Serum from patients with ankylosing spondylitis can increase PPARD, fra-1, MMP7, OPG and RANKL expression in MG63 cells

array:24 ["pii" => "S1807593222013175" "issn" => "18075932" "doi" => "10.6061/clinics/2015(11)04" "estado" => "S300" "fechaPublicacion" => "2015-11-01" "aid" => "1317" "copyright" => "CLINICS" "copyrightAnyo" => "2015" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:738-42" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1807593222013187" "issn" => "18075932" "doi" => "10.6061/clinics/2015(11)05" "estado" => "S300" "fechaPublicacion" => "2015-11-01" "aid" => "1318" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:743-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "CLINICAL SCIENCE" "titulo" => "Baropodometric analyses of patients before and after bariatric surgery" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "743" "paginaFinal" => "747" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 398 "Ancho" => 650 "Tamanyo" => 48778 ] ] "descripcion" => array:1 [ "en" => "FSCAN system version 3848, which measures the peak values for pressure and the ground reaction force for the rear foot and forefoot, the double-support time, and the foot contact area." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ivan Leo Bacha, Fernanda Antico Benetti, Júlia Maria D'Andréa Greve" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Ivan Leo" "apellidos" => "Bacha" ] 1 => array:2 [ "nombre" => "Fernanda Antico" "apellidos" => "Benetti" ] 2 => array:2 [ "nombre" => "Júlia Maria D'Andréa" "apellidos" => "Greve" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013187?idApp=UINPBA00004N" "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013187/v1_202212011342/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1807593222013163" "issn" => "18075932" "doi" => "10.6061/clinics/2015(11)03" "estado" => "S300" "fechaPublicacion" => "2015-11-01" "aid" => "1316" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by/4.0/" "subdocumento" => "fla" "cita" => "Clinics. 2015;70:733-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "CLINICAL SCIENCE" "titulo" => "Can mastalgia be another somatic symptom in fibromyalgia syndrome?" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "733" "paginaFinal" => "737" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 272 "Ancho" => 792 "Tamanyo" => 23036 ] ] "descripcion" => array:1 [ "en" => "The number of patients diagnosed with fibromyalgia syndrome in the mastalgia group (A) and the number of patients with mastalgia in the FMS group (B)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Meral Sen, Murat Ozgur Kilic, Ozlem Cemeroglu, Duygu Icen" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Meral" "apellidos" => "Sen" ] 1 => array:2 [ "nombre" => "Murat Ozgur" "apellidos" => "Kilic" ] 2 => array:2 [ "nombre" => "Ozlem" "apellidos" => "Cemeroglu" ] 3 => array:2 [ "nombre" => "Duygu" "apellidos" => "Icen" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013163?idApp=UINPBA00004N" "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013163/v1_202212011342/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "CLINICAL SCIENCE" "titulo" => "Serum from patients with ankylosing spondylitis can increase PPARD, fra-1, MMP7, OPG and RANKL expression in MG63 cells" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "738" "paginaFinal" => "742" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Zaiying Hu, Dongfang Lin, Jun Qi, Minli Qiu, Qing Lv, Qiuxia Li, Zhiming Lin, Zetao Liao, Yunfeng Pan, Ou Jin, Yuqiong Wu, Jieruo Gu" "autores" => array:12 [ 0 => array:2 [ "nombre" => "Zaiying" "apellidos" => "Hu" ] 1 => array:2 [ "nombre" => "Dongfang" "apellidos" => "Lin" ] 2 => array:2 [ "nombre" => "Jun" "apellidos" => "Qi" ] 3 => array:2 [ "nombre" => "Minli" "apellidos" => "Qiu" ] 4 => array:2 [ "nombre" => "Qing" "apellidos" => "Lv" ] 5 => array:2 [ "nombre" => "Qiuxia" "apellidos" => "Li" ] 6 => array:2 [ "nombre" => "Zhiming" "apellidos" => "Lin" ] 7 => array:2 [ "nombre" => "Zetao" "apellidos" => "Liao" ] 8 => array:2 [ "nombre" => "Yunfeng" "apellidos" => "Pan" ] 9 => array:2 [ "nombre" => "Ou" "apellidos" => "Jin" ] 10 => array:2 [ "nombre" => "Yuqiong" "apellidos" => "Wu" ] 11 => array:4 [ "nombre" => "Jieruo" "apellidos" => "Gu" "email" => array:1 [ 0 => "gujieruo@163.com" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "The Third Affiliated Hospital of Sun Yat-Sen University, Department of Rheumatology, Guangzhou, China" "identificador" => "aff1" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Corresponding author:" ] ] ] ] "textoCompleto" => "INTRODUCTIONAnkylosing spondylitis (AS) is a chronic inflammatory disease characterized by new bone formation that progressively leads to ankylosis and functional disability. The inflammatory phase of AS shares similarities with other types of inflammatory arthritis such as rheumatoid arthritis (RA), with high levels of pro-inflammatory cytokine production and osteoclast activity and damage to the cortical bone of joints <a class="elsevierStyleCrossRef" href="#bib1">1</a>. However, after the inflammation subsides, excessive ossification occurs at the site of initial erosion. Inflammation is often viewed as the inciting cause of ossification <a class="elsevierStyleCrossRef" href="#bib2">2</a>,<a class="elsevierStyleCrossRef" href="#bib3">3</a>. Controlling the inflammatory process, however, does not appear to prevent the development of ossifications in AS <a class="elsevierStyleCrossRef" href="#bib4">4</a>. How inflammation is initiated and how it progresses to bone formation and eventual ankylosis are poorly understood.The Wnt signaling pathway plays critical roles in homeostasis and bone health in adults. It is involved in osteoblastogenesis and is regulated in part by inflammation <a class="elsevierStyleCrossRefs" href="#bib5">5–7</a>. Many studies have suggested a role for the Wnt pathway in the process of new bone formation in AS, as it can provide a linkage between inflammation and ossification <a class="elsevierStyleCrossRefs" href="#bib8">8–12</a>. In the canonical Wnt pathway, the interaction of Wnt proteins with their receptors leads to increased β-catenin levels and eventually to the expression of downstream genes <a class="elsevierStyleCrossRef" href="#bib8">8</a>. Serum from AS patients can increase β-catenin expression and these circulating bone formation-inducing β-catenin molecules are functionally prevalent in AS patients <a class="elsevierStyleCrossRef" href="#bib8">8</a>. However, whether the downstream genes of the canonical Wnt pathway can also be increased by serum from AS patients has not yet been reported.Downstream targets of the canonical Wnt pathway include c-myc, c-jun, cycD, PPARD, fra-1 and MMP7. C-myc functions as a transcription factor that is associated with a variety of hematopoietic tumors <a class="elsevierStyleCrossRef" href="#bib13">13</a>, c-jun is involved in human malignancies <a class="elsevierStyleCrossRef" href="#bib14">14</a> and cycD is another tumor-related gene <a class="elsevierStyleCrossRef" href="#bib15">15</a>. PPARD, which influences chondrocyte cell growth and differentiation <a class="elsevierStyleCrossRef" href="#bib16">16</a>, may affect height in adults through effects on osteoclast function <a class="elsevierStyleCrossRef" href="#bib17">17</a>. Fra-1 plays important roles in osteoblast differentiation and bone formation that might be important for the osteogenic differentiation stimulated by Wnt/β-catenin signaling <a class="elsevierStyleCrossRef" href="#bib18">18</a> and MMP7 is involved in the breakdown of the extracellular matrix in normal physiological processes, as well as in disease states such as arthritis and metastasis <a class="elsevierStyleCrossRef" href="#bib19">19</a>. Because c-myc, c-jun and cycD are more related to tumors, whereas PPARD, fra-1 and MMP7 are considered in many studies to be involved in bone metabolism, we chose PPARD, fra-1 and MMP7 as the target genes to be detected.Osteoprotegerin (OPG) is a protein secreted by osteoblasts that protects the skeleton from bone resorption via binding to receptor activator of NF-κB ligand (RANKL) <a class="elsevierStyleCrossRef" href="#bib20">20</a>. Wnt pathway activation can increase OPG expression <a class="elsevierStyleCrossRef" href="#bib21">21</a>. Whether serum from AS patients can affect OPG and RANKL expression and have an osteogenic effect through Wnt pathway regulation has not yet been reported.In this study, we attempted to explore the effects of serum from AS patients on the canonical Wnt/β-catenin pathway by measuring the expression of its downstream target genes in human osteoblast-like MG63 cells. We also attempted to detect OPG and RANKL expression to assess whether AS serum has an osteogenic effect in MG63 cells.MATERIALS AND METHODSPatientsWe recruited 45 patients who fulfilled the modified New York classification criteria for AS <a class="elsevierStyleCrossRef" href="#bib22">22</a>, 45 age- and sex-matched healthy subjects and 30 patients who met the American College of Rheumatology 1987 revised criteria for RA <a class="elsevierStyleCrossRef" href="#bib23">23</a>. The healthy controls were defined by the Nordic questionnaire <a class="elsevierStyleCrossRef" href="#bib24">24</a>. All patients were Chinese and were recruited from outpatient clinics at the Department of Rheumatology of the 3rd Affiliated Hospital of Sun Yat-sen University. The study was approved by the local ethics committee and all participants gave written informed consent, in accordance with the Declaration of Helsinki.Disease activity assessment was performed using the Bath AS Disease Activity Index (BASDAI) and the Bath AS Function Index (BASFI) in AS patients <a class="elsevierStyleCrossRef" href="#bib25">25</a>,<a class="elsevierStyleCrossRef" href="#bib26">26</a>. Markers of inflammation (erythrocyte sedimentation rate [ESR] and C-reactive protein [CRP] levels) were measured in AS and RA patients. Serum samples were obtained from all participants and were stored in aliquots of 250 µl at -20°C. To avoid freeze-thawing, each experiment was performed with a different aliquot.Cell cultureHuman MG63 osteoblasts obtained from the American Type Culture Collection (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin in 6-well plates at a concentration of 2×105/ml and were incubated in a humidified atmosphere of 5% CO2 at 37°C for 24 hours. After washing with phosphate-buffered saline (PBS), 250 µl of serum from either AS or RA patients or from normal subjects was added into each well and the cells were cultured with DMEM but without FBS for another 48 hours.Quantitative real-time PCRAfter a total incubation period of 3 days <a class="elsevierStyleCrossRef" href="#bib27">27</a>, PPARD, fra-1, MMP7, OPG and RANKL expression in MG63 cells was measured. Total RNA was isolated using TRIzol reagent (Invitrogen) and 1 µg of total RNA was converted to cDNA using the PrimeScriptTM RT reagent kit (TaKaRa). Real-time PCR reactions were performed using SYBR Premix ExTM Taq II (TaKaRa) on an ABI PRISM 7000 Sequence Detection System (Applied Biosystems). The primers used are listed in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>. The following cycling program was used: 15 min preincubation at 95°C, 10 s denaturation at 95°C and 31 s annealing at 60°C for 40 cycles. To confirm the amplification specificity, the PCR products from each primer pair were subjected to melting curve analysis. Each reaction was amplified in triplicate and the threshold cycle (Ct) was calculated using the 2−ΔΔCt method. Relative gene expression was normalized to GAPDH, used as an internal reference.<elsevierMultimedia ident="tbl1"></elsevierMultimedia>Statistical analysisStatistical analysis was performed using SPSS software. Variables were tested for normality by applying the Kolmogorov-Smirnov test. Data are presented as the mean ± standard deviation (SD) or as percentages, as appropriate. Correlations between gene expression and other variables were analyzed using Pearson's or Spearman's test, as appropriate. One-way analysis of variance (ANOVA) and t-tests were used for group comparisons. P values less than 0.05 (2-tailed) were considered significant.RESULTSCharacteristics of the study subjectsThe demographic and disease characteristics of the study subjects are shown in <a class="elsevierStyleCrossRef" href="#tbl2">Table 2</a>. No significant differences were found for sex and age between AS patients and healthy controls (both p>0.05). RA patients were older than AS patients and had shorter symptom durations (both p<0.05).<elsevierMultimedia ident="tbl2"></elsevierMultimedia>Gene expression detected by quantitative real-time PCRThe relative PPARD, fra-1, MMP7, OPG and RANKL mRNA levels are listed in <a class="elsevierStyleCrossRef" href="#tbl3">Table 3</a>. The corresponding p-values for comparisons among the gene expressions in AS, RA and control serum-treated MG63 cells are listed in <a class="elsevierStyleCrossRef" href="#tbl4">Table 4</a>. When MG63 cells were cultured with AS serum, PPARD, fra-1, MMP7 and OPG expression was significantly higher than in cells treated with serum from RA patients or healthy controls (all p<0.05). No significant differences were found for PPARD, fra-1, MMP7 and OPG expression in MG63 cells treated with serum from RA patients and those treated with serum from healthy controls (all p>0.05). In cells cultured with AS or RA patient serum, RANKL expression was higher than that in cells cultured with healthy control serum (both p<0.05); however, the difference in RANKL expression in cells treated with AS and RA patient serum was not significant (p>0.05). The OPG/RANKL ratio was also higher in AS serum-treated cells (p<0.05), but no significant difference was found for that of RA-treated cells (p>0.05) compared to control serum-treated cells.<elsevierMultimedia ident="tbl3"></elsevierMultimedia><elsevierMultimedia ident="tbl4"></elsevierMultimedia>Associations between gene expression and patient demographics and clinical assessmentsThe correlation coefficient (r value) and the corresponding p-value between the gene expression in AS-serum treated MG63 cells and patient demographics and clinical assessments are listed in <a class="elsevierStyleCrossRef" href="#tbl5">Table 5</a>. In AS patients, no associations were found between PPARD, fra-1, MMP7, OPG and RANKL expression and patient demographics and clinical assessments (all p>0.05).<elsevierMultimedia ident="tbl5"></elsevierMultimedia>DISCUSSIONIn this study, we measured the effects of serum from AS patients on human osteoblast-like MG63 cells by detecting the mRNA expression of downstream target genes of the canonical Wnt/β-catenin pathway. PPARD, fra-1, MMP7, OPG and RANKL expression and the OPG/RANKL ratio were significantly higher in AS serum-treated cells than in cells treated with serum from RA patients or healthy controls. We also found that such effects of AS patient serum were not correlated with age, symptom duration, the BASDAI, the BASFI, CRP levels or the ESR.Previous studies have reported that AS serum-treated Jurkat T cells had higher active β-catenin levels compared with control serum-treated cells <a class="elsevierStyleCrossRef" href="#bib8">8</a>. Jurkat T cells are human peripheral blood leukemia T cells that have been widely used to explore the Wnt pathway in leukemia <a class="elsevierStyleCrossRef" href="#bib28">28</a>. MG63 cells, established as an osteoblastic cell line from a human osteosarcoma, are frequently used to study the mechanism of bone metabolism. Many studies have adopted MG63 cells as a model to investigate the Wnt pathway <a class="elsevierStyleCrossRef" href="#bib27">27</a>,<a class="elsevierStyleCrossRef" href="#bib29">29</a>. The use of MG63 cells may be advantageous over Jurkat T cells for researching the role of the Wnt pathway in bone formation, as MG63 cells have more osteoblast-like characteristics; thus, the use of MG63 cells in this study makes our results more convincing.The Wnt pathway is critically important for normal bone homeostasis, as the aberrant regulation of bone homeostasis has been suggested as a key element in the pathogenesis of AS <a class="elsevierStyleCrossRef" href="#bib8">8</a>,<a class="elsevierStyleCrossRef" href="#bib9">9</a>. Dickkopf-1 (DKK-1) and sclerostin are the main inhibitory molecules that regulate the canonical Wnt pathway. The blockade of DKK-1 was shown to lead to the fusion of sacroiliac joints in an animal model of arthritis <a class="elsevierStyleCrossRef" href="#bib10">10</a>. Altered skeletal expression of sclerostin has also been linked to radiographic progression in AS <a class="elsevierStyleCrossRef" href="#bib11">11</a>. A number of studies have evaluated serum Dkk-1 and sclerostin levels in AS patients, but conflicting data have been reported <a class="elsevierStyleCrossRef" href="#bib12">12</a>,. The net effect of AS serum on the canonical Wnt pathway (suppression or promotion) remains inconsistent. Rather than focusing on the circulating concentrations of stimulatory or inhibitory molecules of the Wnt pathway in this study, we evaluated the effect of AS serum by measuring the expression of downstream genes of the Wnt pathway. We found that PPARD, fra-1 and MMP7 gene expression was increased in AS serum-treated MG63 cells. This finding supports the notion that the canonical Wnt pathway can be activated by serum from AS patients.OPG and RANKL are important molecules in maintaining the balance of bone metabolism. The OPG/RANKL ratio increases during the differentiation of pre-osteoblastic cells into mature osteoblasts <a class="elsevierStyleCrossRef" href="#bib20">20</a>. Our results demonstrated that AS patient serum can increase OPG and RANKL expression and increase the OPG/RANKL ratio, which may eventually contribute to the formation of new bone. These effects may also be related to canonical Wnt pathway activation.According to our data, PPARD, fra-1, MMP7, OPG and RANKL expression were not correlated with the BASDAI, the BASFI, CRP levels or the ESR in AS patients. The effects of inflammation on pathophysiological bone formation in AS remain contradictory. Despite significant clinical improvement, cytokine blocking strategies do not overcome new bone formation in AS, suggesting that the molecular processes eliciting syndesmophyte formation may differ from those of inflammation <a class="elsevierStyleCrossRef" href="#bib4">4</a>. In this study, the lack of correlation between the expression of downstream genes of the Wnt pathway and clinical assessments indicated that bone responses may not be tightly linked to inflammation in AS patients.In conclusion, serum from AS patients can increase PPARD, fra-1, MMP7, OPG and RANKL expression and the OPG/RANKL ratio in MG63 cells. These effects may be due to the stimulatory effects of AS serum on the Wnt pathway." "textoCompletoSecciones" => array:1 [ "secciones" => array:7 [ 0 => array:2 [ "identificador" => "xpalclavsec1582239" "titulo" => "KEYWORDS" ] 1 => array:2 [ "identificador" => "cesec10" "titulo" => "INTRODUCTION" ] 2 => array:3 [ "identificador" => "cesec20" "titulo" => "MATERIALS AND METHODS" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "cesec30" "titulo" => "Patients" ] 1 => array:2 [ "identificador" => "cesec40" "titulo" => "Cell culture" ] 2 => array:2 [ "identificador" => "cesec50" "titulo" => "Quantitative real-time PCR" ] 3 => array:2 [ "identificador" => "cesec60" "titulo" => "Statistical analysis" ] ] ] 3 => array:3 [ "identificador" => "cesec70" "titulo" => "RESULTS" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "cesec80" "titulo" => "Characteristics of the study subjects" ] 1 => array:2 [ "identificador" => "cesec90" "titulo" => "Gene expression detected by quantitative real-time PCR" ] 2 => array:2 [ "identificador" => "cesec100" "titulo" => "Associations between gene expression and patient demographics and clinical assessments" ] ] ] 4 => array:2 [ "identificador" => "cesec110" "titulo" => "DISCUSSION" ] 5 => array:2 [ "identificador" => "xack639247" "titulo" => "ACKNOWLEDGMENTS" ] 6 => array:1 [ "titulo" => "REFERENCES" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2015-04-24" "fechaAceptado" => "2015-08-19" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "KEYWORDS" "identificador" => "xpalclavsec1582239" "palabras" => array:3 [ 0 => "Ankylosing Spondylitis" 1 => "Wnt Pathway" 2 => "Gene Expression" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "resumen" => "OBJECTIVES:To explore the effects of serum from patients with ankylosing spondylitis on the canonical Wnt/β-catenin pathway and to assess whether the serum has an osteogenic effect in MG63 cells. METHODS:MG63 cells were cultured with serum from 45 ankylosing spondylitis patients, 30 healthy controls, or 45 rheumatoid arthritis patients. The relative PPARD, fra-1, MMP7, OPG and RANKL mRNA levels were measured using quantitative real-time polymerase chain reaction. Associations between gene expression and patient demographics and clinical assessments were then analyzed. RESULTS:MG63 cells treated with serum from ankylosing spondylitis patients had higher PPARD, fra-1, MMP7 and OPG gene expression than did cells treated with serum from controls or rheumatoid arthritis patients (all p<0.05). RANKL expression was higher in MG63 cells treated with serum from patients with ankylosing spondylitis or rheumatoid arthritis than in those treated with serum from controls (both p<0.05). The OPG/RANKL ratio was also higher in MG63 cells treated with serum from ankylosing spondylitis patients than in those treated with serum from controls (p<0.05). No associations were found between the expression of the five genes and the patient demographics and clinical assessments (all p>0.05). CONCLUSIONS: Serum from ankylosing spondylitis patients increases PPARD, fra-1, MMP7, OPG and RANKL expression and the OPG/RANKL ratio in MG63 cells; these effects may be due to the stimulatory effect of the serum on the Wnt pathway." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "ceabs10" "titulo" => "OBJECTIVES:" ] 1 => array:2 [ "identificador" => "ceabs20" "titulo" => "METHODS:" ] 2 => array:2 [ "identificador" => "ceabs30" "titulo" => "RESULTS:" ] 3 => array:2 [ "identificador" => "ceabs40" "titulo" => "CONCLUSIONS" ] ] ] ] "NotaPie" => array:1 [ 0 => array:1 [ "nota" => "No potential conflict of interest was reported." ] ] "multimedia" => array:5 [ 0 => array:7 [ "identificador" => "tbl1" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Forward primer sequence (5‘-3‘) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Reverse primer sequence (5‘-3‘) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">PPARD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CTACGGTGTTCATGCATGTGAGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">GCACTTCTGGAAGCGGCAGTA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">fra-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">GGAGGAAGGAACTGACCGACTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CTAGGCGCTCCTTCTGCTTCTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">MMP7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">GCATGAGTGAGCTACAGTGGGAAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CCACATCTGGGCTTCTGCATTA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">OPG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">TGGCACCAAAGTAAACGCAGAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CTCGAAGGTGAGGTTAGCATGTC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">RANKL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">AAGATGGCACTCACTGCATTTATAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">TGATGTGCTGTGATCCAACGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">GAPDH \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">GCACCGTCAAGGCTGAGAAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">TGGTGAAGACGCCAGTGGA \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Primers used in real-time PCR." ] ] 1 => array:7 [ "identificador" => "tbl2" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "Values are the mean ± standard deviation, unless otherwise stated. AS = ankylosing spondylitis; RA = rheumatoid arthritis; HLA-B27 = human leukocyte antigen B27; BASDAI = Bath Ankylosing Spondylitis Disease Activity Index; BASFI = Bath Ankylosing Spondylitis Functional Index; CRP = C-reactive protein (reference range <6 mg/L); ESR = erythrocyte sedimentation rate (reference range male <15 mm/h, female <20 mm/h); NA = not applicable." "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="middle" scope="col"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">AS patients \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">RA patients \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Healthy controls \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">Male:female (% male) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">39:6 (86.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">5:25 (16.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">39:6 (86.7) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">28.8 ± 8.9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">45.1 ± 12.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">28.9 ± 8.6 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">Symptom duration (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">5.2 ± 4.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">3.8 ± 5.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">HLA-B27 positive (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">42 (93.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">BASDAI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">3.7 ± 4.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">BASFI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">2.8 ± 3.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CRP (mg/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">21.3 ± 23.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">18.3 ± 22.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">ESR (mm/h) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">24.2 ± 20.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">27.2 ± 19.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="center" valign="middle">NA \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Demographic and clinical characteristics of the study subjects." ] ] 2 => array:7 [ "identificador" => "tbl3" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "Values are the mean ± standard deviation. AS = ankylosing spondylitis; RA = rheumatoid arthritis." "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="3" align="center" valign="middle" scope="col">Serum of subjects</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="middle" scope="col">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">AS patients \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">RA patients \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Healthy controls \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">PPARD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.36 ± 0.98 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.07 ± 0.67 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.00 ± 0.58 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">fra-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.16 ± 0.36 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.88 ± 0.34 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.00 ± 0.38 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">MMP7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.89 ± 0.69 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.20 ± 0.95 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.00 ± 0.64 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">OPG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.75 ± 1.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.15 ± 0.49 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.00 ± 0.54 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">RANKL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.49 ± 1.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.42 ± 0.91 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">1.00 ± 0.51 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Relative PPARD, fra-1, MMP7, OPG and RANKL mRNA levels in MG63 cells cultured with serum from the study subjects." ] ] 3 => array:7 [ "identificador" => "tbl4" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "AS = ankylosing spondylitis; RA = rheumatoid arthritis." "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="3" align="center" valign="middle" scope="col">Comparisons between sera of different subjects</th></tr><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">AS vs. control \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">AS vs. RA \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">RA vs. control \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">PPARD \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.035 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.028 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.234 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">fra-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.043 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.118 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">MMP7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.028 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.279 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">OPG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.002 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.315 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">RANKL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.003 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.917 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.004 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "P values for comparisons of gene expression among the ankylosing, rheumatoid arthritis and control serum-treated MG63 cells." ] ] 4 => array:7 [ "identificador" => "tbl5" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="middle" scope="col"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">PPARD \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">fra-1 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">MMP7 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">OPG \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">RANKL \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="middle" scope="col">OPG/RANKL \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.21,(0.80) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.11,(0.49) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.24,(0.55) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.40,(0.59) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.31,(0.79) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.33,(0.44) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">Symptom duration (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.16,(0.75) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.34,(0.36) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.16,(0.79) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.25,(0.75) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.41,(0.68) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.45,(0.39) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">BASDAI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.12,(0.92) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.31,(0.78) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.16,(0.45) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.17,(0.54) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.08,(0.26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.23,(0.61) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">BASFI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.10,(0.56) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.19,(0.26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.37,(0.89) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.35,(0.83) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.15,(0.47) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.65,(0.35) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">CRP (mg/l) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.02,(0.90) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.21,(0.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.18,(0.25) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.10,(0.52) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.00,(0.99) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.13,(0.41) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="middle">ESR (mm/h) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.10,(0.50) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.17,(0.26) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.13,(0.39) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.05,(0.75) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">0.11,(0.48) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="middle">-0.15,(0.32) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tfn4" "etiqueta" => "*" "nota" => "Values are the r, (p) of correlation coefficient. AS = ankylosing spondylitis; BASDAI = Bath Ankylosing Spondylitis Disease Activity Index; BASFI = Bath Ankylosing Spondylitis Functional Index; CRP = C-reactive protein; ESR = erythrocyte sedimentation rate." ] ] ] "descripcion" => array:1 [ "en" => "Associations between gene expression in ankylosing spondylitis-serum treated MG63 cells and patient demographics and clinical assessments.<a class="elsevierStyleCrossRef" href="#tfn4">*</a>" ] ] ] "bibliografia" => array:2 [ "titulo" => "REFERENCES" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec10" "bibliografiaReferencia" => array:33 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Rheumatoid arthritis and ankylosing spondylitis - pathology of acute inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ H Appel \n \t\t\t\t\t\t\t\t """ 1 => """ C Loddenkemper \n \t\t\t\t\t\t\t\t """ 2 => """ P Miossec \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Clin Exp Rheumatol" "fecha" => "2009" "volumen" => "27" "numero" => "4 Suppl 55" "paginaInicial" => "S15" "paginaFinal" => "S19" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19822040" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Critical appraisal of assessment of structural damage in ankylosing spondylitis: implications for treatment outcomes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ J Sieper \n \t\t\t\t\t\t\t\t """ 1 => """ H Appel \n \t\t\t\t\t\t\t\t """ 2 => """ J Braun \n \t\t\t\t\t\t\t\t """ 3 => """ M Rudwaleit \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/art.23260" "Revista" => array:7 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2008" "volumen" => "58" "numero" => "3" "paginaInicial" => "649" "paginaFinal" => "656" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18311819" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/art.23260" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/art.23260" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New bone formation in axial spondyloarthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ D Wendling \n \t\t\t\t\t\t\t\t """ 1 => """ P Claudepierre \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.jbspin.2013.02.004" "Revista" => array:7 [ "tituloSerie" => "Joint Bone Spine" "fecha" => "2013" "volumen" => "80" "numero" => "5" "paginaInicial" => "454" "paginaFinal" => "458" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23566662" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.jbspin.2013.02.004" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.jbspin.2013.02.004" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structural bone changes in spondyloarthritis: mechanisms, clinical impact and therapeutic considerations" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => """ G Schett \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1097/MAJ.0b013e31820f8b29" "Revista" => array:7 [ "tituloSerie" => "Am J Med Sci" "fecha" => "2011" "volumen" => "341" "numero" => "4" "paginaInicial" => "269" "paginaFinal" => "271" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21358309" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1097/MAJ.0b013e31820f8b29" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1097/MAJ.0b013e31820f8b29" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "To Wnt or not to Wnt: the bone and joint health dilemma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ RJ Lories \n \t\t\t\t\t\t\t\t """ 1 => """ M Corr \n \t\t\t\t\t\t\t\t """ 2 => """ NE Lane \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/nrrheum.2013.25" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Rheumatol" "fecha" => "2013" "volumen" => "9" "numero" => "6" "paginaInicial" => "328" "paginaFinal" => "339" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23459013" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/nrrheum.2013.25" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1038/nrrheum.2013.25" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Eating bone or adding it: the Wnt pathway decides" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ SR Goldring \n \t\t\t\t\t\t\t\t """ 1 => """ MB Goldring \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1038/nm0207-133" "Revista" => array:7 [ "tituloSerie" => "Nat Med" "fecha" => "2007" "volumen" => "13" "numero" => "2" "paginaInicial" => "133" "paginaFinal" => "134" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17290270" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1038/nm0207-133" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1038/nm0207-133" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Targeting the Wnt/-catenin pathway to regulate bone formation in the adult skeleton" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ R Baron \n \t\t\t\t\t\t\t\t """ 1 => """ G Rawadi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1210/en.2007-0270" "Revista" => array:7 [ "tituloSerie" => "Endocrinology" "fecha" => "2007" "volumen" => "148" "numero" => "6" "paginaInicial" => "2635" "paginaFinal" => "2643" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17395698" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1210/en.2007-0270" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1210/en.2007-0270" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evidence that Dkk-1 is dysfunctional in ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ D Daoussis \n \t\t\t\t\t\t\t\t """ 1 => """ SN Liossis \n \t\t\t\t\t\t\t\t """ 2 => """ EE Solomou \n \t\t\t\t\t\t\t\t """ 3 => """ A Tsanaktsi \n \t\t\t\t\t\t\t\t """ 4 => """ K Bounia \n \t\t\t\t\t\t\t\t """ 5 => """ M Karampetsou \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/art.27231" "Revista" => array:7 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2010" "volumen" => "62" "numero" => "1" "paginaInicial" => "150" "paginaFinal" => "158" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20039407" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/art.27231" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/art.27231" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "High level of functional Dickkopf-1 predicts protection from syndesmophyte formation in patients with ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ GR Heiland \n \t\t\t\t\t\t\t\t """ 1 => """ H Appel \n \t\t\t\t\t\t\t\t """ 2 => """ D Poddubnyy \n \t\t\t\t\t\t\t\t """ 3 => """ J Zwerina \n \t\t\t\t\t\t\t\t """ 4 => """ A Hueber \n \t\t\t\t\t\t\t\t """ 5 => """ H Haibel \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1136/annrheumdis-2011-200216" "Revista" => array:7 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2012" "volumen" => "71" "numero" => "4" "paginaInicial" => "572" "paginaFinal" => "574" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22186710" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1136/annrheumdis-2011-200216" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1136/annrheumdis-2011-200216" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Blockade of Dickkopf-1 induces fusion of sacroiliac joints" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ S Uderhardt \n \t\t\t\t\t\t\t\t """ 1 => """ D Diarra \n \t\t\t\t\t\t\t\t """ 2 => """ J Katzenbeisser \n \t\t\t\t\t\t\t\t """ 3 => """ JP David \n \t\t\t\t\t\t\t\t """ 4 => """ J Zwerina \n \t\t\t\t\t\t\t\t """ 5 => """ WG Richards \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1136/ard.2008.102046" "Revista" => array:7 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2010" "volumen" => "69" "numero" => "3" "paginaInicial" => "592" "paginaFinal" => "597" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19304568" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1136/ard.2008.102046" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1136/ard.2008.102046" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Altered skeletal expression of sclerostin and its link to radiographic progression in ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ H Appel \n \t\t\t\t\t\t\t\t """ 1 => """ G Ruiz-Heiland \n \t\t\t\t\t\t\t\t """ 2 => """ J Listing \n \t\t\t\t\t\t\t\t """ 3 => """ J Zwerina \n \t\t\t\t\t\t\t\t """ 4 => """ M Herrmann \n \t\t\t\t\t\t\t\t """ 5 => """ R Mueller \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/art.24888" "Revista" => array:7 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2009" "volumen" => "60" "numero" => "11" "paginaInicial" => "3257" "paginaFinal" => "3262" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19877044" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/art.24888" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/art.24888" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Adalimumab significantly reduces inflammation and serum DKK-1 level but increases fatty deposition in lumbar spine in active ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ Z Hu \n \t\t\t\t\t\t\t\t """ 1 => """ M Xu \n \t\t\t\t\t\t\t\t """ 2 => """ Q Li \n \t\t\t\t\t\t\t\t """ 3 => """ Z Lin \n \t\t\t\t\t\t\t\t """ 4 => """ Z Liao \n \t\t\t\t\t\t\t\t """ 5 => """ S Cao \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1111/j.1756-185X.2012.01734.x" "Revista" => array:8 [ "tituloSerie" => "Int J Rheum Dis" "fecha" => "2012" "volumen" => "15" "numero" => "4" "paginaInicial" => "358" "paginaFinal" => "365" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22898215" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0021915013003316" "estado" => "S300" "issn" => "00219150" ] ] ] 1 => array:2 [ "doi" => "10.1111/j.1756-185X.2012.01734.x" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1111/j.1756-185X.2012.01734.x" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of MYC-regulated long noncoding RNAs in cell cycle regulation and tumorigenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ T Kim \n \t\t\t\t\t\t\t\t """ 1 => """ YJ Jeon \n \t\t\t\t\t\t\t\t """ 2 => """ R Cui \n \t\t\t\t\t\t\t\t """ 3 => """ JH Lee \n \t\t\t\t\t\t\t\t """ 4 => """ Y Peng \n \t\t\t\t\t\t\t\t """ 5 => """ SH Kim \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Natl Cancer Inst" "fecha" => "2015" "volumen" => "107" "numero" => "4" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1093/jnci/dju505" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genome-wide profiling of AP-1-regulated transcription provides insights into the invasiveness of triple-negative breast cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ C Zhao \n \t\t\t\t\t\t\t\t """ 1 => """ Y Qiao \n \t\t\t\t\t\t\t\t """ 2 => """ P Jonsson \n \t\t\t\t\t\t\t\t """ 3 => """ J Wang \n \t\t\t\t\t\t\t\t """ 4 => """ L Xu \n \t\t\t\t\t\t\t\t """ 5 => """ P Rouhi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1158/0008-5472.CAN-13-3396" "Revista" => array:7 [ "tituloSerie" => "Cancer Res" "fecha" => "2014" "volumen" => "74" "numero" => "14" "paginaInicial" => "3983" "paginaFinal" => "3994" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24830720" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1158/0008-5472.CAN-13-3396" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1158/0008-5472.CAN-13-3396" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cyclin D1 is a strong prognostic factor for survival in pancreatic cancer: analysis of CD G870A polymorphism, FISH and immunohistochemistry" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ K Bachmann \n \t\t\t\t\t\t\t\t """ 1 => """ A Neumann \n \t\t\t\t\t\t\t\t """ 2 => """ A Hinsch \n \t\t\t\t\t\t\t\t """ 3 => """ MF Nentwich \n \t\t\t\t\t\t\t\t """ 4 => """ AT El Gammal \n \t\t\t\t\t\t\t\t """ 5 => """ Y Vashist \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/jso.23826" "Revista" => array:7 [ "tituloSerie" => "J Surg Oncol" "fecha" => "2015" "volumen" => "111" "numero" => "3" "paginaInicial" => "316" "paginaFinal" => "323" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25470788" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/jso.23826" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/jso.23826" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A genome-wide association study of limb bone length using a Large White × Minzhu intercross population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ LC Zhang \n \t\t\t\t\t\t\t\t """ 1 => """ N Li \n \t\t\t\t\t\t\t\t """ 2 => """ X Liu \n \t\t\t\t\t\t\t\t """ 3 => """ J Liang \n \t\t\t\t\t\t\t\t """ 4 => """ H Yan \n \t\t\t\t\t\t\t\t """ 5 => """ KB Zhao \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1186/s12711-014-0056-6" "Revista" => array:5 [ "tituloSerie" => "Genet Sel Evol" "fecha" => "2014" "volumen" => "46" "paginaInicial" => "56" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25366846" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1186/s12711-014-0056-6" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1186/s12711-014-0056-6" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A single nucleotide polymorphism on exon-4 of the gene encoding PPARdelta is associated with reduced height in adults and children" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ LR Burch \n \t\t\t\t\t\t\t\t """ 1 => """ K Zhou \n \t\t\t\t\t\t\t\t """ 2 => """ LA Donnelly \n \t\t\t\t\t\t\t\t """ 3 => """ AS Doney \n \t\t\t\t\t\t\t\t """ 4 => """ J Brady \n \t\t\t\t\t\t\t\t """ 5 => """ C Goddard \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1210/jc.2009-0392" "Revista" => array:7 [ "tituloSerie" => "J Clin Endocrinol Metab" "fecha" => "2009" "volumen" => "94" "numero" => "7" "paginaInicial" => "2587" "paginaFinal" => "2593" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19383774" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1210/jc.2009-0392" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1210/jc.2009-0392" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Wnt/β-catenin signaling enhances osteoblastogenic differentiation from human periodontal ligament fibroblasts" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ JS Heo \n \t\t\t\t\t\t\t\t """ 1 => """ SY Lee \n \t\t\t\t\t\t\t\t """ 2 => """ JC Lee \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1007/s10059-010-0139-3" "Revista" => array:7 [ "tituloSerie" => "Mol Cells" "fecha" => "2010" "volumen" => "30" "numero" => "5" "paginaInicial" => "449" "paginaFinal" => "454" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20848229" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1007/s10059-010-0139-3" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1007/s10059-010-0139-3" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metalloproteinase and tissue inhibitor of metalloproteinase expression in the murine STR/ort model of osteoarthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ J Flannelly \n \t\t\t\t\t\t\t\t """ 1 => """ MG Chambers \n \t\t\t\t\t\t\t\t """ 2 => """ J Dudhia \n \t\t\t\t\t\t\t\t """ 3 => """ RM Hembry \n \t\t\t\t\t\t\t\t """ 4 => """ G Murphy \n \t\t\t\t\t\t\t\t """ 5 => """ RM Mason \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1053/joca.2002.0818" "Revista" => array:7 [ "tituloSerie" => "Osteoarthritis Cartilage" "fecha" => "2002" "volumen" => "10" "numero" => "9" "paginaInicial" => "722" "paginaFinal" => "733" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12202125" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1053/joca.2002.0818" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1053/joca.2002.0818" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib20" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A comprehensive manually curated reaction map of RANK/RANKL-signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ R Raju \n \t\t\t\t\t\t\t\t """ 1 => """ L Balakrishnan \n \t\t\t\t\t\t\t\t """ 2 => """ V Nanjappa \n \t\t\t\t\t\t\t\t """ 3 => """ M Bhattacharjee \n \t\t\t\t\t\t\t\t """ 4 => """ D Getnet \n \t\t\t\t\t\t\t\t """ 5 => """ B Muthusamy \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Database (Oxford)" "fecha" => "2011" "volumen" => "2011" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib21" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ DA Glass 2nd \n \t\t\t\t\t\t\t\t """ 1 => """ P Bialek \n \t\t\t\t\t\t\t\t """ 2 => """ JD Ahn \n \t\t\t\t\t\t\t\t """ 3 => """ M Starbuck \n \t\t\t\t\t\t\t\t """ 4 => """ MS Patel \n \t\t\t\t\t\t\t\t """ 5 => """ H Clevers \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.devcel.2005.02.017" "Revista" => array:7 [ "tituloSerie" => "Dev Cell" "fecha" => "2005" "volumen" => "8" "numero" => "5" "paginaInicial" => "751" "paginaFinal" => "764" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15866165" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.devcel.2005.02.017" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.devcel.2005.02.017" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib22" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evaluation of diagnostic criteria for ankylosing spondylitis: a proposal for modification of the New York criteria" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ S Van der Linden \n \t\t\t\t\t\t\t\t """ 1 => """ HA Valkenburg \n \t\t\t\t\t\t\t\t """ 2 => """ A Cats \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/art.1780270401" "Revista" => array:7 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "1984" "volumen" => "27" "numero" => "4" "paginaInicial" => "361" "paginaFinal" => "368" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6231933" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/art.1780270401" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/art.1780270401" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib23" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ FC Arnett \n \t\t\t\t\t\t\t\t """ 1 => """ SM Edworthy \n \t\t\t\t\t\t\t\t """ 2 => """ DA Bloch \n \t\t\t\t\t\t\t\t """ 3 => """ DJ McShane \n \t\t\t\t\t\t\t\t """ 4 => """ JF Fries \n \t\t\t\t\t\t\t\t """ 5 => """ NS Cooper \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1002/art.1780310302" "Revista" => array:7 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "1988" "volumen" => "31" "numero" => "3" "paginaInicial" => "315" "paginaFinal" => "324" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3358796" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1002/art.1780310302" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1002/art.1780310302" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib24" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Standardised Nordic questionnaires for the analysis of musculoskeletal symptoms" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ I Kuorinka \n \t\t\t\t\t\t\t\t """ 1 => """ B Jonsson \n \t\t\t\t\t\t\t\t """ 2 => """ A Kilbom \n \t\t\t\t\t\t\t\t """ 3 => """ H Vinterberg \n \t\t\t\t\t\t\t\t """ 4 => """ F Biering-S⊘rensen \n \t\t\t\t\t\t\t\t """ 5 => """ G Andersson \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/0003-6870(87)90010-x" "Revista" => array:7 [ "tituloSerie" => "Appl Ergon" "fecha" => "1987" "volumen" => "18" "numero" => "3" "paginaInicial" => "233" "paginaFinal" => "237" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15676628" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/0003-6870(87)90010-x" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/0003-6870(87)90010-X" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib25" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Assessments in ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ J Zochling \n \t\t\t\t\t\t\t\t """ 1 => """ J Braun \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.berh.2007.02.010" "Revista" => array:7 [ "tituloSerie" => "Best Pract Res Clin Rheumatol" "fecha" => "2007" "volumen" => "21" "numero" => "4" "paginaInicial" => "699" "paginaFinal" => "712" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17678831" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.berh.2007.02.010" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.berh.2007.02.010" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib26" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A new approach to defining functional ability in ankylosing spondylitis: the development of the Bath Ankylosing Spondylitis Functional Index" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ A Calin \n \t\t\t\t\t\t\t\t """ 1 => """ S Garrett \n \t\t\t\t\t\t\t\t """ 2 => """ H Whitelock \n \t\t\t\t\t\t\t\t """ 3 => """ LG Kennedy \n \t\t\t\t\t\t\t\t """ 4 => """ J O'Hea \n \t\t\t\t\t\t\t\t """ 5 => """ P Mallorie \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "J Rheumatol" "fecha" => "1994" "volumen" => "21" "numero" => "12" "paginaInicial" => "2281" "paginaFinal" => "2285" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7699629" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib27" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of the Wnt/β-catenin pathway in the effect of implant topography on MG63 differentiation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ W Wang \n \t\t\t\t\t\t\t\t """ 1 => """ L Zhao \n \t\t\t\t\t\t\t\t """ 2 => """ Q Ma \n \t\t\t\t\t\t\t\t """ 3 => """ Q Wang \n \t\t\t\t\t\t\t\t """ 4 => """ PK Chu \n \t\t\t\t\t\t\t\t """ 5 => """ Y Zhang \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1016/j.biomaterials.2012.07.064" "Revista" => array:7 [ "tituloSerie" => "Biomaterials" "fecha" => "2012" "volumen" => "33" "numero" => "32" "paginaInicial" => "7993" "paginaFinal" => "8002" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22889483" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1016/j.biomaterials.2012.07.064" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1016/j.biomaterials.2012.07.064" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib28" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The novel arylindolylmaleimide PDA-66 displays pronounced antiproliferative effects in acute lymphoblastic leukemia cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ C Kretzschmar \n \t\t\t\t\t\t\t\t """ 1 => """ C Roolf \n \t\t\t\t\t\t\t\t """ 2 => """ TS Langhammer \n \t\t\t\t\t\t\t\t """ 3 => """ A Sekora \n \t\t\t\t\t\t\t\t """ 4 => """ A Pews-Davtyan \n \t\t\t\t\t\t\t\t """ 5 => """ M Beller \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1186/1471-2407-14-71" "Revista" => array:6 [ "tituloSerie" => "BMC Cancer" "fecha" => "2014" "volumen" => "14" "paginaInicial" => "71" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24502201" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0085253815000150" "estado" => "S300" "issn" => "00852538" ] ] ] 1 => array:2 [ "doi" => "10.1186/1471-2407-14-71" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1186/1471-2407-14-71" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib29" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-27a targets sFRP1 in hFOB cells to regulate proliferation, apoptosis and differentiation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ D Guo \n \t\t\t\t\t\t\t\t """ 1 => """ Q Li \n \t\t\t\t\t\t\t\t """ 2 => """ Q Lv \n \t\t\t\t\t\t\t\t """ 3 => """ Q Wei \n \t\t\t\t\t\t\t\t """ 4 => """ S Cao \n \t\t\t\t\t\t\t\t """ 5 => """ J Gu \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "PLoS One" "fecha" => "2014" "volumen" => "9" "numero" => "3" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1371/journal.pone.0091354" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib30" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Fetuin-A is related to syndesmophytes in patients with ankylosing spondylitis: a case control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ T Tuylu \n \t\t\t\t\t\t\t\t """ 1 => """ I Sari \n \t\t\t\t\t\t\t\t """ 2 => """ D Solmaz \n \t\t\t\t\t\t\t\t """ 3 => """ DL Kozaci \n \t\t\t\t\t\t\t\t """ 4 => """ S Akar \n \t\t\t\t\t\t\t\t """ 5 => """ N Gunay \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.6061/clinics/2014(10)07" "Revista" => array:7 [ "tituloSerie" => "Clinics" "fecha" => "2014" "volumen" => "69" "numero" => "10" "paginaInicial" => "688" "paginaFinal" => "693" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25518021" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.6061/clinics/2014(10)07" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.6061/clinics/2014(10)07" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib31" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sclerostin and Dkk-1 in patients with ankylosing spondylitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ N Ustun \n \t\t\t\t\t\t\t\t """ 1 => """ F Tok \n \t\t\t\t\t\t\t\t """ 2 => """ U Kalyoncu \n \t\t\t\t\t\t\t\t """ 3 => """ S Motor \n \t\t\t\t\t\t\t\t """ 4 => """ R Yuksel \n \t\t\t\t\t\t\t\t """ 5 => """ AE Yagiz \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Acta Reumatol Port" "fecha" => "2014" "volumen" => "39" "numero" => "2" "paginaInicial" => "146" "paginaFinal" => "151" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25111416" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib32" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biomarkers of bone metabolism in ankylosing spondylitis in relation to osteoproliferation and osteoporosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ E Klingberg \n \t\t\t\t\t\t\t\t """ 1 => """ M Nurkkala \n \t\t\t\t\t\t\t\t """ 2 => """ H Carlsten \n \t\t\t\t\t\t\t\t """ 3 => """ H Forsblad-d'Elia \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.3899/jrheum.131199" "Revista" => array:8 [ "tituloSerie" => "J Rheumatol" "fecha" => "2014" "volumen" => "41" "numero" => "7" "paginaInicial" => "1349" "paginaFinal" => "1356" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24931960" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0085253816304690" "estado" => "S300" "issn" => "00852538" ] ] ] 1 => array:2 [ "doi" => "10.3899/jrheum.131199" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.3899/jrheum.131199" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib33" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dickkopf-1 level is lower in patients with ankylosing spondylitis than in healthy people and is not influenced by anti-tumor necrosis factor therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ SR Kwon \n \t\t\t\t\t\t\t\t """ 1 => """ MJ Lim \n \t\t\t\t\t\t\t\t """ 2 => """ CH Suh \n \t\t\t\t\t\t\t\t """ 3 => """ SG Park \n \t\t\t\t\t\t\t\t """ 4 => """ YS Hong \n \t\t\t\t\t\t\t\t """ 5 => """ BY Yoon \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1007/s00296-011-1981-0" "Revista" => array:7 [ "tituloSerie" => "Rheumatol Int" "fecha" => "2012" "volumen" => "32" "numero" => "8" "paginaInicial" => "2523" "paginaFinal" => "2527" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21833531" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1007/s00296-011-1981-0" "WWW" => array:1 [ "link" => "http://dx.doi.org/10.1007/s00296-011-1981-0" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack639247" "titulo" => "ACKNOWLEDGMENTS" "texto" => "This study was supported by the Medical Scientific Research Foundation of Guangdong Province (B2014142), the National Natural Science Foundation of China (81373181) and 5010 Subject of Sun Yat-sen University (2007023)." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013175/v1_202212011342/en/main.assets" "Apartado" => null "PDF" => "https://static.elsevier.es/multimedia/18075932/0000007000000011/v1_202212011342/S1807593222013175/v1_202212011342/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013175?idApp=UINPBA00004N"]

Statistics

CLINICAL SCIENCE

Zaiying Hu, Dongfang Lin, Jun Qi, Minli Qiu, Qing Lv, Qiuxia Li, Zhiming Lin, Zetao Liao, Yunfeng Pan, Ou Jin, Yuqiong Wu, Jieruo Gu

Corresponding author

gujieruo@163.com

Corresponding author:

The Third Affiliated Hospital of Sun Yat-Sen University, Department of Rheumatology, Guangzhou, China

Read

663

Times
was read the article

294

Total PDF

369

Total HTML

Share statistics

 array:24 [
  "pii" => "S1807593222013175"
  "issn" => "18075932"
  "doi" => "10.6061/clinics/2015(11)04"
  "estado" => "S300"
  "fechaPublicacion" => "2015-11-01"
  "aid" => "1317"
  "copyright" => "CLINICS"
  "copyrightAnyo" => "2015"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "https://creativecommons.org/licenses/by/4.0/"
  "subdocumento" => "fla"
  "cita" => "Clinics. 2015;70:738-42"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1807593222013187"
    "issn" => "18075932"
    "doi" => "10.6061/clinics/2015(11)05"
    "estado" => "S300"
    "fechaPublicacion" => "2015-11-01"
    "aid" => "1318"
    "copyright" => "CLINICS"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "https://creativecommons.org/licenses/by/4.0/"
    "subdocumento" => "fla"
    "cita" => "Clinics. 2015;70:743-7"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">CLINICAL SCIENCE</span>"
      "titulo" => "Baropodometric analyses of patients before and after bariatric surgery"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "743"
          "paginaFinal" => "747"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig1"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 398
              "Ancho" => 650
              "Tamanyo" => 48778
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">FSCAN system version 3848&#44; which measures the peak values for pressure and the ground reaction force for the rear foot and forefoot&#44; the double-support time&#44; and the foot contact area&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ivan Leo Bacha, Fernanda Antico Benetti, J&#250;lia Maria D&#39;Andr&#233;a Greve"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Ivan Leo"
              "apellidos" => "Bacha"
            ]
            1 => array:2 [
              "nombre" => "Fernanda Antico"
              "apellidos" => "Benetti"
            ]
            2 => array:2 [
              "nombre" => "J&#250;lia Maria D&#39;Andr&#233;a"
              "apellidos" => "Greve"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013187?idApp=UINPBA00004N"
    "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013187/v1_202212011342/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1807593222013163"
    "issn" => "18075932"
    "doi" => "10.6061/clinics/2015(11)03"
    "estado" => "S300"
    "fechaPublicacion" => "2015-11-01"
    "aid" => "1316"
    "copyright" => "CLINICS"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "https://creativecommons.org/licenses/by/4.0/"
    "subdocumento" => "fla"
    "cita" => "Clinics. 2015;70:733-7"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">CLINICAL SCIENCE</span>"
      "titulo" => "Can mastalgia be another somatic symptom in fibromyalgia syndrome&#63;"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "733"
          "paginaFinal" => "737"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig1"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 272
              "Ancho" => 792
              "Tamanyo" => 23036
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">The number of patients diagnosed with fibromyalgia syndrome in the mastalgia group &#40;A&#41; and the number of patients with mastalgia in the FMS group &#40;B&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Meral Sen, Murat Ozgur Kilic, Ozlem Cemeroglu, Duygu Icen"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Meral"
              "apellidos" => "Sen"
            ]
            1 => array:2 [
              "nombre" => "Murat Ozgur"
              "apellidos" => "Kilic"
            ]
            2 => array:2 [
              "nombre" => "Ozlem"
              "apellidos" => "Cemeroglu"
            ]
            3 => array:2 [
              "nombre" => "Duygu"
              "apellidos" => "Icen"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013163?idApp=UINPBA00004N"
    "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013163/v1_202212011342/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">CLINICAL SCIENCE</span>"
    "titulo" => "Serum from patients with ankylosing spondylitis can increase PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression in MG63 cells"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "738"
        "paginaFinal" => "742"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Zaiying Hu, Dongfang Lin, Jun Qi, Minli Qiu, Qing Lv, Qiuxia Li, Zhiming Lin, Zetao Liao, Yunfeng Pan, Ou Jin, Yuqiong Wu, Jieruo Gu"
        "autores" => array:12 [
          0 => array:2 [
            "nombre" => "Zaiying"
            "apellidos" => "Hu"
          ]
          1 => array:2 [
            "nombre" => "Dongfang"
            "apellidos" => "Lin"
          ]
          2 => array:2 [
            "nombre" => "Jun"
            "apellidos" => "Qi"
          ]
          3 => array:2 [
            "nombre" => "Minli"
            "apellidos" => "Qiu"
          ]
          4 => array:2 [
            "nombre" => "Qing"
            "apellidos" => "Lv"
          ]
          5 => array:2 [
            "nombre" => "Qiuxia"
            "apellidos" => "Li"
          ]
          6 => array:2 [
            "nombre" => "Zhiming"
            "apellidos" => "Lin"
          ]
          7 => array:2 [
            "nombre" => "Zetao"
            "apellidos" => "Liao"
          ]
          8 => array:2 [
            "nombre" => "Yunfeng"
            "apellidos" => "Pan"
          ]
          9 => array:2 [
            "nombre" => "Ou"
            "apellidos" => "Jin"
          ]
          10 => array:2 [
            "nombre" => "Yuqiong"
            "apellidos" => "Wu"
          ]
          11 => array:4 [
            "nombre" => "Jieruo"
            "apellidos" => "Gu"
            "email" => array:1 [
              0 => "gujieruo@163.com"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor1"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "The Third Affiliated Hospital of Sun Yat-Sen University&#44; Department of Rheumatology&#44; Guangzhou&#44; China"
            "identificador" => "aff1"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor1"
            "etiqueta" => "&#42;"
            "correspondencia" => "Corresponding author&#58;"
          ]
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="cesec10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle60">INTRODUCTION</span><p id="para10" class="elsevierStylePara elsevierViewall">Ankylosing spondylitis &#40;AS&#41; is a chronic inflammatory disease characterized by new bone formation that progressively leads to ankylosis and functional disability&#46; The inflammatory phase of AS shares similarities with other types of inflammatory arthritis such as rheumatoid arthritis &#40;RA&#41;&#44; with high levels of pro-inflammatory cytokine production and osteoclast activity and damage to the cortical bone of joints <a class="elsevierStyleCrossRef" href="#bib1">1</a>&#46; However&#44; after the inflammation subsides&#44; excessive ossification occurs at the site of initial erosion&#46; Inflammation is often viewed as the inciting cause of ossification <a class="elsevierStyleCrossRef" href="#bib2">2</a>&#44;<a class="elsevierStyleCrossRef" href="#bib3">3</a>&#46; Controlling the inflammatory process&#44; however&#44; does not appear to prevent the development of ossifications in AS <a class="elsevierStyleCrossRef" href="#bib4">4</a>&#46; How inflammation is initiated and how it progresses to bone formation and eventual ankylosis are poorly understood&#46;</p><p id="para20" class="elsevierStylePara elsevierViewall">The Wnt signaling pathway plays critical roles in homeostasis and bone health in adults&#46; It is involved in osteoblastogenesis and is regulated in part by inflammation <a class="elsevierStyleCrossRefs" href="#bib5">5&#8211;7</a>&#46; Many studies have suggested a role for the Wnt pathway in the process of new bone formation in AS&#44; as it can provide a linkage between inflammation and ossification <a class="elsevierStyleCrossRefs" href="#bib8">8&#8211;12</a>&#46; In the canonical Wnt pathway&#44; the interaction of Wnt proteins with their receptors leads to increased &#946;-catenin levels and eventually to the expression of downstream genes <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; Serum from AS patients can increase &#946;-catenin expression and these circulating bone formation-inducing &#946;-catenin molecules are functionally prevalent in AS patients <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; However&#44; whether the downstream genes of the canonical Wnt pathway can also be increased by serum from AS patients has not yet been reported&#46;</p><p id="para30" class="elsevierStylePara elsevierViewall">Downstream targets of the canonical Wnt pathway include c-myc&#44; c-jun&#44; cycD&#44; PPARD&#44; fra-1 and MMP7&#46; C-myc functions as a transcription factor that is associated with a variety of hematopoietic tumors <a class="elsevierStyleCrossRef" href="#bib13">13</a>&#44; c-jun is involved in human malignancies <a class="elsevierStyleCrossRef" href="#bib14">14</a> and cycD is another tumor-related gene <a class="elsevierStyleCrossRef" href="#bib15">15</a>&#46; PPARD&#44; which influences chondrocyte cell growth and differentiation <a class="elsevierStyleCrossRef" href="#bib16">16</a>&#44; may affect height in adults through effects on osteoclast function <a class="elsevierStyleCrossRef" href="#bib17">17</a>&#46; Fra-1 plays important roles in osteoblast differentiation and bone formation that might be important for the osteogenic differentiation stimulated by Wnt&#47;&#946;-catenin signaling <a class="elsevierStyleCrossRef" href="#bib18">18</a> and MMP7 is involved in the breakdown of the extracellular matrix in normal physiological processes&#44; as well as in disease states such as arthritis and metastasis <a class="elsevierStyleCrossRef" href="#bib19">19</a>&#46; Because c-myc&#44; c-jun and cycD are more related to tumors&#44; whereas PPARD&#44; fra-1 and MMP7 are considered in many studies to be involved in bone metabolism&#44; we chose PPARD&#44; fra-1 and MMP7 as the target genes to be detected&#46;</p><p id="para40" class="elsevierStylePara elsevierViewall">Osteoprotegerin &#40;OPG&#41; is a protein secreted by osteoblasts that protects the skeleton from bone resorption via binding to receptor activator of NF-&#954;B ligand &#40;RANKL&#41; <a class="elsevierStyleCrossRef" href="#bib20">20</a>&#46; Wnt pathway activation can increase OPG expression <a class="elsevierStyleCrossRef" href="#bib21">21</a>&#46; Whether serum from AS patients can affect OPG and RANKL expression and have an osteogenic effect through Wnt pathway regulation has not yet been reported&#46;</p><p id="para50" class="elsevierStylePara elsevierViewall">In this study&#44; we attempted to explore the effects of serum from AS patients on the canonical Wnt&#47;&#946;-catenin pathway by measuring the expression of its downstream target genes in human osteoblast-like MG63 cells&#46; We also attempted to detect OPG and RANKL expression to assess whether AS serum has an osteogenic effect in MG63 cells&#46;</p></span><span id="cesec20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle70">MATERIALS AND METHODS</span><span id="cesec30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle80">Patients</span><p id="para60" class="elsevierStylePara elsevierViewall">We recruited 45 patients who fulfilled the modified New York classification criteria for AS <a class="elsevierStyleCrossRef" href="#bib22">22</a>&#44; 45 age- and sex-matched healthy subjects and 30 patients who met the American College of Rheumatology 1987 revised criteria for RA <a class="elsevierStyleCrossRef" href="#bib23">23</a>&#46; The healthy controls were defined by the Nordic questionnaire <a class="elsevierStyleCrossRef" href="#bib24">24</a>&#46; All patients were Chinese and were recruited from outpatient clinics at the Department of Rheumatology of the 3<span class="elsevierStyleSup">rd</span> Affiliated Hospital of Sun Yat-sen University&#46; The study was approved by the local ethics committee and all participants gave written informed consent&#44; in accordance with the Declaration of Helsinki&#46;</p><p id="para70" class="elsevierStylePara elsevierViewall">Disease activity assessment was performed using the Bath AS Disease Activity Index &#40;BASDAI&#41; and the Bath AS Function Index &#40;BASFI&#41; in AS patients <a class="elsevierStyleCrossRef" href="#bib25">25</a>&#44;<a class="elsevierStyleCrossRef" href="#bib26">26</a>&#46; Markers of inflammation &#40;erythrocyte sedimentation rate &#91;ESR&#93; and C-reactive protein &#91;CRP&#93; levels&#41; were measured in AS and RA patients&#46; Serum samples were obtained from all participants and were stored in aliquots of 250 &#181;l at -20&#176;C&#46; To avoid freeze-thawing&#44; each experiment was performed with a different aliquot&#46;</p></span><span id="cesec40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle90">Cell culture</span><p id="para80" class="elsevierStylePara elsevierViewall">Human MG63 osteoblasts obtained from the American Type Culture Collection &#40;ATCC&#41; were cultured in Dulbecco&#39;s modified Eagle&#39;s medium &#40;DMEM&#44; Gibco&#41; supplemented with 10&#37; fetal bovine serum &#40;FBS&#44; Gibco&#41; and 1&#37; penicillin&#47;streptomycin in 6-well plates at a concentration of 2&#215;10<span class="elsevierStyleSup">5</span>&#47;ml and were incubated in a humidified atmosphere of 5&#37; CO<span class="elsevierStyleInf">2</span> at 37&#176;C for 24 hours&#46; After washing with phosphate-buffered saline &#40;PBS&#41;&#44; 250 &#181;l of serum from either AS or RA patients or from normal subjects was added into each well and the cells were cultured with DMEM but without FBS for another 48 hours&#46;</p></span><span id="cesec50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle100">Quantitative real-time PCR</span><p id="para90" class="elsevierStylePara elsevierViewall">After a total incubation period of 3 days <a class="elsevierStyleCrossRef" href="#bib27">27</a>&#44; PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression in MG63 cells was measured&#46; Total RNA was isolated using TRIzol reagent &#40;Invitrogen&#41; and 1 &#181;g of total RNA was converted to cDNA using the PrimeScript<span class="elsevierStyleSup">TM</span> RT reagent kit &#40;TaKaRa&#41;&#46; Real-time PCR reactions were performed using SYBR Premix Ex<span class="elsevierStyleSup">TM</span> Taq II &#40;TaKaRa&#41; on an ABI PRISM 7000 Sequence Detection System &#40;Applied Biosystems&#41;&#46; The primers used are listed in <a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>&#46; The following cycling program was used&#58; 15 min preincubation at 95&#176;C&#44; 10 s denaturation at 95&#176;C and 31 s annealing at 60&#176;C for 40 cycles&#46; To confirm the amplification specificity&#44; the PCR products from each primer pair were subjected to melting curve analysis&#46; Each reaction was amplified in triplicate and the threshold cycle &#40;Ct&#41; was calculated using the 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span> method&#46; Relative gene expression was normalized to GAPDH&#44; used as an internal reference&#46;</p><elsevierMultimedia ident="tbl1"></elsevierMultimedia></span><span id="cesec60" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle110">Statistical analysis</span><p id="para100" class="elsevierStylePara elsevierViewall">Statistical analysis was performed using SPSS software&#46; Variables were tested for normality by applying the Kolmogorov-Smirnov test&#46; Data are presented as the mean &#177; standard deviation &#40;SD&#41; or as percentages&#44; as appropriate&#46; Correlations between gene expression and other variables were analyzed using Pearson&#39;s or Spearman&#39;s test&#44; as appropriate&#46; One-way analysis of variance &#40;ANOVA&#41; and t-tests were used for group comparisons&#46; <span class="elsevierStyleItalic">P</span> values less than 0&#46;05 &#40;2-tailed&#41; were considered significant&#46;</p></span></span><span id="cesec70" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle120">RESULTS</span><span id="cesec80" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle130">Characteristics of the study subjects</span><p id="para110" class="elsevierStylePara elsevierViewall">The demographic and disease characteristics of the study subjects are shown in <a class="elsevierStyleCrossRef" href="#tbl2">Table 2</a>&#46; No significant differences were found for sex and age between AS patients and healthy controls &#40;both <span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41;&#46; RA patients were older than AS patients and had shorter symptom durations &#40;both <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#46;</p><elsevierMultimedia ident="tbl2"></elsevierMultimedia></span><span id="cesec90" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle140">Gene expression detected by quantitative real-time PCR</span><p id="para120" class="elsevierStylePara elsevierViewall">The relative PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL mRNA levels are listed in <a class="elsevierStyleCrossRef" href="#tbl3">Table 3</a>&#46; The corresponding <span class="elsevierStyleItalic">p</span>-values for comparisons among the gene expressions in AS&#44; RA and control serum-treated MG63 cells are listed in <a class="elsevierStyleCrossRef" href="#tbl4">Table 4</a>&#46; When MG63 cells were cultured with AS serum&#44; PPARD&#44; fra-1&#44; MMP7 and OPG expression was significantly higher than in cells treated with serum from RA patients or healthy controls &#40;all <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#46; No significant differences were found for PPARD&#44; fra-1&#44; MMP7 and OPG expression in MG63 cells treated with serum from RA patients and those treated with serum from healthy controls &#40;all <span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41;&#46; In cells cultured with AS or RA patient serum&#44; RANKL expression was higher than that in cells cultured with healthy control serum &#40;both <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#59; however&#44; the difference in RANKL expression in cells treated with AS and RA patient serum was not significant &#40;<span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41;&#46; The OPG&#47;RANKL ratio was also higher in AS serum-treated cells &#40;<span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#44; but no significant difference was found for that of RA-treated cells &#40;<span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41; compared to control serum-treated cells&#46;</p><elsevierMultimedia ident="tbl3"></elsevierMultimedia><elsevierMultimedia ident="tbl4"></elsevierMultimedia></span><span id="cesec100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle150">Associations between gene expression and patient demographics and clinical assessments</span><p id="para130" class="elsevierStylePara elsevierViewall">The correlation coefficient &#40;r value&#41; and the corresponding <span class="elsevierStyleItalic">p</span>-value between the gene expression in AS-serum treated MG63 cells and patient demographics and clinical assessments are listed in <a class="elsevierStyleCrossRef" href="#tbl5">Table 5</a>&#46; In AS patients&#44; no associations were found between PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression and patient demographics and clinical assessments &#40;all <span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41;&#46;</p><elsevierMultimedia ident="tbl5"></elsevierMultimedia></span></span><span id="cesec110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle160">DISCUSSION</span><p id="para140" class="elsevierStylePara elsevierViewall">In this study&#44; we measured the effects of serum from AS patients on human osteoblast-like MG63 cells by detecting the mRNA expression of downstream target genes of the canonical Wnt&#47;&#946;-catenin pathway&#46; PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression and the OPG&#47;RANKL ratio were significantly higher in AS serum-treated cells than in cells treated with serum from RA patients or healthy controls&#46; We also found that such effects of AS patient serum were not correlated with age&#44; symptom duration&#44; the BASDAI&#44; the BASFI&#44; CRP levels or the ESR&#46;</p><p id="para150" class="elsevierStylePara elsevierViewall">Previous studies have reported that AS serum-treated Jurkat T cells had higher active &#946;-catenin levels compared with control serum-treated cells <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#46; Jurkat T cells are human peripheral blood leukemia T cells that have been widely used to explore the Wnt pathway in leukemia <a class="elsevierStyleCrossRef" href="#bib28">28</a>&#46; MG63 cells&#44; established as an osteoblastic cell line from a human osteosarcoma&#44; are frequently used to study the mechanism of bone metabolism&#46; Many studies have adopted MG63 cells as a model to investigate the Wnt pathway <a class="elsevierStyleCrossRef" href="#bib27">27</a>&#44;<a class="elsevierStyleCrossRef" href="#bib29">29</a>&#46; The use of MG63 cells may be advantageous over Jurkat T cells for researching the role of the Wnt pathway in bone formation&#44; as MG63 cells have more osteoblast-like characteristics&#59; thus&#44; the use of MG63 cells in this study makes our results more convincing&#46;</p><p id="para160" class="elsevierStylePara elsevierViewall">The Wnt pathway is critically important for normal bone homeostasis&#44; as the aberrant regulation of bone homeostasis has been suggested as a key element in the pathogenesis of AS <a class="elsevierStyleCrossRef" href="#bib8">8</a>&#44;<a class="elsevierStyleCrossRef" href="#bib9">9</a>&#46; Dickkopf-1 &#40;DKK-1&#41; and sclerostin are the main inhibitory molecules that regulate the canonical Wnt pathway&#46; The blockade of DKK-1 was shown to lead to the fusion of sacroiliac joints in an animal model of arthritis <a class="elsevierStyleCrossRef" href="#bib10">10</a>&#46; Altered skeletal expression of sclerostin has also been linked to radiographic progression in AS <a class="elsevierStyleCrossRef" href="#bib11">11</a>&#46; A number of studies have evaluated serum Dkk-1 and sclerostin levels in AS patients&#44; but conflicting data have been reported <a class="elsevierStyleCrossRef" href="#bib12">12</a>&#44;&#46; The net effect of AS serum on the canonical Wnt pathway &#40;suppression or promotion&#41; remains inconsistent&#46; Rather than focusing on the circulating concentrations of stimulatory or inhibitory molecules of the Wnt pathway in this study&#44; we evaluated the effect of AS serum by measuring the expression of downstream genes of the Wnt pathway&#46; We found that PPARD&#44; fra-1 and MMP7 gene expression was increased in AS serum-treated MG63 cells&#46; This finding supports the notion that the canonical Wnt pathway can be activated by serum from AS patients&#46;</p><p id="para170" class="elsevierStylePara elsevierViewall">OPG and RANKL are important molecules in maintaining the balance of bone metabolism&#46; The OPG&#47;RANKL ratio increases during the differentiation of pre-osteoblastic cells into mature osteoblasts <a class="elsevierStyleCrossRef" href="#bib20">20</a>&#46; Our results demonstrated that AS patient serum can increase OPG and RANKL expression and increase the OPG&#47;RANKL ratio&#44; which may eventually contribute to the formation of new bone&#46; These effects may also be related to canonical Wnt pathway activation&#46;</p><p id="para180" class="elsevierStylePara elsevierViewall">According to our data&#44; PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression were not correlated with the BASDAI&#44; the BASFI&#44; CRP levels or the ESR in AS patients&#46; The effects of inflammation on pathophysiological bone formation in AS remain contradictory&#46; Despite significant clinical improvement&#44; cytokine blocking strategies do not overcome new bone formation in AS&#44; suggesting that the molecular processes eliciting syndesmophyte formation may differ from those of inflammation <a class="elsevierStyleCrossRef" href="#bib4">4</a>&#46; In this study&#44; the lack of correlation between the expression of downstream genes of the Wnt pathway and clinical assessments indicated that bone responses may not be tightly linked to inflammation in AS patients&#46;</p><p id="para190" class="elsevierStylePara elsevierViewall">In conclusion&#44; serum from AS patients can increase PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression and the OPG&#47;RANKL ratio in MG63 cells&#46; These effects may be due to the stimulatory effects of AS serum on the Wnt pathway&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:7 [
        0 => array:2 [
          "identificador" => "xpalclavsec1582239"
          "titulo" => "KEYWORDS"
        ]
        1 => array:2 [
          "identificador" => "cesec10"
          "titulo" => "INTRODUCTION"
        ]
        2 => array:3 [
          "identificador" => "cesec20"
          "titulo" => "MATERIALS AND METHODS"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "cesec30"
              "titulo" => "Patients"
            ]
            1 => array:2 [
              "identificador" => "cesec40"
              "titulo" => "Cell culture"
            ]
            2 => array:2 [
              "identificador" => "cesec50"
              "titulo" => "Quantitative real-time PCR"
            ]
            3 => array:2 [
              "identificador" => "cesec60"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        3 => array:3 [
          "identificador" => "cesec70"
          "titulo" => "RESULTS"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "cesec80"
              "titulo" => "Characteristics of the study subjects"
            ]
            1 => array:2 [
              "identificador" => "cesec90"
              "titulo" => "Gene expression detected by quantitative real-time PCR"
            ]
            2 => array:2 [
              "identificador" => "cesec100"
              "titulo" => "Associations between gene expression and patient demographics and clinical assessments"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "cesec110"
          "titulo" => "DISCUSSION"
        ]
        5 => array:2 [
          "identificador" => "xack639247"
          "titulo" => "ACKNOWLEDGMENTS"
        ]
        6 => array:1 [
          "titulo" => "REFERENCES"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2015-04-24"
    "fechaAceptado" => "2015-08-19"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "KEYWORDS"
          "identificador" => "xpalclavsec1582239"
          "palabras" => array:3 [
            0 => "Ankylosing Spondylitis"
            1 => "Wnt Pathway"
            2 => "Gene Expression"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:2 [
        "resumen" => "<span id="ceabs10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle10">OBJECTIVES&#58;</span><p id="spara60" class="elsevierStyleSimplePara elsevierViewall">To explore the effects of serum from patients with ankylosing spondylitis on the canonical Wnt&#47;&#946;-catenin pathway and to assess whether the serum has an osteogenic effect in MG63 cells&#46;</p></span> <span id="ceabs20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle20">METHODS&#58;</span><p id="spara70" class="elsevierStyleSimplePara elsevierViewall">MG63 cells were cultured with serum from 45 ankylosing spondylitis patients&#44; 30 healthy controls&#44; or 45 rheumatoid arthritis patients&#46; The relative PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL mRNA levels were measured using quantitative real-time polymerase chain reaction&#46; Associations between gene expression and patient demographics and clinical assessments were then analyzed&#46;</p></span> <span id="ceabs30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle30">RESULTS&#58;</span><p id="spara80" class="elsevierStyleSimplePara elsevierViewall">MG63 cells treated with serum from ankylosing spondylitis patients had higher PPARD&#44; fra-1&#44; MMP7 and OPG gene expression than did cells treated with serum from controls or rheumatoid arthritis patients &#40;all <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#46; RANKL expression was higher in MG63 cells treated with serum from patients with ankylosing spondylitis or rheumatoid arthritis than in those treated with serum from controls &#40;both <span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#46; The OPG&#47;RANKL ratio was also higher in MG63 cells treated with serum from ankylosing spondylitis patients than in those treated with serum from controls &#40;<span class="elsevierStyleItalic">p</span>&#60;0&#46;05&#41;&#46; No associations were found between the expression of the five genes and the patient demographics and clinical assessments &#40;all <span class="elsevierStyleItalic">p</span>&#62;0&#46;05&#41;&#46;</p></span> <span id="ceabs40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle40">CONCLUSIONS</span><p id="spara90" class="elsevierStyleSimplePara elsevierViewall">&#58; Serum from ankylosing spondylitis patients increases PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL expression and the OPG&#47;RANKL ratio in MG63 cells&#59; these effects may be due to the stimulatory effect of the serum on the Wnt pathway&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "ceabs10"
            "titulo" => "OBJECTIVES&#58;"
          ]
          1 => array:2 [
            "identificador" => "ceabs20"
            "titulo" => "METHODS&#58;"
          ]
          2 => array:2 [
            "identificador" => "ceabs30"
            "titulo" => "RESULTS&#58;"
          ]
          3 => array:2 [
            "identificador" => "ceabs40"
            "titulo" => "CONCLUSIONS"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:1 [
        "nota" => "<p class="elsevierStyleNotepara" id="cenpara20">No potential conflict of interest was reported&#46;</p>"
      ]
    ]
    "multimedia" => array:5 [
      0 => array:7 [
        "identificador" => "tbl1"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Forward primer sequence &#40;5&#8216;-3&#8216;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Reverse primer sequence &#40;5&#8216;-3&#8216;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">PPARD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CTACGGTGTTCATGCATGTGAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">GCACTTCTGGAAGCGGCAGTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">fra-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">GGAGGAAGGAACTGACCGACTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CTAGGCGCTCCTTCTGCTTCTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">MMP7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">GCATGAGTGAGCTACAGTGGGAAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CCACATCTGGGCTTCTGCATTA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">OPG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">TGGCACCAAAGTAAACGCAGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CTCGAAGGTGAGGTTAGCATGTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">RANKL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">AAGATGGCACTCACTGCATTTATAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">TGATGTGCTGTGATCCAACGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">GAPDH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">GCACCGTCAAGGCTGAGAAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">TGGTGAAGACGCCAGTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">Primers used in real-time PCR&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "tbl2"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="tfn1" class="elsevierStyleSimplePara elsevierViewall">Values are the mean &#177; standard deviation&#44; unless otherwise stated&#46; AS &#61; ankylosing spondylitis&#59; RA &#61; rheumatoid arthritis&#59; HLA-B27 &#61; human leukocyte antigen B27&#59; BASDAI &#61; Bath Ankylosing Spondylitis Disease Activity Index&#59; BASFI &#61; Bath Ankylosing Spondylitis Functional Index&#59; CRP &#61; C-reactive protein &#40;reference range &#60;6 mg&#47;L&#41;&#59; ESR &#61; erythrocyte sedimentation rate &#40;reference range male &#60;15 mm&#47;h&#44; female &#60;20 mm&#47;h&#41;&#59; NA &#61; not applicable&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="middle" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">AS patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">RA patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Healthy controls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">Male&#58;female &#40;&#37; male&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">39&#58;6 &#40;86&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">5&#58;25 &#40;16&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">39&#58;6 &#40;86&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">28&#46;8 &#177; 8&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">45&#46;1 &#177; 12&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">28&#46;9 &#177; 8&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">Symptom duration &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">5&#46;2 &#177; 4&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">3&#46;8 &#177; 5&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">HLA-B27 positive &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">42 &#40;93&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">BASDAI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">3&#46;7 &#177; 4&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">BASFI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">2&#46;8 &#177; 3&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CRP &#40;mg&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">21&#46;3 &#177; 23&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">18&#46;3 &#177; 22&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">ESR &#40;mm&#47;h&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">24&#46;2 &#177; 20&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">27&#46;2 &#177; 19&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="middle">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara20" class="elsevierStyleSimplePara elsevierViewall">Demographic and clinical characteristics of the study subjects&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "tbl3"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="tfn2" class="elsevierStyleSimplePara elsevierViewall">Values are the mean &#177; standard deviation&#46; AS &#61; ankylosing spondylitis&#59; RA &#61; rheumatoid arthritis&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="3" align="center" valign="middle" scope="col">Serum of subjects</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="middle" scope="col">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">AS patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">RA patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Healthy controls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">PPARD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;36 &#177; 0&#46;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;07 &#177; 0&#46;67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;00 &#177; 0&#46;58&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">fra-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;16 &#177; 0&#46;36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;88 &#177; 0&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;00 &#177; 0&#46;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">MMP7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;89 &#177; 0&#46;69&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;20 &#177; 0&#46;95&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;00 &#177; 0&#46;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">OPG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;75 &#177; 1&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;15 &#177; 0&#46;49&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;00 &#177; 0&#46;54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">RANKL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;49 &#177; 1&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;42 &#177; 0&#46;91&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">1&#46;00 &#177; 0&#46;51&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara30" class="elsevierStyleSimplePara elsevierViewall">Relative PPARD&#44; fra-1&#44; MMP7&#44; OPG and RANKL mRNA levels in MG63 cells cultured with serum from the study subjects&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "tbl4"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="tfn3" class="elsevierStyleSimplePara elsevierViewall">AS &#61; ankylosing spondylitis&#59; RA &#61; rheumatoid arthritis&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="3" align="center" valign="middle" scope="col">Comparisons between sera of different subjects</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">AS <span class="elsevierStyleItalic">vs</span>&#46; control&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">AS <span class="elsevierStyleItalic">vs</span>&#46; RA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">RA <span class="elsevierStyleItalic">vs</span>&#46; control&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">PPARD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;035&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;028&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;234&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">fra-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;043&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;118&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">MMP7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;028&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;279&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">OPG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;002&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;315&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">RANKL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;003&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;917&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;004&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara40" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">P</span> values for comparisons of gene expression among the ankylosing&#44; rheumatoid arthritis and control serum-treated MG63 cells&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "tbl5"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="middle" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">PPARD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">fra-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">MMP7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">OPG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">RANKL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="middle" scope="col">OPG&#47;RANKL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;21&#44;&#40;0&#46;80&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;11&#44;&#40;0&#46;49&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;24&#44;&#40;0&#46;55&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;40&#44;&#40;0&#46;59&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;31&#44;&#40;0&#46;79&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;33&#44;&#40;0&#46;44&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">Symptom duration &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;16&#44;&#40;0&#46;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;34&#44;&#40;0&#46;36&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;16&#44;&#40;0&#46;79&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;25&#44;&#40;0&#46;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;41&#44;&#40;0&#46;68&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;45&#44;&#40;0&#46;39&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">BASDAI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;12&#44;&#40;0&#46;92&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;31&#44;&#40;0&#46;78&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;16&#44;&#40;0&#46;45&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;17&#44;&#40;0&#46;54&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;08&#44;&#40;0&#46;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;23&#44;&#40;0&#46;61&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">BASFI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;10&#44;&#40;0&#46;56&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;19&#44;&#40;0&#46;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;37&#44;&#40;0&#46;89&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;35&#44;&#40;0&#46;83&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;15&#44;&#40;0&#46;47&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;65&#44;&#40;0&#46;35&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">CRP &#40;mg&#47;l&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;02&#44;&#40;0&#46;90&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;21&#44;&#40;0&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;18&#44;&#40;0&#46;25&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;10&#44;&#40;0&#46;52&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;00&#44;&#40;0&#46;99&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;13&#44;&#40;0&#46;41&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="middle">ESR &#40;mm&#47;h&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;10&#44;&#40;0&#46;50&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;17&#44;&#40;0&#46;26&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;13&#44;&#40;0&#46;39&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;05&#44;&#40;0&#46;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">0&#46;11&#44;&#40;0&#46;48&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="middle">-0&#46;15&#44;&#40;0&#46;32&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tfn4"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="cenpara10">Values are the r&#44; &#40;<span class="elsevierStyleItalic">p</span>&#41; of correlation coefficient&#46; AS &#61; ankylosing spondylitis&#59; BASDAI &#61; Bath Ankylosing Spondylitis Disease Activity Index&#59; BASFI &#61; Bath Ankylosing Spondylitis Functional Index&#59; CRP &#61; C-reactive protein&#59; ESR &#61; erythrocyte sedimentation rate&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara50" class="elsevierStyleSimplePara elsevierViewall">Associations between gene expression in ankylosing spondylitis-serum treated MG63 cells and patient demographics and clinical assessments&#46;<a class="elsevierStyleCrossRef" href="#tfn4">&#42;</a></p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "REFERENCES"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec10"
          "bibliografiaReferencia" => array:33 [
            0 => array:3 [
              "identificador" => "bib1"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Rheumatoid arthritis and ankylosing spondylitis - pathology of acute inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              H Appel \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              C Loddenkemper \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              P Miossec \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "2009"
                        "volumen" => "27"
                        "numero" => "4 Suppl 55"
                        "paginaInicial" => "S15"
                        "paginaFinal" => "S19"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19822040"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib2"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Critical appraisal of assessment of structural damage in ankylosing spondylitis&#58; implications for treatment outcomes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => """
                              J Sieper \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              H Appel \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              J Braun \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              M Rudwaleit \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/art.23260"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2008"
                        "volumen" => "58"
                        "numero" => "3"
                        "paginaInicial" => "649"
                        "paginaFinal" => "656"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18311819"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/art.23260"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;art&#46;23260"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib3"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New bone formation in axial spondyloarthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => """
                              D Wendling \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              P Claudepierre \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jbspin.2013.02.004"
                      "Revista" => array:7 [
                        "tituloSerie" => "Joint Bone Spine"
                        "fecha" => "2013"
                        "volumen" => "80"
                        "numero" => "5"
                        "paginaInicial" => "454"
                        "paginaFinal" => "458"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23566662"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.jbspin.2013.02.004"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;jbspin&#46;2013&#46;02&#46;004"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib4"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Structural bone changes in spondyloarthritis&#58; mechanisms&#44; clinical impact and therapeutic considerations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => """
                              G Schett \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1097/MAJ.0b013e31820f8b29"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Med Sci"
                        "fecha" => "2011"
                        "volumen" => "341"
                        "numero" => "4"
                        "paginaInicial" => "269"
                        "paginaFinal" => "271"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21358309"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1097/MAJ.0b013e31820f8b29"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1097&#47;MAJ&#46;0b013e31820f8b29"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib5"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "To Wnt or not to Wnt&#58; the bone and joint health dilemma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              RJ Lories \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              M Corr \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              NE Lane \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1038/nrrheum.2013.25"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Rheumatol"
                        "fecha" => "2013"
                        "volumen" => "9"
                        "numero" => "6"
                        "paginaInicial" => "328"
                        "paginaFinal" => "339"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23459013"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1038/nrrheum.2013.25"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1038&#47;nrrheum&#46;2013&#46;25"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib6"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Eating bone or adding it&#58; the Wnt pathway decides"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => """
                              SR Goldring \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              MB Goldring \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1038/nm0207-133"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Med"
                        "fecha" => "2007"
                        "volumen" => "13"
                        "numero" => "2"
                        "paginaInicial" => "133"
                        "paginaFinal" => "134"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17290270"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1038/nm0207-133"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1038&#47;nm0207-133"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib7"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Targeting the Wnt&#47;-catenin pathway to regulate bone formation in the adult skeleton"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => """
                              R Baron \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              G Rawadi \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1210/en.2007-0270"
                      "Revista" => array:7 [
                        "tituloSerie" => "Endocrinology"
                        "fecha" => "2007"
                        "volumen" => "148"
                        "numero" => "6"
                        "paginaInicial" => "2635"
                        "paginaFinal" => "2643"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17395698"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1210/en.2007-0270"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1210&#47;en&#46;2007-0270"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib8"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evidence that Dkk-1 is dysfunctional in ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              D Daoussis \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              SN Liossis \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              EE Solomou \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              A Tsanaktsi \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              K Bounia \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              M Karampetsou \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/art.27231"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2010"
                        "volumen" => "62"
                        "numero" => "1"
                        "paginaInicial" => "150"
                        "paginaFinal" => "158"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20039407"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/art.27231"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;art&#46;27231"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib9"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "High level of functional Dickkopf-1 predicts protection from syndesmophyte formation in patients with ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              GR Heiland \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              H Appel \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              D Poddubnyy \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              J Zwerina \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              A Hueber \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              H Haibel \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1136/annrheumdis-2011-200216"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Rheum Dis"
                        "fecha" => "2012"
                        "volumen" => "71"
                        "numero" => "4"
                        "paginaInicial" => "572"
                        "paginaFinal" => "574"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22186710"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1136/annrheumdis-2011-200216"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1136&#47;annrheumdis-2011-200216"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib10"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Blockade of Dickkopf-1 induces fusion of sacroiliac joints"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              S Uderhardt \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              D Diarra \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              J Katzenbeisser \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              JP David \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              J Zwerina \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              WG Richards \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1136/ard.2008.102046"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Rheum Dis"
                        "fecha" => "2010"
                        "volumen" => "69"
                        "numero" => "3"
                        "paginaInicial" => "592"
                        "paginaFinal" => "597"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19304568"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1136/ard.2008.102046"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1136&#47;ard&#46;2008&#46;102046"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib11"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered skeletal expression of sclerostin and its link to radiographic progression in ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              H Appel \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              G Ruiz-Heiland \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              J Listing \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              J Zwerina \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              M Herrmann \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              R Mueller \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/art.24888"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2009"
                        "volumen" => "60"
                        "numero" => "11"
                        "paginaInicial" => "3257"
                        "paginaFinal" => "3262"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19877044"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/art.24888"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;art&#46;24888"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib12"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adalimumab significantly reduces inflammation and serum DKK-1 level but increases fatty deposition in lumbar spine in active ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              Z Hu \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              M Xu \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              Q Li \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              Z Lin \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              Z Liao \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              S Cao \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1756-185X.2012.01734.x"
                      "Revista" => array:8 [
                        "tituloSerie" => "Int J Rheum Dis"
                        "fecha" => "2012"
                        "volumen" => "15"
                        "numero" => "4"
                        "paginaInicial" => "358"
                        "paginaFinal" => "365"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22898215"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0021915013003316"
                          "estado" => "S300"
                          "issn" => "00219150"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1111/j.1756-185X.2012.01734.x"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1111&#47;j&#46;1756-185X&#46;2012&#46;01734&#46;x"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib13"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of MYC-regulated long noncoding RNAs in cell cycle regulation and tumorigenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              T Kim \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              YJ Jeon \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              R Cui \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              JH Lee \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              Y Peng \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              SH Kim \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "J Natl Cancer Inst"
                        "fecha" => "2015"
                        "volumen" => "107"
                        "numero" => "4"
                      ]
                    ]
                    1 => array:1 [
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1093&#47;jnci&#47;dju505"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib14"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide profiling of AP-1-regulated transcription provides insights into the invasiveness of triple-negative breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              C Zhao \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              Y Qiao \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              P Jonsson \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              J Wang \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              L Xu \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              P Rouhi \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1158/0008-5472.CAN-13-3396"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cancer Res"
                        "fecha" => "2014"
                        "volumen" => "74"
                        "numero" => "14"
                        "paginaInicial" => "3983"
                        "paginaFinal" => "3994"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24830720"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1158/0008-5472.CAN-13-3396"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1158&#47;0008-5472&#46;CAN-13-3396"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib15"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cyclin D1 is a strong prognostic factor for survival in pancreatic cancer&#58; analysis of CD G870A polymorphism&#44; FISH and immunohistochemistry"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              K Bachmann \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              A Neumann \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              A Hinsch \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              MF Nentwich \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              AT El Gammal \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              Y Vashist \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/jso.23826"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Surg Oncol"
                        "fecha" => "2015"
                        "volumen" => "111"
                        "numero" => "3"
                        "paginaInicial" => "316"
                        "paginaFinal" => "323"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25470788"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/jso.23826"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;jso&#46;23826"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib16"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A genome-wide association study of limb bone length using a Large White&#8201;&#215;&#8201;Minzhu intercross population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              LC Zhang \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              N Li \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              X Liu \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              J Liang \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              H Yan \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              KB Zhao \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1186/s12711-014-0056-6"
                      "Revista" => array:5 [
                        "tituloSerie" => "Genet Sel Evol"
                        "fecha" => "2014"
                        "volumen" => "46"
                        "paginaInicial" => "56"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25366846"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1186/s12711-014-0056-6"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1186&#47;s12711-014-0056-6"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib17"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A single nucleotide polymorphism on exon-4 of the gene encoding PPARdelta is associated with reduced height in adults and children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              LR Burch \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              K Zhou \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              LA Donnelly \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              AS Doney \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              J Brady \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              C Goddard \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1210/jc.2009-0392"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Endocrinol Metab"
                        "fecha" => "2009"
                        "volumen" => "94"
                        "numero" => "7"
                        "paginaInicial" => "2587"
                        "paginaFinal" => "2593"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19383774"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1210/jc.2009-0392"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1210&#47;jc&#46;2009-0392"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib18"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Wnt&#47;&#946;-catenin signaling enhances osteoblastogenic differentiation from human periodontal ligament fibroblasts"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              JS Heo \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              SY Lee \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              JC Lee \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1007/s10059-010-0139-3"
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Cells"
                        "fecha" => "2010"
                        "volumen" => "30"
                        "numero" => "5"
                        "paginaInicial" => "449"
                        "paginaFinal" => "454"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20848229"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1007/s10059-010-0139-3"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1007&#47;s10059-010-0139-3"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib19"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Metalloproteinase and tissue inhibitor of metalloproteinase expression in the murine STR&#47;ort model of osteoarthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              J Flannelly \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              MG Chambers \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              J Dudhia \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              RM Hembry \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              G Murphy \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              RM Mason \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1053/joca.2002.0818"
                      "Revista" => array:7 [
                        "tituloSerie" => "Osteoarthritis Cartilage"
                        "fecha" => "2002"
                        "volumen" => "10"
                        "numero" => "9"
                        "paginaInicial" => "722"
                        "paginaFinal" => "733"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12202125"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1053/joca.2002.0818"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1053&#47;joca&#46;2002&#46;0818"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib20"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A comprehensive manually curated reaction map of RANK&#47;RANKL-signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              R Raju \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              L Balakrishnan \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              V Nanjappa \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              M Bhattacharjee \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              D Getnet \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              B Muthusamy \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Database &#40;Oxford&#41;"
                        "fecha" => "2011"
                        "volumen" => "2011"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib21"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              DA Glass 2nd \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              P Bialek \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              JD Ahn \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              M Starbuck \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              MS Patel \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              H Clevers \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.devcel.2005.02.017"
                      "Revista" => array:7 [
                        "tituloSerie" => "Dev Cell"
                        "fecha" => "2005"
                        "volumen" => "8"
                        "numero" => "5"
                        "paginaInicial" => "751"
                        "paginaFinal" => "764"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15866165"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.devcel.2005.02.017"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;devcel&#46;2005&#46;02&#46;017"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib22"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of diagnostic criteria for ankylosing spondylitis&#58; a proposal for modification of the New York criteria"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => """
                              S Van der Linden \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              HA Valkenburg \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              A Cats \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/art.1780270401"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "1984"
                        "volumen" => "27"
                        "numero" => "4"
                        "paginaInicial" => "361"
                        "paginaFinal" => "368"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6231933"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/art.1780270401"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;art&#46;1780270401"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib23"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              FC Arnett \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              SM Edworthy \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              DA Bloch \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              DJ McShane \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              JF Fries \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              NS Cooper \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1002/art.1780310302"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "1988"
                        "volumen" => "31"
                        "numero" => "3"
                        "paginaInicial" => "315"
                        "paginaFinal" => "324"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3358796"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1002/art.1780310302"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1002&#47;art&#46;1780310302"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib24"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Standardised Nordic questionnaires for the analysis of musculoskeletal symptoms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              I Kuorinka \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              B Jonsson \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              A Kilbom \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              H Vinterberg \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              F Biering-S&#8856;rensen \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              G Andersson \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/0003-6870(87)90010-x"
                      "Revista" => array:7 [
                        "tituloSerie" => "Appl Ergon"
                        "fecha" => "1987"
                        "volumen" => "18"
                        "numero" => "3"
                        "paginaInicial" => "233"
                        "paginaFinal" => "237"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15676628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/0003-6870(87)90010-x"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;0003-6870&#40;87&#41;90010-X"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib25"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Assessments in ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => """
                              J Zochling \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              J Braun \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.berh.2007.02.010"
                      "Revista" => array:7 [
                        "tituloSerie" => "Best Pract Res Clin Rheumatol"
                        "fecha" => "2007"
                        "volumen" => "21"
                        "numero" => "4"
                        "paginaInicial" => "699"
                        "paginaFinal" => "712"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17678831"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.berh.2007.02.010"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;berh&#46;2007&#46;02&#46;010"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib26"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A new approach to defining functional ability in ankylosing spondylitis&#58; the development of the Bath Ankylosing Spondylitis Functional Index"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              A Calin \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              S Garrett \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              H Whitelock \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              LG Kennedy \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              J O&#39;Hea \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              P Mallorie \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "1994"
                        "volumen" => "21"
                        "numero" => "12"
                        "paginaInicial" => "2281"
                        "paginaFinal" => "2285"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7699629"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib27"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of the Wnt&#47;&#946;-catenin pathway in the effect of implant topography on MG63 differentiation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => """
                              W Wang \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              L Zhao \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              Q Ma \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              Q Wang \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              PK Chu \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              Y Zhang \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biomaterials.2012.07.064"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biomaterials"
                        "fecha" => "2012"
                        "volumen" => "33"
                        "numero" => "32"
                        "paginaInicial" => "7993"
                        "paginaFinal" => "8002"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22889483"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1016/j.biomaterials.2012.07.064"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1016&#47;j&#46;biomaterials&#46;2012&#46;07&#46;064"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib28"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The novel arylindolylmaleimide PDA-66 displays pronounced antiproliferative effects in acute lymphoblastic leukemia cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              C Kretzschmar \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              C Roolf \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              TS Langhammer \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              A Sekora \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              A Pews-Davtyan \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              M Beller \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1186/1471-2407-14-71"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMC Cancer"
                        "fecha" => "2014"
                        "volumen" => "14"
                        "paginaInicial" => "71"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24502201"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0085253815000150"
                          "estado" => "S300"
                          "issn" => "00852538"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1186/1471-2407-14-71"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1186&#47;1471-2407-14-71"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib29"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-27a targets sFRP1 in hFOB cells to regulate proliferation&#44; apoptosis and differentiation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => """
                              D Guo \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              Q Li \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              Q Lv \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              Q Wei \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              S Cao \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              J Gu \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2014"
                        "volumen" => "9"
                        "numero" => "3"
                      ]
                    ]
                    1 => array:1 [
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1371&#47;journal&#46;pone&#46;0091354"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib30"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fetuin-A is related to syndesmophytes in patients with ankylosing spondylitis&#58; a case control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              T Tuylu \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              I Sari \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              D Solmaz \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              DL Kozaci \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              S Akar \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              N Gunay \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.6061/clinics/2014(10)07"
                      "Revista" => array:7 [
                        "tituloSerie" => "Clinics"
                        "fecha" => "2014"
                        "volumen" => "69"
                        "numero" => "10"
                        "paginaInicial" => "688"
                        "paginaFinal" => "693"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25518021"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.6061/clinics/2014(10)07"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;6061&#47;clinics&#47;2014&#40;10&#41;07"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib31"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sclerostin and Dkk-1 in patients with ankylosing spondylitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              N Ustun \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              F Tok \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              U Kalyoncu \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              S Motor \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              R Yuksel \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              AE Yagiz \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Acta Reumatol Port"
                        "fecha" => "2014"
                        "volumen" => "39"
                        "numero" => "2"
                        "paginaInicial" => "146"
                        "paginaFinal" => "151"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25111416"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib32"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biomarkers of bone metabolism in ankylosing spondylitis in relation to osteoproliferation and osteoporosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => """
                              E Klingberg \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              M Nurkkala \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              H Carlsten \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              H Forsblad-d&#39;Elia \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.3899/jrheum.131199"
                      "Revista" => array:8 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "2014"
                        "volumen" => "41"
                        "numero" => "7"
                        "paginaInicial" => "1349"
                        "paginaFinal" => "1356"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24931960"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0085253816304690"
                          "estado" => "S300"
                          "issn" => "00852538"
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.3899/jrheum.131199"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;3899&#47;jrheum&#46;131199"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib33"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dickkopf-1 level is lower in patients with ankylosing spondylitis than in healthy people and is not influenced by anti-tumor necrosis factor therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => """
                              SR Kwon \n
                              \t\t\t\t\t\t\t\t
                              """
                            1 => """
                              MJ Lim \n
                              \t\t\t\t\t\t\t\t
                              """
                            2 => """
                              CH Suh \n
                              \t\t\t\t\t\t\t\t
                              """
                            3 => """
                              SG Park \n
                              \t\t\t\t\t\t\t\t
                              """
                            4 => """
                              YS Hong \n
                              \t\t\t\t\t\t\t\t
                              """
                            5 => """
                              BY Yoon \n
                              \t\t\t\t\t\t\t\t
                              """
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:2 [
                    0 => array:2 [
                      "doi" => "10.1007/s00296-011-1981-0"
                      "Revista" => array:7 [
                        "tituloSerie" => "Rheumatol Int"
                        "fecha" => "2012"
                        "volumen" => "32"
                        "numero" => "8"
                        "paginaInicial" => "2523"
                        "paginaFinal" => "2527"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21833531"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                    1 => array:2 [
                      "doi" => "10.1007/s00296-011-1981-0"
                      "WWW" => array:1 [
                        "link" => "http&#58;&#47;&#47;dx&#46;doi&#46;org&#47;10&#46;1007&#47;s00296-011-1981-0"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack639247"
        "titulo" => "ACKNOWLEDGMENTS"
        "texto" => "<p id="para200" class="elsevierStylePara elsevierViewall">This study was supported by the Medical Scientific Research Foundation of Guangdong Province &#40;B2014142&#41;&#44; the National Natural Science Foundation of China &#40;81373181&#41; and 5010 Subject of Sun Yat-sen University &#40;2007023&#41;&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/18075932/0000007000000011/v1_202212011342/S1807593222013175/v1_202212011342/en/main.assets"
  "Apartado" => null
  "PDF" => "https://static.elsevier.es/multimedia/18075932/0000007000000011/v1_202212011342/S1807593222013175/v1_202212011342/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222013175?idApp=UINPBA00004N"
]

Article information

ISSN: 18075932
Original language: English

DOI:10.6061/clinics/2015(11)04

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	9	1	10
2024 October	34	29	63
2024 September	25	32	57
2024 August	19	23	42
2024 July	26	22	48
2024 June	22	11	33
2024 May	53	17	70
2024 April	24	11	35
2024 March	26	16	42
2024 February	10	10	20
2024 January	11	14	25
2023 December	13	14	27
2023 November	23	17	40
2023 October	15	20	35
2023 September	14	10	24
2023 August	7	3	10
2023 July	6	11	17
2023 June	5	10	15
2023 May	3	11	14
2023 April	4	2	6
2023 March	4	3	7
2023 February	0	1	1
2023 January	5	4	9
2022 December	11	2	13

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter