CASE REPORT
Novel compound aquaporin 2 mutations in nephrogenic diabetes insipidus
Read
759
Timeswas read the article
290
Total PDF
469
Total HTML
Share statistics
array:24 [ "pii" => "S1807593222022876" "issn" => "18075932" "doi" => "10.6061/clinics/2012(01)13" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "2287" "copyright" => "CLINICS" "copyrightAnyo" => "2012" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "crp" "cita" => "Clinics. 2012;67:79-82" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S1807593222022888" "issn" => "18075932" "doi" => "10.6061/clinics/2012(01)14" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "2288" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "crp" "cita" => "Clinics. 2012;67:83-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:10 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">CASE REPORT</span>" "titulo" => "Intravascular leiomyoma with heart extension" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "83" "paginaFinal" => "87" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 643 "Ancho" => 425 "Tamanyo" => 85307 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">(<span class="elsevierStyleBold">A</span>) A preoperative sagittal computed tomography (CT) scan showing a mass (leiomyoma) extending from the right internal iliac vein to the right atrium. Figures A-1 to A-7 show the transverse CT scans of the areas indicated in A. (<span class="elsevierStyleBold">A-1 and A-2</span>) The intracardiac tumor. (<span class="elsevierStyleBold">A-3</span> to <span class="elsevierStyleBold">A-4</span>) The intracaval tumor. Note that both kidneys presented with multiple cysts. (<span class="elsevierStyleBold">A-5</span>) The severely dilated inferior vena cava (11 cm). (<span class="elsevierStyleBold">A-6</span>) The multilobulated pelvic tumor with intense vascularization. (<span class="elsevierStyleBold">A-7</span>) The intrailiac tumor. (<span class="elsevierStyleBold">B-H</span>) The postoperative CT scans, showing absence of the tumor and a normal-diameter inferior vena cava. <span class="elsevierStyleItalic">I-HVC</span>, intrahepatic vena cava; <span class="elsevierStyleItalic">IVC</span>, inferior vena cava; <span class="elsevierStyleItalic">RA</span>, right atrium; <span class="elsevierStyleItalic">RHC</span>, right heart chambers; <span class="elsevierStyleItalic">RV</span>, right ventricle; <span class="elsevierStyleItalic">yellow arrow</span>, tumor localization; <span class="elsevierStyleItalic">black arrow</span>, vessel lumen.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Marcia Maria Morales, Alexandre Anacleto, João Carlos Leal, Sérgio Carvalho, Jerônimo Del'Arco" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Marcia Maria" "apellidos" => "Morales" ] 1 => array:2 [ "nombre" => "Alexandre" "apellidos" => "Anacleto" ] 2 => array:2 [ "nombre" => "João Carlos" "apellidos" => "Leal" ] 3 => array:2 [ "nombre" => "Sérgio" "apellidos" => "Carvalho" ] 4 => array:2 [ "nombre" => "Jerônimo" "apellidos" => "Del'Arco" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222022888?idApp=UINPBA00004N" "url" => "/18075932/0000006700000001/v1_202212011621/S1807593222022888/v1_202212011621/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1807593222022864" "issn" => "18075932" "doi" => "10.6061/clinics/2012(01)12" "estado" => "S300" "fechaPublicacion" => "2012-01-01" "aid" => "2286" "copyright" => "CLINICS" "documento" => "article" "crossmark" => 0 "licencia" => "https://creativecommons.org/licenses/by-nc/3.0/" "subdocumento" => "crp" "cita" => "Clinics. 2012;67:77-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:9 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">CASE REPORT</span>" "titulo" => "Narcolepsy after A/H1N1 vaccination" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "77" "paginaFinal" => "78" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Mirian Fabiola Studart Gurgel Mendes, Dirceu de Campos Valladares Neto, Rosângela Aparecida de Azevedo, Paulo Caramelli" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Mirian Fabiola Studart Gurgel" "apellidos" => "Mendes" ] 1 => array:2 [ "nombre" => "Dirceu" "apellidos" => "de Campos Valladares Neto" ] 2 => array:2 [ "nombre" => "Rosângela Aparecida" "apellidos" => "de Azevedo" ] 3 => array:2 [ "nombre" => "Paulo" "apellidos" => "Caramelli" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222022864?idApp=UINPBA00004N" "url" => "/18075932/0000006700000001/v1_202212011621/S1807593222022864/v1_202212011621/en/main.assets" ] "en" => array:15 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">CASE REPORT</span>" "titulo" => "Novel compound aquaporin 2 mutations in nephrogenic diabetes insipidus" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "79" "paginaFinal" => "82" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Raphael D. Liberatore, Juliana G. Carneiro, Franciele B. Leidenz, Rachel Melilo-Carolino, Helena C. Sarubi, Luiz De Marco" "autores" => array:6 [ 0 => array:4 [ "nombre" => "Raphael D." "apellidos" => "Liberatore" "sufijo" => "Junior" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">I</span>" "identificador" => "aff1" ] ] ] 1 => array:3 [ "nombre" => "Juliana G." "apellidos" => "Carneiro" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] ] ] 2 => array:3 [ "nombre" => "Franciele B." "apellidos" => "Leidenz" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] ] ] 3 => array:3 [ "nombre" => "Rachel" "apellidos" => "Melilo-Carolino" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] ] ] 4 => array:3 [ "nombre" => "Helena C." "apellidos" => "Sarubi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] ] ] 5 => array:4 [ "nombre" => "Luiz" "apellidos" => "De Marco" "email" => array:1 [ 0 => "ldemarco@ufmg.br" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">II</span>" "identificador" => "aff2" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor1" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Faculdade de Medicina de São José do Rio Preto, Department of Pediatrics, São José do Rio /SP, Brazil." "etiqueta" => "I" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Universidade Federal de Minas Gerais, Faculdade de Medicina, Department of Surgery, Belo Horizonte/MG, Brazil." "etiqueta" => "II" "identificador" => "aff2" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "*" "correspondencia" => "Tel.: 55 31 3409-9134" ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 785 "Ancho" => 465 "Tamanyo" => 79293 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">(a) Pedigree of the Brazilian family with NDI; the proband is indicated by an arrow. An open square with an inset (N) indicates that the individual was unaffected. (b) c.491T>C polymorphism; (c and e) heterozygosis at c.601C>T (H201Y) of the proband and her mother; and (d and f) heterozygosis at c.697C>G (G211R) of the proband and her father.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="cesec10" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle10">INTRODUCTION</span><p id="para10" class="elsevierStylePara elsevierViewall">Nephrogenic diabetes insipidus (NDI) is a rare disease that is characterized by the excretion of abnormally large volumes of urine, due to the inability of the kidneys to concentrate urine in response to arginine vasopressin (AVP). Classical NDI symptoms include polydipsia and polyuria in infants during the first year of life. Acquired NDI is the most common form of this disease in adults. The majority of inherited cases are caused by mutations in the arginine vasopressin V2 receptor (<span class="elsevierStyleItalic">AVPR2)</span> gene (MIM# 300538) on chromosome Xq28, which leads to functional defects in the AVPR2. The aquaporin (<span class="elsevierStyleItalic">AQP2)</span> gene (MIM# 107777) on chromosome 12q13 (<a class="elsevierStyleCrossRef" href="#bib1">1</a>) is associated with the disease (<a class="elsevierStyleCrossRef" href="#bib2">2</a>,<a class="elsevierStyleCrossRef" href="#bib3">3</a>) in the minority of cases (∼10%). The present study identified two novel compound heterozygous mutations in the <span class="elsevierStyleItalic">AQP2</span> gene, H201Y and G211R, in one female patient with congenital NDI.</p></span><span id="cesec20" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle20">CASE REPORT</span><p id="para20" class="elsevierStylePara elsevierViewall">A breastfeeding two-month-old girl was admitted to the emergency room after 12 days of fever of unknown origin and weight loss. The patient had received 20 μg of 1-desamino[8-D-arginine]vasopressin (dDAVP) intranasally, but this intervention did not decrease her urine output. Physical examination revealed a severely dehydrated and highly irritable infant with no other clinical abnormalities. The infant's height-for-age ratio was in the 3<span class="elsevierStyleSup">rd</span> percentile, and her initial laboratory profile revealed hypernatremia (172 mEq/ml) and a low urine density (1.005). The patient's basal sodium was within the normal range after an increase in her fluid intake and a low sodium diet, and she was subjected to laboratory investigation to ascertain the diagnosis of NDI according to established criteria (<a class="elsevierStyleCrossRef" href="#bib4">4</a>). A short water deprivation test was performed under a strictly controlled medical setting, but this test was stopped six hours later because of weight loss (3%). Her urinary osmolality was 263 mOsmol/kg at six hours and increased to 300 mOsmol/kg one hour after dDAVP administration (20 μg intranasally). The patient was allowed water after the administration of dDAVP. The T1-weighted images from a brain MRI did not reveal the hyperintense signal that is normally emitted by the posterior pituitary gland (i.e., there was no “bright spot”). The child's parents were also subjected to diagnostic procedures to exclude nephrogenic diabetes insipidus. The patient was the second child of a healthy young and non-consanguineous couple with no diabetes insipidus symptoms. The patient was a postfertilization baby for whom the female sex had been chosen, and her older brother had hemophilia. The family pedigree is shown in <a class="elsevierStyleCrossRef" href="#fig1">Figure 1a</a>. Hydrochlorothiazide (5 mg/kg/twice daily) and amiloride (20 mg/m<span class="elsevierStyleSup">2</span>/day) were initiated, but only a partial response was observed; namely, the patient's basal urine osmolality increased to 456 mOsmol/kg two weeks after the initiation of these two medications. A remission of symptoms occurred when indomethacin (1.0 mg/kg/day) was subsequently added. Two weeks after initial administration of this medication, the patient's urine osmolality rose to 587 mOsmol/kg. The patient's height-for-age ratio was in the 50<span class="elsevierStyleSup">th</span> percentile at age four, while she was under careful surveillance and receiving medications.</p><elsevierMultimedia ident="fig1"></elsevierMultimedia><p id="para30" class="elsevierStylePara elsevierViewall">The parents signed an informed consent that was approved by the Institutional Ethics Committee in accordance with the ethical standards of the 1964 Declaration of Helsinki.</p></span><span id="cesec30" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle30">MATERIALS AND METHODS</span><p id="para40" class="elsevierStylePara elsevierViewall">Whole blood cells were collected from the patient and her parents for molecular analyses. Genomic DNA was isolated using the Wizard Genome DNA Purification Kit® (Promega, Madison, WI) according to the manufacturer's instructions. All coding and flanking regions of all exons of the <span class="elsevierStyleItalic">AVPR2</span> gene were amplified by PCR using previously described sets of primers (<a class="elsevierStyleCrossRef" href="#bib5">5</a>). The <span class="elsevierStyleItalic">AQP2</span> gene oligonucleotides included the following sequences: exon 1, forward CATCCTGGCCCTGAGACA, reverse TACAAGGGATTCCCCAGGAC; exon 2, forward GACAGGAAGATGGAGCCAGA, reverse TGGAGTGGTCTGTGTGTCTGT; exon 3, forward ACAAGGACTTCCTGCCCTGT, reverse TCCCATGCTATTCCAGCTCT; and exon 4, forward TAATGTCGGGGAGGAGAGGT, reverse CACGTCCAGGAAGCAGCTA. Briefly, PCR was performed in a final volume of 25 μl containing IIB Buffer 10x, 0.2 mM dNTP, 10 pmol of each primer, 0.625 U <span class="elsevierStyleItalic">Taq polymerase</span> and 60 ng/μl DNA. PCR products were purified using the GFX PCR DNA and Gel Purification Kit (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturer's instructions and sequenced in an ABI Prism® 3130 Genetic Analyzer using the ABI Prism Dye Terminator sequencing kit (Applied Biosystems, Foster City, CA) according to the standard protocol. Sequences were performed in the sense and antisense directions in duplicate using separate DNA extractions.</p></span><span id="cesec40" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle40">RESULTS</span><p id="para50" class="elsevierStylePara elsevierViewall">A diagnosis of NDI due to mutations of the <span class="elsevierStyleItalic">AVPR2</span> gene was excluded based on the patient's sex, although certain female carriers have a partial response to dDAVP due to skewed X-chromosome inactivation (<a class="elsevierStyleCrossRef" href="#bib6">6</a>), and also based on the direct sequencing of the entire coding and exon-flanking gene regions, which demonstrated a wild-type sequence. Sequencing analyses of all four <span class="elsevierStyleItalic">AQP2</span> exons revealed that the patient was a compound heterozygote with two novel point mutations in exons 3 and 4. One point mutation was a C-to-T transversion at position 601 (c.601C>T) in exon 3 (H201Y) (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1c</a>), which was inherited from her mother (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1e</a>), and a C to G transition at position 697 (c.697C>G) in exon 4 (G211R) (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1d</a>), which was inherited from her father (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1f</a>). A previously described polymorphism at position 491 (c.491T>C; S167S) was also present (<a class="elsevierStyleCrossRef" href="#fig1">Figure 1b</a>). Neither parent exhibited any clinical or biochemical signs of diabetes insipidus.</p></span><span id="cesec50" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cestitle50">DISCUSSION</span><p id="para60" class="elsevierStylePara elsevierViewall">This report described two novel missense mutations in a heterozygote female infant with inherited NDI. Severe polyuria and polydipsia began soon after birth, and these findings in association with the child's sex and the failure of dDAVP to relieve symptoms suggested that NDI was caused by mutation(s) of the <span class="elsevierStyleItalic">AQP2</span> gene. A full mutation analysis of the AVP receptor gene demonstrated no germline mutations. NDI that is caused by mutations in the <span class="elsevierStyleItalic">AQP2</span> gene are inherited as either an autosomal recessive or a dominant trait (<a class="elsevierStyleCrossRef" href="#bib7">7</a>,<a class="elsevierStyleCrossRef" href="#bib8">8</a>). The sequencing analyses of the <span class="elsevierStyleItalic">AQP2</span> gene in our patient revealed a compound heterozygosity that was inherited from both parents. Heterozygote mutation carriers are not affected. Therefore, no clinically important phenotype was expected or observed in the patient's parents. Interestingly, the patient's height-for-age ratio at age four was within the normal range. Patients with mutations in the <span class="elsevierStyleItalic">AQP2</span> gene have a short (<a class="elsevierStyleCrossRef" href="#bib9">9</a>) or normal stature (<a class="elsevierStyleCrossRef" href="#bib10">10</a>,<a class="elsevierStyleCrossRef" href="#bib11">11</a>). The response to therapy in this child was notably better than the response of other patients with autosomal-recessive NDI due to <span class="elsevierStyleItalic">AQP2</span> gene mutations. The reasons for this improved response are not known, but the presence of a compound heterozygote mutation may underlie this unusually good response.</p><p id="para70" class="elsevierStylePara elsevierViewall">The human <span class="elsevierStyleItalic">AQP2</span> gene is located on chromosome 12q13. This gene has four exons and three introns, and it is predicted to code a 271-amino-acid protein. AQP2 is a single polypeptide chain with six transmembrane domains, which is similar to other aquaporins, and both terminal ends are located inside the cell (<a class="elsevierStyleCrossRef" href="#bib3">3</a>). The first intracellular and the third extracellular loops contain the asparagine-proline-alanine (NPA) motif that is conserved in all members of the membrane integral protein (MIP) family. This motif may play a role in the formation of functional water-selective pores, but it is no longer thought to confer water selectivity (<a class="elsevierStyleCrossRef" href="#bib12">12</a>). In addition, the phosphorylation of serine at position 256 by PKA in the cytoplasmic COOH-terminus of AQP2 is essential for its distribution from intracellular vesicles to the apical plasma membrane (<a class="elsevierStyleCrossRef" href="#bib13">13</a>,<a class="elsevierStyleCrossRef" href="#bib14">14</a>).</p><p id="para80" class="elsevierStylePara elsevierViewall">To date, 66 distinct <span class="elsevierStyleItalic">AQP2</span> gene mutations have been described, and the vast majority (86%) of these mutations are associated with an autosomal recessive mode of transmission (MIM #125800). Several compound mutations within this gene have also been described (<a class="elsevierStyleCrossRef" href="#bib6">6</a>,<a class="elsevierStyleCrossRef" href="#bib9">9</a>,<a class="elsevierStyleCrossRef" href="#bib11">11</a>,<a class="elsevierStyleCrossRefs" href="#bib15">15–19</a>). Most mutations in patients with autosomal-recessive NDI are localized between the first and the last transmembrane domains. This segment forms the AQP2 water pore, and the mutation-induced misfolding illustrates the sensitivity of the pore to structural changes (<a class="elsevierStyleCrossRef" href="#bib14">14</a>). A compound recessive mutation has been described previously in a female patient in which one of the mutations was located in the conserved region of the last transmembrane domain of AQP2, and this mutation resulted in a misfolded protein (<a class="elsevierStyleCrossRef" href="#bib6">6</a>).</p><p id="para90" class="elsevierStylePara elsevierViewall">The mutations in our analysis, H201Y and G211R, were located on the extracellular and transmembrane domains, respectively, and these domains are probably critical for protein function. Both histidine 201 and glycine 211 are highly conserved amino acids between species. The wild-type glycine, which is the smallest amino acid, is located next to proline, which is responsible for protein folding. The mutations resulting from a substitution of tyrosine (uncharged polar amino acid) for histidine and arginine for glycine severely alter AQP2 structure and disrupt water absorption.</p><p id="para100" class="elsevierStylePara elsevierViewall">In conclusion, this study described a compound heterozygosity that was characterized by two novel mutations in <span class="elsevierStyleItalic">AQP2</span> exons 3 and 4 in an infant female patient. These combined mutations probably caused a disruption in the protein, but functional studies are necessary to understand the effects of these mutations on AQP2.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:7 [ 0 => array:2 [ "identificador" => "cesec10" "titulo" => "INTRODUCTION" ] 1 => array:2 [ "identificador" => "cesec20" "titulo" => "CASE REPORT" ] 2 => array:2 [ "identificador" => "cesec30" "titulo" => "MATERIALS AND METHODS" ] 3 => array:2 [ "identificador" => "cesec40" "titulo" => "RESULTS" ] 4 => array:2 [ "identificador" => "cesec50" "titulo" => "DISCUSSION" ] 5 => array:2 [ "identificador" => "xack639469" "titulo" => "ACKNOWLEDGMENTS" ] 6 => array:1 [ "titulo" => "REFERENCES" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "NotaPie" => array:1 [ 0 => array:1 [ "nota" => "<p class="elsevierStyleNotepara" id="cenpara10">No potential conflict of interest was reported.</p> <p class="elsevierStyleNotepara" id="cenpara20">Liberator Jr. RD was responsible for thepatient care. Carneiro JG, Leidenz FB, Melilo-Carolino R, Sarubi HC were responsible for the experimental work. De Marco L was responsible for the experimental design and manuscript writing.</p>" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 785 "Ancho" => 465 "Tamanyo" => 79293 ] ] "descripcion" => array:1 [ "en" => "<p id="spara10" class="elsevierStyleSimplePara elsevierViewall">(a) Pedigree of the Brazilian family with NDI; the proband is indicated by an arrow. An open square with an inset (N) indicates that the individual was unaffected. (b) c.491T>C polymorphism; (c and e) heterozygosis at c.601C>T (H201Y) of the proband and her mother; and (d and f) heterozygosis at c.697C>G (G211R) of the proband and her father.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "REFERENCES" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec10" "bibliografiaReferencia" => array:19 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cloning, characterization, and chromosomal mapping of human aquaporin of collecting duct" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ S Sasaki \n \t\t\t\t\t\t\t\t """ 1 => """ K Fushimi \n \t\t\t\t\t\t\t\t """ 2 => """ H Saito \n \t\t\t\t\t\t\t\t """ 3 => """ F Saito \n \t\t\t\t\t\t\t\t """ 4 => """ S Uchida \n \t\t\t\t\t\t\t\t """ 5 => """ K Ishibashi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Clin Invest" "fecha" => "1994" "volumen" => "93" "paginaInicial" => "6" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1172/JCI117079" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ PMT Deen \n \t\t\t\t\t\t\t\t """ 1 => """ MAJ Verdijk \n \t\t\t\t\t\t\t\t """ 2 => """ NVAM Knoers \n \t\t\t\t\t\t\t\t """ 3 => """ B Wieringa \n \t\t\t\t\t\t\t\t """ 4 => """ LAH Monnens \n \t\t\t\t\t\t\t\t """ 5 => """ CH van Os \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Science" "fecha" => "1994" "volumen" => "264" "paginaInicial" => "4" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1126/science.8140421" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular biology of hereditary diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ TM Fujiwara \n \t\t\t\t\t\t\t\t """ 1 => """ DG Bichet \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1681/ASN.2004080660" "Revista" => array:5 [ "tituloSerie" => "J Am Soc Nephrol" "fecha" => "2005" "volumen" => "16" "paginaInicial" => "46" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15563559" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1681/ASN.2004080660" "WWW" => array:1 [ "link" => "10.1681/ASN.2005040371" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ JM Sands \n \t\t\t\t\t\t\t\t """ 1 => """ DG Bichet \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7326/0003-4819-144-2-200601170-00006" "Revista" => array:5 [ "tituloSerie" => "Ann Intern Med" "fecha" => "2006" "volumen" => "144" "paginaInicial" => "94" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16418408" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Novel vasopressin type 2 (AVPR2) gene mutations in Brazilian nephrogenic diabetes insipidus patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ WL Boson \n \t\t\t\t\t\t\t\t """ 1 => """ T Della Manna \n \t\t\t\t\t\t\t\t """ 2 => """ D Damiani \n \t\t\t\t\t\t\t\t """ 3 => """ DM Miranda \n \t\t\t\t\t\t\t\t """ 4 => """ MR Gadelha \n \t\t\t\t\t\t\t\t """ 5 => """ B Liberman \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Genet Test" "fecha" => "2006" "volumen" => "10" "paginaInicial" => "62" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1089/gte.2006.10.157" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular biology of hereditary diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => """ TM Fujiwara \n \t\t\t\t\t\t\t\t """ 1 => """ DG Bichet \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:2 [ "doi" => "10.1681/ASN.2004080660" "Revista" => array:5 [ "tituloSerie" => "J Am Soc Nephrol" "fecha" => "2005" "volumen" => "16" "paginaInicial" => "46" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15563559" "web" => "Medline" ] ] ] ] 1 => array:2 [ "doi" => "10.1681/ASN.2004080660" "WWW" => array:1 [ "link" => "10.1681/ASN.2005040371" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Patients with autosomal nephrogenic diabetes insipidus homozygous for mutations in the aquaporin 2 water-channel gene" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ AF van Lieburg \n \t\t\t\t\t\t\t\t """ 1 => """ MAJ Verdijk \n \t\t\t\t\t\t\t\t """ 2 => """ VVAM Knoers \n \t\t\t\t\t\t\t\t """ 3 => """ AJ van Essen \n \t\t\t\t\t\t\t\t """ 4 => """ W Proesmans \n \t\t\t\t\t\t\t\t """ 5 => """ R Mallmann \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Am J Hum Genet" "fecha" => "1994" "volumen" => "55" "paginaInicial" => "52" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An aquaporin-2 water channel mutant which causes autosomal dominant nephrogenic diabetes insipidus is retained in the Golgi complex" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ SM Mulders \n \t\t\t\t\t\t\t\t """ 1 => """ DG Bichet \n \t\t\t\t\t\t\t\t """ 2 => """ JPL Rijss \n \t\t\t\t\t\t\t\t """ 3 => """ E-J Kamsteeg \n \t\t\t\t\t\t\t\t """ 4 => """ M-F Arthus \n \t\t\t\t\t\t\t\t """ 5 => """ M Lonergan \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Clin Invest" "fecha" => "1998" "volumen" => "102" "paginaInicial" => "66" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1172/JCI2605" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cell-biologic and functional analyses of five new aquaporin-2 missense mutations that cause recessive nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ N Marr \n \t\t\t\t\t\t\t\t """ 1 => """ DG Bichet \n \t\t\t\t\t\t\t\t """ 2 => """ S Hoefs \n \t\t\t\t\t\t\t\t """ 3 => """ PJ Savelkoul \n \t\t\t\t\t\t\t\t """ 4 => """ IB Konings \n \t\t\t\t\t\t\t\t """ 5 => """ F De Mattia \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Am Soc Nephrol" "fecha" => "2002" "volumen" => "13" "paginaInicial" => "77" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1097/01.ASN.0000027355.41663.14" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Novel mutation of <span class="elsevierStyleItalic">aquaporin-2</span> gene in a patient with congenital nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ S-S Moon \n \t\t\t\t\t\t\t\t """ 1 => """ H-J Kim \n \t\t\t\t\t\t\t\t """ 2 => """ Y-K Choi \n \t\t\t\t\t\t\t\t """ 3 => """ H-A Seo \n \t\t\t\t\t\t\t\t """ 4 => """ J-H Jeon \n \t\t\t\t\t\t\t\t """ 5 => """ J-E Lee \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Endocr J" "fecha" => "2009" "volumen" => "56" "paginaInicial" => "10" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1507/endocrj.K09E-078" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Compound heterozygous mutation of aquaporin 2 gene in woman patient with congenital nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ Z Tsutsumi \n \t\t\t\t\t\t\t\t """ 1 => """ T Inokuchi \n \t\t\t\t\t\t\t\t """ 2 => """ D Tamada \n \t\t\t\t\t\t\t\t """ 3 => """ Y Moriwaki \n \t\t\t\t\t\t\t\t """ 4 => """ T Ka \n \t\t\t\t\t\t\t\t """ 5 => """ S Takahashi \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Intern Med" "fecha" => "2009" "volumen" => "48" "paginaInicial" => "40" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.2169/internalmedicine.48.1642" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Point mutations in the aromatic/arginine region in aquaporin 1 allow passage of urea, glycerol, ammonia, and protons" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ E Beitz \n \t\t\t\t\t\t\t\t """ 1 => """ B Wu \n \t\t\t\t\t\t\t\t """ 2 => """ LM Holm \n \t\t\t\t\t\t\t\t """ 3 => """ JE Schultz \n \t\t\t\t\t\t\t\t """ 4 => """ T Zeuthen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Proc Natl Acad Sci U S A" "fecha" => "2006" "volumen" => "103" "paginaInicial" => "74" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1073/pnas.0507225103" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The C-terminal tail of aquaporin-2 determines apical trafficking" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => """ M Kuwahara \n \t\t\t\t\t\t\t\t """ 1 => """ T Asai \n \t\t\t\t\t\t\t\t """ 2 => """ Y Terada \n \t\t\t\t\t\t\t\t """ 3 => """ S Sasaki \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Kidney Int" "fecha" => "2005" "volumen" => "68" "paginaInicial" => "2009" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1111/j.1523-1755.2005.00654.x" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => """ JH Robben \n \t\t\t\t\t\t\t\t """ 1 => """ NV Knoers \n \t\t\t\t\t\t\t\t """ 2 => """ PM Deen \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Am J Physiol Renal Physiol" "fecha" => "2006" "volumen" => "291" "paginaInicial" => "F270" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1152/ajprenal.00491.2005" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Two novel aquaporin-2 mutations in a sporadic Japanese patient with autosomal recessive nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => """ T Tajima \n \t\t\t\t\t\t\t\t """ 1 => """ K Okuhara \n \t\t\t\t\t\t\t\t """ 2 => """ K Satoh \n \t\t\t\t\t\t\t\t """ 3 => """ J Nakae \n \t\t\t\t\t\t\t\t """ 4 => """ K Fujieda \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Endocr J" "fecha" => "2003" "volumen" => "50" "paginaInicial" => "6" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1507/endocrj.50.473" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Two novel mutations in the aquaporin 2 gene in a girl with congenital nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ HI Cheong \n \t\t\t\t\t\t\t\t """ 1 => """ SJ Cho \n \t\t\t\t\t\t\t\t """ 2 => """ SH Zheng \n \t\t\t\t\t\t\t\t """ 3 => """ HY Cho \n \t\t\t\t\t\t\t\t """ 4 => """ IS Ha \n \t\t\t\t\t\t\t\t """ 5 => """ Y Chou \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Korean Med Sci" "fecha" => "2005" "volumen" => "20" "paginaInicial" => "8" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.3346/jkms.2005.20.6.1076" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of two novel missense mutations in the AQP2 gene causing nephrogenic diabetes insipidus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ A Iolascon \n \t\t\t\t\t\t\t\t """ 1 => """ V Aglio \n \t\t\t\t\t\t\t\t """ 2 => """ G Tamma \n \t\t\t\t\t\t\t\t """ 3 => """ M D'Apolito \n \t\t\t\t\t\t\t\t """ 4 => """ F Addabbo \n \t\t\t\t\t\t\t\t """ 5 => """ G Procino \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Nephron Physiol" "fecha" => "2007" "volumen" => "105" "paginaInicial" => "41" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1159/000098136" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Functional characterization of vasopressin receptor 2 mutations causing partial and complete congenital nephrogenic diabetes insipidus in Thai families" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => """ T Sahakitrungruang \n \t\t\t\t\t\t\t\t """ 1 => """ MK Tee \n \t\t\t\t\t\t\t\t """ 2 => """ N Rattanachartnarong \n \t\t\t\t\t\t\t\t """ 3 => """ V Shotelersuk \n \t\t\t\t\t\t\t\t """ 4 => """ K Suphapeetiporn \n \t\t\t\t\t\t\t\t """ 5 => """ WL Miller \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Horm Res Paediatr" "fecha" => "2010" "volumen" => "73" "paginaInicial" => "54" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1159/000308167" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New autosomal recessive mutations in aquaporin-2 causing nephrogenic diabetes insipidus through deficient targeting display normal expression in Xenopus oocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => """ A Leduc-Nadeau \n \t\t\t\t\t\t\t\t """ 1 => """ Y Lussier \n \t\t\t\t\t\t\t\t """ 2 => """ MF Arthus \n \t\t\t\t\t\t\t\t """ 3 => """ M Lonergan \n \t\t\t\t\t\t\t\t """ 4 => """ A Martinez-Aguayo \n \t\t\t\t\t\t\t\t """ 5 => """ E Riveira-Munoz \n \t\t\t\t\t\t\t\t """ ] ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Physiol" "fecha" => "2010" "volumen" => "588" "paginaInicial" => "18" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "10.1113/jphysiol.2010.187674" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack639469" "titulo" => "ACKNOWLEDGMENTS" "texto" => "<p id="para110" class="elsevierStylePara elsevierViewall">We thank the patient and her family for their cooperation. We also thank Dr. Eitan Friedman for helpful comments. This work was funded by grants from the CNPq, FAPEMIG and INCT em Medicina Molecular, Brazil.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/18075932/0000006700000001/v1_202212011621/S1807593222022876/v1_202212011621/en/main.assets" "Apartado" => null "PDF" => "https://static.elsevier.es/multimedia/18075932/0000006700000001/v1_202212011621/S1807593222022876/v1_202212011621/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593222022876?idApp=UINPBA00004N" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 6 | 0 | 6 |
| 2024 October | 23 | 24 | 47 |
| 2024 September | 33 | 13 | 46 |
| 2024 August | 53 | 19 | 72 |
| 2024 July | 30 | 21 | 51 |
| 2024 June | 32 | 17 | 49 |
| 2024 May | 47 | 13 | 60 |
| 2024 April | 28 | 15 | 43 |
| 2024 March | 19 | 14 | 33 |
| 2024 February | 26 | 18 | 44 |
| 2024 January | 14 | 8 | 22 |
| 2023 December | 10 | 12 | 22 |
| 2023 November | 15 | 19 | 34 |
| 2023 October | 12 | 16 | 28 |
| 2023 September | 16 | 21 | 37 |
| 2023 August | 5 | 6 | 11 |
| 2023 July | 10 | 12 | 22 |
| 2023 June | 11 | 12 | 23 |
| 2023 May | 13 | 6 | 19 |
| 2023 April | 8 | 7 | 15 |
| 2023 March | 7 | 3 | 10 |
| 2023 February | 9 | 2 | 11 |
| 2023 January | 10 | 5 | 15 |
| 2022 December | 32 | 7 | 39 |
Show all