LncRNA HCG18 affects aortic dissection through the miR-103a-3p/HMGA2 axis by modulating proliferation and apoptosis of vascular smoothing muscle cells

array:21 ["pii" => "S1807593224000772" "issn" => "18075932" "doi" => "10.1016/j.clinsp.2024.100400" "estado" => "S250" "fechaPublicacion" => "2024-01-01" "aid" => "100400" "copyrightAnyo" => "2024" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:17 [ "pii" => "S1807593224001066" "issn" => "18075932" "doi" => "10.1016/j.clinsp.2024.100429" "estado" => "S250" "fechaPublicacion" => "2024-01-01" "aid" => "100429" "copyright" => "HCFMUSP" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original articles" "titulo" => "Prognostic value of angiographic microvascular resistance in patients with ST-segment elevation myocardial infarction" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "en" ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0003" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1759 "Ancho" => 2500 "Tamanyo" => 485292 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0003" "detalle" => "Fig 3&#58" "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Derivation of angiography-derived physiological indices of coronary lesion in patients with STEMI." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Gangzhen Qian, Haoran Qin, Dan Deng, Yue Feng, Chao Zhang, Xiaolong Qu, Zhihui Zhang" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Gangzhen" "apellidos" => "Qian" ] 1 => array:2 [ "nombre" => "Haoran" "apellidos" => "Qin" ] 2 => array:2 [ "nombre" => "Dan" "apellidos" => "Deng" ] 3 => array:2 [ "nombre" => "Yue" "apellidos" => "Feng" ] 4 => array:2 [ "nombre" => "Chao" "apellidos" => "Zhang" ] 5 => array:2 [ "nombre" => "Xiaolong" "apellidos" => "Qu" ] 6 => array:2 [ "nombre" => "Zhihui" "apellidos" => "Zhang" ] ] ] ] "resumen" => array:1 [ 0 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001">•AMR measured after PCI can predict the risk of MACEs in patients with STEMI.</li><li class="elsevierStyleListItem" id="celistitem0002">•AMR-involved nomogram improved predictive performance over variables alone.</li><li class="elsevierStyleListItem" id="celistitem0003">•AAMR-involved nomogram-derived high-risk population showed a worse prognosis at 3 years.</li><li class="elsevierStyleListItem" id="celistitem0004">•AMR has the potential to be a feasible alternative for IMR.</li></ul>" ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001066?idApp=UINPBA00004N" "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001066/v123_202411010523/en/main.assets" ] "itemAnterior" => array:17 [ "pii" => "S1807593224001236" "issn" => "18075932" "doi" => "10.1016/j.clinsp.2024.100446" "estado" => "S250" "fechaPublicacion" => "2024-01-01" "aid" => "100446" "copyright" => "HCFMUSP" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original articles" "titulo" => "The value of immature granulocyte percentage united with D-Dimer in the evaluation of severe pancreatitis and its prognosis" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "en" ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1566 "Ancho" => 2833 "Tamanyo" => 213964 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0007" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "ROC curve of IG % and D-D to evaluate the prognosis of severe pancreatitis." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Tian-Tian Xu, Si-Bing Chen" "autores" => array:2 [ 0 => array:2 [ "nombre" => "Tian-Tian" "apellidos" => "Xu" ] 1 => array:2 [ "nombre" => "Si-Bing" "apellidos" => "Chen" ] ] ] ] "resumen" => array:1 [ 0 => array:3 [ "titulo" => "Highlights" "clase" => "author-highlights" "resumen" => "<ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001">•The serum levels of IG % and D-D in the study and control group.</li><li class="elsevierStyleListItem" id="celistitem0002">•The serum levels of IG % and D-D in the survival group and death group.</li><li class="elsevierStyleListItem" id="celistitem0003">•Diagnostic value of IG % and D-D in severe pancreatitis.</li><li class="elsevierStyleListItem" id="celistitem0004">•Assessment value of IG % and D-D in prognosis of severe pancreatitis patients.</li></ul>" ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001236?idApp=UINPBA00004N" "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001236/v123_202411010523/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original articles" "titulo" => "LncRNA HCG18 affects aortic dissection through the miR-103a-3p/HMGA2 axis by modulating proliferation and apoptosis of vascular smoothing muscle cells" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "ZhiHong Yang, YuanSheng Cui, ShuGuo Xu, LongBiao Li" "autores" => array:4 [ 0 => array:2 [ "nombre" => "ZhiHong" "apellidos" => "Yang" ] 1 => array:2 [ "nombre" => "YuanSheng" "apellidos" => "Cui" ] 2 => array:2 [ "nombre" => "ShuGuo" "apellidos" => "Xu" ] 3 => array:4 [ "nombre" => "LongBiao" "apellidos" => "Li" "email" => array:1 [ 0 => "lilongbiaolb@outlook.com" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "*" "identificador" => "cor0001" ] ] ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Department of Invasive Technology, Ningde Municipal Hospital of Ningde Normal University, Ningde City, Fujian Province, China" "identificador" => "aff0001" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0001" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 1 "multimedia" => array:6 [ "identificador" => "fig0007" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => false "mostrarDisplay" => true "figura" => array:1 [ 0 => array:4 [ "imagen" => "ga1.jpeg" "Alto" => 274 "Ancho" => 2213 "Tamanyo" => 37231 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alttx001" "detalle" => "Image, graphical abstrac" "rol" => "short" ] ] ] ] "textoCompleto" => "IntroductionAortic dissection, an acute macrovascular disease with a dangerous condition and a high mortality rate, can be divided into Stanford type A and Stanford type B depending on whether the dissection affects the ascending aorta.<a class="elsevierStyleCrossRefs" href="#bib0001">1-4</a> Acute Stanford Type A Aortic Dissection (TAAD) has the characteristics of sudden onset, rapid progression, and high mortality.<a class="elsevierStyleCrossRef" href="#bib0005">5</a> In recent years, the use of advanced imaging technology has made TAAD clear diagnosis is no longer difficult, but there are still many questions about its pathogenesis and treatment options. Studies found that AD is a comprehensive pathological change process caused by pathological changes involving multiple blood vessel constituents, such as human aortic Smooth Muscle Cells (VSMCs) and extracellular matrix.<a class="elsevierStyleCrossRef" href="#bib0006">6</a>,<a class="elsevierStyleCrossRef" href="#bib0007">7</a> Surgical operation is the only approach for curing TAAD; however, the surgery is invasive and costly, and mortality rates are still high, even after treatment. Therefore, understanding the pathogenesis of AD and searching for biomarkers may reveal new therapeutic strategies to reduce clinical mortality.Long non-coding RNAs (lncRNAs) are a category of non-coding transcripts with longer than 200 nucleotides, which have attracted more and more attention of researchers. LncRNAs are closely related to cardiovascular diseases, cancer, and neurodegenerative diseases.<a class="elsevierStyleCrossRefs" href="#bib0008">8-10</a> A member of the HLA complex, lncRNA HCG18 presents an abnormal expression profile in gastric cancer,<a class="elsevierStyleCrossRef" href="#bib0011">11</a> melanoma,<a class="elsevierStyleCrossRef" href="#bib0012">12</a> osteosarcoma,<a class="elsevierStyleCrossRef" href="#bib0013">13</a> and nasopharyngeal carcinoma.<a class="elsevierStyleCrossRef" href="#bib0014">14</a> HCG18 is overexpressed in intervertebral disc degeneration and it can promote the degradation of extracellular matrix in nucleus pulposus cells.<a class="elsevierStyleCrossRef" href="#bib0015">15</a> Additionally, HCG18 inhibits proliferation and induces apoptosis of VSMCs,<a class="elsevierStyleCrossRef" href="#bib0016">16</a> indicating that HCG18 may be related to AD. However, the regulatory mechanism of HCG18 in AD progression remains unclear.MicroRNAs (miRNAs) are a family of small non-coding RNAs with a length of 18‒22 nucleotides. Evidence suggests that during normal physiological and pathological conditions, lncRNAs act as competing endogenous RNAs that competitively bind and sequester their target miRNAs, thereby counteracting miRNA-mediated repression of targeted mRNAs, indirectly regulating the expression of the miRNA target genes.<a class="elsevierStyleCrossRef" href="#bib0017">17</a>,<a class="elsevierStyleCrossRef" href="#bib0018">18</a> In addition, in this study, the authors found that there are target binding sites with HCG18 with miR-103a-3p and miR-103a-3p with HMGA2. Therefore, the aim of this study was to investigate the role and potential mechanism of HCG18/miR-103a-3p/HMGA2 axis in the development of AD and to provide new targets for targeted therapy of AD.MethodsSurgical indicationsPatients presenting with signs and symptoms of TAAD were always treated on an emergency basis as soon as the diagnosis was confirmed by transthoracic 2D echo and/or angio-computed tomography. Potential contraindications were progressively reduced, current indications including patients with systemic malperfusion, with irreversible neurological damage, and advanced age. The surgical strategy was mainly dictated by the preoperative imaging and the intraoperative findings. Graft replacement of the ascending aorta, always extended to include the hemiarch, was considered as a limited repair, performed when the entry tear was found only in the ascending aorta; dilatation of the aortic arch or presence of arch tears, evidenced by routinely performing an open distal anastomosis, represented an indication to replace both the ascending aorta and arch. Management of the aortic root depended upon its size, morphology and function, and involvement of the aortic valve.<a class="elsevierStyleCrossRef" href="#bib0019">19</a>Clinical sampleIn all, 30 patients admitted to the emergency department of the Ningde Municipal Hospital of Ningde Normal University who met the diagnostic criteria of TAAD were collected. Aortic wall tissues of ascending aorta of patients with TAAD were obtained during surgical operations and the aortic tissues of ascending aorta from donors for heart transplants were selected as the control group. Patients in the control group were excluded from Marfan syndrome, Ehlers-Danlos syndrome, familial thoracic abdominal aortic dissection, hyperkinetic inflammation, and other aortic diseases. A detailed description of the clinical characteristics of the study population is presented in <a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>. This study was approved by the Medical Ethics Committee of Ningde Municipal Hospital of Ningde Normal University (n° 201906F23). All subjects received informed consent. Aortic tissue was fixed with neutral formalin and stored at −80 °C in EP tubes for further analysis.<elsevierMultimedia ident="tbl0001"></elsevierMultimedia>Cell cultureRat aorta VSMCs (Chinese Academy of Sciences) were cultured at 37 °C and 5 % CO2 in DMEM medium (Invitrogen) containing 10 % FBS (Invitrogen) and necessary antibiotics.Cell transfectionSpecific oligonucleotides and plasmids were designed, including small interfering RNA (siRNA) targeting HCG18 (si-HCG18), miR-103a-3p mimic, HMGA2-overexpression vector (oe-HMGA2), and negative controls (Sangon, Shanghai, China). Lentiviruses were constructed and packaged by GenePharma (Shanghai, China). Lipofectamine 2000 (Invitrogen) was applied for cell transfection as per the manufacturer's instructions. VSMCs were collected after 48 h of transfection.CCK-8 testCell viability was assayed by CCK-8. Specifically. VSMCs were re-suspended in DMEM and plated on 96-well plates (1 × 104 cells/well). Then, the CCK-8 solution (10 μL/well; Dojindo) was incubated at 37 °C for 2 h before recording the absorbance at 450 nm on the microplate reader (Thermo Fisher Scientific).Colony formation experimentCell proliferation was detected by colony formation assay. Specifically, VSMCs were inoculated in 6-well plates (700-well) for 14d After being fixed in 10 % formaldehyde, VSMCs were stained with 1 % crystal violet (Beyotime, China) and imaged under a microscope (Leica, Germany) to count colonies (≥ 50 cells).Flow cytometryApoptosis was detected by flow cytometry. Specifically, VSMCs were digested with trypsin, followed by staining with Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences) and sorting on the FACScan machine (BD Biosciences). Cell apoptosis rate was determined by CellQuest software (BD Biosciences).Luciferase activity measurementWild Type (WT)-HCG18, Mutant (MUT)-HCG18, WT-HMGA2, and MUT-HMGA2 vectors were prepared by Sangon. The vectors and miR-103a-3p mimic or mimic NC and were co-transfected into VSMCs. Analysis of luciferase activity was made using the dual luciferase reporting kit (Promega) and GloMax fluorescence reader (Promega).Rat model of ADβ-Aminopropionitrile (BAPN) can inhibit the crosslinking of collagen and elastin fibers, leading to AD.<a class="elsevierStyleCrossRef" href="#bib0020">20</a>,<a class="elsevierStyleCrossRef" href="#bib0021">21</a> AD animal models were established[<a class="elsevierStyleCrossRef" href="#bib0022">22</a>,<a class="elsevierStyleCrossRef" href="#bib0023">23</a> as described previously. AD rats (3-weeks of age) were fed a normal diet with 0.25 % BAPN (Sigma) orally until 7-weeks of age. The sham rats were treated with the same amount of normal saline. Then, at 6-weeks of age, AD rats have injected with either si-HCG18 or Negative Controls (si-NC) lentivirus (1 × 1011 PFU) through the caudal vein. Finally, the aorta tissues were collected from each euthanized rat and fixed in 4 % paraformaldehyde (P0099, Beyotime). Animal experiments complied with the ARRIVE guidelines and performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The experiments were approved by the Institutional Animal Care and Use Committee of Ningde Municipal Hospital of Ningde Normal University (n° 201908J11).HE-stainingThe fixed aorta tissue was embedded in paraffin and sectioned into 4 μm. Tissue sections were dewaxed in xylene and rehydrated in graded ethanol. Staining experiments were performed using the HE-kit (C0105, Beyotime). After the sections were dehydrated, cleared, and sealed, the histopathological changes in the aortic tissue were observed under a microscope (Olympus, Japan).RT-qPCRTotal RNA was isolated using TRIzol reagent (Invitrogen) and then reverse-transcribed into cDNA using the PrimeScript RT Master Mix Kit (Takara). Real-time qPCR analysis was performed using SYBR Green Realtime PCR Master Mix (ToyoBo) in the 7900HT PCR System (ABI). All primers (<a class="elsevierStyleCrossRef" href="#tbl0002">Table 2</a>) for RT-qPCR were synthesized by Sangon. GAPDH and U6 were considered internal controls for lncRNA/mRNA and miRNA analysis, respectively.<elsevierMultimedia ident="tbl0002"></elsevierMultimedia>Western blotAfter extracting total proteins from the aortic tissue and VSMCs using RIPA lysis buffer, protein concentration was determined using the BCA kit. Protein (20 μg) was separated using 10 % SDS-PAGE, loaded onto the PVDF membrane (Merk, Germany), and sealed with 5 % skim milk for 2 h before mixing with primary antibody HMGA2 (ab97276, 1:1000, Abcam), Bcl-2 (SC-7382, 1:500, Santa Cruz), Bax (SC-7480, 1: 500, Santa Cruz), and GAPDH (ab8245, 1:1000, Abcam) overnight at 4 °C and corresponding secondary antibody for 2 h. Protein bands were visualized using ECL reagents (Pierce) and imaged using FluorChem imaging systems (BioRad).Statistical analysisAll data were processed with GraphPad Prism 6.0 software. Values were expressed as mean ± standard deviation and assessed by t-test (two groups) or one-way ANOVA (multiple groups); p < 0.05 indicated statistical significance.ResultsDownregulating HCG18 enhances VSMC proliferation and reduces apoptosisIn the aortic tissues of TAAD patients, HCG18 levels were increased (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>A). To explore HCG18’s role in AD, HCG18’s effect on the proliferation and apoptosis of VSMCs was examined. si-NC or si-HCG18 was transfected into VSMCs, and RT-qPCR results revealed that HCG18 expression was reduced in VSMCs transfected with si-HCG18 (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>B). CCK-8 and colony formation assays showed that silencing HCG18 promoted the proliferation of VSMCs (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>C‒D). Western blot results revealed that down-regulation of HCG18 increased Bcl-2 protein levels and decreased Bax protein levels (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>E). Flow cytometry results showed that down-regulation of HCG18 inhibited apoptosis in VSMCs (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>F).<elsevierMultimedia ident="fig0001"></elsevierMultimedia>HCG18 acts as a miR-103a-3p spongeBinding sites between HCG18 and miR-103a-3p were found through bioinformation website analysis (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>A). Then, dual luciferase reporter assay verified the targeting relationship between HCG18 and miR-103a-3p, as manifested by the decrease in luciferase activity after co-transfection of WT-HCG18 with miR-103a-3p mimic (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>B). RT-qPCR results revealed downregulated miR-103a-3p in the aortic tissues of TAAD patients (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>C), while increased expression in si-HCG18-transfected VSMCs (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>D).<elsevierMultimedia ident="fig0002"></elsevierMultimedia>Upregulating miR-103a-3p protects VSMCsmimic NC or miR-103a-3p mimic was transfected into VSMCs. RT-qPCR assay showed elevated miR-103a-3p expression in VSMCs transfected with miR-103a-3p mimic (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>A). CCK-8 and colony formation assays showed that upregulation of miR-103a-3p promoted the proliferation of VSMCs (both p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>B‒C). Western blot results revealed that up-regulation of miR-103a-3p resulted in increased levels of Bcl-2 protein and decreased levels of Bax protein (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>D). Flow cytometry results showed that up-regulation of miR-103a-3p inhibited apoptosis in VSMCs (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>E).<elsevierMultimedia ident="fig0003"></elsevierMultimedia>miR-103a-3p targets HMGA2Bioinformatics website analysis showed that miR-103a-3p has a targeted binding site with HMGA2 (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>A). The results of dual luciferase reporter gene assay experiments showed that the luciferase activity was reduced after WT-HMGA2 was co-transfected with miR-103a-3p mimic (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>B). HMGA2 was upregulated in the aortic tissues of patients with TAAD (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>C) and was decreased in VSMCs transfected with si-HCG18 or miR-103a-3p mimic (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>D).<elsevierMultimedia ident="fig0004"></elsevierMultimedia>HCG18/miR-103a-3p/HMGA2 axis affects VSMC proliferation and apoptosisTo further study HCG18/miR-103a-3p/HMGA2 axis in AD, si-HCG18 + oe-NC, si-HCG18 + oe-HMGA2, miR-103a-3p mimic + oe-NC or miR-103a-3p mimic + oe-HMGA2 were transfected into VSMCs. As measured by RT-qPCR and Western blot measurement, oe-HMGA2 impaired si-HCG18 or miR-103a-3p mimic in reducing HCG18 levels (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>A). Experimental data measured that enhancing HMGA2 could reduce the impacts of HCG18 downregulation or miR-103a-3p upregulation on proliferation and apoptosis of VSMCs (all p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 5</a>B‒E).<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Downregulating HCG18 improves the pathological injury of the aorta in AD ratsFinally, an AD animal model was induced to verify the regulatory effect of HCG18. HCG18 was upregulated in AD rats (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>A). si-NC or si-HCG18 lentivirus was injected into the tail vein of AD rats, and successful lentivirus injection was verified by RT-qPCR (p < 0.05; <a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>B). HE-staining observed that the aortic wall of AD rats contained broken elastic fibers, and blood cells entered the aortic wall, leading to tearing and stripping; down-regulation of HCG18 could improve the above pathological changes (<a class="elsevierStyleCrossRef" href="#fig0006">Fig. 6</a>C).<elsevierMultimedia ident="fig0006"></elsevierMultimedia>DiscussionIt is known that HCG18 exerts adjustive effects on VSMCs.<a class="elsevierStyleCrossRef" href="#bib0016">16</a> This work studied the function of HCG18 in AD and explored its related downstream mechanism. Abnormal regulation of lncRNAs is often related to pathological processes, including coronary heart disease.<a class="elsevierStyleCrossRef" href="#bib0024">24</a>,<a class="elsevierStyleCrossRef" href="#bib0025">25</a> LncRNAs have also been reported to be involved in regulating cardiovascular diseases such as heart failure, hypertension, and aneurysm.<a class="elsevierStyleCrossRef" href="#bib0026">26</a>,<a class="elsevierStyleCrossRef" href="#bib0027">27</a> HCG18 is a recently studied lncRNA that is abnormally expressed in many diseases.<a class="elsevierStyleCrossRefs" href="#bib0028">28-30</a> The current work identified that HCG18 was upregulated in the aortic tissues of TAAD patients, and down-regulated HCG18 protected VSMCs regarding cell proliferation and apoptosis. In addition, down-regulated HCG18 could improve the pathological injury of aorta in AD rats.Studies have confirmed the mutual regulatory relationship between lncRNAs and miRNAs, exerting physiological and pathological functions through different regulatory ways.<a class="elsevierStyleCrossRefs" href="#bib0031">31-33</a> It is noted that HCG18 aggravates diabetic peripheral neuropathy through modulating miR-146a.<a class="elsevierStyleCrossRef" href="#bib0034">34</a> It has been proposed that HCG18 accelerates lung adenocarcinoma development by targeting miR-34a-5p.<a class="elsevierStyleCrossRef" href="#bib0035">35</a> The present study found that HCG18 was competitively bound to miR-103a-3p. As measured, miR-103a-3p was downregulated in the aortic tissues of AD patients and enhancing miR-103a-3p induced proliferative and suppressed apoptotic activities of VSMCs.HMGA2, as a transcription factor, is increased in expression in malignant tumors.<a class="elsevierStyleCrossRefs" href="#bib0036">36-38</a> As suggested, targeting HMGA2 is a useful method in miR-26b inhibiting Stanford Type A AD.<a class="elsevierStyleCrossRef" href="#bib0039">39</a> The current work identified HMGA2 as the target gene of miR-103a-3p, and HMGA2 was upregulated in the aortic tissues of AD patients. HMGA2 promotion could impair HCG18 downregulation or miR-103a-3p upregulation in mediating VSMC proliferation and apoptosis.Considering the limitations of this study, a limited sample may not fully confirm the accuracy of the results. Secondly, the relationship between HCG18 and other potential targeted miRNAs needs further attention and research. In addition, only TAAD patients were included in this study, and the experimental results cannot be generalized to all AD patients for the time being.ConclusionIn summary, this study for the first time found that HCG18 promotes AD progression by competing with miR-103a-3p to target HMGA2 expression. This provides a theoretical basis for gene therapy for aortic coarctation, and surgical treatment assisted by gene therapy may be a new therapeutic strategy for patients with TAAD.Availability of data and materialsThe datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.Ethics statementThis study was approved by the Medical Ethics Committee of Ningde Municipal Hospital of Ningde Normal University (n°201906F23). All subjects received informed consent. The animal experiments were complied with the ARRIVE guidelines and approved by the ethics committee of Ningde Municipal Hospital of Ningde Normal University (n° 201908J11).Authors’ contributionsZhiHong Yang designed the research study. YuanSheng Cui and ShuGuo Xu performed the research. LongBiao Li provided help and advice. YuanSheng Cui and ShuGuo Xu analyzed the data. ZhiHong Yang wrote the manuscript. LongBiao Li reviewed and edited the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.FundingNot applicable." "textoCompletoSecciones" => array:1 [ "secciones" => array:15 [ 0 => array:3 [ "identificador" => "xres2290997" "titulo" => "Graphical abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abss0006" ] ] ] 1 => array:3 [ "identificador" => "xres2290996" "titulo" => "Highlights" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abss0001" ] ] ] 2 => array:3 [ "identificador" => "xres2290995" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0002" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abss0003" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abss0004" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0005" "titulo" => "Conclusion" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1903352" "titulo" => "Keywords" ] 4 => array:2 [ "identificador" => "sec0001" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0002" "titulo" => "Methods" "secciones" => array:13 [ 0 => array:2 [ "identificador" => "sec0003" "titulo" => "Surgical indications" ] 1 => array:2 [ "identificador" => "sec0004" "titulo" => "Clinical sample" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Cell culture" ] 3 => array:2 [ "identificador" => "sec0006" "titulo" => "Cell transfection" ] 4 => array:2 [ "identificador" => "sec0007" "titulo" => "CCK-8 test" ] 5 => array:2 [ "identificador" => "sec0008" "titulo" => "Colony formation experiment" ] 6 => array:2 [ "identificador" => "sec0009" "titulo" => "Flow cytometry" ] 7 => array:2 [ "identificador" => "sec0010" "titulo" => "Luciferase activity measurement" ] 8 => array:2 [ "identificador" => "sec0011" "titulo" => "Rat model of AD" ] 9 => array:2 [ "identificador" => "sec0012" "titulo" => "HE-staining" ] 10 => array:2 [ "identificador" => "sec0013" "titulo" => "RT-qPCR" ] 11 => array:2 [ "identificador" => "sec0014" "titulo" => "Western blot" ] 12 => array:2 [ "identificador" => "sec0015" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0016" "titulo" => "Results" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0017" "titulo" => "Downregulating HCG18 enhances VSMC proliferation and reduces apoptosis" ] 1 => array:2 [ "identificador" => "sec0018" "titulo" => "HCG18 acts as a miR-103a-3p sponge" ] 2 => array:2 [ "identificador" => "sec0019" "titulo" => "Upregulating miR-103a-3p protects VSMCs" ] 3 => array:2 [ "identificador" => "sec0020" "titulo" => "miR-103a-3p targets HMGA2" ] 4 => array:2 [ "identificador" => "sec0021" "titulo" => "HCG18/miR-103a-3p/HMGA2 axis affects VSMC proliferation and apoptosis" ] 5 => array:2 [ "identificador" => "sec0022" "titulo" => "Downregulating HCG18 improves the pathological injury of the aorta in AD rats" ] ] ] 7 => array:2 [ "identificador" => "sec0023" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0024" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0025" "titulo" => "Availability of data and materials" ] 10 => array:2 [ "identificador" => "sec0026" "titulo" => "Ethics statement" ] 11 => array:2 [ "identificador" => "sec0027" "titulo" => "Authors’ contributions" ] 12 => array:2 [ "identificador" => "sec0028" "titulo" => "Funding" ] 13 => array:2 [ "identificador" => "xack786268" "titulo" => "Acknowledgments" ] 14 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2023-12-20" "fechaAceptado" => "2024-05-18" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1903352" "palabras" => array:5 [ 0 => "LncRNA HCG18" 1 => "miR-103a-3p" 2 => "HMGA2" 3 => "VSMCs" 4 => "Aortic dissection" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundAortic Dissection (AD) is a vascular disease with a high mortality rate and limited treatment strategies. The current research analyzed the function and regulatory mechanism of lncRNA HCG18 in AD. MethodsHCG18, miR-103a-3p, and HMGA2 levels in the aortic tissue of AD patients were examined by RT-qPCR. After transfection with relevant plasmids, the proliferation of rat aortic Vascular Smoothing Muscle Cells (VSMCs) was detected by CCK-8 and colony formation assay, Bcl-2 and Bax was measured by Western blot, and apoptosis was checked by flow cytometry. Then, the targeting relationship between miR-103a-3p and HCG18 or HMGA2 was verified by bioinformation website analysis and dual luciferase reporter assay. Finally, the effect of HCG18 was verified in an AD rat model induced by β-aminopropionitrile. ResultsHCG18 and HMGA2 were upregulated and miR-103a-3p was downregulated in the aortic tissues of AD patients. Downregulating HCG18 or upregulating miR-103a-3p enhanced the proliferation of VSMCs and limited cell apoptosis. HCG18 promoted HMGA2 expression by competing with miR-103a-3p and restoring HMGA2 could impair the effect of HCG18 downregulation or miR-103a-3p upregulation in mediating the proliferation and apoptosis of VSMCs. In addition, down-regulation of HCG18 could improve the pathological injury of the aorta in AD rats. ConclusionHCG18 reduces proliferation and induces apoptosis of VSMCs through the miR-103a-3p/HMGA2 axis, thus aggravating AD." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abss0002" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abss0003" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abss0004" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abss0005" "titulo" => "Conclusion" ] ] ] ] "highlights" => array:2 [ "titulo" => "Highlights" "resumen" => "<ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001">•Downregulating HCG18 enhances VSMC proliferation and reduces apoptosis.</li><li class="elsevierStyleListItem" id="celistitem0002">•HCG18/miR-103a-3p/HMGA2 axis affects VSMC proliferation and apoptosis.</li><li class="elsevierStyleListItem" id="celistitem0003">•Downregulating HCG18 improves the pathological injury of the aorta in AD rats.</li></ul>" ] "multimedia" => array:9 [ 0 => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1572 "Ancho" => 3458 "Tamanyo" => 289270 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0003" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Downregulating HCG18 promotes the proliferation of VSMCs and inhibits cell apoptosis. (A) RT-qPCR analyzed HCG18 in aortic tissues of AD patients (n = 30); (B) RT-qPCR verified the successful transfection; (C‒D) CCK-8 and colony formation assay measured VSMC proliferation; (E) Western blot measured Bcl-2 and Bax protein expression; (F) Flow cytometry analyzed VSMC apoptosis. Values are expressed as mean ± standard deviation (n = 3). *vs. si-NC, p < 0.05." ] ] 1 => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1905 "Ancho" => 3458 "Tamanyo" => 318040 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0004" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "HCG18 functions as a miR-103a-3p sponge. (A) Bioinformation website predicted the binding sites of HCG18 and miR-103a-3p; (B) Dual luciferase reporter assay verified the targeting relationship between HCG18 and miR-103a-3p; (C) RT-qPCR analyzed miR-103a-3p expression in aortic tissues of AD patients (n = 30); (D) RT-qPCR analyzed miR-103a-3p expression in VSMCs transfected with si-NC or si-HCG18. Values are expressed as mean ± standard deviation (n = 3)." ] ] 2 => array:8 [ "identificador" => "fig0003" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 3847 "Ancho" => 3458 "Tamanyo" => 681565 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0005" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Upregulating miR-103a-3p protects VSMCs. (A) RT-qPCR verified the successful transfection; (B‒C) CCK-8 and colony formation assay measured VSMC proliferation; (D) Western blot measurement measured Bcl-2 and Bax protein expression; (E) Flow cytometry analyzed VSMC apoptosis. Values are expressed as mean ± standard deviation (n = 3). *vs. mimic NC, p < 0.05." ] ] 3 => array:8 [ "identificador" => "fig0004" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 2053 "Ancho" => 3458 "Tamanyo" => 316462 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0006" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "HMGA2 is directly targeted by miR-103a-3p. (A) Bioinformation website predicted the binding sites of miR-103a-3p to HMGA2; (B) Dual luciferase reporter assay verified the targeting relationship between miR-103a-3p and HMGA2; (C) RT-qPCR analyzed HMGA2 in aortic tissues of AD patients (n = 30); (D) RT-qPCR and Western blot measurement analyzed HMGA2 in VSMCs transfected with si-NC, si-HCG18, mimic NC, or miR-103a-3p mimic. Values are expressed as mean ± standard deviation (n = 3)." ] ] 4 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2373 "Ancho" => 3458 "Tamanyo" => 622852 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0007" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "HCG18/miR-103a-3p/HMGA2 axis affects VSMC proliferation and apoptosis. (A) RT-qPCR and Western blot measurement verified the successful transfection; (B‒C) CCK-8 and colony formation assay measured VSMC proliferation; (D) Western blot measurement measured Bcl-2 and Bax protein expression; (E) Flow cytometry analyzed VSMC apoptosis. Values are expressed as mean ± standard deviation (n = 3). *vs. si-HCG18 + oe-NC, p < 0.05; #vs. miR-103a-3p mimic + oe-NC, p < 0.05." ] ] 5 => array:8 [ "identificador" => "fig0006" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 2956 "Ancho" => 2167 "Tamanyo" => 775409 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0008" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Downregulating HCG18 improves the pathological injury of aorta in AD rats. (A) RT-qPCR analyzed HCG18 in AD rats; (B) RT-qPCR verified the successful injection of lentivirus; (C) HE-staining observed the pathological changes of aorta in AD rats; Values are expressed as mean ± standard deviation (n = 6). *vs. Sham, p < 0.05; #vs. si-NC, p < 0.05." ] ] 6 => array:8 [ "identificador" => "tbl0001" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "TAAD, Type A Aortic Dissection." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristics \t\t\t\t\t\t\n \t\t\t\t\t\t</th><a name="en0002"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Control (n = 30) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><a name="en0003"></a><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="top" scope="col" style="border-bottom: 2px solid black">TAAD (n = 30) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0004"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0005"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">53.2 ± 9.6 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0006"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">52.4 ± 11.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0007"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Body mass index \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0008"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">26.4 ± 4.0 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0009"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">28.5 ± 3.1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0010"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Sex \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0011"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0012"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0013"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Male \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0014"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">25 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0015"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">24 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0016"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Female \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0017"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0019"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Current smoker \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0020"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">7 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0021"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">8 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0022"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Alcoholic abuse \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0023"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0025"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Hypertension \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0026"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">26 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0028"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Hyperlipidemia \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0029"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0031"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Atherosclerosis \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0032"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0033"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">15 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0034"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Diabetes mellitus \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0035"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0036"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">0 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3711690.png" ] ] ] ] "descripcion" => array:1 [ "en" => "The clinical characteristics of TAAD and control groups." ] ] 7 => array:8 [ "identificador" => "tbl0002" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "HCG18, Long Noncoding RNA HLA Complex Group 18; miR-103a-3p, microRNA-103a-3p; HMGA2, High Mobility Group AT-hook 2; GAPDH, Glyceraldehyde-3-Phosphate Dehydrogenase." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><a name="en0037"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="top" style="border-bottom: 2px solid black">Genes \t\t\t\t\t\t\n \t\t\t\t</td><a name="en0038"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top" style="border-bottom: 2px solid black">Sequences (5′–3′) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0039"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">HCG18</td><a name="en0040"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward: GCTAGGTCCTCTACTTTCTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0042"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse: CAGAAAGTAGAGGACCTAGC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0043"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">miR-103a-3p</td><a name="en0044"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward: AGCAGCATTGTACAGGGCTATG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0046"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse: CTCTACAGCTATATTGCCAGCCAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0047"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">HMGA2</td><a name="en0048"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward: GGGCGCCGACATTCAAT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0050"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse: ACTGCAGTGTCTTCTCCCTTCAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0051"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">U6</td><a name="en0052"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward: CTCGCTTCGGCAGCACA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0054"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse: AACGCTTCACGAATTTGCGT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0055"></a><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">GAPDH</td><a name="en0056"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Forward: GTCGGTGTGAACGGATTTG \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><a name="en0058"></a><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="top">Reverse: TCCCATTCTCAGCCTTGAC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3711689.png" ] ] ] ] "descripcion" => array:1 [ "en" => "RT-qPCR sequences." ] ] 8 => array:6 [ "identificador" => "fig0007" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => false "mostrarDisplay" => true "figura" => array:1 [ 0 => array:4 [ "imagen" => "ga1.jpeg" "Alto" => 274 "Ancho" => 2213 "Tamanyo" => 37231 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alttx001" "detalle" => "Image, graphical abstrac" "rol" => "short" ] ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec1" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0001" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Management of acute aortic dissection" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "C. Nienaber" 1 => "R. Clough" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0140-6736(14)61005-9" "Revista" => array:7 [ "tituloSerie" => "Lancet" "fecha" => "2015" "volumen" => "385" "numero" => "9970" "paginaInicial" => "800" "paginaFinal" => "811" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25662791" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0002" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aortic dissection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.A. Nienaber" 1 => "R.E. Clough" 2 => "N. Sakalihasan" 3 => "T. Suzuki" 4 => "R. Gibbs" 5 => "F. Mussa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrdp.2016.53" "Revista" => array:5 [ "tituloSerie" => "Nat Rev Dis Primers" "fecha" => "2016" "volumen" => "2" "paginaInicial" => "16053" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27440162" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0003" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aortic dissection: medical, interventional and surgical management" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M. Silaschi" 1 => "J. Byrne" 2 => "O. Wendler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/heartjnl-2015-308284" "Revista" => array:7 [ "tituloSerie" => "Heart" "fecha" => "2017" "volumen" => "103" "numero" => "1" "paginaInicial" => "78" "paginaFinal" => "87" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27733536" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0004" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical, diagnostic, and management perspectives of aortic dissection" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "I.A. Khan" 1 => "C.K. Nair" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.122.1.311" "Revista" => array:7 [ "tituloSerie" => "Chest" "fecha" => "2002" "volumen" => "122" "numero" => "1" "paginaInicial" => "311" "paginaFinal" => "328" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12114376" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0005" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines; American Association for Thoracic Surgery; American College of Radiology; American Stroke Association; Society of Cardiovascular Anesthesiologists; Society for Cardiovascular Angiography and Interventions; Society of Interventional Radiology; Society of Thoracic Surgeons; Society for Vascular Medicine. 2010 ACCF/AHA/AATS/ACR/ASA/SCA/SCAI/SIR/STS/SVM guidelines for the diagnosis and management of patients with Thoracic Aortic Disease: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines, American Association for Thoracic Surgery, American College of Radiology, American Stroke Association, Society of Cardiovascular Anesthesiologists, Society for Cardiovascular Angiography and Interventions, Society of Interventional Radiology, Society of Thoracic Surgeons, and Society for Vascular Medicine" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L.F. Hiratzka" 1 => "G.L. Bakris" 2 => "J.A. Beckman" 3 => "R.M. Bersin" 4 => "V.F. Carr" 5 => "D.E. Casey Jr" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIR.0b013e3181d4739e" "Revista" => array:7 [ "tituloSerie" => "Circulation" "fecha" => "2010" "volumen" => "121" "numero" => "13" "paginaInicial" => "e266" "paginaFinal" => "e369" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20233780" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0006" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Altered smooth muscle cell force generation as a driver of thoracic aortic aneurysms and dissections" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "D. Milewicz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/ATVBAHA.116.303229" "Revista" => array:7 [ "tituloSerie" => "Arterioscler Thromb Vasc Biol" "fecha" => "2017" "volumen" => "37" "numero" => "1" "paginaInicial" => "26" "paginaFinal" => "34" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27879251" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0007" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of smooth muscle cell phenotypes with extracellular matrix disorders in thoracic aortic dissection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "L. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jvs.2012.05.084" "Revista" => array:7 [ "tituloSerie" => "J Vasc Surg" "fecha" => "2012" "volumen" => "56" "numero" => "6" "paginaInicial" => "1698" "paginaFinal" => "1709" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22960022" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0008" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long noncoding RNAs in cardiovascular diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S. Uchida" 1 => "S. Dimmeler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCRESAHA.116.302521" "Revista" => array:7 [ "tituloSerie" => "Circ Res" "fecha" => "2015" "volumen" => "116" "numero" => "4" "paginaInicial" => "737" "paginaFinal" => "750" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25677520" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0009" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging roles of long non-coding RNA in cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:1 [ 0 => "A. Sanchez Calle" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/cas.13642" "Revista" => array:7 [ "tituloSerie" => "Cancer Sci" "fecha" => "2018" "volumen" => "109" "numero" => "7" "paginaInicial" => "2093" "paginaFinal" => "2100" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29774630" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0010" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The long non-coding RNAs in neurodegenerative diseases: novel mechanisms of pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "P. Riva" 1 => "A. Ratti" 2 => "M. Venturin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2174/1567205013666160622112234" "Revista" => array:7 [ "tituloSerie" => "Curr Alzheimer Res" "fecha" => "2016" "volumen" => "13" "numero" => "11" "paginaInicial" => "1219" "paginaFinal" => "1231" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27338628" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0011" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Exosome-mediated transfer of lncRNA HCG18 promotes M2 macrophage polarization in gastric cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Xin" 1 => "Y. Wu" 2 => "C. Liu" 3 => "F. Zeng" 4 => "J.-L. Wang" 5 => "D-Z Wu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.molimm.2021.10.011" "Revista" => array:6 [ "tituloSerie" => "Mol Immunol" "fecha" => "2021" "volumen" => "140" "paginaInicial" => "196" "paginaFinal" => "205" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34735868" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0012" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA HCG18 facilitates melanoma progression by modulating miR-324-5p/CDK16 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Zhang" 1 => "H. Lv" 2 => "F. Zhang" 3 => "A Ji" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Am J Transl Res" "fecha" => "2022" "volumen" => "14" "numero" => "2" "paginaInicial" => "1246" "paginaFinal" => "1257" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35273726" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0013" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA HCG18 promotes osteosarcoma growth by enhanced aerobic glycolysis via the miR-365a-3p/PGK1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X. Pan" 1 => "J. Guo" 2 => "C. Liu" 3 => "Z. Pan" 4 => "Z. Yang" 5 => "X. Yao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s11658-021-00304-6" "Revista" => array:6 [ "tituloSerie" => "Cell Mol Biol Lett" "fecha" => "2022" "volumen" => "27" "numero" => "1" "paginaInicial" => "5" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34991445" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0014" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA HCG18 contributes to nasopharyngeal carcinoma development by modulating miR-140/CCND1 and Hedgehog signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L. Li" 1 => "T.-T. Ma" 2 => "Y.-H. Ma" 3 => "Y.-F. Jiang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Eur Rev Med Pharmacol Sci" "fecha" => "2019" "volumen" => "23" "numero" => "23" "paginaInicial" => "10387" "paginaFinal" => "10399" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0015" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA HCG18 promotes extracellular matrix degradation of nucleus pulposus cells in intervertebral disc degeneration by regulating the miR-4306/EPAS1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Cao" 1 => "Y. Ma" 2 => "H. Yang" 3 => "G. Luo" 4 => "H. Cheng" 5 => "X. Jin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.wneu.2022.11.126" "Revista" => array:6 [ "tituloSerie" => "World Neurosurg" "fecha" => "2023" "volumen" => "172" "paginaInicial" => "e52" "paginaFinal" => "e61" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/36460200" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0016" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA HCG18 is critical for vascular smooth muscle cell proliferation and phenotypic switching" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Lu" 1 => "J. Guo" 2 => "S. Zhu" 3 => "H. Zhang" 4 => "Q. Zhu" 5 => "Y. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s13577-020-00366-2" "Revista" => array:7 [ "tituloSerie" => "Hum Cell" "fecha" => "2020" "volumen" => "33" "numero" => "3" "paginaInicial" => "537" "paginaFinal" => "544" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32449112" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0017" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Integrative analysis of long noncoding RNA (lncRNA), microRNA (miRNA) and mRNA expression and construction of a competing endogenous RNA (ceRNA) network in metastatic melanoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L-X Wang" 1 => "C. Wan" 2 => "Z.-B. Dong" 3 => "B.-H. Wang" 4 => "H.-Y. Liu" 5 => "Y. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.12659/MSM.913881" "Revista" => array:6 [ "tituloSerie" => "Med Sci Monit" "fecha" => "2019" "volumen" => "25" "paginaInicial" => "2896" "paginaFinal" => "2907" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31004080" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0018" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNAs (miRNAs) and long non-coding RNAs (lncRNAs) as new tools for cancer therapy: first steps from bench to bedside" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Ratti" 1 => "A. Lampis" 2 => "M. Ghidini" 3 => "M. Salati" 4 => "M.B. Mirchev" 5 => "N. Valeri" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11523-020-00717-x" "Revista" => array:7 [ "tituloSerie" => "Target Oncol" "fecha" => "2020" "volumen" => "15" "numero" => "3" "paginaInicial" => "261" "paginaFinal" => "278" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32451752" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0019" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Type A acute aortic dissection with ≥40-mm aortic root: results of conservative and replacement strategies at long-term follow-up" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Vendramin" 1 => "A. Lechiancole" 2 => "D. Piani" 3 => "L. Deroma" 4 => "A. Tullio" 5 => "S. Sponga" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/ejcts/ezaa456" "Revista" => array:7 [ "tituloSerie" => "Eur J Cardiothorac Surg" "fecha" => "2021" "volumen" => "59" "numero" => "5" "paginaInicial" => "1115" "paginaFinal" => "1122" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33367649" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0020" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inhibition of cross-links in collagen is associated with reduced stiffness of the aorta in young rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A. Bruel" 1 => "G. Ortoft" 2 => "H. Oxlund" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0021-9150(98)00130-0" "Revista" => array:7 [ "tituloSerie" => "Atherosclerosis" "fecha" => "1998" "volumen" => "140" "numero" => "1" "paginaInicial" => "135" "paginaFinal" => "145" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9733224" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0021" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alteration of elastic architecture in the lathyritic rat aorta implies the pathogenesis of aortic dissecting aneurysm" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y. Nakashima" 1 => "K. Sueishi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Am J Pathol" "fecha" => "1992" "volumen" => "140" "numero" => "4" "paginaInicial" => "959" "paginaFinal" => "969" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1562054" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0022" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-22 inhibits the apoptosis of vascular smooth muscle cell by targeting p38MAPKalpha in vascular remodeling of aortic dissection" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Xiao" 1 => "Y. Sun" 2 => "X. Ma" 3 => "C. Wang" 4 => "L. Zhang" 5 => "J. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.omtn.2020.08.018" "Revista" => array:6 [ "tituloSerie" => "Mol Ther Nucleic Acids" "fecha" => "2020" "volumen" => "22" "paginaInicial" => "1051" "paginaFinal" => "1062" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33294292" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0023" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bindarit reduces the incidence of acute aortic dissection complicated lung injury via modulating NF-kappaB pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Z. Wu" 1 => "J. Chang" 2 => "W. Ren" 3 => "Z. Hu" 4 => "B. Li" 5 => "H Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3892/etm.2017.4830" "Revista" => array:7 [ "tituloSerie" => "Exp Ther Med" "fecha" => "2017" "volumen" => "14" "numero" => "3" "paginaInicial" => "2613" "paginaFinal" => "2618" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28962202" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0024" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long non-coding RNAs: a new frontier in the study of human diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "X. Shi" 1 => "M. Sun" 2 => "H. Liu" 3 => "Y. Yao" 4 => "Y. Song" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.canlet.2013.06.013" "Revista" => array:7 [ "tituloSerie" => "Cancer Lett" "fecha" => "2013" "volumen" => "339" "numero" => "2" "paginaInicial" => "159" "paginaFinal" => "166" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23791884" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0025" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The emerging role of long noncoding RNAs in human disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J. DiStefano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-4939-7471-9_6" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol" "fecha" => "2018" "volumen" => "1706" "paginaInicial" => "91" "paginaFinal" => "110" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29423795" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0026" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long noncoding RNAs in kidney and cardiovascular diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J. Lorenzen" 1 => "T. Thum" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nrneph.2016.51" "Revista" => array:7 [ "tituloSerie" => "Nat Rev Nephrol" "fecha" => "2016" "volumen" => "12" "numero" => "6" "paginaInicial" => "360" "paginaFinal" => "373" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27140855" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0027" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The emerging roles of long noncoding RNAs in common cardiovascular diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "X. Jiang" 1 => "Q. Ning" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/hr.2015.26" "Revista" => array:7 [ "tituloSerie" => "Hypertens Res" "fecha" => "2015" "volumen" => "38" "numero" => "6" "paginaInicial" => "375" "paginaFinal" => "379" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25762413" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0028" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HCG18LncRNA promotes clear cell renal cell carcinoma progression by targeting to upregulate" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Yang" 1 => "P. Gong" 2 => "D. Yao" 3 => "D. Xue" 4 => "X. He" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/CMAR.S298649" "Revista" => array:6 [ "tituloSerie" => "Cancer Manag Res" "fecha" => "2021" "volumen" => "13" "paginaInicial" => "2287" "paginaFinal" => "2294" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33732021" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0029" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HCG18LncRNA suppresses CD8 T cells to confer resistance to cetuximab in colorectal cancer via miR-20b-5p/PD-L1 axis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.-J. Xu" 1 => "J.-M. Zhao" 2 => "X.-F. Ni" 3 => "W. Wang" 4 => "W.-W. Hu" 5 => "C.-P. Wu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Epigenomics" "fecha" => "2021" "volumen" => "13" "numero" => "16" "paginaInicial" => "1281" "paginaFinal" => "1297" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0030" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Upregulated lncRNA HCG18 in patients with non-alcoholic fatty liver disease and its regulatory effect on insulin resistance" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y. Xia" 1 => "Y. Zhang" 2 => "H. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/DMSO.S333431" "Revista" => array:6 [ "tituloSerie" => "Diabetes Metab Syndr Obes" "fecha" => "2021" "volumen" => "14" "paginaInicial" => "4747" "paginaFinal" => "4756" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34887672" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0031" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analyzing MiRNA-LncRNA interactions" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M. Paraskevopoulou" 1 => "A. Hatzigeorgiou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/978-1-4939-3378-5_21" "Revista" => array:6 [ "tituloSerie" => "Methods Mol Biol" "fecha" => "2016" "volumen" => "1402" "paginaInicial" => "271" "paginaFinal" => "286" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26721498" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0032" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Analyzing the LncRNA, miRNA, and mRNA regulatory network in prostate cancer with bioinformatics software" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.-H. He" 1 => "Z.-P. Han" 2 => "M.-X. Zou" 3 => "L. Wang" 4 => "Y.B. Lv" 5 => "J.B. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/cmb.2016.0093" "Revista" => array:7 [ "tituloSerie" => "J Comput Biol" "fecha" => "2018" "volumen" => "25" "numero" => "2" "paginaInicial" => "146" "paginaFinal" => "157" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28836827" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0033" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Construction and analysis of mRNA, miRNA, lncRNA, and TF regulatory networks reveal the key genes associated with prostate cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y. Ye" 1 => "S. Li" 2 => "S. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "PLoS ONE" "fecha" => "2018" "volumen" => "13" "numero" => "8" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0034" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long non-coding RNA HCG18 promotes M1 macrophage polarization through regulating the miR-146a/TRAF6 axis, facilitating the progression of diabetic peripheral neuropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W. Ren" 1 => "G. Xi" 2 => "X. Li" 3 => "L. Zhao" 4 => "K. Yang" 5 => "X. Fan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s11010-020-03923-3" "Revista" => array:7 [ "tituloSerie" => "Mol Cell Biochem" "fecha" => "2021" "volumen" => "476" "numero" => "1" "paginaInicial" => "471" "paginaFinal" => "482" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32996080" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0035" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HCG18/miR-34a-5p/HMMR axis accelerates the progression of lung adenocarcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Li" 1 => "T. Pan" 2 => "W. Jiang" 3 => "H. Zhao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Biomed Pharmacother" "fecha" => "2020" "volumen" => "129" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0036" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HMGA2 as a critical regulator in cancer development" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Mansoori" 1 => "A. Mohammadi" 2 => "H.J. Ditzel" 3 => "P.H.G. Duijf" 4 => "V. Khaze" 5 => "M.F. Gjerstorff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/genes12020269" "Revista" => array:6 [ "tituloSerie" => "Genes" "fecha" => "2021" "volumen" => "12" "numero" => "2" "paginaInicial" => "269" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33668453" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0037" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging roles for HMGA2 in colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "X. Wang" 1 => "J. Wang" 2 => "J. Wu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Transl Oncol" "fecha" => "2021" "volumen" => "14" "numero" => "1" ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0038" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "HMGA2 supports cancer hallmarks in triple-negative breast cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Mansoori" 1 => "M.G. Terp" 2 => "A. Mohammadi" 3 => "C.B. Pedersen" 4 => "H.J. Ditzel" 5 => "B. Baradaran" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/cancers13205197" "Revista" => array:6 [ "tituloSerie" => "Cancers" "fecha" => "2021" "volumen" => "13" "numero" => "20" "paginaInicial" => "5197" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34680349" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0039" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-26b suppresses the development of Stanford type A aortic dissection by regulating HMGA2 and TGF-β/Smad3 signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Yang" 1 => "P. Wu" 2 => "X. Liu" 3 => "J. Feng" 4 => "S. Zheng" 5 => "Y. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.5761/atcs.oa.19-00184" "Revista" => array:7 [ "tituloSerie" => "Ann Thorac Cardiovasc Surg" "fecha" => "2020" "volumen" => "26" "numero" => "3" "paginaInicial" => "140" "paginaFinal" => "150" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31723084" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack786268" "titulo" => "Acknowledgments" "texto" => "Not applicable." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224000772/v123_202411010523/en/main.assets" "Apartado" => array:4 [ "identificador" => "94924" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/18075932/000000790000000C/v123_202411010523/S1807593224000772/v123_202411010523/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224000772?idApp=UINPBA00004N"]

Statistics

Original articles

ZhiHong Yang, YuanSheng Cui, ShuGuo Xu, LongBiao Li

Corresponding author

lilongbiaolb@outlook.com

Corresponding author.

Department of Invasive Technology, Ningde Municipal Hospital of Ningde Normal University, Ningde City, Fujian Province, China

Read

264

Times
was read the article

Total PDF

178

Total HTML

Share statistics

 array:21 [
  "pii" => "S1807593224000772"
  "issn" => "18075932"
  "doi" => "10.1016/j.clinsp.2024.100400"
  "estado" => "S250"
  "fechaPublicacion" => "2024-01-01"
  "aid" => "100400"
  "copyrightAnyo" => "2024"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:17 [
    "pii" => "S1807593224001066"
    "issn" => "18075932"
    "doi" => "10.1016/j.clinsp.2024.100429"
    "estado" => "S250"
    "fechaPublicacion" => "2024-01-01"
    "aid" => "100429"
    "copyright" => "HCFMUSP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
      "titulo" => "Prognostic value of angiographic microvascular resistance in patients with ST-segment elevation myocardial infarction"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "en"
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0003"
          "etiqueta" => "Fig&#46; 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1759
              "Ancho" => 2500
              "Tamanyo" => 485292
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0003"
              "detalle" => "Fig 3&#58"
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Derivation of angiography-derived physiological indices of coronary lesion in patients with STEMI&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Gangzhen Qian, Haoran Qin, Dan Deng, Yue Feng, Chao Zhang, Xiaolong Qu, Zhihui Zhang"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Gangzhen"
              "apellidos" => "Qian"
            ]
            1 => array:2 [
              "nombre" => "Haoran"
              "apellidos" => "Qin"
            ]
            2 => array:2 [
              "nombre" => "Dan"
              "apellidos" => "Deng"
            ]
            3 => array:2 [
              "nombre" => "Yue"
              "apellidos" => "Feng"
            ]
            4 => array:2 [
              "nombre" => "Chao"
              "apellidos" => "Zhang"
            ]
            5 => array:2 [
              "nombre" => "Xiaolong"
              "apellidos" => "Qu"
            ]
            6 => array:2 [
              "nombre" => "Zhihui"
              "apellidos" => "Zhang"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara013" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">AMR measured after PCI can predict the risk of MACEs in patients with STEMI&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">AMR-involved nomogram improved predictive performance over variables alone&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0004" class="elsevierStylePara elsevierViewall">AAMR-involved nomogram-derived high-risk population showed a worse prognosis at 3 years&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0004"><span class="elsevierStyleLabel">&#8226;</span><p id="para0005" class="elsevierStylePara elsevierViewall">AMR has the potential to be a feasible alternative for IMR&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001066?idApp=UINPBA00004N"
    "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001066/v123_202411010523/en/main.assets"
  ]
  "itemAnterior" => array:17 [
    "pii" => "S1807593224001236"
    "issn" => "18075932"
    "doi" => "10.1016/j.clinsp.2024.100446"
    "estado" => "S250"
    "fechaPublicacion" => "2024-01-01"
    "aid" => "100446"
    "copyright" => "HCFMUSP"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
      "titulo" => "The value of immature granulocyte percentage united with D-Dimer in the evaluation of severe pancreatitis and its prognosis"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "en"
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0002"
          "etiqueta" => "Fig&#46; 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1566
              "Ancho" => 2833
              "Tamanyo" => 213964
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0007"
              "detalle" => "Fig "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">ROC curve of IG &#37; and D-D to evaluate the prognosis of severe pancreatitis&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Tian-Tian Xu, Si-Bing Chen"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "Tian-Tian"
              "apellidos" => "Xu"
            ]
            1 => array:2 [
              "nombre" => "Si-Bing"
              "apellidos" => "Chen"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Highlights"
          "clase" => "author-highlights"
          "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara008" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0001" class="elsevierStylePara elsevierViewall">The serum levels of IG &#37; and D-D in the study and control group&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">The serum levels of IG &#37; and D-D in the survival group and death group&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">Diagnostic value of IG &#37; and D-D in severe pancreatitis&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0004"><span class="elsevierStyleLabel">&#8226;</span><p id="para0004" class="elsevierStylePara elsevierViewall">Assessment value of IG &#37; and D-D in prognosis of severe pancreatitis patients&#46;</p></li></ul></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224001236?idApp=UINPBA00004N"
    "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224001236/v123_202411010523/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original articles</span>"
    "titulo" => "LncRNA HCG18 affects aortic dissection through the miR-103a-3p&#47;HMGA2 axis by modulating proliferation and apoptosis of vascular smoothing muscle cells"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "ZhiHong Yang, YuanSheng Cui, ShuGuo Xu, LongBiao Li"
        "autores" => array:4 [
          0 => array:2 [
            "nombre" => "ZhiHong"
            "apellidos" => "Yang"
          ]
          1 => array:2 [
            "nombre" => "YuanSheng"
            "apellidos" => "Cui"
          ]
          2 => array:2 [
            "nombre" => "ShuGuo"
            "apellidos" => "Xu"
          ]
          3 => array:4 [
            "nombre" => "LongBiao"
            "apellidos" => "Li"
            "email" => array:1 [
              0 => "lilongbiaolb@outlook.com"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0001"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "Department of Invasive Technology&#44; Ningde Municipal Hospital of Ningde Normal University&#44; Ningde City&#44; Fujian Province&#44; China"
            "identificador" => "aff0001"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0001"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 1
      "multimedia" => array:6 [
        "identificador" => "fig0007"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "ga1.jpeg"
            "Alto" => 274
            "Ancho" => 2213
            "Tamanyo" => 37231
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alttx001"
            "detalle" => "Image&#44; graphical abstrac"
            "rol" => "short"
          ]
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0009">Introduction</span><p id="para0008" class="elsevierStylePara elsevierViewall">Aortic dissection&#44; an acute macrovascular disease with a dangerous condition and a high mortality rate&#44; can be divided into Stanford type A and Stanford type B depending on whether the dissection affects the ascending aorta&#46;<a class="elsevierStyleCrossRefs" href="#bib0001"><span class="elsevierStyleSup">1-4</span></a> Acute Stanford Type A Aortic Dissection &#40;TAAD&#41; has the characteristics of sudden onset&#44; rapid progression&#44; and high mortality&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">5</span></a> In recent years&#44; the use of advanced imaging technology has made TAAD clear diagnosis is no longer difficult&#44; but there are still many questions about its pathogenesis and treatment options&#46; Studies found that AD is a comprehensive pathological change process caused by pathological changes involving multiple blood vessel constituents&#44; such as human aortic Smooth Muscle Cells &#40;VSMCs&#41; and extracellular matrix&#46;<a class="elsevierStyleCrossRef" href="#bib0006"><span class="elsevierStyleSup">6</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0007"><span class="elsevierStyleSup">7</span></a> Surgical operation is the only approach for curing TAAD&#59; however&#44; the surgery is invasive and costly&#44; and mortality rates are still high&#44; even after treatment&#46; Therefore&#44; understanding the pathogenesis of AD and searching for biomarkers may reveal new therapeutic strategies to reduce clinical mortality&#46;</p><p id="para0009" class="elsevierStylePara elsevierViewall">Long non-coding RNAs &#40;lncRNAs&#41; are a category of non-coding transcripts with longer than 200 nucleotides&#44; which have attracted more and more attention of researchers&#46; LncRNAs are closely related to cardiovascular diseases&#44; cancer&#44; and neurodegenerative diseases&#46;<a class="elsevierStyleCrossRefs" href="#bib0008"><span class="elsevierStyleSup">8-10</span></a> A member of the HLA complex&#44; lncRNA HCG18 presents an abnormal expression profile in gastric cancer&#44;<a class="elsevierStyleCrossRef" href="#bib0011"><span class="elsevierStyleSup">11</span></a> melanoma&#44;<a class="elsevierStyleCrossRef" href="#bib0012"><span class="elsevierStyleSup">12</span></a> osteosarcoma&#44;<a class="elsevierStyleCrossRef" href="#bib0013"><span class="elsevierStyleSup">13</span></a> and nasopharyngeal carcinoma&#46;<a class="elsevierStyleCrossRef" href="#bib0014"><span class="elsevierStyleSup">14</span></a> HCG18 is overexpressed in intervertebral disc degeneration and it can promote the degradation of extracellular matrix in nucleus pulposus cells&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a> Additionally&#44; HCG18 inhibits proliferation and induces apoptosis of VSMCs&#44;<a class="elsevierStyleCrossRef" href="#bib0016"><span class="elsevierStyleSup">16</span></a> indicating that HCG18 may be related to AD&#46; However&#44; the regulatory mechanism of HCG18 in AD progression remains unclear&#46;</p><p id="para0010" class="elsevierStylePara elsevierViewall">MicroRNAs &#40;miRNAs&#41; are a family of small non-coding RNAs with a length of 18&#8210;22 nucleotides&#46; Evidence suggests that during normal physiological and pathological conditions&#44; lncRNAs act as competing endogenous RNAs that competitively bind and sequester their target miRNAs&#44; thereby counteracting miRNA-mediated repression of targeted mRNAs&#44; indirectly regulating the expression of the miRNA target genes&#46;<a class="elsevierStyleCrossRef" href="#bib0017"><span class="elsevierStyleSup">17</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0018"><span class="elsevierStyleSup">18</span></a> In addition&#44; in this study&#44; the authors found that there are target binding sites with HCG18 with miR-103a-3p and miR-103a-3p with HMGA2&#46; Therefore&#44; the aim of this study was to investigate the role and potential mechanism of HCG18&#47;miR-103a-3p&#47;HMGA2 axis in the development of AD and to provide new targets for targeted therapy of AD&#46;</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0010">Methods</span><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0011">Surgical indications</span><p id="para0011" class="elsevierStylePara elsevierViewall">Patients presenting with signs and symptoms of TAAD were always treated on an emergency basis as soon as the diagnosis was confirmed by transthoracic 2D echo and&#47;or angio-computed tomography&#46; Potential contraindications were progressively reduced&#44; current indications including patients with systemic malperfusion&#44; with irreversible neurological damage&#44; and advanced age&#46; The surgical strategy was mainly dictated by the preoperative imaging and the intraoperative findings&#46; Graft replacement of the ascending aorta&#44; always extended to include the hemiarch&#44; was considered as a limited repair&#44; performed when the entry tear was found only in the ascending aorta&#59; dilatation of the aortic arch or presence of arch tears&#44; evidenced by routinely performing an open distal anastomosis&#44; represented an indication to replace both the ascending aorta and arch&#46; Management of the aortic root depended upon its size&#44; morphology and function&#44; and involvement of the aortic valve&#46;<a class="elsevierStyleCrossRef" href="#bib0019"><span class="elsevierStyleSup">19</span></a></p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0012">Clinical sample</span><p id="para0012" class="elsevierStylePara elsevierViewall">In all&#44; 30 patients admitted to the emergency department of the Ningde Municipal Hospital of Ningde Normal University who met the diagnostic criteria of TAAD were collected&#46; Aortic wall tissues of ascending aorta of patients with TAAD were obtained during surgical operations and the aortic tissues of ascending aorta from donors for heart transplants were selected as the control group&#46; Patients in the control group were excluded from Marfan syndrome&#44; Ehlers-Danlos syndrome&#44; familial thoracic abdominal aortic dissection&#44; hyperkinetic inflammation&#44; and other aortic diseases&#46; A detailed description of the clinical characteristics of the study population is presented in <a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>&#46; This study was approved by the Medical Ethics Committee of Ningde Municipal Hospital of Ningde Normal University &#40;n&#176; 201906F23&#41;&#46; All subjects received informed consent&#46; Aortic tissue was fixed with neutral formalin and stored at &#8722;80 &#176;C in EP tubes for further analysis&#46;</p><elsevierMultimedia ident="tbl0001"></elsevierMultimedia></span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0013">Cell culture</span><p id="para0013" class="elsevierStylePara elsevierViewall">Rat aorta VSMCs &#40;Chinese Academy of Sciences&#41; were cultured at 37 &#176;C and 5 &#37; CO<span class="elsevierStyleInf">2</span> in DMEM medium &#40;Invitrogen&#41; containing 10 &#37; FBS &#40;Invitrogen&#41; and necessary antibiotics&#46;</p></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0014">Cell transfection</span><p id="para0014" class="elsevierStylePara elsevierViewall">Specific oligonucleotides and plasmids were designed&#44; including small interfering RNA &#40;siRNA&#41; targeting HCG18 &#40;si-HCG18&#41;&#44; miR-103a-3p mimic&#44; HMGA2-overexpression vector &#40;oe-HMGA2&#41;&#44; and negative controls &#40;Sangon&#44; Shanghai&#44; China&#41;&#46; Lentiviruses were constructed and packaged by GenePharma &#40;Shanghai&#44; China&#41;&#46; Lipofectamine 2000 &#40;Invitrogen&#41; was applied for cell transfection as per the manufacturer&#39;s instructions&#46; VSMCs were collected after 48 h of transfection&#46;</p></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0015">CCK-8 test</span><p id="para0015" class="elsevierStylePara elsevierViewall">Cell viability was assayed by CCK-8&#46; Specifically&#46; VSMCs were re-suspended in DMEM and plated on 96-well plates &#40;1 &#215; 10<span class="elsevierStyleSup">4</span> cells&#47;well&#41;&#46; Then&#44; the CCK-8 solution &#40;10 &#956;L&#47;well&#59; Dojindo&#41; was incubated at 37 &#176;C for 2 h before recording the absorbance at 450 nm on the microplate reader &#40;Thermo Fisher Scientific&#41;&#46;</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0016">Colony formation experiment</span><p id="para0016" class="elsevierStylePara elsevierViewall">Cell proliferation was detected by colony formation assay&#46; Specifically&#44; VSMCs were inoculated in 6-well plates &#40;700-well&#41; for 14d After being fixed in 10 &#37; formaldehyde&#44; VSMCs were stained with 1 &#37; crystal violet &#40;Beyotime&#44; China&#41; and imaged under a microscope &#40;Leica&#44; Germany&#41; to count colonies &#40;&#8805; 50 cells&#41;&#46;</p></span><span id="sec0009" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0017">Flow cytometry</span><p id="para0017" class="elsevierStylePara elsevierViewall">Apoptosis was detected by flow cytometry&#46; Specifically&#44; VSMCs were digested with trypsin&#44; followed by staining with Annexin V-FITC&#47;PI Apoptosis Detection Kit &#40;BD Biosciences&#41; and sorting on the FACScan machine &#40;BD Biosciences&#41;&#46; Cell apoptosis rate was determined by CellQuest software &#40;BD Biosciences&#41;&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0018">Luciferase activity measurement</span><p id="para0018" class="elsevierStylePara elsevierViewall">Wild Type &#40;WT&#41;-HCG18&#44; Mutant &#40;MUT&#41;-HCG18&#44; WT-HMGA2&#44; and MUT-HMGA2 vectors were prepared by Sangon&#46; The vectors and miR-103a-3p mimic or mimic NC and were co-transfected into VSMCs&#46; Analysis of luciferase activity was made using the dual luciferase reporting kit &#40;Promega&#41; and GloMax fluorescence reader &#40;Promega&#41;&#46;</p></span><span id="sec0011" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0019">Rat model of AD</span><p id="para0019" class="elsevierStylePara elsevierViewall">&#946;-Aminopropionitrile &#40;BAPN&#41; can inhibit the crosslinking of collagen and elastin fibers&#44; leading to AD&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0021"><span class="elsevierStyleSup">21</span></a> AD animal models were established<span class="elsevierStyleSup">&#91;</span><a class="elsevierStyleCrossRef" href="#bib0022"><span class="elsevierStyleSup">22</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0023"><span class="elsevierStyleSup">23</span></a> as described previously&#46; AD rats &#40;3-weeks of age&#41; were fed a normal diet with 0&#46;25 &#37; BAPN &#40;Sigma&#41; orally until 7-weeks of age&#46; The sham rats were treated with the same amount of normal saline&#46; Then&#44; at 6-weeks of age&#44; AD rats have injected with either si-HCG18 or Negative Controls &#40;si-NC&#41; lentivirus &#40;1 &#215; 10<span class="elsevierStyleSup">11</span> PFU&#41; through the caudal vein&#46; Finally&#44; the aorta tissues were collected from each euthanized rat and fixed in 4 &#37; paraformaldehyde &#40;P0099&#44; Beyotime&#41;&#46; Animal experiments complied with the ARRIVE guidelines and performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals&#46; The experiments were approved by the Institutional Animal Care and Use Committee of Ningde Municipal Hospital of Ningde Normal University &#40;n&#176; 201908J11&#41;&#46;</p></span><span id="sec0012" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0020">HE-staining</span><p id="para0020" class="elsevierStylePara elsevierViewall">The fixed aorta tissue was embedded in paraffin and sectioned into 4 &#956;m&#46; Tissue sections were dewaxed in xylene and rehydrated in graded ethanol&#46; Staining experiments were performed using the HE-kit &#40;C0105&#44; Beyotime&#41;&#46; After the sections were dehydrated&#44; cleared&#44; and sealed&#44; the histopathological changes in the aortic tissue were observed under a microscope &#40;Olympus&#44; Japan&#41;&#46;</p></span><span id="sec0013" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0021">RT-qPCR</span><p id="para0021" class="elsevierStylePara elsevierViewall">Total RNA was isolated using TRIzol reagent &#40;Invitrogen&#41; and then reverse-transcribed into cDNA using the PrimeScript RT Master Mix Kit &#40;Takara&#41;&#46; Real-time qPCR analysis was performed using SYBR Green Realtime PCR Master Mix &#40;ToyoBo&#41; in the 7900HT PCR System &#40;ABI&#41;&#46; All primers &#40;<a class="elsevierStyleCrossRef" href="#tbl0002">Table 2</a>&#41; for RT-qPCR were synthesized by Sangon&#46; GAPDH and U6 were considered internal controls for lncRNA&#47;mRNA and miRNA analysis&#44; respectively&#46;</p><elsevierMultimedia ident="tbl0002"></elsevierMultimedia></span><span id="sec0014" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0022">Western blot</span><p id="para0022" class="elsevierStylePara elsevierViewall">After extracting total proteins from the aortic tissue and VSMCs using RIPA lysis buffer&#44; protein concentration was determined using the BCA kit&#46; Protein &#40;20 &#956;g&#41; was separated using 10 &#37; SDS-PAGE&#44; loaded onto the PVDF membrane &#40;Merk&#44; Germany&#41;&#44; and sealed with 5 &#37; skim milk for 2 h before mixing with primary antibody HMGA2 &#40;ab97276&#44; 1&#58;1000&#44; Abcam&#41;&#44; Bcl-2 &#40;SC-7382&#44; 1&#58;500&#44; Santa Cruz&#41;&#44; Bax &#40;SC-7480&#44; 1&#58; 500&#44; Santa Cruz&#41;&#44; and GAPDH &#40;ab8245&#44; 1&#58;1000&#44; Abcam&#41; overnight at 4 &#176;C and corresponding secondary antibody for 2 h&#46; Protein bands were visualized using ECL reagents &#40;Pierce&#41; and imaged using FluorChem imaging systems &#40;BioRad&#41;&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0023">Statistical analysis</span><p id="para0023" class="elsevierStylePara elsevierViewall">All data were processed with GraphPad Prism 6&#46;0 software&#46; Values were expressed as mean &#177; standard deviation and assessed by <span class="elsevierStyleItalic">t</span>-test &#40;two groups&#41; or one-way ANOVA &#40;multiple groups&#41;&#59; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05 indicated statistical significance&#46;</p></span></span><span id="sec0016" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0024">Results</span><span id="sec0017" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0025">Downregulating HCG18 enhances VSMC proliferation and reduces apoptosis</span><p id="para0024" class="elsevierStylePara elsevierViewall">In the aortic tissues of TAAD patients&#44; HCG18 levels were increased &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>A&#41;&#46; To explore HCG18&#8217;s role in AD&#44; HCG18&#8217;s effect on the proliferation and apoptosis of VSMCs was examined&#46; si-NC or si-HCG18 was transfected into VSMCs&#44; and RT-qPCR results revealed that HCG18 expression was reduced in VSMCs transfected with si-HCG18 &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>B&#41;&#46; CCK-8 and colony formation assays showed that silencing HCG18 promoted the proliferation of VSMCs &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>C&#8210;D&#41;&#46; Western blot results revealed that down-regulation of HCG18 increased Bcl-2 protein levels and decreased Bax protein levels &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>E&#41;&#46; Flow cytometry results showed that down-regulation of HCG18 inhibited apoptosis in VSMCs &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>F&#41;&#46;</p><elsevierMultimedia ident="fig0001"></elsevierMultimedia></span><span id="sec0018" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0026">HCG18 acts as a miR-103a-3p sponge</span><p id="para0025" class="elsevierStylePara elsevierViewall">Binding sites between HCG18 and miR-103a-3p were found through bioinformation website analysis &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>A&#41;&#46; Then&#44; dual luciferase reporter assay verified the targeting relationship between HCG18 and miR-103a-3p&#44; as manifested by the decrease in luciferase activity after co-transfection of WT-HCG18 with miR-103a-3p mimic &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>B&#41;&#46; RT-qPCR results revealed downregulated miR-103a-3p in the aortic tissues of TAAD patients &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>C&#41;&#44; while increased expression in si-HCG18-transfected VSMCs &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>D&#41;&#46;</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia></span><span id="sec0019" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0027">Upregulating miR-103a-3p protects VSMCs</span><p id="para0026" class="elsevierStylePara elsevierViewall">mimic NC or miR-103a-3p mimic was transfected into VSMCs&#46; RT-qPCR assay showed elevated miR-103a-3p expression in VSMCs transfected with miR-103a-3p mimic &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>A&#41;&#46; CCK-8 and colony formation assays showed that upregulation of miR-103a-3p promoted the proliferation of VSMCs &#40;both <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>B&#8210;C&#41;&#46; Western blot results revealed that up-regulation of miR-103a-3p resulted in increased levels of Bcl-2 protein and decreased levels of Bax protein &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>D&#41;&#46; Flow cytometry results showed that up-regulation of miR-103a-3p inhibited apoptosis in VSMCs &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>E&#41;&#46;</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0028">miR-103a-3p targets HMGA2</span><p id="para0027" class="elsevierStylePara elsevierViewall">Bioinformatics website analysis showed that miR-103a-3p has a targeted binding site with HMGA2 &#40;<a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>A&#41;&#46; The results of dual luciferase reporter gene assay experiments showed that the luciferase activity was reduced after WT-HMGA2 was co-transfected with miR-103a-3p mimic &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>B&#41;&#46; HMGA2 was upregulated in the aortic tissues of patients with TAAD &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>C&#41; and was decreased in VSMCs transfected with si-HCG18 or miR-103a-3p mimic &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0004">Fig&#46; 4</a>D&#41;&#46;</p><elsevierMultimedia ident="fig0004"></elsevierMultimedia></span><span id="sec0021" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0029">HCG18&#47;miR-103a-3p&#47;HMGA2 axis affects VSMC proliferation and apoptosis</span><p id="para0028" class="elsevierStylePara elsevierViewall">To further study HCG18&#47;miR-103a-3p&#47;HMGA2 axis in AD&#44; si-HCG18 &#43; oe-NC&#44; si-HCG18 &#43; oe-HMGA2&#44; miR-103a-3p mimic &#43; oe-NC or miR-103a-3p mimic &#43; oe-HMGA2 were transfected into VSMCs&#46; As measured by RT-qPCR and Western blot measurement&#44; oe-HMGA2 impaired si-HCG18 or miR-103a-3p mimic in reducing HCG18 levels &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>A&#41;&#46; Experimental data measured that enhancing HMGA2 could reduce the impacts of HCG18 downregulation or miR-103a-3p upregulation on proliferation and apoptosis of VSMCs &#40;all <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 5</a>B&#8210;E&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0022" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0030">Downregulating HCG18 improves the pathological injury of the aorta in AD rats</span><p id="para0029" class="elsevierStylePara elsevierViewall">Finally&#44; an AD animal model was induced to verify the regulatory effect of HCG18&#46; HCG18 was upregulated in AD rats &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>A&#41;&#46; si-NC or si-HCG18 lentivirus was injected into the tail vein of AD rats&#44; and successful lentivirus injection was verified by RT-qPCR &#40;<span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>B&#41;&#46; HE-staining observed that the aortic wall of AD rats contained broken elastic fibers&#44; and blood cells entered the aortic wall&#44; leading to tearing and stripping&#59; down-regulation of HCG18 could improve the above pathological changes &#40;<a class="elsevierStyleCrossRef" href="#fig0006">Fig&#46; 6</a>C&#41;&#46;</p><elsevierMultimedia ident="fig0006"></elsevierMultimedia></span></span><span id="sec0023" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0031">Discussion</span><p id="para0030" class="elsevierStylePara elsevierViewall">It is known that HCG18 exerts adjustive effects on VSMCs&#46;<a class="elsevierStyleCrossRef" href="#bib0016"><span class="elsevierStyleSup">16</span></a> This work studied the function of HCG18 in AD and explored its related downstream mechanism&#46; Abnormal regulation of lncRNAs is often related to pathological processes&#44; including coronary heart disease&#46;<a class="elsevierStyleCrossRef" href="#bib0024"><span class="elsevierStyleSup">24</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">25</span></a> LncRNAs have also been reported to be involved in regulating cardiovascular diseases such as heart failure&#44; hypertension&#44; and aneurysm&#46;<a class="elsevierStyleCrossRef" href="#bib0026"><span class="elsevierStyleSup">26</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0027"><span class="elsevierStyleSup">27</span></a> HCG18 is a recently studied lncRNA that is abnormally expressed in many diseases&#46;<a class="elsevierStyleCrossRefs" href="#bib0028"><span class="elsevierStyleSup">28-30</span></a> The current work identified that HCG18 was upregulated in the aortic tissues of TAAD patients&#44; and down-regulated HCG18 protected VSMCs regarding cell proliferation and apoptosis&#46; In addition&#44; down-regulated HCG18 could improve the pathological injury of aorta in AD rats&#46;</p><p id="para0031" class="elsevierStylePara elsevierViewall">Studies have confirmed the mutual regulatory relationship between lncRNAs and miRNAs&#44; exerting physiological and pathological functions through different regulatory ways&#46;<a class="elsevierStyleCrossRefs" href="#bib0031"><span class="elsevierStyleSup">31-33</span></a> It is noted that HCG18 aggravates diabetic peripheral neuropathy through modulating miR-146a&#46;<a class="elsevierStyleCrossRef" href="#bib0034"><span class="elsevierStyleSup">34</span></a> It has been proposed that HCG18 accelerates lung adenocarcinoma development by targeting miR-34a-5p&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">35</span></a> The present study found that HCG18 was competitively bound to miR-103a-3p&#46; As measured&#44; miR-103a-3p was downregulated in the aortic tissues of AD patients and enhancing miR-103a-3p induced proliferative and suppressed apoptotic activities of VSMCs&#46;</p><p id="para0032" class="elsevierStylePara elsevierViewall">HMGA2&#44; as a transcription factor&#44; is increased in expression in malignant tumors&#46;<a class="elsevierStyleCrossRefs" href="#bib0036"><span class="elsevierStyleSup">36-38</span></a> As suggested&#44; targeting HMGA2 is a useful method in miR-26b inhibiting Stanford Type A AD&#46;<a class="elsevierStyleCrossRef" href="#bib0039"><span class="elsevierStyleSup">39</span></a> The current work identified HMGA2 as the target gene of miR-103a-3p&#44; and HMGA2 was upregulated in the aortic tissues of AD patients&#46; HMGA2 promotion could impair HCG18 downregulation or miR-103a-3p upregulation in mediating VSMC proliferation and apoptosis&#46;</p><p id="para0033" class="elsevierStylePara elsevierViewall">Considering the limitations of this study&#44; a limited sample may not fully confirm the accuracy of the results&#46; Secondly&#44; the relationship between HCG18 and other potential targeted miRNAs needs further attention and research&#46; In addition&#44; only TAAD patients were included in this study&#44; and the experimental results cannot be generalized to all AD patients for the time being&#46;</p></span><span id="sec0024" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0032">Conclusion</span><p id="para0034" class="elsevierStylePara elsevierViewall">In summary&#44; this study for the first time found that HCG18 promotes AD progression by competing with miR-103a-3p to target HMGA2 expression&#46; This provides a theoretical basis for gene therapy for aortic coarctation&#44; and surgical treatment assisted by gene therapy may be a new therapeutic strategy for patients with TAAD&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0033">Availability of data and materials</span><p id="para0035" class="elsevierStylePara elsevierViewall">The datasets used and&#47;or analyzed during the present study are available from the corresponding author upon reasonable request&#46;</p></span><span id="sec0026" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0034">Ethics statement</span><p id="para0036" class="elsevierStylePara elsevierViewall">This study was approved by the Medical Ethics Committee of Ningde Municipal Hospital of Ningde Normal University &#40;n&#176;201906F23&#41;&#46; All subjects received informed consent&#46; The animal experiments were complied with the ARRIVE guidelines and approved by the ethics committee of Ningde Municipal Hospital of Ningde Normal University &#40;n&#176; 201908J11&#41;&#46;</p></span><span id="sec0027" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0035">Authors&#8217; contributions</span><p id="para0037" class="elsevierStylePara elsevierViewall">ZhiHong Yang designed the research study&#46; YuanSheng Cui and ShuGuo Xu performed the research&#46; LongBiao Li provided help and advice&#46; YuanSheng Cui and ShuGuo Xu analyzed the data&#46; ZhiHong Yang wrote the manuscript&#46; LongBiao Li reviewed and edited the manuscript&#46; All authors contributed to editorial changes in the manuscript&#46; All authors read and approved the final manuscript&#46;</p></span><span id="sec0028" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0036">Funding</span><p id="para0038" class="elsevierStylePara elsevierViewall">Not applicable&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:15 [
        0 => array:3 [
          "identificador" => "xres2290997"
          "titulo" => "Graphical abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abss0006"
            ]
          ]
        ]
        1 => array:3 [
          "identificador" => "xres2290996"
          "titulo" => "Highlights"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abss0001"
            ]
          ]
        ]
        2 => array:3 [
          "identificador" => "xres2290995"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abss0002"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abss0003"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abss0004"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abss0005"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1903352"
          "titulo" => "Keywords"
        ]
        4 => array:2 [
          "identificador" => "sec0001"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0002"
          "titulo" => "Methods"
          "secciones" => array:13 [
            0 => array:2 [
              "identificador" => "sec0003"
              "titulo" => "Surgical indications"
            ]
            1 => array:2 [
              "identificador" => "sec0004"
              "titulo" => "Clinical sample"
            ]
            2 => array:2 [
              "identificador" => "sec0005"
              "titulo" => "Cell culture"
            ]
            3 => array:2 [
              "identificador" => "sec0006"
              "titulo" => "Cell transfection"
            ]
            4 => array:2 [
              "identificador" => "sec0007"
              "titulo" => "CCK-8 test"
            ]
            5 => array:2 [
              "identificador" => "sec0008"
              "titulo" => "Colony formation experiment"
            ]
            6 => array:2 [
              "identificador" => "sec0009"
              "titulo" => "Flow cytometry"
            ]
            7 => array:2 [
              "identificador" => "sec0010"
              "titulo" => "Luciferase activity measurement"
            ]
            8 => array:2 [
              "identificador" => "sec0011"
              "titulo" => "Rat model of AD"
            ]
            9 => array:2 [
              "identificador" => "sec0012"
              "titulo" => "HE-staining"
            ]
            10 => array:2 [
              "identificador" => "sec0013"
              "titulo" => "RT-qPCR"
            ]
            11 => array:2 [
              "identificador" => "sec0014"
              "titulo" => "Western blot"
            ]
            12 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0016"
          "titulo" => "Results"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0017"
              "titulo" => "Downregulating HCG18 enhances VSMC proliferation and reduces apoptosis"
            ]
            1 => array:2 [
              "identificador" => "sec0018"
              "titulo" => "HCG18 acts as a miR-103a-3p sponge"
            ]
            2 => array:2 [
              "identificador" => "sec0019"
              "titulo" => "Upregulating miR-103a-3p protects VSMCs"
            ]
            3 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "miR-103a-3p targets HMGA2"
            ]
            4 => array:2 [
              "identificador" => "sec0021"
              "titulo" => "HCG18&#47;miR-103a-3p&#47;HMGA2 axis affects VSMC proliferation and apoptosis"
            ]
            5 => array:2 [
              "identificador" => "sec0022"
              "titulo" => "Downregulating HCG18 improves the pathological injury of the aorta in AD rats"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0023"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0024"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0025"
          "titulo" => "Availability of data and materials"
        ]
        10 => array:2 [
          "identificador" => "sec0026"
          "titulo" => "Ethics statement"
        ]
        11 => array:2 [
          "identificador" => "sec0027"
          "titulo" => "Authors&#8217; contributions"
        ]
        12 => array:2 [
          "identificador" => "sec0028"
          "titulo" => "Funding"
        ]
        13 => array:2 [
          "identificador" => "xack786268"
          "titulo" => "Acknowledgments"
        ]
        14 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2023-12-20"
    "fechaAceptado" => "2024-05-18"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1903352"
          "palabras" => array:5 [
            0 => "LncRNA HCG18"
            1 => "miR-103a-3p"
            2 => "HMGA2"
            3 => "VSMCs"
            4 => "Aortic dissection"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abss0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0003">Background</span><p id="spara012" class="elsevierStyleSimplePara elsevierViewall">Aortic Dissection &#40;AD&#41; is a vascular disease with a high mortality rate and limited treatment strategies&#46; The current research analyzed the function and regulatory mechanism of lncRNA HCG18 in AD&#46;</p></span> <span id="abss0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Methods</span><p id="spara013" class="elsevierStyleSimplePara elsevierViewall">HCG18&#44; miR-103a-3p&#44; and HMGA2 levels in the aortic tissue of AD patients were examined by RT-qPCR&#46; After transfection with relevant plasmids&#44; the proliferation of rat aortic Vascular Smoothing Muscle Cells &#40;VSMCs&#41; was detected by CCK-8 and colony formation assay&#44; Bcl-2 and Bax was measured by Western blot&#44; and apoptosis was checked by flow cytometry&#46; Then&#44; the targeting relationship between miR-103a-3p and HCG18 or HMGA2 was verified by bioinformation website analysis and dual luciferase reporter assay&#46; Finally&#44; the effect of HCG18 was verified in an AD rat model induced by &#946;-aminopropionitrile&#46;</p></span> <span id="abss0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Results</span><p id="spara014" class="elsevierStyleSimplePara elsevierViewall">HCG18 and HMGA2 were upregulated and miR-103a-3p was downregulated in the aortic tissues of AD patients&#46; Downregulating HCG18 or upregulating miR-103a-3p enhanced the proliferation of VSMCs and limited cell apoptosis&#46; HCG18 promoted HMGA2 expression by competing with miR-103a-3p and restoring HMGA2 could impair the effect of HCG18 downregulation or miR-103a-3p upregulation in mediating the proliferation and apoptosis of VSMCs&#46; In addition&#44; down-regulation of HCG18 could improve the pathological injury of the aorta in AD rats&#46;</p></span> <span id="abss0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0006">Conclusion</span><p id="spara015" class="elsevierStyleSimplePara elsevierViewall">HCG18 reduces proliferation and induces apoptosis of VSMCs through the miR-103a-3p&#47;HMGA2 axis&#44; thus aggravating AD&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abss0002"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abss0003"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abss0004"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abss0005"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "highlights" => array:2 [
      "titulo" => "Highlights"
      "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara011" class="elsevierStyleSimplePara elsevierViewall"><ul class="elsevierStyleList" id="celist0001"><li class="elsevierStyleListItem" id="celistitem0001"><span class="elsevierStyleLabel">&#8226;</span><p id="para0001" class="elsevierStylePara elsevierViewall">Downregulating HCG18 enhances VSMC proliferation and reduces apoptosis&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0002"><span class="elsevierStyleLabel">&#8226;</span><p id="para0002" class="elsevierStylePara elsevierViewall">HCG18&#47;miR-103a-3p&#47;HMGA2 axis affects VSMC proliferation and apoptosis&#46;</p></li><li class="elsevierStyleListItem" id="celistitem0003"><span class="elsevierStyleLabel">&#8226;</span><p id="para0003" class="elsevierStylePara elsevierViewall">Downregulating HCG18 improves the pathological injury of the aorta in AD rats&#46;</p></li></ul></p></span>"
    ]
    "multimedia" => array:9 [
      0 => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1572
            "Ancho" => 3458
            "Tamanyo" => 289270
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0003"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Downregulating HCG18 promotes the proliferation of VSMCs and inhibits cell apoptosis&#46; &#40;A&#41; RT-qPCR analyzed HCG18 in aortic tissues of AD patients &#40;<span class="elsevierStyleItalic">n</span> &#61; 30&#41;&#59; &#40;B&#41; RT-qPCR verified the successful transfection&#59; &#40;C&#8210;D&#41; CCK-8 and colony formation assay measured VSMC proliferation&#59; &#40;E&#41; Western blot measured Bcl-2 and Bax protein expression&#59; &#40;F&#41; Flow cytometry analyzed VSMC apoptosis&#46; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 3&#41;&#46; &#42;vs<span class="elsevierStyleItalic">&#46;</span> si-NC&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1905
            "Ancho" => 3458
            "Tamanyo" => 318040
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0004"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">HCG18 functions as a miR-103a-3p sponge&#46; &#40;A&#41; Bioinformation website predicted the binding sites of HCG18 and miR-103a-3p&#59; &#40;B&#41; Dual luciferase reporter assay verified the targeting relationship between HCG18 and miR-103a-3p&#59; &#40;C&#41; RT-qPCR analyzed miR-103a-3p expression in aortic tissues of AD patients &#40;<span class="elsevierStyleItalic">n</span> &#61; 30&#41;&#59; &#40;D&#41; RT-qPCR analyzed miR-103a-3p expression in VSMCs transfected with si-NC or si-HCG18&#46; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 3&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0003"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 3847
            "Ancho" => 3458
            "Tamanyo" => 681565
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Upregulating miR-103a-3p protects VSMCs&#46; &#40;A&#41; RT-qPCR verified the successful transfection&#59; &#40;B&#8210;C&#41; CCK-8 and colony formation assay measured VSMC proliferation&#59; &#40;D&#41; Western blot measurement measured Bcl-2 and Bax protein expression&#59; &#40;E&#41; Flow cytometry analyzed VSMC apoptosis&#46; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 3&#41;&#46; &#42;vs&#46; mimic NC&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0004"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 2053
            "Ancho" => 3458
            "Tamanyo" => 316462
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0006"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara004" class="elsevierStyleSimplePara elsevierViewall">HMGA2 is directly targeted by miR-103a-3p&#46; &#40;A&#41; Bioinformation website predicted the binding sites of miR-103a-3p to HMGA2&#59; &#40;B&#41; Dual luciferase reporter assay verified the targeting relationship between miR-103a-3p and HMGA2&#59; &#40;C&#41; RT-qPCR analyzed HMGA2 in aortic tissues of AD patients &#40;<span class="elsevierStyleItalic">n</span> &#61; 30&#41;&#59; &#40;D&#41; RT-qPCR and Western blot measurement analyzed HMGA2 in VSMCs transfected with si-NC&#44; si-HCG18&#44; mimic NC&#44; or miR-103a-3p mimic&#46; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 3&#41;&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 2373
            "Ancho" => 3458
            "Tamanyo" => 622852
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0007"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara005" class="elsevierStyleSimplePara elsevierViewall">HCG18&#47;miR-103a-3p&#47;HMGA2 axis affects VSMC proliferation and apoptosis&#46; &#40;A&#41; RT-qPCR and Western blot measurement verified the successful transfection&#59; &#40;B&#8210;C&#41; CCK-8 and colony formation assay measured VSMC proliferation&#59; &#40;D&#41; Western blot measurement measured Bcl-2 and Bax protein expression&#59; &#40;E&#41; Flow cytometry analyzed VSMC apoptosis&#46; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 3&#41;&#46; &#42;vs&#46; si-HCG18 &#43; oe-NC&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <span class="elsevierStyleSup">&#35;</span>vs&#46; miR-103a-3p mimic &#43; oe-NC&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "fig0006"
        "etiqueta" => "Fig&#46; 6"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr6.jpeg"
            "Alto" => 2956
            "Ancho" => 2167
            "Tamanyo" => 775409
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0008"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara006" class="elsevierStyleSimplePara elsevierViewall">Downregulating HCG18 improves the pathological injury of aorta in AD rats&#46; &#40;A&#41; RT-qPCR analyzed HCG18 in AD rats&#59; &#40;B&#41; RT-qPCR verified the successful injection of lentivirus&#59; &#40;C&#41; HE-staining observed the pathological changes of aorta in AD rats&#59; Values are expressed as mean &#177; standard deviation &#40;<span class="elsevierStyleItalic">n</span> &#61; 6&#41;&#46; &#42;vs&#46; Sham&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#59; <span class="elsevierStyleSup">&#35;</span>vs&#46; si-NC&#44; <span class="elsevierStyleItalic">p</span> &#60; 0&#46;05&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0001"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara008" class="elsevierStyleSimplePara elsevierViewall">TAAD&#44; Type A Aortic Dissection&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Characteristics&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0002"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Control &#40;<span class="elsevierStyleItalic">n</span> &#61; 30&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0003"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">TAAD &#40;<span class="elsevierStyleItalic">n</span> &#61; 30&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0004"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Age &#40;years&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0005"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">53&#46;2 &#177; 9&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0006"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">52&#46;4 &#177; 11&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0007"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Body mass index&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0008"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">26&#46;4 &#177; 4&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0009"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">28&#46;5 &#177; 3&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0010"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0011"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0012"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0013"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0014"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0015"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">24&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0016"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0017"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0019"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Current smoker&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0020"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0021"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0022"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Alcoholic abuse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0023"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0025"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Hypertension&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0026"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0028"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Hyperlipidemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0029"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0031"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Atherosclerosis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0032"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0033"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0034"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Diabetes mellitus&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0035"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0036"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711690.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara007" class="elsevierStyleSimplePara elsevierViewall">The clinical characteristics of TAAD and control groups&#46;</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "tbl0002"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara010" class="elsevierStyleSimplePara elsevierViewall">HCG18&#44; Long Noncoding RNA HLA Complex Group 18&#59; miR-103a-3p&#44; microRNA-103a-3p&#59; HMGA2&#44; High Mobility Group AT-hook 2&#59; GAPDH&#44; Glyceraldehyde-3-Phosphate Dehydrogenase&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><a name="en0037"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="top" style="border-bottom: 2px solid black"><span class="elsevierStyleBold">Genes</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0038"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top" style="border-bottom: 2px solid black"><span class="elsevierStyleBold">Sequences &#40;5&#8242;&#8211;3&#8242;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0039"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">HCG18</td><a name="en0040"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&#58; GCTAGGTCCTCTACTTTCTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0042"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&#58; CAGAAAGTAGAGGACCTAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0043"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">miR-103a-3p</td><a name="en0044"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&#58; AGCAGCATTGTACAGGGCTATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0046"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&#58; CTCTACAGCTATATTGCCAGCCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0047"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">HMGA2</td><a name="en0048"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&#58; GGGCGCCGACATTCAAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0050"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&#58; ACTGCAGTGTCTTCTCCCTTCAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0051"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">U6</td><a name="en0052"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&#58; CTCGCTTCGGCAGCACA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0054"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&#58; AACGCTTCACGAATTTGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0055"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="top">GAPDH</td><a name="en0056"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward&#58; GTCGGTGTGAACGGATTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0058"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse&#58; TCCCATTCTCAGCCTTGAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3711689.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara009" class="elsevierStyleSimplePara elsevierViewall">RT-qPCR sequences&#46;</p>"
        ]
      ]
      8 => array:6 [
        "identificador" => "fig0007"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "ga1.jpeg"
            "Alto" => 274
            "Ancho" => 2213
            "Tamanyo" => 37231
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alttx001"
            "detalle" => "Image&#44; graphical abstrac"
            "rol" => "short"
          ]
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec1"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0001"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of acute aortic dissection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46; Nienaber"
                            1 => "R&#46; Clough"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(14)61005-9"
                      "Revista" => array:7 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2015"
                        "volumen" => "385"
                        "numero" => "9970"
                        "paginaInicial" => "800"
                        "paginaFinal" => "811"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25662791"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0002"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Aortic dissection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;A&#46; Nienaber"
                            1 => "R&#46;E&#46; Clough"
                            2 => "N&#46; Sakalihasan"
                            3 => "T&#46; Suzuki"
                            4 => "R&#46; Gibbs"
                            5 => "F&#46; Mussa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrdp.2016.53"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Rev Dis Primers"
                        "fecha" => "2016"
                        "volumen" => "2"
                        "paginaInicial" => "16053"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27440162"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0003"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Aortic dissection&#58; medical&#44; interventional and surgical management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Silaschi"
                            1 => "J&#46; Byrne"
                            2 => "O&#46; Wendler"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/heartjnl-2015-308284"
                      "Revista" => array:7 [
                        "tituloSerie" => "Heart"
                        "fecha" => "2017"
                        "volumen" => "103"
                        "numero" => "1"
                        "paginaInicial" => "78"
                        "paginaFinal" => "87"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27733536"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0004"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical&#44; diagnostic&#44; and management perspectives of aortic dissection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "I&#46;A&#46; Khan"
                            1 => "C&#46;K&#46; Nair"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.122.1.311"
                      "Revista" => array:7 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2002"
                        "volumen" => "122"
                        "numero" => "1"
                        "paginaInicial" => "311"
                        "paginaFinal" => "328"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12114376"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "American College of Cardiology Foundation&#47;American Heart Association Task Force on Practice Guidelines&#59; American Association for Thoracic Surgery&#59; American College of Radiology&#59; American Stroke Association&#59; Society of Cardiovascular Anesthesiologists&#59; Society for Cardiovascular Angiography and Interventions&#59; Society of Interventional Radiology&#59; Society of Thoracic Surgeons&#59; Society for Vascular Medicine&#46; 2010 ACCF&#47;AHA&#47;AATS&#47;ACR&#47;ASA&#47;SCA&#47;SCAI&#47;SIR&#47;STS&#47;SVM guidelines for the diagnosis and management of patients with Thoracic Aortic Disease&#58; a report of the American College of Cardiology Foundation&#47;American Heart Association Task Force on Practice Guidelines&#44; American Association for Thoracic Surgery&#44; American College of Radiology&#44; American Stroke Association&#44; Society of Cardiovascular Anesthesiologists&#44; Society for Cardiovascular Angiography and Interventions&#44; Society of Interventional Radiology&#44; Society of Thoracic Surgeons&#44; and Society for Vascular Medicine"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;F&#46; Hiratzka"
                            1 => "G&#46;L&#46; Bakris"
                            2 => "J&#46;A&#46; Beckman"
                            3 => "R&#46;M&#46; Bersin"
                            4 => "V&#46;F&#46; Carr"
                            5 => "D&#46;E&#46; Casey Jr"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIR.0b013e3181d4739e"
                      "Revista" => array:7 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2010"
                        "volumen" => "121"
                        "numero" => "13"
                        "paginaInicial" => "e266"
                        "paginaFinal" => "e369"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20233780"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0006"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered smooth muscle cell force generation as a driver of thoracic aortic aneurysms and dissections"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "D&#46; Milewicz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/ATVBAHA.116.303229"
                      "Revista" => array:7 [
                        "tituloSerie" => "Arterioscler Thromb Vasc Biol"
                        "fecha" => "2017"
                        "volumen" => "37"
                        "numero" => "1"
                        "paginaInicial" => "26"
                        "paginaFinal" => "34"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27879251"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0007"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of smooth muscle cell phenotypes with extracellular matrix disorders in thoracic aortic dissection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "L&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jvs.2012.05.084"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Vasc Surg"
                        "fecha" => "2012"
                        "volumen" => "56"
                        "numero" => "6"
                        "paginaInicial" => "1698"
                        "paginaFinal" => "1709"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22960022"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0008"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long noncoding RNAs in cardiovascular diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46; Uchida"
                            1 => "S&#46; Dimmeler"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCRESAHA.116.302521"
                      "Revista" => array:7 [
                        "tituloSerie" => "Circ Res"
                        "fecha" => "2015"
                        "volumen" => "116"
                        "numero" => "4"
                        "paginaInicial" => "737"
                        "paginaFinal" => "750"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25677520"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0009"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Emerging roles of long non-coding RNA in cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:1 [
                            0 => "A&#46; Sanchez Calle"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/cas.13642"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cancer Sci"
                        "fecha" => "2018"
                        "volumen" => "109"
                        "numero" => "7"
                        "paginaInicial" => "2093"
                        "paginaFinal" => "2100"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29774630"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The long non-coding RNAs in neurodegenerative diseases&#58; novel mechanisms of pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "P&#46; Riva"
                            1 => "A&#46; Ratti"
                            2 => "M&#46; Venturin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2174/1567205013666160622112234"
                      "Revista" => array:7 [
                        "tituloSerie" => "Curr Alzheimer Res"
                        "fecha" => "2016"
                        "volumen" => "13"
                        "numero" => "11"
                        "paginaInicial" => "1219"
                        "paginaFinal" => "1231"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27338628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0011"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Exosome-mediated transfer of lncRNA HCG18 promotes M2 macrophage polarization in gastric cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Xin"
                            1 => "Y&#46; Wu"
                            2 => "C&#46; Liu"
                            3 => "F&#46; Zeng"
                            4 => "J&#46;-L&#46; Wang"
                            5 => "D-Z Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.molimm.2021.10.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Immunol"
                        "fecha" => "2021"
                        "volumen" => "140"
                        "paginaInicial" => "196"
                        "paginaFinal" => "205"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34735868"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0012"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA HCG18 facilitates melanoma progression by modulating miR-324-5p&#47;CDK16 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Zhang"
                            1 => "H&#46; Lv"
                            2 => "F&#46; Zhang"
                            3 => "A Ji"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Transl Res"
                        "fecha" => "2022"
                        "volumen" => "14"
                        "numero" => "2"
                        "paginaInicial" => "1246"
                        "paginaFinal" => "1257"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35273726"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0013"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA HCG18 promotes osteosarcoma growth by enhanced aerobic glycolysis via the miR-365a-3p&#47;PGK1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46; Pan"
                            1 => "J&#46; Guo"
                            2 => "C&#46; Liu"
                            3 => "Z&#46; Pan"
                            4 => "Z&#46; Yang"
                            5 => "X&#46; Yao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s11658-021-00304-6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell Mol Biol Lett"
                        "fecha" => "2022"
                        "volumen" => "27"
                        "numero" => "1"
                        "paginaInicial" => "5"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34991445"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0014"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA HCG18 contributes to nasopharyngeal carcinoma development by modulating miR-140&#47;CCND1 and Hedgehog signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46; Li"
                            1 => "T&#46;-T&#46; Ma"
                            2 => "Y&#46;-H&#46; Ma"
                            3 => "Y&#46;-F&#46; Jiang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Rev Med Pharmacol Sci"
                        "fecha" => "2019"
                        "volumen" => "23"
                        "numero" => "23"
                        "paginaInicial" => "10387"
                        "paginaFinal" => "10399"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA HCG18 promotes extracellular matrix degradation of nucleus pulposus cells in intervertebral disc degeneration by regulating the miR-4306&#47;EPAS1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Cao"
                            1 => "Y&#46; Ma"
                            2 => "H&#46; Yang"
                            3 => "G&#46; Luo"
                            4 => "H&#46; Cheng"
                            5 => "X&#46; Jin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.wneu.2022.11.126"
                      "Revista" => array:6 [
                        "tituloSerie" => "World Neurosurg"
                        "fecha" => "2023"
                        "volumen" => "172"
                        "paginaInicial" => "e52"
                        "paginaFinal" => "e61"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/36460200"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0016"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA HCG18 is critical for vascular smooth muscle cell proliferation and phenotypic switching"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46; Lu"
                            1 => "J&#46; Guo"
                            2 => "S&#46; Zhu"
                            3 => "H&#46; Zhang"
                            4 => "Q&#46; Zhu"
                            5 => "Y&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s13577-020-00366-2"
                      "Revista" => array:7 [
                        "tituloSerie" => "Hum Cell"
                        "fecha" => "2020"
                        "volumen" => "33"
                        "numero" => "3"
                        "paginaInicial" => "537"
                        "paginaFinal" => "544"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32449112"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0017"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Integrative analysis of long noncoding RNA &#40;lncRNA&#41;&#44; microRNA &#40;miRNA&#41; and mRNA expression and construction of a competing endogenous RNA &#40;ceRNA&#41; network in metastatic melanoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L-X Wang"
                            1 => "C&#46; Wan"
                            2 => "Z&#46;-B&#46; Dong"
                            3 => "B&#46;-H&#46; Wang"
                            4 => "H&#46;-Y&#46; Liu"
                            5 => "Y&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.12659/MSM.913881"
                      "Revista" => array:6 [
                        "tituloSerie" => "Med Sci Monit"
                        "fecha" => "2019"
                        "volumen" => "25"
                        "paginaInicial" => "2896"
                        "paginaFinal" => "2907"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31004080"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0018"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNAs &#40;miRNAs&#41; and long non-coding RNAs &#40;lncRNAs&#41; as new tools for cancer therapy&#58; first steps from bench to bedside"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Ratti"
                            1 => "A&#46; Lampis"
                            2 => "M&#46; Ghidini"
                            3 => "M&#46; Salati"
                            4 => "M&#46;B&#46; Mirchev"
                            5 => "N&#46; Valeri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11523-020-00717-x"
                      "Revista" => array:7 [
                        "tituloSerie" => "Target Oncol"
                        "fecha" => "2020"
                        "volumen" => "15"
                        "numero" => "3"
                        "paginaInicial" => "261"
                        "paginaFinal" => "278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32451752"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0019"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Type A acute aortic dissection with &#8805;40-mm aortic root&#58; results of conservative and replacement strategies at long-term follow-up"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Vendramin"
                            1 => "A&#46; Lechiancole"
                            2 => "D&#46; Piani"
                            3 => "L&#46; Deroma"
                            4 => "A&#46; Tullio"
                            5 => "S&#46; Sponga"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/ejcts/ezaa456"
                      "Revista" => array:7 [
                        "tituloSerie" => "Eur J Cardiothorac Surg"
                        "fecha" => "2021"
                        "volumen" => "59"
                        "numero" => "5"
                        "paginaInicial" => "1115"
                        "paginaFinal" => "1122"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33367649"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inhibition of cross-links in collagen is associated with reduced stiffness of the aorta in young rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46; Bruel"
                            1 => "G&#46; Ortoft"
                            2 => "H&#46; Oxlund"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0021-9150(98)00130-0"
                      "Revista" => array:7 [
                        "tituloSerie" => "Atherosclerosis"
                        "fecha" => "1998"
                        "volumen" => "140"
                        "numero" => "1"
                        "paginaInicial" => "135"
                        "paginaFinal" => "145"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9733224"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0021"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alteration of elastic architecture in the lathyritic rat aorta implies the pathogenesis of aortic dissecting aneurysm"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46; Nakashima"
                            1 => "K&#46; Sueishi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Pathol"
                        "fecha" => "1992"
                        "volumen" => "140"
                        "numero" => "4"
                        "paginaInicial" => "959"
                        "paginaFinal" => "969"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1562054"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0022"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-22 inhibits the apoptosis of vascular smooth muscle cell by targeting p38MAPKalpha in vascular remodeling of aortic dissection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Xiao"
                            1 => "Y&#46; Sun"
                            2 => "X&#46; Ma"
                            3 => "C&#46; Wang"
                            4 => "L&#46; Zhang"
                            5 => "J&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.omtn.2020.08.018"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Ther Nucleic Acids"
                        "fecha" => "2020"
                        "volumen" => "22"
                        "paginaInicial" => "1051"
                        "paginaFinal" => "1062"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33294292"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0023"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bindarit reduces the incidence of acute aortic dissection complicated lung injury via modulating NF-kappaB pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Z&#46; Wu"
                            1 => "J&#46; Chang"
                            2 => "W&#46; Ren"
                            3 => "Z&#46; Hu"
                            4 => "B&#46; Li"
                            5 => "H Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/etm.2017.4830"
                      "Revista" => array:7 [
                        "tituloSerie" => "Exp Ther Med"
                        "fecha" => "2017"
                        "volumen" => "14"
                        "numero" => "3"
                        "paginaInicial" => "2613"
                        "paginaFinal" => "2618"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28962202"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0024"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long non-coding RNAs&#58; a new frontier in the study of human diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "X&#46; Shi"
                            1 => "M&#46; Sun"
                            2 => "H&#46; Liu"
                            3 => "Y&#46; Yao"
                            4 => "Y&#46; Song"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.canlet.2013.06.013"
                      "Revista" => array:7 [
                        "tituloSerie" => "Cancer Lett"
                        "fecha" => "2013"
                        "volumen" => "339"
                        "numero" => "2"
                        "paginaInicial" => "159"
                        "paginaFinal" => "166"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23791884"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The emerging role of long noncoding RNAs in human disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46; DiStefano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-4939-7471-9_6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2018"
                        "volumen" => "1706"
                        "paginaInicial" => "91"
                        "paginaFinal" => "110"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29423795"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0026"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long noncoding RNAs in kidney and cardiovascular diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Lorenzen"
                            1 => "T&#46; Thum"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrneph.2016.51"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Nephrol"
                        "fecha" => "2016"
                        "volumen" => "12"
                        "numero" => "6"
                        "paginaInicial" => "360"
                        "paginaFinal" => "373"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27140855"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0027"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The emerging roles of long noncoding RNAs in common cardiovascular diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "X&#46; Jiang"
                            1 => "Q&#46; Ning"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/hr.2015.26"
                      "Revista" => array:7 [
                        "tituloSerie" => "Hypertens Res"
                        "fecha" => "2015"
                        "volumen" => "38"
                        "numero" => "6"
                        "paginaInicial" => "375"
                        "paginaFinal" => "379"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25762413"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0028"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HCG18LncRNA promotes clear cell renal cell carcinoma progression by targeting to upregulate"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Y&#46; Yang"
                            1 => "P&#46; Gong"
                            2 => "D&#46; Yao"
                            3 => "D&#46; Xue"
                            4 => "X&#46; He"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/CMAR.S298649"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Manag Res"
                        "fecha" => "2021"
                        "volumen" => "13"
                        "paginaInicial" => "2287"
                        "paginaFinal" => "2294"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33732021"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0029"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HCG18LncRNA suppresses CD8 T cells to confer resistance to cetuximab in colorectal cancer via miR-20b-5p&#47;PD-L1 axis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;-J&#46; Xu"
                            1 => "J&#46;-M&#46; Zhao"
                            2 => "X&#46;-F&#46; Ni"
                            3 => "W&#46; Wang"
                            4 => "W&#46;-W&#46; Hu"
                            5 => "C&#46;-P&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Epigenomics"
                        "fecha" => "2021"
                        "volumen" => "13"
                        "numero" => "16"
                        "paginaInicial" => "1281"
                        "paginaFinal" => "1297"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Upregulated lncRNA HCG18 in patients with non-alcoholic fatty liver disease and its regulatory effect on insulin resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Y&#46; Xia"
                            1 => "Y&#46; Zhang"
                            2 => "H&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/DMSO.S333431"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes Metab Syndr Obes"
                        "fecha" => "2021"
                        "volumen" => "14"
                        "paginaInicial" => "4747"
                        "paginaFinal" => "4756"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34887672"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0031"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analyzing MiRNA-LncRNA interactions"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Paraskevopoulou"
                            1 => "A&#46; Hatzigeorgiou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-4939-3378-5_21"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2016"
                        "volumen" => "1402"
                        "paginaInicial" => "271"
                        "paginaFinal" => "286"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26721498"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0032"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analyzing the LncRNA&#44; miRNA&#44; and mRNA regulatory network in prostate cancer with bioinformatics software"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;-H&#46; He"
                            1 => "Z&#46;-P&#46; Han"
                            2 => "M&#46;-X&#46; Zou"
                            3 => "L&#46; Wang"
                            4 => "Y&#46;B&#46; Lv"
                            5 => "J&#46;B&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/cmb.2016.0093"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Comput Biol"
                        "fecha" => "2018"
                        "volumen" => "25"
                        "numero" => "2"
                        "paginaInicial" => "146"
                        "paginaFinal" => "157"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28836827"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0033"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Construction and analysis of mRNA&#44; miRNA&#44; lncRNA&#44; and TF regulatory networks reveal the key genes associated with prostate cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Y&#46; Ye"
                            1 => "S&#46; Li"
                            2 => "S&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "PLoS ONE"
                        "fecha" => "2018"
                        "volumen" => "13"
                        "numero" => "8"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0034"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long non-coding RNA HCG18 promotes M1 macrophage polarization through regulating the miR-146a&#47;TRAF6 axis&#44; facilitating the progression of diabetic peripheral neuropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Ren"
                            1 => "G&#46; Xi"
                            2 => "X&#46; Li"
                            3 => "L&#46; Zhao"
                            4 => "K&#46; Yang"
                            5 => "X&#46; Fan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11010-020-03923-3"
                      "Revista" => array:7 [
                        "tituloSerie" => "Mol Cell Biochem"
                        "fecha" => "2021"
                        "volumen" => "476"
                        "numero" => "1"
                        "paginaInicial" => "471"
                        "paginaFinal" => "482"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32996080"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HCG18&#47;miR-34a-5p&#47;HMMR axis accelerates the progression of lung adenocarcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "W&#46; Li"
                            1 => "T&#46; Pan"
                            2 => "W&#46; Jiang"
                            3 => "H&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Biomed Pharmacother"
                        "fecha" => "2020"
                        "volumen" => "129"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0036"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HMGA2 as a critical regulator in cancer development"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Mansoori"
                            1 => "A&#46; Mohammadi"
                            2 => "H&#46;J&#46; Ditzel"
                            3 => "P&#46;H&#46;G&#46; Duijf"
                            4 => "V&#46; Khaze"
                            5 => "M&#46;F&#46; Gjerstorff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/genes12020269"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genes"
                        "fecha" => "2021"
                        "volumen" => "12"
                        "numero" => "2"
                        "paginaInicial" => "269"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33668453"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0037"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Emerging roles for HMGA2 in colorectal cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "X&#46; Wang"
                            1 => "J&#46; Wang"
                            2 => "J&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Transl Oncol"
                        "fecha" => "2021"
                        "volumen" => "14"
                        "numero" => "1"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0038"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HMGA2 supports cancer hallmarks in triple-negative breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Mansoori"
                            1 => "M&#46;G&#46; Terp"
                            2 => "A&#46; Mohammadi"
                            3 => "C&#46;B&#46; Pedersen"
                            4 => "H&#46;J&#46; Ditzel"
                            5 => "B&#46; Baradaran"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/cancers13205197"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancers"
                        "fecha" => "2021"
                        "volumen" => "13"
                        "numero" => "20"
                        "paginaInicial" => "5197"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34680349"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0039"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-26b suppresses the development of Stanford type A aortic dissection by regulating HMGA2 and TGF-&#946;&#47;Smad3 signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46; Yang"
                            1 => "P&#46; Wu"
                            2 => "X&#46; Liu"
                            3 => "J&#46; Feng"
                            4 => "S&#46; Zheng"
                            5 => "Y&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5761/atcs.oa.19-00184"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Thorac Cardiovasc Surg"
                        "fecha" => "2020"
                        "volumen" => "26"
                        "numero" => "3"
                        "paginaInicial" => "140"
                        "paginaFinal" => "150"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31723084"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack786268"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="para0040" class="elsevierStylePara elsevierViewall">Not applicable&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/18075932/000000790000000C/v123_202411010523/S1807593224000772/v123_202411010523/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "94924"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/18075932/000000790000000C/v123_202411010523/S1807593224000772/v123_202411010523/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1807593224000772?idApp=UINPBA00004N"
]

Article information

ISSN: 18075932
Original language: English

DOI:10.1016/j.clinsp.2024.100400

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	9	1	10
2024 October	62	20	82
2024 September	56	17	73
2024 August	51	48	99

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter