metricas
covid
Buscar en
Clinics
Toda la web
Inicio Clinics Clinical significance of TLR7/IL-23/IL-17 signaling pathway in patients with acu...
Journal Information

Statistics

Follow this link to access the full text of the article

Original articles
Clinical significance of TLR7/IL-23/IL-17 signaling pathway in patients with acute respiratory distress syndrome
Lihong Chu, Fengqi Liu, Kankai Tang
Corresponding author
HYICU5158@126.com

Corresponding author.
The First People's Hospital of Huzhou, Huzhou, Zhejiang, PR China
Read
193
Times
was read the article
83
Total PDF
110
Total HTML
Share statistics
 array:22 [
  "pii" => "S1807593224000358"
  "issn" => "18075932"
  "doi" => "10.1016/j.clinsp.2024.100358"
  "estado" => "S250"
  "fechaPublicacion" => "2024-01-01"
  "aid" => "100358"
  "copyright" => "HCFMUSP"
  "copyrightAnyo" => "2024"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:17 [
    "pii" => "S1807593224001613"
    "issn" => "18075932"
    "doi" => "10.1016/j.clinsp.2024.100484"
    "estado" => "S250"
    "fechaPublicacion" => "2024-01-01"
    "aid" => "100484"
    "copyright" => "HCFMUSP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
      "titulo" => "Parathyroidectomy reduces the costs of medication in patients with secondary hyperparathyroidism"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "en"
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0003"
          "etiqueta" => "Fig&#46; 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1698
              "Ancho" => 2000
              "Tamanyo" => 109906
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0005"
              "detalle" => "Fig "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Postoperative costs of calcium&#44; calcitriol and sevelamer at different phases&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Gabriel Mattucci Domingues Pereira, Matheus Liao, Sergio Samir Arap, Felipe Ferraz Magnabosco, Marilia D&#39;Elboux Guimar&#227;es Brescia, Rosa Maria Affonso Moyses, Melani Ribeiro Cust&#243;dio, Vanda Jorgetti, Luiz Paulo Kowalski, F&#225;bio Luiz de Menezes Montenegro"
          "autores" => array:10 [
            0 => array:2 [
              "nombre" => "Gabriel Mattucci Domingues"
              "apellidos" => "Pereira"
            ]
            1 => array:2 [
              "nombre" => "Matheus"
              "apellidos" => "Liao"
            ]
            2 => array:2 [
              "nombre" => "Sergio Samir"
              "apellidos" => "Arap"
            ]
            3 => array:2 [
              "nombre" => "Felipe Ferraz"
              "apellidos" => "Magnabosco"
            ]
            4 => array:2 [
              "nombre" => "Marilia D&#39;Elboux Guimar&#227;es"
              "apellidos" => "Brescia"
            ]
            5 => array:2 [
              "nombre" => "Rosa Maria Affonso"
              "apellidos" => "Moyses"
            ]
            6 => array:2 [
              "nombre" => "Melani Ribeiro"
              "apellidos" => "Cust&#243;dio"
            ]
            7 => array:2 [
              "nombre" => "Vanda"
              "apellidos" => "Jorgetti"
            ]
            8 => array:2 [
              "nombre" => "Luiz Paulo"
              "apellidos" => "Kowalski"
            ]
            9 => array:2 [
              "nombre" => "F&#225;bio Luiz de Menezes"
              "apellidos" => "Montenegro"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara007" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0001" class="elsevierStylePara elsevierViewall">Subtotal or Total Parathyroidectomy with autograft equally reduces the costs of medication in patients with secondary hyperparathyroidism in the long run&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">Endocrine surgeons could individualize the operation technique in the treatment of hyperparathyroidism in dialysis patients&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">The first month after parathyroidectomy shows an increased medication cost compared with the preoperative period in secondary hyperparathyroidism&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001613?idApp=UINPBA00004N"
    "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001613/v123_202411010523/en/main.assets"
  ]
  "itemAnterior" => array:17 [
    "pii" => "S1807593224001728"
    "issn" => "18075932"
    "doi" => "10.1016/j.clinsp.2024.100495"
    "estado" => "S250"
    "fechaPublicacion" => "2024-01-01"
    "aid" => "100495"
    "copyright" => "HCFMUSP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
      "titulo" => "Analysis of IgE level influencing factors of common allergens for allergic rhinitis in northeastern China"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "en"
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Yanling Chu, Ai-Hui Yan"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "Yanling"
              "apellidos" => "Chu"
            ]
            1 => array:2 [
              "nombre" => "Ai-Hui"
              "apellidos" => "Yan"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara006" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0001" class="elsevierStylePara elsevierViewall">The IgE level is lower in female patients with AR compared with male patients&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">AR patients&#8217; IgE Level is affected by allergic history&#44; home-raised plants&#44; and pets&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">IgE levels vary with furniture renewal&#44; asthma&#44; and age in allergic rhinitis patients&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001728?idApp=UINPBA00004N"
    "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001728/v123_202411010523/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
    "titulo" => "Clinical significance of TLR7&#47;IL-23&#47;IL-17 signaling pathway in patients with acute respiratory distress syndrome"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Lihong Chu, Fengqi Liu, Kankai Tang"
        "autores" => array:3 [
          0 => array:2 [
            "nombre" => "Lihong"
            "apellidos" => "Chu"
          ]
          1 => array:2 [
            "nombre" => "Fengqi"
            "apellidos" => "Liu"
          ]
          2 => array:4 [
            "nombre" => "Kankai"
            "apellidos" => "Tang"
            "email" => array:1 [
              0 => "HYICU5158@126.com"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0001"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "The First People&#39;s Hospital of Huzhou&#44; Huzhou&#44; Zhejiang&#44; PR China"
            "identificador" => "aff0001"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0001"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1033
            "Ancho" => 3500
            "Tamanyo" => 198868
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">Comparison of TLR7&#44; IL-23 and IL-17 levels in peripheral blood mononuclear cells of patients with different conditions in ARDS group&#46; The expression of TLR7 mRNA &#40;A&#41; in peripheral blood mononuclear cells and the levels of IL-23 &#40;B&#41; and IL-17 &#40;C&#41; in the severe group were significantly higher than those in moderate and mild groups&#46; Note&#58; Compared with the mild group&#44; <span class="elsevierStyleSup">&#8270;&#8270;&#8270;</span>p &#60; 0&#46;001&#59; compared with the moderate group&#44; <span class="elsevierStyleSup">&#35;&#35;&#35;</span>p &#60; 0&#46;001&#46; TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0008">Introduction</span><p id="para0008" class="elsevierStylePara elsevierViewall">Acute progressive respiratory failure&#44; also known as Acute Respiratory Distress Syndrome &#40;ARDS&#41;&#44; is caused by non-cardiogenic pulmonary and intrapulmonary factors&#44; including trauma&#44; shock&#44; severe infection&#44; and burns&#46;<a class="elsevierStyleCrossRef" href="#bib0001"><span class="elsevierStyleSup">1</span></a> The disease has immediate onset and complex etiology&#44; with predominant features being respiratory distress and uncontrollable hypoxemia&#46; Hypoxic symptoms such as cyanosis and accelerated respiration are also common&#46;<a class="elsevierStyleCrossRef" href="#bib0002"><span class="elsevierStyleSup">2</span></a><a class="elsevierStyleCrossRef" href="#bib0003"><span class="elsevierStyleSup">3</span></a> Epidemiological studies indicate that China has an annual ARDS incidence of 59&#47;100&#44;000&#59; with 670&#44;000 new cases recorded each year and a fatality rate of 40&#37;&#8211;50&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0004"><span class="elsevierStyleSup">4</span></a> Currently&#44; patient imaging&#44; oxygenation&#44; and clinical features are mostly combined for clinical diagnosis of ARDS and illness assessment&#46; However&#44; some tests exhibit lag that generates challenges for accurate prognostic predictions&#46; The development of serum biochemical indices with high sensitivity and specificity is thus urgently necessary to aid in the clinical diagnosis and treatment of ARDS&#46;</p><p id="para0009" class="elsevierStylePara elsevierViewall">The pathogenesis of multi-organ dysfunction syndrome is linked to an uncontrolled inflammatory response&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">5</span></a><a class="elsevierStyleCrossRef" href="#bib0006"><span class="elsevierStyleSup">6</span></a> In particular&#44; ARDS pathophysiology involves an unregulated inflammatory response that impairs the functions of the alveolar epithelium and pulmonary vascular endothelium&#46;<a class="elsevierStyleCrossRef" href="#bib0007"><span class="elsevierStyleSup">7</span></a> Alveolar epithelial cells can be divided into type I and type II&#44; both of which are damaged during diffuse alveolar injury&#46; Common lung injury markers include Surfactant Protein-D &#40;SP-D&#41; and Clara Cell protein-16 &#40;CC-16&#41;&#46; Although the specifics remain unknown&#44; ARDS pathogenesis is generally believed to be associated with immune dysregulation and imbalance&#46;<a class="elsevierStyleCrossRef" href="#bib0008"><span class="elsevierStyleSup">8</span></a> During acute lung injury&#44; exogenous factors stimulate alveolar macrophages and cause inflammatory cytokine synthesis&#44; in turn triggering the production of numerous proteases&#44; chemokines&#44; and oxygen-free radicals&#46; These compounds contribute to the formation of pulmonary hyaline membranes and increase pulmonary capillary permeability&#44; ultimately inducing ARDS&#46; Simultaneously&#44; an acute uncontrolled inflammatory response can produce pulmonary edema&#59; this condition causes edematous fluid rich in inflammatory cells and proteins to enter the pulmonary interstitial and alveolar spaces&#44; increasing ARDS risk&#46;</p><p id="para0010" class="elsevierStylePara elsevierViewall">Toll-Like Receptors &#40;TLRs&#41; identify pathogenic microbes and may function as the first line of defense in lung inflammatory response&#46; They also regulate the expression of downstream inflammatory factors&#46; In particular&#44; Toll-Like Receptor 7 &#40;TLR7&#41; is broadly distributed on immune cell membranes&#44; contributing to lung damage via identifying features specific to bacteria and viruses&#44; thus activating airway responses&#46;<a class="elsevierStyleCrossRef" href="#bib0009"><span class="elsevierStyleSup">9</span></a><a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">10</span></a> During pathogen invasion&#44; TLR7 triggers plasmacytoid dendritic cells to secrete Interleukin &#40;IL&#41; factors &#40;e&#46;g&#46;&#44; IL-23 and IL-17&#41; through MyD88-independent and MyD88-dependent signaling pathways&#46; These processes drive Th1 cell immunity&#44; activating antigen-specific cytotoxic T-cells&#44; phagocytes&#44; and other cells to release cytokines&#46; Notably&#44; an imbalance in the ratio of pro-inflammatory helper T-cell 17 and anti-inflammatory regulatory T-cells &#40;Th17&#47;Treg&#41; increases the risk of poor prognosis in ARDS&#46; This imbalance is reflected in the concentrations of cytokines IL-23 and IL-17&#46;<a class="elsevierStyleCrossRef" href="#bib0011"><span class="elsevierStyleSup">11</span></a> IL-23 can specifically bind to the surface receptors of effector T-cells such as CD4&#43;&#44; inducing IL-17 production&#46; This contribution to the inflammatory response maintains normal Th17 cell differentiation and function&#46; Here&#44; the authors hypothesized that&#44; along with driving Th1 cells to participate in immune and inflammatory responses&#44; TLR7 also exacerbates those responses by activating the IL-23&#47;IL-17 signaling pathway&#46; To analyze the role of the TLR7&#47;IL-23&#47;IL-17 signaling pathway in ARDS occurrence&#44; development&#44; and prognosis&#44; the authors first compared the expression of the TLR7&#47;IL-23&#47;IL-17 signaling pathway between patients and healthy individuals&#46; Next&#44; the authors analyzed how pathway activation is related to the symptoms&#44; SP-D&#44; CC-16&#44; and prognosis of ARDS patients&#46;</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0009">Materials and methods</span><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0010">Clinical data</span><p id="para0011" class="elsevierStylePara elsevierViewall">This study retrospectively selected 85 patients with ARDS who were admitted to the hospital from March 2019 to June 2022&#46; The sample included 50 males and 35 females&#44; ranging in age from 32 to 79 years &#40;mean &#61; 57&#46;9 &#177; 10&#46;3-years&#41;&#44; with varying degrees of disease severity &#40;mild &#61; 29 cases&#44; moderate &#61; 41&#44; severe &#61; 15&#41;&#46; Additionally&#44; a healthy control group was formed of 85 individuals who participated in check-ups at the hospital during the same period&#46; This group included 47 males and 38 females aged 35&#8211;79 years &#40;mean &#61; 58&#46;4 &#177; 9&#46;5 years&#41;&#46;</p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0011">Criteria for the ARDS group</span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0012">Diagnostic criteria and disease severity</span><p id="para0012" class="elsevierStylePara elsevierViewall">The diagnostic criteria for ARDS were as follows&#58; meeting the Berlin definition proposed by the European Society of Intensive Care Medicine in 2012<a class="elsevierStyleCrossRef" href="#bib0012"><span class="elsevierStyleSup">12</span></a>&#59; onset time of new or worsening respiratory symptoms within 1-week&#59; chest Computed Tomography &#40;CT&#41; or chest radiograph showing patchy and blurred shadow of both lungs that cannot be explained by pulmonary nodules&#44; pulmonary atelectasis&#44; or pleural effusion&#59; respiratory failure from pulmonary edema not fully explained by volume overload or heart failure&#46; Disease severity was split into mild &#40;Oxygenation Index &#91;OI&#93; &#62; 200 mmHg and &#8804; 300 mmHg&#41;&#44; moderate &#40;OI &#62; 100 mmHg and &#8804; 200 mmHg&#41;&#44; and severe &#40;OI &#8804; 100 mmHg&#41;&#46;</p></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0013">Inclusion and exclusion criteria</span><p id="para0013" class="elsevierStylePara elsevierViewall">Patients with the following conditions were included&#58; meeting ARDS diagnostic criteria at any level of severity&#59; were between 18 to 80 years old &#40;inclusive&#41;&#59; exhibited clear etiology&#44; including acute pancreatitis&#44; trauma&#44; and severe pneumonia&#59; experienced tracheal intubation or tracheotomy connected to ventilator-assisted ventilation&#59; and complete clinical data were available&#46; Patients were excluded if they met the following conditions&#58; received immunosuppressant or hormone therapy 6-months before enrollment&#59; were diagnosed with autoimmune diseases&#44; neoplastic diseases&#44; blood system diseases&#44; chronic liver diseases&#44; congenital heart disease or other acute and chronic inflammatory diseases&#44; as well as respiratory diseases or other lung diseases&#59; died within 24 hours after admission&#59; lost to follow-up&#59; pregnant or breast-feeding&#46; This study was approved by the Ethics Committee of The First People&#39;s Hospital of Huzhou &#40;n&#176; 2022KYLL041&#41; and complied with the Declaration of Helsinki&#46; The study was a retrospective analysis and followed the STARD guidelines&#46;</p></span></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0014">Sample collection</span><p id="para0014" class="elsevierStylePara elsevierViewall">On the day of the physical examination of healthy controls and before the ARDS group received treatment&#44; 4 mL of peripheral venous blood was collected from all participants and divided into two equal portions&#46; One portion was placed in an anticoagulant tube containing EDTA to isolate mononuclear cells from peripheral blood using Ficoll density gradient centrifugation&#46; The other portion was centrifuged &#40;2000 r&#47;min&#44; <span class="elsevierStyleItalic">R</span> &#61; 6 cm&#41; for 20 min to obtain the supernatant&#44; which was stored at -80&#176;C until use&#46;</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0015">TLR7 mRNA in peripheral blood mononuclear cells</span><p id="para0015" class="elsevierStylePara elsevierViewall">Total RNA was extracted from peripheral blood mononuclear cells using a Trizol kit and Total RNA Extraction Kit &#40;kit purchased from Thermo Fisher Scientific&#41;&#46; The RNA concentration was determined using a spectrophotometer &#40;NanoDrop ND-1000&#44; NanoDrop&#44; USA&#41;&#44; reverse-transcribed into cDNA &#40;Yisheng Biotechnology Co&#46;&#44; Ltd&#46;&#44; Shanghai&#41;&#44; and stored at -20&#176;C&#46; TLR7 expression was measured using qRT-PCR &#40;Shanghai Hongshi Medical Technology Co&#46;&#44; Ltd&#46;&#41;&#44; with cDNA as the template&#46; The reaction volume was 20 &#956;L&#44; and the thermocycling schedule was as follows&#58; 95&#176;C for 2 min&#59; 40 cycles of 95&#176;C for 5s and 60&#176;C for 30s&#59; 72&#176;C for 3-min&#46; Fluorescence data was collected at 72&#176;C for each cycle&#44; and TLR7 expression was calculated with the 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span> method&#46; The internal reference was U6&#46; The following primers were used&#58; forward 5&#697;-GTCGTTCGGCAGCACA-3&#697;&#44; reverse 5&#697;-AACGCTTCACGAATTTGCGT-3&#697; &#40;U6&#41;&#59; forward 5&#697;-CCCCATTCCTTGTGCGCCG-3&#697;&#44; reverse 5&#697;- ACCATCTTGGGGCACATGCT3-3&#697; &#40;TLR7&#41;&#46;</p></span><span id="sec0009" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0016">Levels of serum IL-23&#44; IL-17&#44; and lung injury markers</span><p id="para0016" class="elsevierStylePara elsevierViewall">Levels of serum IL-23&#44; IL-17&#44; SP-D&#44; and CC-16 were determined from thawed serum samples using Enzyme-Linked Immunosorbent Assay &#40;ELISA&#41; kits &#40;Shanghai Lepisit Biotechnology&#41;&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0017">Short-term prognosis</span><p id="para0017" class="elsevierStylePara elsevierViewall">Patients were followed up for 28d after admission to the hospital&#46; Deaths within 28d were counted to divide participants into death and survival groups&#46;</p></span><span id="sec0011" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0018">Statistical analysis</span><p id="para0018" class="elsevierStylePara elsevierViewall">All data were analyzed in SPSS 23&#46;0 software&#46; Measurement data conforming to the normal distribution were represented as means &#177; standard deviation and subjected to <span class="elsevierStyleItalic">t</span>-tests&#46; Count data were represented as percentages and subjected to &#967;<span class="elsevierStyleSup">2</span> tests&#46; Relationships between TLR7&#44; IL-23&#44; and IL-17 levels with OI and lung injury markers were determined using Spearman rank correlations&#46; Receiver Operator Characteristic &#40;ROC&#41; curves were drawn to analyze the predictive value of TLR7&#44; IL-23&#44; and IL-17&#44; separately and in combination&#46; Multivariate logistic regression was used to analyze the risk factors affecting patient prognosis&#46; Significance was set at p &#60; 0&#46;05&#46;</p></span></span><span id="sec0012" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0019">Results</span><span id="sec0013" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0020">Demographic data of ARDS and control groups</span><p id="para0019" class="elsevierStylePara elsevierViewall">Sex&#44; age&#44; and body mass index did not differ between the ARDS and control groups &#40;p &#62; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0001"></elsevierMultimedia></span><span id="sec0014" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0021">Comparisons of TLR7&#44; IL-23&#44; IL-17 levels between ARDS and control groups</span><p id="para0020" class="elsevierStylePara elsevierViewall">Peripheral blood TLR7 mRNA expression&#44; IL-23&#44; and IL-17 levels in peripheral blood mononuclear cells were higher in the ARDS group than in the control group &#40;p &#60; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0002">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0002"></elsevierMultimedia></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0022">Predictive value of TLR7&#44; IL-23&#44; IL-17 levels for ARDS</span><p id="para0021" class="elsevierStylePara elsevierViewall">Whether ARDS occurred or not was used as a status variable &#40;0 &#61; not occurred&#44; 1 &#61; occurred&#41;&#44; and TLR7 mRNA expression and IL-23 and IL-17 levels in peripheral blood mononuclear cells were used as test variables to plot the ROC curve&#46; The results of the ROC analysis showed that with 1&#46;158 as the best cut-off value&#44; the Youden index of TLR7 mRNA expression for predicting ARDS was 0&#46;537&#44; and the Area Under the Curve &#40;AUC&#41; was 0&#46;899&#46; With 103&#46;655 pg&#47;mL as the best cut-off value&#44; the Youden index of IL-23 for predicting ARDS was 0&#46;475&#44; and the AUC was 0&#46;860&#46; With 20&#46;47 pg&#47;mL as the best cut-off value&#44; the Youden index of IL-17 for predicting ARDS was 0&#46;444&#44; and the AUC was 0&#46;854&#46; The Youden index of the combination of expression of TLR7 mRNA in peripheral blood mononuclear cells and the levels of IL-23 and IL-17 for predicting ARDS was 0&#46;612&#44; and the AUC was 0&#46;911 &#40;<a class="elsevierStyleCrossRef" href="#tbl0003">Table 3</a> and <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0003"></elsevierMultimedia><elsevierMultimedia ident="fig0001"></elsevierMultimedia></span><span id="sec0016" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0023">TLR7&#44; IL-23&#44; IL-17 levels in patients with differing ARDS severity</span><p id="para0022" class="elsevierStylePara elsevierViewall">The expression of TLR7 mRNA in peripheral blood mononuclear cells and the levels of IL-23 and IL-17 were the highest in the severe group&#44; followed by the moderate group&#44; and the lowest in the mild group &#40;p &#60; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia></span><span id="sec0017" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0024">OI and lung injury markers in patients with differing ARDS severity</span><p id="para0023" class="elsevierStylePara elsevierViewall">OI was the lowest in the severe group&#44; followed by the moderate group&#44; and the highest in the mild group&#44; while serum SP-D and CC-16 levels were the highest in the severe group&#44; followed by the moderate group&#44; and the lowest in the mild group &#40;p &#60; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>&#41;&#46;</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia></span><span id="sec0018" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0025">Correlation analysis of TLR7&#44; IL-23&#44; IL-17 levels with OI and lung injury markers</span><p id="para0024" class="elsevierStylePara elsevierViewall">TLR7 mRNA&#44; IL-23&#44; and IL-17 levels in peripheral blood mononuclear cells were negatively correlated with OI &#40;Spearman&#39;s <span class="elsevierStyleItalic">r</span> &#60; 0&#44; p &#60; 0&#46;05&#41; and positively correlated with SP-D and CC-16 levels &#40;<a class="elsevierStyleCrossRef" href="#tbl0004">Table 4</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0004"></elsevierMultimedia></span><span id="sec0019" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0026">Baseline data of ARDS patients with different prognoses</span><p id="para0025" class="elsevierStylePara elsevierViewall">Sex&#44; age&#44; body mass index&#44; underlying disease&#44; bad habits&#44; and percentage of ARDS types did not differ between death and survival groups &#40;p &#62; 0&#46;05&#41;&#46; Patients who died exhibited a higher percentage of severe ARDS than patients who survived&#44; while also having higher TLR7 mRNA&#44; IL-23&#44; and IL-17 levels &#40;p &#60; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>&#41;&#46;</p><elsevierMultimedia ident="fig0004"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0027">Logistic multivariate analysis of factors affecting the prognosis</span><p id="para0026" class="elsevierStylePara elsevierViewall">The 28-d survival status of ARDS patients was used as the dependent variable &#40;&#34;1&#34; &#61; death&#44; &#34;0&#34; &#61; survival&#41;&#44; and the variables with statistically significant differences were used as the independent variables&#46; Multivariate logistic regression revealed that disease stage &#40;severe&#41;&#44; TLR7 mRNA expression&#44; IL-23 levels&#44; and IL-17 levels were risk factors affecting the 28-d survival status of ARDS patients &#40;OR &#62; 1&#44; p &#60; 0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 5</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span></span><span id="sec0021" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0028">Discussion</span><p id="para0027" class="elsevierStylePara elsevierViewall">Th17&#47;Treg cells are a pair of pro-inflammatory and anti-inflammatory immune regulatory cells&#46; The former secretes large amounts of IL-17 after activation&#44; directly increasing alveolar epithelial permeability&#46; Animal experimental results <a class="elsevierStyleCrossRef" href="#bib0013"><span class="elsevierStyleSup">13</span></a> demonstrated that the Treg&#47;Th17 ratio was unbalanced in ARDS rats&#44; while cytokines such as IL-17 and IL-6 increased&#46; These findings indicate that ARDS rats are associated with immune dysregulation&#46; Similarly&#44; Ding et al&#46;<a class="elsevierStyleCrossRef" href="#bib0014"><span class="elsevierStyleSup">14</span></a> found that serum IL-17 levels increased significantly in ARDS&#46; Specifically&#44; lung injury scores were reduced in mice 48h after administering an IL-17-blocking antibody&#46; The antibody successfully alleviated symptoms of acute respiratory infection via affecting retinoic acid Receptor-related Orphan Receptor gamma-t &#40;ROR&#947;t&#41; levels and the PI3K pathway&#46;</p><p id="para0028" class="elsevierStylePara elsevierViewall">The immune molecule TLR7 elevates Th17 cells and is involved in airway inflammation and immune imbalance through secreting IL-17&#44; as well as recruiting and activating neutrophils&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a><a class="elsevierStyleCrossRef" href="#bib0016"><span class="elsevierStyleSup">16</span></a> Additionally&#44; IL-23 binds specifically to effector T-cell surface receptors such as CD4&#43; to induce IL-17 production&#44; which participates in the inflammatory response and maintains normal Th17 cell differentiation and function&#46; Thus&#44; a commonly accepted hypothesis is that TLR7&#44; while driving Th1 cell immunity&#44; may also activate the IL-23&#47;IL-17 signaling pathway by stimulating Th17 cell immunity and exacerbating the inflammatory response&#46; Previous research in older patients has confirmed that TLR7&#47;IL-23&#47;IL-17 signaling activation is associated with lung infections&#44;<a class="elsevierStyleCrossRef" href="#bib0017"><span class="elsevierStyleSup">17</span></a> but currently&#44; the authors have no clear evidence regarding whether this pathway is associated with ARDS&#46;</p><p id="para0029" class="elsevierStylePara elsevierViewall">This study found that TLR7 mRNA expression&#44; along with IL-23 and IL-17 levels&#44; were higher in ARDS peripheral blood than in healthy controls&#46; Furthermore&#44; the levels of these indicators were negatively correlated with OI&#46; The ROC curves further revealed that the Youden index of the combination of the three indicators was 0&#46;612&#44; with an AUC of 0&#46;911&#46; These values indicate that the TLR7&#47;IL-23&#47;IL-17 signaling pathway is activated in patients with ARDS&#44; and its expression is correlated with the severity of the disease&#46; The present results suggest that clinical monitoring of changes in TLR7&#47;IL-23&#47;IL-17 signaling should be performed regularly&#46; Moreover&#44; targeted measures should be taken to downregulate pathway expression as a method to alleviate symptoms&#46;</p><p id="para0030" class="elsevierStylePara elsevierViewall">The results of the logistic regression revealed that TLR7 mRNA expression&#44; IL-23 levels&#44; and IL-17 levels were risk factors affecting patient survival at 28d&#46; These results confirm that the activation of the TLR7&#47;IL-23&#47;IL-17 signaling pathway increases the risk of adverse short-term prognosis in ARDS&#46; Several factors may explain these results&#46; First&#44; abnormally elevated levels of TLR7&#44; IL-23&#44; and IL-17 activate the systemic inflammatory response&#44; causing neutrophils to accumulate in the lungs&#46; This accumulation destroys epithelial and endothelial integrity&#44; further expanding the alveolar-arterial oxygen gradient and increasing cell permeability&#46; The outcome is interstitial pulmonary edema&#44; along with negative effects on oxygenation function and prognosis&#46; Second&#44; strong activation of the specific immune response aggravates inflammatory damage in the liver and elevates inflammatory cytokines&#46; These factors subsequently activate the TLR7&#47;IL-23&#47;IL-17 signaling pathway&#44; which is clearly critical to determining ARDS prognosis&#46;</p><p id="para0031" class="elsevierStylePara elsevierViewall">CC16 is secreted by Clara cells distributed in the fine bronchial mucosa of the lungs&#46; Its primary function is to protect the pulmonary surfactant from degradation and remove harmful substances deposited in the respiratory tract&#46; In addition&#44; CC16 exhibits antifibrotic&#44; antioxidant&#44; antitumor&#44; and anti-inflammatory properties&#46; Increased serum CC16 levels reflected impaired integrity of the alveolar epithelium and vascular endothelium&#46;<a class="elsevierStyleCrossRef" href="#bib0018"><span class="elsevierStyleSup">18</span></a> In patients with severe chest trauma&#44; serum CC16 levels tended to increase during the immediate post-traumatic period and then decreased to a normal range after 12&#8211;24h&#46;<a class="elsevierStyleCrossRef" href="#bib0019"><span class="elsevierStyleSup">19</span></a> As a protein in the collagen agglutination family&#44; SP-D is synthesized and secreted by alveolar type II epithelial cells and airway Clara cells&#46; It mediates the immune response and inflammatory reaction and is involved in maintaining alveolar physiological function and inhibiting oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a> Studies have demonstrated that abnormally elevated SP-D levels are linked with the pathogenesis of lung injury-related diseases such as severe pneumonia and chronic obstructive pulmonary disease&#46;<a class="elsevierStyleCrossRef" href="#bib0021"><span class="elsevierStyleSup">21</span></a><a class="elsevierStyleCrossRef" href="#bib0022"><span class="elsevierStyleSup">22</span></a> In this study&#44; serum SP-D and CC-16 levels were the highest in the severe group&#44; followed by the moderate group&#44; and the lowest in the mild group&#44; and their levels were positively correlated with TLR7 mRNA&#44; IL-23&#44; and IL-17 levels&#46; The authors thus speculated that TLR7&#47;IL-23&#47;IL-17 pathway activation may be involved in ARDS development and progression&#44; specifically via aggravating lung injury&#46;</p></span><span id="sec0022" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0029">Conclusion</span><p id="para0032" class="elsevierStylePara elsevierViewall">In conclusion&#44; activating the TLR7&#47;IL-23&#47;IL-17 signaling pathway in ARDS patients is closely related to the severity of the disease and the levels of lung injury markers &#40;SP-D and CC-16&#41; and are risk factors affecting the short-term prognosis of ARDS patients&#46; However&#44; this study has several limitations&#44; notably the small sample size&#44; geographical limitations of case sources&#44; and short follow-up time&#46; Future studies should therefore aim to increase the number of participants&#44; include multicenter study subjects&#44; expand the range of case sources&#44; and extend the follow-up period&#46;</p><span id="sec0023" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0030">Authors&#8217; contributions</span><p id="para0033" class="elsevierStylePara elsevierViewall">All authors designed experiments&#44; carried out experiments&#44; and analyzed experimental results&#46; Lihong Chu wrote the manuscript&#46; Kankai Tang revised the manuscript&#46; All authors approved the final manuscript&#46;</p></span><span id="sec0024" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0031">Funding</span><p id="para0034" class="elsevierStylePara elsevierViewall">This research did not receive any specific grant from funding agencies in the public&#44; commercial&#44; or not-for-profit sectors&#46;</p></span></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:3 [
          "identificador" => "xres2290918"
          "titulo" => "Highlights"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abss0001"
            ]
          ]
        ]
        1 => array:3 [
          "identificador" => "xres2290919"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abss0002"
              "titulo" => "Objectives"
            ]
            1 => array:2 [
              "identificador" => "abss0003"
              "titulo" => "Method"
            ]
            2 => array:2 [
              "identificador" => "abss0004"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abss0005"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1903308"
          "titulo" => "Keywords"
        ]
        3 => array:2 [
          "identificador" => "sec0001"
          "titulo" => "Introduction"
        ]
        4 => array:3 [
          "identificador" => "sec0002"
          "titulo" => "Materials and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0003"
              "titulo" => "Clinical data"
            ]
            1 => array:3 [
              "identificador" => "sec0004"
              "titulo" => "Criteria for the ARDS group"
              "secciones" => array:2 [
                0 => array:2 [
                  "identificador" => "sec0005"
                  "titulo" => "Diagnostic criteria and disease severity"
                ]
                1 => array:2 [
                  "identificador" => "sec0006"
                  "titulo" => "Inclusion and exclusion criteria"
                ]
              ]
            ]
            2 => array:2 [
              "identificador" => "sec0007"
              "titulo" => "Sample collection"
            ]
            3 => array:2 [
              "identificador" => "sec0008"
              "titulo" => "TLR7 mRNA in peripheral blood mononuclear cells"
            ]
            4 => array:2 [
              "identificador" => "sec0009"
              "titulo" => "Levels of serum IL-23&#44; IL-17&#44; and lung injury markers"
            ]
            5 => array:2 [
              "identificador" => "sec0010"
              "titulo" => "Short-term prognosis"
            ]
            6 => array:2 [
              "identificador" => "sec0011"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        5 => array:3 [
          "identificador" => "sec0012"
          "titulo" => "Results"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0013"
              "titulo" => "Demographic data of ARDS and control groups"
            ]
            1 => array:2 [
              "identificador" => "sec0014"
              "titulo" => "Comparisons of TLR7&#44; IL-23&#44; IL-17 levels between ARDS and control groups"
            ]
            2 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Predictive value of TLR7&#44; IL-23&#44; IL-17 levels for ARDS"
            ]
            3 => array:2 [
              "identificador" => "sec0016"
              "titulo" => "TLR7&#44; IL-23&#44; IL-17 levels in patients with differing ARDS severity"
            ]
            4 => array:2 [
              "identificador" => "sec0017"
              "titulo" => "OI and lung injury markers in patients with differing ARDS severity"
            ]
            5 => array:2 [
              "identificador" => "sec0018"
              "titulo" => "Correlation analysis of TLR7&#44; IL-23&#44; IL-17 levels with OI and lung injury markers"
            ]
            6 => array:2 [
              "identificador" => "sec0019"
              "titulo" => "Baseline data of ARDS patients with different prognoses"
            ]
            7 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Logistic multivariate analysis of factors affecting the prognosis"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0021"
          "titulo" => "Discussion"
        ]
        7 => array:3 [
          "identificador" => "sec0022"
          "titulo" => "Conclusion"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0023"
              "titulo" => "Authors&#8217; contributions"
            ]
            1 => array:2 [
              "identificador" => "sec0024"
              "titulo" => "Funding"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "xack786237"
          "titulo" => "Acknowledgments"
        ]
        9 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2023-06-20"
    "fechaAceptado" => "2024-04-01"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1903308"
          "palabras" => array:4 [
            0 => "Acute respiratory distress syndrome"
            1 => "Toll-like receptor 7"
            2 => "Interleukin-23"
            3 => "Interleukin-17"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "highlights" => array:2 [
      "titulo" => "Highlights"
      "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara015" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0001" class="elsevierStylePara elsevierViewall">TLR7&#47;IL-23&#47;IL-17 pathway activation in ARDS patients implicates immune dysregulation in disease severity&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">TLR7&#47;IL-23&#47;IL-17 pathway is associated with adverse short-term prognosis in ARDS&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">SP-D and CC-16 are positively correlated with TLR7&#47;IL-23&#47;IL-17 pathway activation&#44; indicating lung injury involvement in ARDS progression&#46;</p></li></ul></p></span>"
    ]
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abss0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0003">Objectives</span><p id="spara016" class="elsevierStyleSimplePara elsevierViewall">To analyze the clinical significance of Toll-Like Receptor 7&#47;Interleukin-23&#47;Interleukin-17 &#40;TLR7&#47;IL-23&#47;IL-17&#41; signaling pathway in patients with Acute Respiratory Distress Syndrome &#40;ARDS&#41;&#46;</p></span> <span id="abss0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Method</span><p id="spara017" class="elsevierStyleSimplePara elsevierViewall">The clinical data of 85 patients with ARDS were retrospectively analyzed and set as the ARDS group&#44; and the clinical data of 85 healthy participants during the same period were set as the healthy control group&#46; Univariate and multivariate logistic regression were used to analyze risk the factors affecting the prognosis of ARDS patients&#46;</p></span> <span id="abss0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Results</span><p id="spara018" class="elsevierStyleSimplePara elsevierViewall">TheTLR7 mRNA expression and IL-23 and IL-17 levels in peripheral blood mononuclear cells were higher in the ARDS group than in the control group &#40;p &#60; 0&#46;05&#41;&#46; TLR7 mRNA expression&#44; IL-23&#44; IL-17&#44; Surfactant Protein-D &#40;SP-D&#41;&#44; and Clara Cell protein-16 &#40;CC-16&#41; levels were the highest in the severe group&#44; followed by the moderate group&#44; and the lowest in the mild group&#44; while Oxygenation Index &#40;OI&#41; was the lowest in the severe group&#44; followed by the moderate group&#44; and the highest in the mild group &#40;p &#60; 0&#46;05&#41;&#46; Multivariate logistic regression analysis found that the disease grade &#40;severe&#41;&#44; TLR7 mRNA expression&#44; IL-23 level&#44; and IL-17 level were the risk factors affecting the 28-d survival status of ARDS patients &#40;OR &#62; 1&#44; p &#60; 0&#46;05&#41;&#46;</p></span> <span id="abss0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0006">Conclusions</span><p id="spara019" class="elsevierStyleSimplePara elsevierViewall">In ARDS patients&#44; the TLR7&#47;IL-23&#47;IL-17 signaling pathway is activated&#46; The expression of this pathway is closely related to the severity of the disease and the levels of lung injury markers&#44; and it is a risk factor that may have a direct impact on the prognosis of ARDS patients&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abss0002"
            "titulo" => "Objectives"
          ]
          1 => array:2 [
            "identificador" => "abss0003"
            "titulo" => "Method"
          ]
          2 => array:2 [
            "identificador" => "abss0004"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abss0005"
            "titulo" => "Conclusions"
          ]
        ]
      ]
    ]
    "multimedia" => array:9 [
      0 => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1501
            "Ancho" => 1667
            "Tamanyo" => 94508
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">ROC plots of TLR7&#44; IL-23&#44; and IL-17 levels and their combined predictive value for ARDS&#46; TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1033
            "Ancho" => 3500
            "Tamanyo" => 198868
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">Comparison of TLR7&#44; IL-23 and IL-17 levels in peripheral blood mononuclear cells of patients with different conditions in ARDS group&#46; The expression of TLR7 mRNA &#40;A&#41; in peripheral blood mononuclear cells and the levels of IL-23 &#40;B&#41; and IL-17 &#40;C&#41; in the severe group were significantly higher than those in moderate and mild groups&#46; Note&#58; Compared with the mild group&#44; <span class="elsevierStyleSup">&#8270;&#8270;&#8270;</span>p &#60; 0&#46;001&#59; compared with the moderate group&#44; <span class="elsevierStyleSup">&#35;&#35;&#35;</span>p &#60; 0&#46;001&#46; TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0003"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1038
            "Ancho" => 3500
            "Tamanyo" => 197968
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0003"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Comparison of OI and lung injury marker levels in patients with different conditions in the ARDS group&#46; The OI &#40;A&#41; of the severe group was significantly lower than that of the moderate and mild groups&#44; and the serum SP-D &#40;B&#41; and CC-16 &#40;C&#41; levels were significantly higher than those of the moderate and mild groups&#46; Note&#58; Compared with mild group&#44; <span class="elsevierStyleSup">&#8270;&#8270;&#8270;</span>p &#60; 0&#46;001&#59; compared with moderate group&#44; <span class="elsevierStyleSup">&#35;&#35;&#35;</span>p &#60; 0&#46;001&#46; ARDS&#44; Acute Respiratory Distress Syndrome&#59; OI&#44; Oxygenation Index&#59; SP-D&#44; Surfactant Protein-D&#59; CC-16&#44; Clara Cell protein-16&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0004"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 2625
            "Ancho" => 3500
            "Tamanyo" => 371399
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0004"
            "detalle" => "Fig "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara004" class="elsevierStyleSimplePara elsevierViewall">Comparison of baseline data of patients with different prognosis in ARDS group&#46; &#40;A&#41; Gender&#59; &#40;B&#41; Age&#59; &#40;C&#41; Body mass index&#59; &#40;D&#41; Underlying disease&#59; &#40;E&#41; Adverse habits&#59; &#40;F&#41; Disease classification&#59; &#40;G&#41; Type of ARDS&#59; &#40;H&#41; TLR7 mRNA&#59; &#40;I&#41; IL-23&#59; &#40;J&#41; IL-17&#46; Note&#58; Compared with the death group&#44; <span class="elsevierStyleSup">&#38;&#38;&#38;</span> p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0001"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara006" class="elsevierStyleSimplePara elsevierViewall">ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col"></th><a name="en0002"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col"></th><a name="en0003"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col"></th><a name="en0004"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col"></th><a name="en0005"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col"></th><a name="en0006"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col">Pathogenic factors&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0007"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col">Underlying disease&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0008"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col">Adverse habits&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><a name="en00501"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Group</th><a name="en00502"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Number of cases</th><a name="en000f3"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sex &#40;Male&#47; Female&#41;</th><a name="en00f04"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Age &#40;years&#41;</th><a name="en00f05"></a><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="1" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Body mass index &#40;kg&#47;m<span class="elsevierStyleSup">2</span>&#41;</th><a name="en0014"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Acute pancreatitis&#47; Trauma&#47; Severe pneumonia&#47; Other&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0015"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Hypertension&#47; Diabetes&#47; Hyperlipidemia&#47; Coronary heart disease&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0016"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">History of smoking&#47; Alcohol consumption&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0017"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Control group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0019"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">47&#47;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0020"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">58&#46;4&#177;9&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0021"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">24&#46;84&#177;2&#46;29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0022"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0023"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0025"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">ARDS group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0026"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">50&#47;35&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0028"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">57&#46;9&#177;10&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0029"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">24&#46;37&#177;2&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">10&#47;25&#47;48&#47;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0031"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">22&#47;15&#47;23&#47;11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0032"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">27&#47;19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711580.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara005" class="elsevierStyleSimplePara elsevierViewall">Comparison of demographic data of ARDS and control groups &#40;n&#44; mean &#177; SD&#41;&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0002"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0006"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spara008" class="elsevierStyleSimplePara elsevierViewall">Note&#58; Compared with the control group</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0033"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0034"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Number of cases&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0035"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">TLR7 mRNA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0036"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">IL-23 &#40;pg&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0037"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">IL-17 &#40;pg&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0038"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Control group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0039"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0040"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;96 &#177; 0&#46;13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0041"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">95&#46;95 &#177; 17&#46;44&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0042"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">17&#46;10 &#177; 3&#46;29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0043"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">ARDS group&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0044"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0045"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;30 &#177; 0&#46;20<a class="elsevierStyleCrossRef" href="#tb2fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0046"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">123&#46;01 &#177; 19&#46;59<a class="elsevierStyleCrossRef" href="#tb2fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0047"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">22&#46;90 &#177; 4&#46;04<a class="elsevierStyleCrossRef" href="#tb2fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711581.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tb2fn1"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="notep0003">p &#60; 0&#46;001&#46; TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara007" class="elsevierStyleSimplePara elsevierViewall">Comparison of TLR7&#44; IL-23 and IL-17 levels in peripheral blood mononuclear cells between ARDS and control groups &#40;mean &#177; SD&#41;&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0003"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0007"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara010" class="elsevierStyleSimplePara elsevierViewall">TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#59; AUC&#44; Area Under the Curve&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0048"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Indicator&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0049"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Best cut-off value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0050"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Standard error&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0051"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0052"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0053"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Youden Index&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0054"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">AUC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0055"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">95&#37; CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0056"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">TLR7 mRNA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0057"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;158&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0058"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;025&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0059"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">82&#46;02&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0060"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">71&#46;69&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0061"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;537&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0062"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;899&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0063"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;850&#8210;0&#46;947&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0064"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">IL-23&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0065"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">103&#46;655pg&#47;mL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0066"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;029&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0067"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">78&#46;56&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0068"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">68&#46;95&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0069"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;475&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0070"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;860&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0071"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;803&#8210;0&#46;917&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0072"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">IL-17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0073"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">20&#46;47pg&#47;mL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0074"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;031&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0075"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">77&#46;15&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0076"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">67&#46;28&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0077"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;444&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0078"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;854&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0079"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;793&#8210;0&#46;914&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0080"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Combination&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0081"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0082"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;022&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0083"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">85&#46;36&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0084"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">75&#46;85&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0085"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;612&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0086"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;911&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0087"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;868&#8210;0&#46;953&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711583.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara009" class="elsevierStyleSimplePara elsevierViewall">Predictive value of TLR7&#44; IL-23&#44; IL-17 levels for ARDS&#46;</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "tbl0004"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0008"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara012" class="elsevierStyleSimplePara elsevierViewall">TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; OI&#44; Oxygenation Index&#59; SP-D&#44; Surfactant Protein-D&#59; CC-16&#44; Clara Cell protein-16&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0088"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Indicator&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0089"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Coefficient&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0090"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">OI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0091"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">SP-D&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0092"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">CC-16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0093"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">TLR7 mRNA</td><a name="en0094"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top"><span class="elsevierStyleItalic">r</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0095"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8722;0&#46;636&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0096"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;586&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0097"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;702&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0099"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">p&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0100"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0101"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0102"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0103"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">IL-23</td><a name="en0104"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top"><span class="elsevierStyleItalic">r</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0105"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8722;0&#46;619&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0106"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;572&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0107"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;657&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0109"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">p&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0110"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0111"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0112"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0113"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="top">IL-17</td><a name="en0114"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top"><span class="elsevierStyleItalic">r</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0115"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8722;0&#46;592&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0116"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;538&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0117"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;635&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0119"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">p&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0120"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0121"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0122"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711579.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara011" class="elsevierStyleSimplePara elsevierViewall">Correlation analysis of TLR7&#44; IL-23&#44; IL-17 levels with OI and lung injury markers&#46;</p>"
        ]
      ]
      8 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0009"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara014" class="elsevierStyleSimplePara elsevierViewall">TLR7&#44; Toll-Like Receptor 7&#59; IL-23&#44; Interleukin-23&#59; IL-17&#44; Interleukin-17&#59; ARDS&#44; Acute Respiratory Distress Syndrome&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0123"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Factor&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0124"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&#946;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0125"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">SE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0126"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Wald <span class="elsevierStyleItalic">&#967;<span class="elsevierStyleSup">2</span></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0127"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">p&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0128"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0129"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">95&#37; CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0130"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Disease classification &#40;severe&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0131"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;386&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0132"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;628&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0133"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">4&#46;872&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0134"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;027&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0135"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">4&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0136"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;168&#8210;13&#46;698&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0137"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">TLR7 mRNA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0138"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;216&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0139"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;535&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0140"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#46;262&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0141"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;023&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0142"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">3&#46;402&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0143"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;189&#8210;9&#46;862&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0144"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">IL-23&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0145"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;168&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0146"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;524&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0147"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">4&#46;964&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0148"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;026&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0149"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">3&#46;215&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0150"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;142&#8210;8&#46;986&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0151"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">IL-17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0152"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;179&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0153"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;569&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0154"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">4&#46;312&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0155"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;035&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0156"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">3&#46;202&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0157"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;068&#8210;9&#46;897&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0158"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Constant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0159"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">-5&#46;021&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0160"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;035&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0161"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">27&#46;462&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0162"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0163"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;004&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0164"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711582.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara013" class="elsevierStyleSimplePara elsevierViewall">Logistic multivariate analysis of risk factors affecting the prognosis of ARDS patients&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec1"
          "bibliografiaReferencia" => array:22 [
            0 => array:3 [
              "identificador" => "bib0001"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pathogenesis of acute respiratory distress syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "LA Huppert"
                            1 => "MA Matthay"
                            2 => "LB&#46; Ware"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1055/s-0039-1683996"
                      "Revista" => array:7 [
                        "tituloSerie" => "Semin Respir Crit Care Med"
                        "fecha" => "2019"
                        "volumen" => "40"
                        "numero" => "1"
                        "paginaInicial" => "31"
                        "paginaFinal" => "39"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31060086"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0002"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute respiratory distress syndrome&#58; diagnosis and management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A Saguil"
                            1 => "MV&#46; Fargo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Am Fam Physician"
                        "fecha" => "2020"
                        "volumen" => "101"
                        "numero" => "12"
                        "paginaInicial" => "730"
                        "paginaFinal" => "738"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32538594"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0003"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute respiratory distress syndrome&#58; etiology&#44; pathogenesis&#44; and summary on management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Kaku"
                            1 => "CD Nguyen"
                            2 => "NN Htet"
                            3 => "D Tutera"
                            4 => "J Barr"
                            5 => "HS Paintal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1177/0885066619855021"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Intensive Care Med"
                        "fecha" => "2020"
                        "volumen" => "35"
                        "numero" => "8"
                        "paginaInicial" => "723"
                        "paginaFinal" => "737"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31208266"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0004"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Phenotypes and personalized medicine in the acute respiratory distress syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "MA Matthay"
                            1 => "YM Arabi"
                            2 => "ER Siegel"
                            3 => "LB Ware"
                            4 => "LDJ Bos"
                            5 => "P Sinha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Intens Care Med"
                        "fecha" => "2020"
                        "volumen" => "46"
                        "numero" => "12"
                        "paginaInicial" => "2136"
                        "paginaFinal" => "2152"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Single cell RNA sequencing identifies an early monocyte gene signature in acute respiratory distress syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Jiang"
                            1 => "BR Rosborough"
                            2 => "J Chen"
                            3 => "S Das"
                            4 => "GD Kitsios"
                            5 => "BJ McVerry"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "JCI Insight"
                        "fecha" => "2020"
                        "volumen" => "5"
                        "numero" => "13"
                        "itemHostRev" => array:3 [
                          "pii" => "S0168822708003343"
                          "estado" => "S300"
                          "issn" => "01688227"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0006"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lipocalin-2 silencing suppresses inflammation and oxidative stress of acute respiratory distress syndrome by ferroptosis via inhibition of MAPK&#47;ERK pathway in neonatal mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X Wang"
                            1 => "C Zhang"
                            2 => "N Zou"
                            3 => "Q Chen"
                            4 => "C Wang"
                            5 => "X Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/21655979.2021.2009970"
                      "Revista" => array:7 [
                        "tituloSerie" => "Bioengineered"
                        "fecha" => "2022"
                        "volumen" => "13"
                        "numero" => "1"
                        "paginaInicial" => "508"
                        "paginaFinal" => "520"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34969358"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0007"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pulmonary innate immune response determines the outcome of inflammation during pneumonia and sepsis-associated acute lung injury"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "V&#46; Kumar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fimmu.2020.01722"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2020"
                        "volumen" => "11"
                        "paginaInicial" => "1722"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32849610"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0008"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Novel biomarkers for acute respiratory distress syndrome&#58; genetics&#44; epigenetics and transcriptomics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F Zheng"
                            1 => "Y Pan"
                            2 => "Y Yang"
                            3 => "C Zeng"
                            4 => "X Fang"
                            5 => "Q Shu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2217/bmm-2021-0749"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biomark Med"
                        "fecha" => "2022"
                        "volumen" => "16"
                        "numero" => "3"
                        "paginaInicial" => "217"
                        "paginaFinal" => "231"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35026957"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0009"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "TLR7 mediates acute respiratory distress syndrome in sepsis by sensing extracellular miR-146a"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Huang"
                            1 => "J Zhu"
                            2 => "L Gu"
                            3 => "J Hu"
                            4 => "X Feng"
                            5 => "W Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1165/rcmb.2021-0551OC"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Respir Cell Mol Biol"
                        "fecha" => "2022"
                        "volumen" => "67"
                        "numero" => "3"
                        "paginaInicial" => "375"
                        "paginaFinal" => "388"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35679261"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Innate receptor activation patterns involving TLR and NLR synergisms in COVID-19&#44; ALI&#47;ARDS and sepsis cytokine storms&#58; a review and model making novel predictions and therapeutic suggestions"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "R Root-Bernstein"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ijms22042108"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Sci"
                        "fecha" => "2021"
                        "volumen" => "22"
                        "numero" => "4"
                        "paginaInicial" => "2108"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33672738"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0011"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "PARP-1 inhibition repressed imbalance of Th17 and treg cells in preterm rats with intrauterine infection-induced acute respiratory distress syndrome by reducing the expression level of IL-6"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Q Chen"
                            1 => "E Zhang"
                            2 => "C Wang"
                            3 => "P Zhang"
                            4 => "L&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "J Healthc Eng"
                        "fecha" => "2022"
                        "volumen" => "2022"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0012"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute respiratory distress syndrome&#58; the Berlin Definition"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "VM Ranieri"
                            1 => "GD Rubenfeld"
                            2 => "BT Thompson"
                            3 => "ND Ferguson"
                            4 => "E Caldwell"
                            5 => "E Fan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/jama.2012.5669"
                      "Revista" => array:7 [
                        "tituloSerie" => "Jama"
                        "fecha" => "2012"
                        "volumen" => "307"
                        "numero" => "23"
                        "paginaInicial" => "2526"
                        "paginaFinal" => "2533"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22797452"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0013"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Resolution acute respiratory distress syndrome through reversing the imbalance of Treg&#47;Th17 by targeting the cAMP signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Q Li"
                            1 => "X Hu"
                            2 => "R Sun"
                            3 => "Y Tu"
                            4 => "F Gong"
                            5 => "Y&#46; Ni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Med Rep"
                        "fecha" => "2016"
                        "volumen" => "14"
                        "numero" => "1"
                        "paginaInicial" => "343"
                        "paginaFinal" => "348"
                        "itemHostRev" => array:3 [
                          "pii" => "S0140673612617280"
                          "estado" => "S300"
                          "issn" => "01406736"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0014"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of IL-17 in LPS-induced acute lung injury&#58; an in vivo study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q Ding"
                            1 => "GQ Liu"
                            2 => "YY Zeng"
                            3 => "JJ Zhu"
                            4 => "ZY Liu"
                            5 => "X Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/oncotarget.21474"
                      "Revista" => array:7 [
                        "tituloSerie" => "Oncotarget"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "numero" => "55"
                        "paginaInicial" => "93704"
                        "paginaFinal" => "93711"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29212183"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered distribution&#44; activation and increased IL-17 production of mucosal-associated invariant T cells in patients with acute respiratory distress syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "TO Kim"
                            1 => "KJ Park"
                            2 => "YN Cho"
                            3 => "HM Jin"
                            4 => "YG Jo"
                            5 => "HS Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/thoraxjnl-2021-217724"
                      "Revista" => array:7 [
                        "tituloSerie" => "Thorax"
                        "fecha" => "2022"
                        "volumen" => "77"
                        "numero" => "9"
                        "paginaInicial" => "865"
                        "paginaFinal" => "872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35086913"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0016"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased expression of IL-23 and IL-17 in serum of patients with neonatal respiratory distress syndrome and its clinical significance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "LY Zheng"
                            1 => "PC&#46; Sun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Clin Lab"
                        "fecha" => "2020"
                        "volumen" => "66"
                        "numero" => "8"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0017"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression and clinical value of TLR7&#44; IL-23&#44; IL-17 in elderly patients with pulmonary infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B Wang"
                            1 => "L Zhao"
                            2 => "J Yu"
                            3 => "H&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Basic Clin Pharmacol Toxicol"
                        "fecha" => "2021"
                        "volumen" => "128"
                        "numero" => "S3"
                        "paginaInicial" => "33"
                        "itemHostRev" => array:3 [
                          "pii" => "S0735109722001693"
                          "estado" => "S300"
                          "issn" => "07351097"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0018"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clara cell secretory protein &#40;CC16&#41; as a peripheral blood biomarker of lung injury in ventilated preterm neonates"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K Sarafidis"
                            1 => "T Stathopoulou"
                            2 => "E Diamanti"
                            3 => "V Soubasi"
                            4 => "C Agakidis"
                            5 => "A Balaska"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00431-008-0712-3"
                      "Revista" => array:7 [
                        "tituloSerie" => "Eur J Pediatr"
                        "fecha" => "2008"
                        "volumen" => "167"
                        "numero" => "11"
                        "paginaInicial" => "1297"
                        "paginaFinal" => "1303"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18521628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0019"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clara cell protein 16&#58; a biomarker for detecting secondary respiratory complications in patients with multiple injuries"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Wutzler"
                            1 => "L Backhaus"
                            2 => "D Henrich"
                            3 => "E Geiger"
                            4 => "J Barker"
                            5 => "I Marzi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/TA.0b013e31825ac394"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Trauma Acute Care Surg"
                        "fecha" => "2012"
                        "volumen" => "73"
                        "numero" => "4"
                        "paginaInicial" => "838"
                        "paginaFinal" => "842"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22902736"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "SP-A and SP-D&#58; dual functioning immune molecules with antiviral and immunomodulatory properties"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A Watson"
                            1 => "J Madsen"
                            2 => "HW Clark"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2021"
                        "volumen" => "11"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0021"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased serum SP-D in identification of high-risk smokers at high risk of COPD"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C Dalg&#229;rd"
                            1 => "F Wang"
                            2 => "IL Titlestad"
                            3 => "Kyvik KO"
                            4 => "J Vestbo"
                            5 => "GL&#46; Sorensen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol"
                        "fecha" => "2021"
                        "volumen" => "320"
                        "numero" => "6"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0022"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnosis of chronic obstructive pulmonary disease and regulatory mechanism of miR-149-3p on alveolar inflammatory factors and expression of surfactant proteins A &#40;SP-A&#41; and D &#40;SP-D&#41; on lung surface mediated by Wnt pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "X Zhang"
                            1 => "Y Wang"
                            2 => "X He"
                            3 => "Z Sun"
                            4 => "X&#46; Shi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Comput Intell Neurosci"
                        "fecha" => "2022"
                        "volumen" => "2022"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack786237"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="para0036" class="elsevierStylePara elsevierViewall">None&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224000358/v123_202411010523/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "94924"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/18075932/000000790000000C/v123_202411010523/S1807593224000358/v123_202411010523/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224000358?idApp=UINPBA00004N"
]
Article information
ISSN: 18075932
Original language: English
The statistics are updated each day
Year/Month Html Pdf Total
2024 November 2 0 2
2024 October 58 31 89
2024 September 50 52 102

Follow this link to access the full text of the article

es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos