm, 8000×; C. 5 μm, 2500×.</p>" ] ] 3 => array:7 [ "identificador" => "fig4" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 2404 "Ancho" => 1338 "Tamanyo" => 370080 ] ] "descripcion" => array:1 [ "en" => "<p id="spara40" class="elsevierStyleSimplePara elsevierViewall">Immunofluorescence analysis after 6 weeks of therapy. A. Insulin/glucagon immunofluorescence staining for pancreatic islets: In the DM group, the distribution of glucagon-positive cells (green) in the islets was disorganized, and most cells were distributed in the center and around the islets; glucagon-positive cells increased and insulin-positive cells (<a class="elsevierStyleCrossRef" href="#bib4">4</a>) decreased as compared with those in NC group. In SC+HBO and SC groups, glucagon-positive cells in the islet center decreased and insulin-positive cells increased as compared with DM group. Scale bar: 50 μm, 200×. B. MOD of insulin or glucagon immunohistochemistry in pancreatic islets: The MOD values of insulin for SC+HBO and SC groups were higher than those for DM group. The MOD value of SC+HBO group was higher than the values for SC and HBO groups; the MOD values of glucagon for SC+HBO and SC groups were lower than the value for DM group, while the MOD value of SC+HBO group was lower than the values reported for SC and HBO groups. **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group; <span class="elsevierStyleSup">▴▴</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> SC group; <span class="elsevierStyleSup">△△</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> HBO group. <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups.</p>" ] ] 4 => array:7 [ "identificador" => "fig5" "etiqueta" => "Figure 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:2 [ 0 => array:1 [ "imagen" => "gr5a.jpeg" ] 1 => array:1 [ "imagen" => "gr5b.jpeg" ] ] "descripcion" => array:1 [ "en" => "<p id="spara50" class="elsevierStyleSimplePara elsevierViewall">Apoptosis and proliferation of pancreatic islet cells after 6 weeks of therapy. A. Staining for apoptosis and proliferation analysis in islet cells: The brown cells in the islets shown by red arrows were positively stained cells. TUNEL staining showed that the number of positively stained cells in the islets of DM group was higher than that in the islets of NC group. Positive cells in the islets of SC+HBO and SC groups were lower than those in the islets of DM group. Ki67 and PCNA staining showed that positive cells in islets were slightly higher in DM group than in NC group, and obviously increased in SC+HBO and SC groups as compared with those in DM group. Scale bar: 20 μm, 400×. B. Apoptosis index (AI) and proliferation index (PI) of islet cells: TUNEL AI was lower for SC+HBO and SC groups than that for DM group. The AI for SC+HBO group was lower than that for HBO group; the PI of Ki67 and PCNA was higher for SC+HBO and SC groups than that for DM group, while the PI of SC+HBO group was higher than that of HBO group. **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group; <span class="elsevierStyleSup">△△</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> HBO group; <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups; <span class="elsevierStyleSup">★★</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> either SC or SC+HBO group.</p>" ] ] 5 => array:7 [ "identificador" => "fig6" "etiqueta" => "Figure 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 1083 "Ancho" => 1753 "Tamanyo" => 83093 ] ] "descripcion" => array:1 [ "en" => "<p id="spara60" class="elsevierStyleSimplePara elsevierViewall">Expression of <span class="elsevierStyleItalic">Pdx1</span>, <span class="elsevierStyleItalic">Pax4</span>, and <span class="elsevierStyleItalic">Ngn3</span> mRNAs in the pancreas by PCR after 6 weeks of therapy. <span class="elsevierStyleBold">Gene</span> expression of the SC+HBO group and the SC group was higher than that of the DM group; and the expression of the SC+HBO group was higher than that of the SC group. **<span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> DM group; <span class="elsevierStyleSup">▴▴</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> SC group; <span class="elsevierStyleSup">⋇⋇</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> each of the other four groups; <span class="elsevierStyleSup">★★</span><span class="elsevierStyleItalic">p</span><0.01 <span class="elsevierStyleItalic">vs</span> either SC group or SC+HBO group.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "REFERENCES" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec10" "bibliografiaReferencia" => array:51 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IDF DIABETES ATLAS" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ NH Cho \n \t\t\t\t\t\t\t\t """ 1 => """ J Kirigia \n \t\t\t\t\t\t\t\t """ 2 => """ J Claude \n \t\t\t\t\t\t\t\t """ 3 => """ K Mbanya, Ogurstova \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "edicion" => "Eighth edition" "fecha" => "2017" "editorial" => "International Diabetes Federation" "editorialLocalizacion" => "Abu Dhabi, UAE" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Miracle cells for natural dentistry - A review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ R Somani \n \t\t\t\t\t\t\t\t """ 1 => """ S Jaidka \n \t\t\t\t\t\t\t\t """ 2 => """ N Bajaj \n \t\t\t\t\t\t\t\t """ 3 => """ S Arora \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.jobcr.2015.11.007" "Revista" => array:6 [ "tituloSerie" => "J Oral Biol Craniofac Res" "fecha" => "2017" "volumen" => "7" "numero" => "1" "paginaInicial" => "49" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28316922" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.jobcr.2015.11.007" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.jobcr.2015.11.007" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Differentiation of dental pulp stem cells into islet-like aggregates" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ V Govindasamy \n \t\t\t\t\t\t\t\t """ 1 => """ VS Ronald \n \t\t\t\t\t\t\t\t """ 2 => """ AN Abdullah \n \t\t\t\t\t\t\t\t """ 3 => """ KR Nathan \n \t\t\t\t\t\t\t\t """ 4 => """ ZA Ab Aziz \n \t\t\t\t\t\t\t\t """ 5 => """ M Abdullah \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1177/0022034510396879" "Revista" => array:7 [ "tituloSerie" => "J Dent Res" "fecha" => "2011" "volumen" => "90" "numero" => "5" "paginaInicial" => "646" "paginaFinal" => "652" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21335539" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1177/0022034510396879" "WWW" => array:1 [ "link" => "https://doi.org/10.1177/0022034510396879" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Endothelial progenitor cell release into circulation is triggered by hyperoxia-induced increases in bone marrow nitric oxide" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ LJ Goldstein \n \t\t\t\t\t\t\t\t """ 1 => """ KA Gallagher \n \t\t\t\t\t\t\t\t """ 2 => """ SM Bauer \n \t\t\t\t\t\t\t\t """ 3 => """ RJ Bauer \n \t\t\t\t\t\t\t\t """ 4 => """ V Baireddy \n \t\t\t\t\t\t\t\t """ 5 => """ ZJ Liu \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1634/stemcells.2006-0010" "Revista" => array:7 [ "tituloSerie" => "Stem Cells" "fecha" => "2006" "volumen" => "24" "numero" => "10" "paginaInicial" => "2309" "paginaFinal" => "2318" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16794267" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1634/stemcells.2006-0010" "WWW" => array:1 [ "link" => "https://doi.org/10.1634/stemcells.2006-0010" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Stem cell mobilization by hyperbaric oxygen" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ SR Thom \n \t\t\t\t\t\t\t\t """ 1 => """ VM Bhopale \n \t\t\t\t\t\t\t\t """ 2 => """ OC Velazquez \n \t\t\t\t\t\t\t\t """ 3 => """ LJ Goldstein \n \t\t\t\t\t\t\t\t """ 4 => """ LH Thom \n \t\t\t\t\t\t\t\t """ 5 => """ DG Buerk \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1152/ajpheart.00888.2005" "Revista" => array:7 [ "tituloSerie" => "Am J Physiol Heart Circ Physiol" "fecha" => "2006" "volumen" => "290" "numero" => "4" "paginaInicial" => "H1378" "paginaFinal" => "H1386" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16299259" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1152/ajpheart.00888.2005" "WWW" => array:1 [ "link" => "https://doi.org/10.1152/ajpheart.00888.2005" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of in vitro and in vivo oxygen modulation on β cell differentiation from human embryonic stem cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ S Cechin \n \t\t\t\t\t\t\t\t """ 1 => """ S Alvarez-Cubela \n \t\t\t\t\t\t\t\t """ 2 => """ JA Giraldo \n \t\t\t\t\t\t\t\t """ 3 => """ RD Molano \n \t\t\t\t\t\t\t\t """ 4 => """ S Villate \n \t\t\t\t\t\t\t\t """ 5 => """ C Ricordi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.5966/sctm.2013-0160" "Revista" => array:7 [ "tituloSerie" => "Stem Cells Transl Med" "fecha" => "2014" "volumen" => "3" "numero" => "3" "paginaInicial" => "277" "paginaFinal" => "289" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24375542" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.5966/sctm.2013-0160" "WWW" => array:1 [ "link" => "https://doi.org/10.5966/sctm.2013-0160" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Induction of beta-cell resistance to hypoxia and technologies for oxygen delivery to transplanted pancreatic islets" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ D Lazard \n \t\t\t\t\t\t\t\t """ 1 => """ P Vardi \n \t\t\t\t\t\t\t\t """ 2 => """ K Bloch \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/dmrr.2294" "Revista" => array:7 [ "tituloSerie" => "Diabetes Metab Res Rev" "fecha" => "2012" "volumen" => "28" "numero" => "6" "paginaInicial" => "475" "paginaFinal" => "484" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22389124" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/dmrr.2294" "WWW" => array:1 [ "link" => "https://doi.org/10.1002/dmrr.2294" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Combined treatment of intrapancreatic autologous bone marrow stem cells and hyperbaric oxygen in type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ EJ Estrada \n \t\t\t\t\t\t\t\t """ 1 => """ F Valacchi \n \t\t\t\t\t\t\t\t """ 2 => """ E Nicora \n \t\t\t\t\t\t\t\t """ 3 => """ S Brieva \n \t\t\t\t\t\t\t\t """ 4 => """ C Esteve \n \t\t\t\t\t\t\t\t """ 5 => """ L Echevarria \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.3727/096368908787648119" "Revista" => array:7 [ "tituloSerie" => "Cell Transplant" "fecha" => "2008" "volumen" => "17" "numero" => "12" "paginaInicial" => "1295" "paginaFinal" => "1304" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19364067" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.3727/096368908787648119" "WWW" => array:1 [ "link" => "https://doi.org/10.3727/096368908787648119" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Autologous bone marrow stem cell transplantation for the treatment of type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ L Wang \n \t\t\t\t\t\t\t\t """ 1 => """ S Zhao \n \t\t\t\t\t\t\t\t """ 2 => """ H Mao \n \t\t\t\t\t\t\t\t """ 3 => """ L Zhou \n \t\t\t\t\t\t\t\t """ 4 => """ ZJ Wang \n \t\t\t\t\t\t\t\t """ 5 => """ HX Wang \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Chin Med J" "fecha" => "2011" "volumen" => "124" "numero" => "22" "paginaInicial" => "3622" "paginaFinal" => "3628" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22340214" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A practical guide for induction of type-2 diabetes in rat: Incorporating a high-fat diet and streptozotocin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ S Gheibi \n \t\t\t\t\t\t\t\t """ 1 => """ K Kashfi \n \t\t\t\t\t\t\t\t """ 2 => """ A Ghasemi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.biopha.2017.08.098" "Revista" => array:6 [ "tituloSerie" => "Biomed Pharmacother" "fecha" => "2017" "volumen" => "95" "paginaInicial" => "605" "paginaFinal" => "613" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28881291" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.biopha.2017.08.098" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.biopha.2017.08.098" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuro-regenerative mechanisms" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ K Sakai \n \t\t\t\t\t\t\t\t """ 1 => """ A Yamamoto \n \t\t\t\t\t\t\t\t """ 2 => """ K Matsubara \n \t\t\t\t\t\t\t\t """ 3 => """ S Nakamura \n \t\t\t\t\t\t\t\t """ 4 => """ M Naruse \n \t\t\t\t\t\t\t\t """ 5 => """ M Yamagata \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI59251" "Revista" => array:7 [ "tituloSerie" => "J Clin Invest" "fecha" => "2012" "volumen" => "122" "numero" => "1" "paginaInicial" => "80" "paginaFinal" => "90" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22133879" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immunomodulatory properties of stem cells from human exfoliated deciduous teeth" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ T Yamaza \n \t\t\t\t\t\t\t\t """ 1 => """ A Kentaro \n \t\t\t\t\t\t\t\t """ 2 => """ C Chen \n \t\t\t\t\t\t\t\t """ 3 => """ Y Liu \n \t\t\t\t\t\t\t\t """ 4 => """ Y Shi \n \t\t\t\t\t\t\t\t """ 5 => """ S Gronthos \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1186/scrt5" "Revista" => array:6 [ "tituloSerie" => "Stem Cell Res Ther" "fecha" => "2010" "volumen" => "1" "numero" => "1" "paginaInicial" => "5" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20504286" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1186/scrt5" "WWW" => array:1 [ "link" => "https://doi.org/10.1186/scrt5" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Different roles of dexamethasone on transforming growth factor-beta1-induced fibronectin and nerve growth factor expression in dental pulp cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ S Srisawasdi \n \t\t\t\t\t\t\t\t """ 1 => """ P Pavasant \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.joen.2007.05.007" "Revista" => array:7 [ "tituloSerie" => "J Endod" "fecha" => "2007" "volumen" => "33" "numero" => "9" "paginaInicial" => "1057" "paginaFinal" => "1060" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17931932" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.joen.2007.05.007" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.joen.2007.05.007" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ K Iohara \n \t\t\t\t\t\t\t\t """ 1 => """ L Zheng \n \t\t\t\t\t\t\t\t """ 2 => """ M Ito \n \t\t\t\t\t\t\t\t """ 3 => """ A Tomokiyo \n \t\t\t\t\t\t\t\t """ 4 => """ K Matsushita \n \t\t\t\t\t\t\t\t """ 5 => """ M Nakashima \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1634/stemcells.2006-0161" "Revista" => array:8 [ "tituloSerie" => "Stem Cells" "fecha" => "2006" "volumen" => "24" "numero" => "11" "paginaInicial" => "2493" "paginaFinal" => "2503" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16873765" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0085253815499740" "estado" => "S300" "issn" => "00852538" ] ] ] 1 => array:2 [ "doi" => "10.1634/stemcells.2006-0161" "WWW" => array:1 [ "link" => "https://doi.org/10.1634/stemcells.2006-0161" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Isolation and characterization of postnatal stem cells from human dental tissues" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ YY Jo \n \t\t\t\t\t\t\t\t """ 1 => """ HJ Lee \n \t\t\t\t\t\t\t\t """ 2 => """ SY Kook \n \t\t\t\t\t\t\t\t """ 3 => """ HW Choung \n \t\t\t\t\t\t\t\t """ 4 => """ JY Park \n \t\t\t\t\t\t\t\t """ 5 => """ JH Chung \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/ten.2006.0192" "Revista" => array:7 [ "tituloSerie" => "Tissue Eng" "fecha" => "2007" "volumen" => "13" "numero" => "4" "paginaInicial" => "767" "paginaFinal" => "773" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17432951" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Banking stem cells from human exfoliated deciduous teeth (SHED): saving for the future" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ V Arora \n \t\t\t\t\t\t\t\t """ 1 => """ P Arora \n \t\t\t\t\t\t\t\t """ 2 => """ AK Munshi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.17796/jcpd.33.4.y887672r0j703654" "Revista" => array:7 [ "tituloSerie" => "J Clin Pediatr Dent" "fecha" => "2009" "volumen" => "33" "numero" => "4" "paginaInicial" => "289" "paginaFinal" => "294" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19725233" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.17796/jcpd.33.4.y887672r0j703654" "WWW" => array:1 [ "link" => "https://doi.org/10.17796/jcpd.33.4.y887672r0j703654" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ GT Huang \n \t\t\t\t\t\t\t\t """ 1 => """ S Gronthos \n \t\t\t\t\t\t\t\t """ 2 => """ S Shi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1177/0022034509340867" "Revista" => array:7 [ "tituloSerie" => "J Dent Res" "fecha" => "2009" "volumen" => "88" "numero" => "9" "paginaInicial" => "792" "paginaFinal" => "806" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19767575" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1177/0022034509340867" "WWW" => array:1 [ "link" => "https://doi.org/10.1177/0022034509340867" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparative characterization of stem cells from human exfoliated deciduous teeth, dental pulp, and bone marrow-derived mesenchymal stem cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ R Kunimatsu \n \t\t\t\t\t\t\t\t """ 1 => """ K Nakajima \n \t\t\t\t\t\t\t\t """ 2 => """ T Awada \n \t\t\t\t\t\t\t\t """ 3 => """ Y Tsuka \n \t\t\t\t\t\t\t\t """ 4 => """ T Abe \n \t\t\t\t\t\t\t\t """ 5 => """ K Ando \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.bbrc.2018.04.213" "Revista" => array:7 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2018" "volumen" => "501" "numero" => "1" "paginaInicial" => "193" "paginaFinal" => "198" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29730288" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.bbrc.2018.04.213" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.bbrc.2018.04.213" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "[Comparison of the secretory related molecules expression in stem cells from the pulp of human exfoliated deciduous teeth and dental pulp stem cells]" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ ZH Du \n \t\t\t\t\t\t\t\t """ 1 => """ SL Li \n \t\t\t\t\t\t\t\t """ 2 => """ XY Ge \n \t\t\t\t\t\t\t\t """ 3 => """ GY Yu \n \t\t\t\t\t\t\t\t """ 4 => """ C Ding \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3760/cma.j.issn.1002-0098.2018.11.005" "Revista" => array:7 [ "tituloSerie" => "Zhonghua Kou Qiang Yi Xue Za Zhi" "fecha" => "2018" "volumen" => "53" "numero" => "11" "paginaInicial" => "741" "paginaFinal" => "747" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30419654" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib20" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long-term cryopreservation of dental pulp stem cells (SBP-DPSCs) and their differentiated osteoblasts: a cell source for tissue repair" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ G Papaccio \n \t\t\t\t\t\t\t\t """ 1 => """ A Graziano \n \t\t\t\t\t\t\t\t """ 2 => """ R d'Aquino \n \t\t\t\t\t\t\t\t """ 3 => """ MF Graziano \n \t\t\t\t\t\t\t\t """ 4 => """ G Pirozzi \n \t\t\t\t\t\t\t\t """ 5 => """ D Menditti \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/jcp.20667" "Revista" => array:7 [ "tituloSerie" => "J Cell Physiol" "fecha" => "2006" "volumen" => "208" "numero" => "2" "paginaInicial" => "319" "paginaFinal" => "325" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16622855" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/jcp.20667" "WWW" => array:1 [ "link" => "https://doi.org/10.1002/jcp.20667" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib21" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multilineage differentiation potential of stem cells derived from human dental pulp after cryopreservation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ W Zhang \n \t\t\t\t\t\t\t\t """ 1 => """ XF Walboomers \n \t\t\t\t\t\t\t\t """ 2 => """ S Shi \n \t\t\t\t\t\t\t\t """ 3 => """ M Fan \n \t\t\t\t\t\t\t\t """ 4 => """ JA Jansen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1089/ten.2006.12.2813" "Revista" => array:7 [ "tituloSerie" => "Tissue Eng" "fecha" => "2006" "volumen" => "12" "numero" => "10" "paginaInicial" => "2813" "paginaFinal" => "2823" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17518650" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1089/ten.2006.12.2813" "WWW" => array:1 [ "link" => "https://doi.org/10.1089/ten.2006.12.2813" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib22" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Insulin-promoter-factor 1 is required for pancreas development in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ J Jonsson \n \t\t\t\t\t\t\t\t """ 1 => """ L Carlsson \n \t\t\t\t\t\t\t\t """ 2 => """ T Edlund \n \t\t\t\t\t\t\t\t """ 3 => """ H Edlund \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/371606a0" "Revista" => array:7 [ "tituloSerie" => "Nature" "fecha" => "1994" "volumen" => "371" "numero" => "6498" "paginaInicial" => "606" "paginaFinal" => "609" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7935793" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/371606a0" "WWW" => array:1 [ "link" => "https://doi.org/10.1038/371606a0" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib23" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ DA Stoffers \n \t\t\t\t\t\t\t\t """ 1 => """ NT Zinkin \n \t\t\t\t\t\t\t\t """ 2 => """ V Stanojevic \n \t\t\t\t\t\t\t\t """ 3 => """ WL Clarke \n \t\t\t\t\t\t\t\t """ 4 => """ JF Habener \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/ng0197-106" "Revista" => array:7 [ "tituloSerie" => "Nat Genet" "fecha" => "1997" "volumen" => "15" "numero" => "1" "paginaInicial" => "106" "paginaFinal" => "110" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8988180" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/ng0197-106" "WWW" => array:1 [ "link" => "https://doi.org/10.1038/ng0197-106" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib24" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Derivation of islet-like cells from mesenchymal stem cells using PDX1-transducing lentiviruses" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ S Talebi \n \t\t\t\t\t\t\t\t """ 1 => """ A Aleyasin \n \t\t\t\t\t\t\t\t """ 2 => """ M Soleimani \n \t\t\t\t\t\t\t\t """ 3 => """ M Massumi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/bab.1013" "Revista" => array:7 [ "tituloSerie" => "Biotechnol Appl Biochem" "fecha" => "2012" "volumen" => "59" "numero" => "3" "paginaInicial" => "205" "paginaFinal" => "212" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23586830" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/bab.1013" "WWW" => array:1 [ "link" => "https://doi.org/10.1002/bab.1013" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib25" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dynamic recruitment of functionally distinct Swi/Snf chromatin remodeling complexes modulates Pdx1 activity in islet β cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ B McKenna \n \t\t\t\t\t\t\t\t """ 1 => """ M Guo \n \t\t\t\t\t\t\t\t """ 2 => """ A Reynolds \n \t\t\t\t\t\t\t\t """ 3 => """ M Hara \n \t\t\t\t\t\t\t\t """ 4 => """ R Stein \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.celrep.2015.02.054" "Revista" => array:7 [ "tituloSerie" => "Cell Rep" "fecha" => "2015" "volumen" => "10" "numero" => "12" "paginaInicial" => "2032" "paginaFinal" => "2042" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25801033" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.celrep.2015.02.054" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.celrep.2015.02.054" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib26" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Malondialdehyde regulates glucose-stimulated insulin secretion in murine islets via TCF7L2-dependent Wnt signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ X Wang \n \t\t\t\t\t\t\t\t """ 1 => """ XG Lei \n \t\t\t\t\t\t\t\t """ 2 => """ J Wang \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.mce.2013.09.003" "Revista" => array:7 [ "tituloSerie" => "Mol Cell Endocrinol" "fecha" => "2014" "volumen" => "382" "numero" => "1" "paginaInicial" => "8" "paginaFinal" => "16" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24035868" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.mce.2013.09.003" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.mce.2013.09.003" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib27" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expression of neurogenin3 reveals an islet cell precursor population in the pancreas" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ VM Schwitzgebel \n \t\t\t\t\t\t\t\t """ 1 => """ DW Scheel \n \t\t\t\t\t\t\t\t """ 2 => """ JR Conners \n \t\t\t\t\t\t\t\t """ 3 => """ J Kalamaras \n \t\t\t\t\t\t\t\t """ 4 => """ JE Lee \n \t\t\t\t\t\t\t\t """ 5 => """ DJ Anderson \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1242/dev.127.16.3533" "Revista" => array:7 [ "tituloSerie" => "Development" "fecha" => "2000" "volumen" => "127" "numero" => "16" "paginaInicial" => "3533" "paginaFinal" => "3542" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10903178" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib28" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Independent development of pancreatic alpha- and beta-cells from neurogenin3-expressing precursors: a role for the notch pathway in repression of premature differentiation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ J Jensen \n \t\t\t\t\t\t\t\t """ 1 => """ RS Heller \n \t\t\t\t\t\t\t\t """ 2 => """ T Funder-Nielsen \n \t\t\t\t\t\t\t\t """ 3 => """ EE Pedersen \n \t\t\t\t\t\t\t\t """ 4 => """ C Lindsell \n \t\t\t\t\t\t\t\t """ 5 => """ G Weinmaster \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.2337/diabetes.49.2.163" "Revista" => array:7 [ "tituloSerie" => "Diabetes" "fecha" => "2000" "volumen" => "49" "numero" => "2" "paginaInicial" => "163" "paginaFinal" => "176" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10868931" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.2337/diabetes.49.2.163" "WWW" => array:1 [ "link" => "https://doi.org/10.2337/diabetes.49.2.163" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib29" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ G Gu \n \t\t\t\t\t\t\t\t """ 1 => """ J Dubauskaite \n \t\t\t\t\t\t\t\t """ 2 => """ DA Melton \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1242/dev.129.10.2447" "Revista" => array:7 [ "tituloSerie" => "Development" "fecha" => "2002" "volumen" => "129" "numero" => "10" "paginaInicial" => "2447" "paginaFinal" => "2457" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11973276" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib30" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Temporal control of neurogenin3 activity in pancreas progenitors reveals competence windows for the generation of different endocrine cell types" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ KA Johansson \n \t\t\t\t\t\t\t\t """ 1 => """ U Dursun \n \t\t\t\t\t\t\t\t """ 2 => """ N Jordan \n \t\t\t\t\t\t\t\t """ 3 => """ G Gu \n \t\t\t\t\t\t\t\t """ 4 => """ F Beermann \n \t\t\t\t\t\t\t\t """ 5 => """ G Gradwohl \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.devcel.2007.02.010" "Revista" => array:7 [ "tituloSerie" => "Dev Cell" "fecha" => "2007" "volumen" => "12" "numero" => "3" "paginaInicial" => "457" "paginaFinal" => "465" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17336910" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.devcel.2007.02.010" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.devcel.2007.02.010" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib31" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pdxl and its role in activating Ngn3 and Pax6 to induce differentiation of iPSCs into islet β cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ Y Qin \n \t\t\t\t\t\t\t\t """ 1 => """ L Xiao \n \t\t\t\t\t\t\t\t """ 2 => """ XB Zhan \n \t\t\t\t\t\t\t\t """ 3 => """ HX Zhou \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.4238/2015.August.3.12" "Revista" => array:7 [ "tituloSerie" => "Genet Mol Res" "fecha" => "2015" "volumen" => "14" "numero" => "3" "paginaInicial" => "8892" "paginaFinal" => "8900" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26345820" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.4238/2015.August.3.12" "WWW" => array:1 [ "link" => "https://doi.org/10.4238/2015.August.3.12" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib32" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pax4 acts as a key player in pancreas development and plasticity" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ T Napolitano \n \t\t\t\t\t\t\t\t """ 1 => """ F Avolio \n \t\t\t\t\t\t\t\t """ 2 => """ M Courtney \n \t\t\t\t\t\t\t\t """ 3 => """ A Vieira \n \t\t\t\t\t\t\t\t """ 4 => """ N Druelle \n \t\t\t\t\t\t\t\t """ 5 => """ N Ben-Othman \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.semcdb.2015.08.013" "Revista" => array:6 [ "tituloSerie" => "Semin Cell Dev Biol" "fecha" => "2015" "volumen" => "44" "paginaInicial" => "107" "paginaFinal" => "114" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26319183" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.semcdb.2015.08.013" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.semcdb.2015.08.013" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib33" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PAX4 Gene Transfer Induces α-to-β Cell Phenotypic Conversion and Confers Therapeutic Benefits for Diabetes Treatment" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ Y Zhang \n \t\t\t\t\t\t\t\t """ 1 => """ GE Fava \n \t\t\t\t\t\t\t\t """ 2 => """ H Wang \n \t\t\t\t\t\t\t\t """ 3 => """ F Mauvais-Jarvis \n \t\t\t\t\t\t\t\t """ 4 => """ VA Fonseca \n \t\t\t\t\t\t\t\t """ 5 => """ H Wu \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/mt.2015.181" "Revista" => array:7 [ "tituloSerie" => "Mol Ther" "fecha" => "2016" "volumen" => "24" "numero" => "2" "paginaInicial" => "251" "paginaFinal" => "260" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26435408" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/mt.2015.181" "WWW" => array:1 [ "link" => "https://doi.org/10.1038/mt.2015.181" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib34" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Overexpression of PAX4 reduces glucagon expression in differentiating hESCs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ BK Gage \n \t\t\t\t\t\t\t\t """ 1 => """ RK Baker \n \t\t\t\t\t\t\t\t """ 2 => """ TJ Kieffer \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Islets" "fecha" => "2014" "volumen" => "6" "numero" => "2" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "https://doi.org/10.4161/isl.29236" ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib35" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PAX4 promotes PDX1-induced differentiation of mesenchymal stem cells into insulin-secreting cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ L Xu \n \t\t\t\t\t\t\t\t """ 1 => """ C Xu \n \t\t\t\t\t\t\t\t """ 2 => """ S Zhou \n \t\t\t\t\t\t\t\t """ 3 => """ X Liu \n \t\t\t\t\t\t\t\t """ 4 => """ J Wang \n \t\t\t\t\t\t\t\t """ 5 => """ X Liu \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Am J Transl Res" "fecha" => "2017" "volumen" => "9" "numero" => "3" "paginaInicial" => "874" "paginaFinal" => "886" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28386318" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib36" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serum high sensitivity C-reactive protein, nitric oxide metabolites, plasma fibrinogen, and lipid parameters in Indian type 2 diabetic males" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ R Sarangi \n \t\t\t\t\t\t\t\t """ 1 => """ S Padhi \n \t\t\t\t\t\t\t\t """ 2 => """ S Mohapatra \n \t\t\t\t\t\t\t\t """ 3 => """ S Swain \n \t\t\t\t\t\t\t\t """ 4 => """ RK Padhy \n \t\t\t\t\t\t\t\t """ 5 => """ MK Mandal \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.dsx.2012.05.015" "Revista" => array:7 [ "tituloSerie" => "Diabetes Metab Syndr" "fecha" => "2012" "volumen" => "6" "numero" => "1" "paginaInicial" => "9" "paginaFinal" => "14" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23014248" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.dsx.2012.05.015" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.dsx.2012.05.015" ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib37" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of inflammatory cytokines in diabetes and its complications" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => """ GL King \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Periodontol" "fecha" => "2008" "volumen" => "79" "numero" => "8 Suppl" "paginaInicial" => "1527" "paginaFinal" => "1534" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "https://doi.org/10.1902/jop.2008.080246" ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib38" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ H Xu \n \t\t\t\t\t\t\t\t """ 1 => """ GT Barnes \n \t\t\t\t\t\t\t\t """ 2 => """ Q Yang \n \t\t\t\t\t\t\t\t """ 3 => """ G Tan \n \t\t\t\t\t\t\t\t """ 4 => """ D Yang \n \t\t\t\t\t\t\t\t """ 5 => """ CJ Chou \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1172/JCI19451" "Revista" => array:7 [ "tituloSerie" => "J Clin Invest" "fecha" => "2003" "volumen" => "112" "numero" => "12" "paginaInicial" => "1821" "paginaFinal" => "1830" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14679177" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1172/JCI19451" "WWW" => array:1 [ "link" => "https://doi.org/10.1172/JCI200319451" ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib39" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular mechanisms of tumor necrosis factor alpha gene expression in monocytic cells via hyperglycemia-induced oxidant stress-dependent and -independent pathways" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ M Guha \n \t\t\t\t\t\t\t\t """ 1 => """ W Bai \n \t\t\t\t\t\t\t\t """ 2 => """ JL Nadler \n \t\t\t\t\t\t\t\t """ 3 => """ R Natarajan \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1074/jbc.275.23.17728" "Revista" => array:7 [ "tituloSerie" => "J Biol Chem" "fecha" => "2000" "volumen" => "275" "numero" => "23" "paginaInicial" => "17728" "paginaFinal" => "17739" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10837498" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1074/jbc.275.23.17728" "WWW" => array:1 [ "link" => "https://doi.org/10.1074/jbc.275.23.17728" ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib40" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Glucose-dependent interleukin 6 and tumor necrosis factor production by human peripheral blood monocytes in vitro" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ M Morohoshi \n \t\t\t\t\t\t\t\t """ 1 => """ K Fujisawa \n \t\t\t\t\t\t\t\t """ 2 => """ I Uchimura \n \t\t\t\t\t\t\t\t """ 3 => """ F Numano \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.2337/diab.45.7.954" "Revista" => array:7 [ "tituloSerie" => "Diabetes" "fecha" => "1996" "volumen" => "45" "numero" => "7" "paginaInicial" => "954" "paginaFinal" => "959" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8666148" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.2337/diab.45.7.954" "WWW" => array:1 [ "link" => "https://doi.org/10.2337/diab.45.7.954" ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib41" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Proinflammatory cytokines Il-6 and TNF-α and the development of inflammation in obese subjects" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ K Popko \n \t\t\t\t\t\t\t\t """ 1 => """ E Gorska \n \t\t\t\t\t\t\t\t """ 2 => """ A Stelmaszczyk-Emmel \n \t\t\t\t\t\t\t\t """ 3 => """ R Plywaczewski \n \t\t\t\t\t\t\t\t """ 4 => """ A Stoklosa \n \t\t\t\t\t\t\t\t """ 5 => """ D Gorecka \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1186/2047-783x-15-s2-120" "Revista" => array:7 [ "tituloSerie" => "Eur J Med Res" "fecha" => "2010" "volumen" => "15" "numero" => "Suppl 2" "paginaInicial" => "120" "paginaFinal" => "122" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21147638" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1186/2047-783x-15-s2-120" "WWW" => array:1 [ "link" => "https://doi.org/10.1186/2047-783X-15-S2-120" ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib42" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Macrophage-mediated inflammation in metabolic disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ A Chawla \n \t\t\t\t\t\t\t\t """ 1 => """ KD Nguyen \n \t\t\t\t\t\t\t\t """ 2 => """ YP Goh \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/nri3071" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Immunol" "fecha" => "2011" "volumen" => "11" "numero" => "11" "paginaInicial" => "738" "paginaFinal" => "749" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21984069" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/nri3071" "WWW" => array:1 [ "link" => "https://doi.org/10.1038/nri3071" ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib43" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ PD Cani \n \t\t\t\t\t\t\t\t """ 1 => """ R Bibiloni \n \t\t\t\t\t\t\t\t """ 2 => """ C Knauf \n \t\t\t\t\t\t\t\t """ 3 => """ A Waget \n \t\t\t\t\t\t\t\t """ 4 => """ AM Neyrinck \n \t\t\t\t\t\t\t\t """ 5 => """ NM Delzenne \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.2337/db07-1403" "Revista" => array:7 [ "tituloSerie" => "Diabetes" "fecha" => "2008" "volumen" => "57" "numero" => "6" "paginaInicial" => "1470" "paginaFinal" => "1481" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18305141" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.2337/db07-1403" "WWW" => array:1 [ "link" => "https://doi.org/10.2337/db07-1403" ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib44" "etiqueta" => "44" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Macrophages, inflammation, and insulin resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ JM Olefsky \n \t\t\t\t\t\t\t\t """ 1 => """ CK Glass \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1146/annurev-physiol-021909-135846" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Physiol" "fecha" => "2010" "volumen" => "72" "paginaInicial" => "219" "paginaFinal" => "246" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20148674" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1146/annurev-physiol-021909-135846" "WWW" => array:1 [ "link" => "https://doi.org/10.1146/annurev-physiol-021909-135846" ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib45" "etiqueta" => "45" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Conditioned Media From Adipose Tissue Derived Mesenchymal Stem Cells Reverse Insulin Resistance in Cellular Models" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ N Shree \n \t\t\t\t\t\t\t\t """ 1 => """ RR Bhonde \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/jcb.25777" "Revista" => array:7 [ "tituloSerie" => "J Cell Biochem" "fecha" => "2017" "volumen" => "118" "numero" => "8" "paginaInicial" => "2037" "paginaFinal" => "2043" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27791278" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/jcb.25777" "WWW" => array:1 [ "link" => "https://doi.org/10.1002/jcb.25777" ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib46" "etiqueta" => "46" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumour necrosis factor-alpha infusion produced insulin resistance but no change in the incretin effect in healthy volunteers" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ ST Nielsen \n \t\t\t\t\t\t\t\t """ 1 => """ L Lehrskov-Schmidt \n \t\t\t\t\t\t\t\t """ 2 => """ R Krogh-Madsen \n \t\t\t\t\t\t\t\t """ 3 => """ TP Solomon \n \t\t\t\t\t\t\t\t """ 4 => """ L Lehrskov-Schmidt \n \t\t\t\t\t\t\t\t """ 5 => """ JJ Holst \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/dmrr.2441" "Revista" => array:7 [ "tituloSerie" => "Diabetes Metab Res Rev" "fecha" => "2013" "volumen" => "29" "numero" => "8" "paginaInicial" => "655" "paginaFinal" => "663" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23904405" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/dmrr.2441" "WWW" => array:1 [ "link" => "https://doi.org/10.1002/dmrr.2441" ] ] ] ] ] ] 46 => array:3 [ "identificador" => "bib47" "etiqueta" => "47" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "18F-FDG labeling of mesenchymal stem cells and multipotent adult progenitor cells for PET imaging: effects on ultrastructure and differentiation capacity" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ E Wolfs \n \t\t\t\t\t\t\t\t """ 1 => """ T Struys \n \t\t\t\t\t\t\t\t """ 2 => """ T Notelaers \n \t\t\t\t\t\t\t\t """ 3 => """ SJ Roberts \n \t\t\t\t\t\t\t\t """ 4 => """ A Sohni \n \t\t\t\t\t\t\t\t """ 5 => """ G Bormans \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.2967/jnumed.112.108316" "Revista" => array:7 [ "tituloSerie" => "J Nucl Med" "fecha" => "2013" "volumen" => "54" "numero" => "3" "paginaInicial" => "447" "paginaFinal" => "454" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23353687" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.2967/jnumed.112.108316" "WWW" => array:1 [ "link" => "https://doi.org/10.2967/jnumed.112.108316" ] ] ] ] ] ] 47 => array:3 [ "identificador" => "bib48" "etiqueta" => "48" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biodistribution of 18F-FDG-Labeled Autologous Bone Marrow-Derived Stem Cells in Patients With Type 2 Diabetes Mellitus: Exploring Targeted and Intravenous Routes of Delivery" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ V Sood \n \t\t\t\t\t\t\t\t """ 1 => """ BR Mittal \n \t\t\t\t\t\t\t\t """ 2 => """ A Bhansali \n \t\t\t\t\t\t\t\t """ 3 => """ B Singh \n \t\t\t\t\t\t\t\t """ 4 => """ N Khandelwal \n \t\t\t\t\t\t\t\t """ 5 => """ N Marwaha \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1097/RLU.0000000000000850" "Revista" => array:7 [ "tituloSerie" => "Clin Nucl Med" "fecha" => "2015" "volumen" => "40" "numero" => "9" "paginaInicial" => "697" "paginaFinal" => "700" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26164170" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1097/RLU.0000000000000850" "WWW" => array:1 [ "link" => "https://doi.org/10.1097/RLU.0000000000000850" ] ] ] ] ] ] 48 => array:3 [ "identificador" => "bib49" "etiqueta" => "49" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Intravenous Administration of Bone Marrow-Derived Mesenchymal Stem Cell, but not Adipose Tissue-Derived Stem Cell, Ameliorated the Neonatal Hypoxic-Ischemic Brain Injury by Changing Cerebral Inflammatory State in Rat" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ Y Sugiyama \n \t\t\t\t\t\t\t\t """ 1 => """ Y Sato \n \t\t\t\t\t\t\t\t """ 2 => """ Y Kitase \n \t\t\t\t\t\t\t\t """ 3 => """ T Suzuki \n \t\t\t\t\t\t\t\t """ 4 => """ T Kondo \n \t\t\t\t\t\t\t\t """ 5 => """ A Mikrogeorgiou \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.3389/fneur.2018.00757" "Revista" => array:5 [ "tituloSerie" => "Front Neurol" "fecha" => "2018" "volumen" => "9" "paginaInicial" => "757" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30254603" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.3389/fneur.2018.00757" "WWW" => array:1 [ "link" => "https://doi.org/10.3389/fneur.2018.00757" ] ] ] ] ] ] 49 => array:3 [ "identificador" => "bib50" "etiqueta" => "50" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effect of mesenchymal stem cells transplantation on glycaemic profile & their localization in streptozotocin induced diabetic Wistar rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ S Bhansali \n \t\t\t\t\t\t\t\t """ 1 => """ V Kumar \n \t\t\t\t\t\t\t\t """ 2 => """ UN Saikia \n \t\t\t\t\t\t\t\t """ 3 => """ B Medhi \n \t\t\t\t\t\t\t\t """ 4 => """ V Jha \n \t\t\t\t\t\t\t\t """ 5 => """ A Bhansali \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.4103/0971-5916.162116" "Revista" => array:7 [ "tituloSerie" => "Indian J Med Res" "fecha" => "2015" "volumen" => "142" "numero" => "1" "paginaInicial" => "63" "paginaFinal" => "71" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26261168" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.4103/0971-5916.162116" "WWW" => array:1 [ "link" => "https://doi.org/10.4103/0971-5916.162116" ] ] ] ] ] ] 50 => array:3 [ "identificador" => "bib51" "etiqueta" => "51" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Autologous bone marrow mononuclear cell infusion and hyperbaric oxygen therapy in type 2 diabetes mellitus: an open-label, randomized controlled clinical trial" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ Z Wu \n \t\t\t\t\t\t\t\t """ 1 => """ J Cai \n \t\t\t\t\t\t\t\t """ 2 => """ J Chen \n \t\t\t\t\t\t\t\t """ 3 => """ L Huang \n \t\t\t\t\t\t\t\t """ 4 => """ W Wu \n \t\t\t\t\t\t\t\t """ 5 => """ F Luo \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.jcyt.2013.10.004" "Revista" => array:7 [ "tituloSerie" => "Cytotherapy" "fecha" => "2014" "volumen" => "16" "numero" => "2" "paginaInicial" => "258" "paginaFinal" => "265" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24290656" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.jcyt.2013.10.004" "WWW" => array:1 [ "link" => "https://doi.org/10.1016/j.jcyt.2013.10.004" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack638096" "titulo" => "ACKNOWLEDGMENTS" "texto" => "<p id="para410" class="elsevierStylePara elsevierViewall">We thank Qingle Liu for the technical assistance with HBO, Shunmin Zhang and Canrong Ni for the technical assistance with histopathology, and Jiaqi Wang for the technical assistance with PCR. This research was supported by the National Natural Science Funds of China (81471038, 81272665).</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/18075932/000000750000000C/v1_202211290815/S1807593222003283/v1_202211290815/en/main.assets" "Apartado" => null "PDF" => "https://static.elsevier.es/multimedia/18075932/000000750000000C/v1_202211290815/S1807593222003283/v1_202211290815/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222003283?idApp=UINPBA00004N" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 October | 35 | 14 | 49 |
2024 September | 49 | 15 | 64 |
2024 August | 50 | 23 | 73 |
2024 July | 53 | 14 | 67 |
2024 June | 44 | 15 | 59 |
2024 May | 95 | 14 | 109 |
2024 April | 29 | 12 | 41 |
2024 March | 23 | 16 | 39 |
2024 February | 20 | 18 | 38 |
2024 January | 14 | 20 | 34 |
2023 December | 13 | 23 | 36 |
2023 November | 17 | 21 | 38 |
2023 October | 20 | 33 | 53 |
2023 September | 12 | 25 | 37 |
2023 August | 16 | 8 | 24 |
2023 July | 12 | 16 | 28 |
2023 June | 7 | 9 | 16 |
2023 May | 2 | 2 | 4 |
2023 April | 3 | 1 | 4 |
2023 March | 4 | 3 | 7 |
2023 February | 1 | 1 | 2 |
2023 January | 2 | 0 | 2 |
2022 December | 28 | 4 | 32 |
2022 November | 1 | 0 | 1 |