was read the article
array:23 [ "pii" => "S0213005X09001220" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2008.09.009" "estado" => "S300" "fechaPublicacion" => "2009-05-01" "aid" => "84" "copyright" => "Elsevier España, S.L. All rights reserved" "copyrightAnyo" => "2008" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Enferm Infecc Microbiol Clin. 2009;27:269-74" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 3069 "formatos" => array:3 [ "EPUB" => 12 "HTML" => 2533 "PDF" => 524 ] ] "itemSiguiente" => array:18 [ "pii" => "S0213005X09001244" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2008.09.010" "estado" => "S300" "fechaPublicacion" => "2009-05-01" "aid" => "86" "copyright" => "Elsevier España, S.L" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Enferm Infecc Microbiol Clin. 2009;27:275-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 3449 "formatos" => array:3 [ "EPUB" => 10 "HTML" => 3007 "PDF" => 432 ] ] "es" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original breve</span>" "titulo" => "Impacto de la vacuna neumocócica conjugada heptavalente en una población con valores bajos-intermedios de vacunación" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "275" "paginaFinal" => "277" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Impact of 7-valent pneumococcal conjugate vaccination in a population with low to intermediate vaccination levels" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Lluís Salleras, Àngela Domínguez, Pilar Ciruela, Conchita Izquierdo, Eva Borràs" "autores" => array:6 [ 0 => array:3 [ "Iniciales" => "L." "nombre" => "Lluís" "apellidos" => "Salleras" ] 1 => array:3 [ "Iniciales" => "A." "nombre" => "Àngela" "apellidos" => "Domínguez" ] 2 => array:2 [ "nombre" => "Pilar" "apellidos" => "Ciruela" ] 3 => array:2 [ "nombre" => "Conchita" "apellidos" => "Izquierdo" ] 4 => array:2 [ "nombre" => "Eva" "apellidos" => "Borràs" ] 5 => array:1 [ "colaborador" => "el Grupo de Trabajo del Sistema de Notificación Microbiológica de Cataluña" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X09001244?idApp=UINPBA00004N" "url" => "/0213005X/0000002700000005/v1_201305090137/S0213005X09001244/v1_201305090137/es/main.assets" ] "itemAnterior" => array:18 [ "pii" => "S0213005X09001207" "issn" => "0213005X" "doi" => "10.1016/j.eimc.2008.07.006" "estado" => "S300" "fechaPublicacion" => "2009-05-01" "aid" => "82" "copyright" => "Elsevier España, S.L" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Enferm Infecc Microbiol Clin. 2009;27:263-8" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 5707 "formatos" => array:3 [ "EPUB" => 11 "HTML" => 4627 "PDF" => 1069 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original</span>" "titulo" => "Brote de meningitis por echovirus serotipo 30 en la Comunidad Valenciana" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "263" "paginaFinal" => "268" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Meningitis outbreak caused by Echovirus serotype 30 in the Valencian Community" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig2" "etiqueta" => "Figura 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1597 "Ancho" => 2169 "Tamanyo" => 195953 ] ] "descripcion" => array:1 [ "es" => "<p class="elsevierStyleSimplePara elsevierViewall">Distribución geográfica de los casos de meningitis aséptica en el Departamento de Salud n.° 11 de la Comunidad Valenciana. *Primer caso (10/11/2007).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "M. Lirios Juliá, Javier Colomina, Victoria Domínguez, Nieves Orta, Antonio Guerrero" "autores" => array:5 [ 0 => array:2 [ "nombre" => "M. Lirios" "apellidos" => "Juliá" ] 1 => array:2 [ "nombre" => "Javier" "apellidos" => "Colomina" ] 2 => array:2 [ "nombre" => "Victoria" "apellidos" => "Domínguez" ] 3 => array:2 [ "nombre" => "Nieves" "apellidos" => "Orta" ] 4 => array:2 [ "nombre" => "Antonio" "apellidos" => "Guerrero" ] ] ] ] ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X09001207?idApp=UINPBA00004N" "url" => "/0213005X/0000002700000005/v1_201305090137/S0213005X09001207/v1_201305090137/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original</span>" "titulo" => "Nosocomial outbreak by imipenem-resistant metallo-β-lactamase-producing <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> in an adult intensive care unit in a Brazilian teaching hospital" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "269" "paginaFinal" => "274" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Renata Cristina Cezário, Lea Duarte De Morais, Joseane Cristina Ferreira, Rogério M. Costa-Pinto, Ana Lúcia da Costa Darini, Paulo P. Gontijo-Filho" "autores" => array:6 [ 0 => array:4 [ "nombre" => "Renata Cristina" "apellidos" => "Cezário" "email" => array:1 [ 0 => "cezariorenata@yahoo.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor1" ] ] ] 1 => array:3 [ "nombre" => "Lea" "apellidos" => "Duarte De Morais" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] ] ] 2 => array:3 [ "nombre" => "Joseane Cristina" "apellidos" => "Ferreira" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff3" ] ] ] 3 => array:4 [ "Iniciales" => "R.M." "nombre" => "Rogério M." "apellidos" => "Costa-Pinto" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff4" ] ] ] 4 => array:4 [ "Iniciales" => "A.L." "nombre" => "Ana Lúcia" "apellidos" => "da Costa Darini" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff4" ] ] ] 5 => array:3 [ "nombre" => "Paulo P." "apellidos" => "Gontijo-Filho" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Area Immunology, Parasitology and Microbiology at Universidade Federal de Uberlândia, Uberlândia-Minas Gerais, Brazil" "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff1" ] 1 => array:3 [ "entidad" => "Microbiology Laboratory of Hospital de Clinicas da Universidade Federal de Uberlândia, Uberlândia-Minas Gerais, Brazil" "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff2" ] 2 => array:3 [ "entidad" => "Faculty of Mathematics, Statistical and Biometric Studies at Universidade Federal de Uberlândia, Uberlândia-Minas Gerais, Brazil" "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff3" ] 3 => array:3 [ "entidad" => "Clinical, Toxicologic and Bromatologic Analyses of Pharmaceutical Sciences at Universidade de São Paulo/USP, Ribeirão Preto, Brazil" "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff4" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor1" "etiqueta" => "⁎" "correspondencia" => "Autor para correspondencia." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Brote nosocomial causado por <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> resistente a imipenem productora de metalo-<span class="elsevierStyleBold">β</span>-lactamasa en unidad de cuidados intensivos para adultos de un hospital universitario brasileño" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig1" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2791 "Ancho" => 2916 "Tamanyo" => 521284 ] ] "descripcion" => array:1 [ "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Schematic representation of temporal and spatial relationships among patients infected with imipenem-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> during the study period. The arrows represent referral of patients from other hospitals to the ICU in Uberlandia Federal University Hospital, black sections indicate the time the patient was another ward, sections with hatched lines indicate time the patient was in the ICU and infected by imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span>, and crosses indicate death of the patient.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Introduction</span><p class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> is an opportunistic pathogen that can cause severe invasive disease in critically ill and immunocompromised patients.<a class="elsevierStyleCrossRef" href="#bib1"><span class="elsevierStyleSup">1</span></a> This microorganism is an important cause of nosocomial infections, including pneumonia, wound infections, bacteremia, and urinary tract infection,<a class="elsevierStyleCrossRefs" href="#bib2"><span class="elsevierStyleSup">2,3</span></a><span class="elsevierStyleItalic">P. aeruginosa</span> is frequent cause of ventilator-associated pneumonia in intensive care units (ICUs), the associated risk factors being mechanical ventilation lasting longer than 7 days, severity of the underlying condition, and previous antibiotic treatment, surgery, or immunosuppression.<a class="elsevierStyleCrossRefs" href="#bib3"><span class="elsevierStyleSup">3,4</span></a></p><p class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">P. aeruginosa</span> is a uniquely problematic microorganism because of a combination of inherent resistance to many drug classes and an ability to acquire resistance to all relevant treatments.<a class="elsevierStyleCrossRef" href="#bib5"><span class="elsevierStyleSup">5</span></a> Thus, carbapenems remain one of the best therapy options, although their use is threatened by the emergence of carbapenem-hydrolyzing, enzyme-producing strains and dissemination of multidrug-resistant clones. One reported outbreak of <span class="elsevierStyleItalic">P. aeruginosa</span> was only susceptible to polymyxin.<a class="elsevierStyleCrossRefs" href="#bib6"><span class="elsevierStyleSup">6,7</span></a> In Brazilian hospitals, <span class="elsevierStyleItalic">P. aeruginosa</span> is a leading cause of nosocomial infection and the first cause of nosocomial pneumonia, notably in ICUs.<a class="elsevierStyleCrossRefs" href="#bib8"><span class="elsevierStyleSup">8–10</span></a></p><p class="elsevierStylePara elsevierViewall">This study describes a nosocomial outbreak of imipenem-resistant, metallo-β-lactamase-producing <span class="elsevierStyleItalic">P. aeruginosa</span> with horizontal transmission in patients hospitalized in a mixed ICU.</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Methods</span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Hospital</span><p class="elsevierStylePara elsevierViewall">The Uberlândia University Hospital is a 500-bed, tertiary-care teaching hospital in the city of Uberlândia, Minas Gerais State, Brazil, with a 15-bed, mixed (surgical-clinical) adult ICU.</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Study design</span><p class="elsevierStylePara elsevierViewall">From November 2003 to June 2005, a case-control study was carried out to investigate an imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> nosocomial outbreak, affecting 47 patients.</p><p class="elsevierStylePara elsevierViewall">The index case was a 77-year-old woman with a diagnosis of pulmonary thromboembolism, who had received cefepime, ceftriaxone, and ampicillin antibiotic treatment in the ICU of another Uberlandia hospital in November 2003. She was referred to the ICU of the university hospital with a clinical diagnosis of respiratory failure and acute abdomen. Forty-eight hours after starting mechanical ventilation, ventilator-associated pneumonia due to <span class="elsevierStyleItalic">P. aeruginosa</span> resistant to imipenem and other antimicrobial classes was detected (isolate 1). The patient remained in the unit for approximately 3 weeks. She received imipenem treatment for 24 hours, and was then switched to polymyxin B<span class="elsevierStyleSup">®</span> for 30 days’ time; despite this treatment, she died.</p><p class="elsevierStylePara elsevierViewall">The risk factors associated with infection by imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> (IRPa) were evaluated in a case-control study. Cases were defined as patients for whom culture had identified at least one IRPa strain (n=47). For each case, 2 or 3 controls were selected (n=122), defined as patients without IRPa infection, whose hospital stay coincided the closest in time with that of the infected patient. Only the first isolate per patient was considered for the analysis. During the study period, contamination of the health staff's hands (23), patients hospitalized during this period (86), and the surfaces in the ICU near the patients (mechanical ventilation unit, headboard, sinks) was investigated. The Institutional Ethics Committee gave their approval to conduct the study (CEP n<span class="elsevierStyleSup">o</span>186/2005).</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Data collection</span><p class="elsevierStylePara elsevierViewall">Data for each patient were collected from the medical charts. The following variables were analyzed: age, sex, duration of ICU stay, comorbid conditions (diabetes mellitus, AIDS, renal failure, immunosuppression, cardiovascular disease), surgery, invasive device use (mechanical ventilation, central venous catheter, nasogastric tube) and prior use of antimicrobial drugs.</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Identification and susceptibility testing procedures</span><p class="elsevierStylePara elsevierViewall">Bacterial strains were identified by conventional biochemical tests, as described elsewhere.<a class="elsevierStyleCrossRef" href="#bib11"><span class="elsevierStyleSup">11</span></a> Susceptibility testing was performed by agar diffusion with the following antimicrobials agents (CECON<span class="elsevierStyleSup">®</span>): aztreonam (30<span class="elsevierStyleHsp" style=""></span>μg), ciprofloxacin (5<span class="elsevierStyleHsp" style=""></span>μg), cefepime (30<span class="elsevierStyleHsp" style=""></span>μg), imipenem (10<span class="elsevierStyleHsp" style=""></span>μg), meropenem (10<span class="elsevierStyleHsp" style=""></span>μg), ceftazidime (30<span class="elsevierStyleHsp" style=""></span>μg), gentamicin (10<span class="elsevierStyleHsp" style=""></span>μg), piperacillin/tazobactam (100/10<span class="elsevierStyleHsp" style=""></span>μg), and polymyxin B (300<span class="elsevierStyleHsp" style=""></span>U); the interpretative criteria used were those described in the CLSI (formerly NCCLS) guidelines.<a class="elsevierStyleCrossRef" href="#bib12"><span class="elsevierStyleSup">12</span></a> Quality control was conducted using <span class="elsevierStyleItalic">P. aeruginosa</span> ATCC 27853. <span class="elsevierStyleItalic">P. aeruginosa</span> was defined as being multidrug-resistant when the organism was resistant to imipenem/meropenem and 2 or more of the other antimicrobial classes studied, except polymyxin.</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Phenotypic metallo-β-lactamase production</span><p class="elsevierStylePara elsevierViewall">All strains resistant to ceftazidime and/or imipenem were screened for metallo-β-lactamase (MBL) production by the disk approximation test, using filter disks with ceftazidime (30<span class="elsevierStyleHsp" style=""></span>μg) and imipenem (10<span class="elsevierStyleHsp" style=""></span>μg) at 25<span class="elsevierStyleHsp" style=""></span>mm or 10<span class="elsevierStyleHsp" style=""></span>mm equidistant, respectively, and disks containing the following inhibitors: 2<span class="elsevierStyleHsp" style=""></span>μL of undiluted 2-mercaptopropionic acid (2-MPA) solution (Aldrich Chemical Co, Milwaukee, USA) or 5<span class="elsevierStyleHsp" style=""></span>μL of EDTA 500<span class="elsevierStyleHsp" style=""></span>mM solution, as described by Arakawa.<a class="elsevierStyleCrossRef" href="#bib13"><span class="elsevierStyleSup">13</span></a> The positive control strain was an IMP-1-producing <span class="elsevierStyleItalic">P. aeruginosa</span> (PSA 319).<a class="elsevierStyleCrossRef" href="#bib14"><span class="elsevierStyleSup">14</span></a></p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Detection of the bla gene</span><p class="elsevierStylePara elsevierViewall">Because of cost constraints, 15 MBL-positive isolates were selected as representative strains for the detection of genes encoding Ambler class B β-lactamase of the VIM, IMP, or SPM type by PCR using the following specific primers (reading 5′-3′): <span class="elsevierStyleItalic">vim</span> forward, GTCTATTTGACCGCGTC, <span class="elsevierStyleItalic">vim</span> reverse; CTACTCAACGACTGAGCG; <span class="elsevierStyleItalic">imp</span> forward, ATGAGCAAGTTATCTGTATTC, <span class="elsevierStyleItalic">imp</span> reverse: GTCGCAACGACTGTGTAG and <span class="elsevierStyleItalic">spm</span> reverse: TCGCCGTGTCCAGGTATAAC, <span class="elsevierStyleItalic">spm</span> forward: CCTACAATCTAACGGCGACC. The cycling parameters were 95<span class="elsevierStyleHsp" style=""></span>°C for 5<span class="elsevierStyleHsp" style=""></span>min, followed by 30 denaturation cycles at 95<span class="elsevierStyleHsp" style=""></span>°C for 1<span class="elsevierStyleHsp" style=""></span>min, annealing at 40<span class="elsevierStyleHsp" style=""></span>°C for 1<span class="elsevierStyleHsp" style=""></span>min, and extension at 68<span class="elsevierStyleHsp" style=""></span>°C for 1<span class="elsevierStyleHsp" style=""></span>min. PCR products were visualized by electrophoresis on 0.8% agarose gels stained with 1% ethidium bromide.<a class="elsevierStyleCrossRefs" href="#bib14"><span class="elsevierStyleSup">14,15</span></a></p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Genotyping by pulsed-field gel electrophoresis</span><p class="elsevierStylePara elsevierViewall">Among 47 IRPa isolates, 15 randomly selected isolates with a positive MBL-producing phenotype were typed using pulsed-field gel electrophoresis (PFGE), as described by Denton et al,<a class="elsevierStyleCrossRef" href="#bib16"><span class="elsevierStyleSup">16</span></a> with modifications. Each plug was digested with 30<span class="elsevierStyleHsp" style=""></span>U of <span class="elsevierStyleItalic">SpeI</span> restriction endonuclease (Invitrogen, Carlsbad, CA) at 37<span class="elsevierStyleHsp" style=""></span>°C for 12<span class="elsevierStyleHsp" style=""></span>h. Briefly, electrophoresis was performed by a 1% PFGE agarose gel run on the Gene Navigator (Pharmacia, Amersham Biociences) instrument at 164<span class="elsevierStyleHsp" style=""></span>V for 20.1<span class="elsevierStyleHsp" style=""></span>h, at 14<span class="elsevierStyleHsp" style=""></span>°C. The equipment was adjusted for a pulse of 5<span class="elsevierStyleHsp" style=""></span>s for 20<span class="elsevierStyleHsp" style=""></span>h and 15<span class="elsevierStyleHsp" style=""></span>s for 0.1<span class="elsevierStyleHsp" style=""></span>h. Band patterns were visualized by ethidium bromide staining and ultraviolet transillumination. Cloning was evaluated according to the Tenover criteria,<a class="elsevierStyleCrossRef" href="#bib17"><span class="elsevierStyleSup">17</span></a> based on visual comparisons of the band patterns of samples run together in the same gel. Genetic similarities in samples were analyzed with a multivariate statistical package (MVSP 3.0).</p></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Statistical analysis</span><p class="elsevierStylePara elsevierViewall">Categorical variables were assessed with the chi-square test and Fisher's exact test; significance was set at a <span class="elsevierStyleItalic">P</span> value of ⩽0.05. Odds ratios and 95% confidence intervals were calculated with Epi-Info software, version 5.0. Variables were selected by forward logistic regression for the multivariate analysis.</p></span></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Results</span><p class="elsevierStylePara elsevierViewall">Following the index case, 46 additional cases of hospital-acquired infection were documented, including mechanical ventilation-associated pneumonia (41), bloodstream infection (3), surgical wound infection (1) and urinary tract infection (1) caused by <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> resistant to imipenem and other antimicrobial agents, including cephalosporins, aminoglycosides, and fluoroquinolones (data not shown).</p><p class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#fig1">Fig. 1</a> shows the mortality data and the temporal/spatial relationships (ICU stay) among the 47 patients, which provides evidence of cross-transmission of IRPa.</p><elsevierMultimedia ident="fig1"></elsevierMultimedia><p class="elsevierStylePara elsevierViewall">During the scrutiny for contamination, <span class="elsevierStyleItalic">P. aeruginosa</span> was not detected on culture of samples from the hands of 23 professionals, although initially this was suspected as the route by which the microorganism had been disseminated. However, <span class="elsevierStyleItalic">P. aeruginosa</span> was found colonizing 15/86 (17.4%) of the patients examined and on surfaces located near the patients, including the mechanical ventilation nebulizer in 10/86 (11.6%) and the headboard of the bed in 3/86 (3.5%), but not the sinks.</p><p class="elsevierStylePara elsevierViewall">The majority of imipenem/ceftazidime-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> strains in infected patients (33/43; 76.7%) had an MBL-positive phenotype, with no differences in detection between mercaptopropionic acid or EDTA (<a class="elsevierStyleCrossRef" href="#tbl1">Table 1</a>). In the contamination scrutiny, 17.8% (5/28) of <span class="elsevierStyleItalic">P. aeruginosa</span> imipenem/ceftazidime-resistant strains had an MBL-positive phenotype. Only 26.7% (4/15) of MBL-producing strains were positive for the <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span> gene. The <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">VIM−2,</span> bla <span class="elsevierStyleInf">IMP−1,</span></span> and <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM</span></span> genes were not found.</p><elsevierMultimedia ident="tbl1"></elsevierMultimedia><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Genotyping</span><p class="elsevierStylePara elsevierViewall">Two strains collected from the environment and strains from tracheal secretions were MBL-producers. A total of 15 strains were typed; however, 2 specimens remained undefined. Four clones and their subclones were found on PFGE, with a predominance of clone A, A1, A2 (61.5%), followed by B, B1 (23.1%), C and D (1 sample each), and 2 indeterminate results (<a class="elsevierStyleCrossRef" href="#tbl2">Table 2</a>).</p><elsevierMultimedia ident="tbl2"></elsevierMultimedia><p class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#tbl3">Table 3</a> shows the univariate analysis. On multivariate analysis, age ⩾60 years (<span class="elsevierStyleItalic">P</span>⩽0.02; OR 2.4; 95% CI 1.10–5.49), use of mechanical ventilation (<span class="elsevierStyleItalic">P</span>⩽0.001; OR 7.2; 95% CI 2.74–19.10), presence of a tracheotomy (<span class="elsevierStyleItalic">P</span>⩽0.02; OR 4.01; CI 1.17–13.72), and carbapenem use (<span class="elsevierStyleItalic">P</span><0.001, OR 5.7; 95% CI 2.31–10.08) were risk factors for acquiring imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> infection</p><elsevierMultimedia ident="tbl3"></elsevierMultimedia></span></span><span class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Discussion</span><p class="elsevierStylePara elsevierViewall">The presence of MBL-producing <span class="elsevierStyleItalic">P. aeruginosa</span> has been described in many hospitals around the world.<a class="elsevierStyleCrossRef" href="#bib18"><span class="elsevierStyleSup">18</span></a> Nonetheless, dissemination of an <span class="elsevierStyleItalic">SPM-1</span> MBL-producing <span class="elsevierStyleItalic">P. aeruginosa</span> epidemic has been demonstrated only in hospitals of different Brazilian regions.<a class="elsevierStyleCrossRefs" href="#bib8"><span class="elsevierStyleSup">8,14,19</span></a> As compared to other studies carried out in Brazil, the presently reported nosocomial outbreak of imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> infection involved the largest number of cases to date (47 patients) and was associated with 4 clones. This study is the first to include an expressive number (≈60%) of critical IRPa-infected patients who died within 30 days after the infection.</p><p class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> is a leading pathogen in mechanical ventilation-associated nosocomial pneumonia, with an associated mortality rate of 20% to 80%.<a class="elsevierStyleCrossRefs" href="#bib8"><span class="elsevierStyleSup">8,9,20</span></a> During the outbreak in our hospital, pneumonia was the predominant infection, accounting for more than two-thirds (85%) of the cases, followed by bloodstream infection and surgical wounds.</p><p class="elsevierStylePara elsevierViewall">The multivariate logistic regression analysis showed that patients with nosocomial IPRa infection were more likely to have been exposed to mechanical ventilation, and that tracheotomy and use of carbapenems were predisposing factors for the infection. These findings are consistent with those of other studies.<a class="elsevierStyleCrossRefs" href="#bib4"><span class="elsevierStyleSup">4,20–22</span></a></p><p class="elsevierStylePara elsevierViewall">Although the advent of carbapenems in the 1980s heralded a new treatment option for serious bacterial infections, carbapenem resistance is now observed in Enterobacteriaceae and <span class="elsevierStyleItalic">Acinetobacter</span> spp., and is becoming commonplace in <span class="elsevierStyleItalic">P. aeruginosa.</span><a class="elsevierStyleCrossRef" href="#bib18"><span class="elsevierStyleSup">18</span></a><span class="elsevierStyleItalic">P. aeruginosa</span> possessing MBLs has been increasingly reported worldwide, mainly in ICUs and including Brazil,<a class="elsevierStyleCrossRefs" href="#bib14"><span class="elsevierStyleSup">14,18,19</span></a> but at rates comparatively lower than those found in our study (≈90%).</p><p class="elsevierStylePara elsevierViewall">These enzymes are clinically relevant because of their ability to hydrolyze most β-lactams, including carbapenems (but excluding aztreonam),<a class="elsevierStyleCrossRef" href="#bib18"><span class="elsevierStyleSup">18</span></a> and their association with mobile genetic elements, increasing the possibility of rapid spread.<a class="elsevierStyleCrossRefs" href="#bib19"><span class="elsevierStyleSup">19,23–25</span></a> In the Americas, 6 different MBLs have been described in <span class="elsevierStyleItalic">P aeruginosa</span>, including SPM-1, IMP-1, IMP-16, VIM-2, VIM-8 and VIM-11<a class="elsevierStyleCrossRef" href="#bib18"><span class="elsevierStyleSup">18</span></a> and three MBL types (SPM-1, VIM-2 and IMP-1) have been detected in Brazilian hospitals, with most strains expressing <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span>, which is disseminated among our hospitals.<a class="elsevierStyleCrossRefs" href="#bib8"><span class="elsevierStyleSup">8,14,19,22</span></a> We found that MBL-producing strains accounted for a substantial number of cases (76.7%), and that the strains were clinically relevant, because 70.0% of the patients died. In contrast to the reported results of Sader et al,<a class="elsevierStyleCrossRef" href="#bib26"><span class="elsevierStyleSup">26</span></a> neither <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">IMP−1</span></span> or <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">VIM−1</span></span> genes were found in this study.</p><p class="elsevierStylePara elsevierViewall">The acquisition of resistant bacteria in hospitals may be a consequence of selective pressure exerted by the use of antibiotics and/or horizontal dissemination.<a class="elsevierStyleCrossRef" href="#bib27"><span class="elsevierStyleSup">27</span></a> Molecular typing of strains presenting the <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span> gene showed the presence of a single clone (A). In the present study, multidrug-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> strains were clustered in two major genotypes; these showed coresistance to most of the antimicrobial agents tested. Multidrug resistance can be explained by the accumulation of several resistance mechanisms, including gene mutation, over-expression of efflux pumps, loss or modification of porins, and acquired extended-spectrum β-lactamases.<a class="elsevierStyleCrossRef" href="#bib28"><span class="elsevierStyleSup">28</span></a> This suggests that the selective pressure of previous antimicrobial use in the unit contributed to the emergence of resistant clones.</p><p class="elsevierStylePara elsevierViewall">Both the SPM and non-SPM-infected patients were clustered for 18 months in a single unit, with overlapping during their hospitalization. These data suggest that horizontal transmission between these patients may have played a role in the dissemination of the infection. Clonal dissemination was detected within and between intensive care units in São Paulo (4) and Brasilia,<a class="elsevierStyleCrossRef" href="#bib10"><span class="elsevierStyleSup">10</span></a> but with unrelated strains recovered from one of them. These data differ from those of Pellegrino et al<a class="elsevierStyleCrossRef" href="#bib29"><span class="elsevierStyleSup">29</span></a> who reported clonal dissemination between private and public institutions in Rio de Janeiro, in which both presented an apparently endemic background.</p><p class="elsevierStylePara elsevierViewall">Detection of clonal dissemination usually indicates inadequate nosocomial infection control practice.<a class="elsevierStyleCrossRef" href="#bib10"><span class="elsevierStyleSup">10</span></a> This outbreak of <span class="elsevierStyleItalic">P. aeruginosa</span> infection was probably linked to transmission of the microorganism via the hands of healthcare workers. We did not identify hand carriage among the workers examined, but a spatial/temporal relationship was seen among the cases in our unit, and low adherence (23%) to proper hand washing<a class="elsevierStyleCrossRef" href="#bib30"><span class="elsevierStyleSup">30</span></a> practice was detected in a recent study.</p><p class="elsevierStylePara elsevierViewall">In conclusion, to our knowledge, this is the first study to conduct an analysis using both classical and molecular techniques of an outbreak of infection associated with a highly prevalent MBL-producing <span class="elsevierStyleItalic">P. aeruginosa</span>, including mainly <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span> strains clustered in 2 major genotype, resulting in a significant increase in mortality of elderly patients and in previous use of antibiotics. The clonal dissemination among patients in our unit indicates problems in nosocomial infection control practice, likely associated with low adherence to hand hygiene, and selective pressure that provides resistant strains with an advantage over their susceptible ancestors.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:2 [ "identificador" => "xres149937" "titulo" => array:5 [ 0 => "Abstract" 1 => "Objective" 2 => "Methods" 3 => "Results" 4 => "Conclusions" ] ] 1 => array:2 [ "identificador" => "xpalclavsec137868" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres149936" "titulo" => array:5 [ 0 => "Resumen" 1 => "Objetivo" 2 => "Métodos" 3 => "Resultados" 4 => "Conclusiones" ] ] 3 => array:2 [ "identificador" => "xpalclavsec137867" "titulo" => "Palabras clave" ] 4 => array:1 [ "titulo" => "Introduction" ] 5 => array:2 [ "titulo" => "Methods" "secciones" => array:8 [ 0 => array:1 [ "titulo" => "Hospital" ] 1 => array:1 [ "titulo" => "Study design" ] 2 => array:1 [ "titulo" => "Data collection" ] 3 => array:1 [ "titulo" => "Identification and susceptibility testing procedures" ] 4 => array:1 [ "titulo" => "Phenotypic metallo-β-lactamase production" ] 5 => array:1 [ "titulo" => "Detection of the bla gene" ] 6 => array:1 [ "titulo" => "Genotyping by pulsed-field gel electrophoresis" ] 7 => array:1 [ "titulo" => "Statistical analysis" ] ] ] 6 => array:2 [ "titulo" => "Results" "secciones" => array:1 [ 0 => array:1 [ "titulo" => "Genotyping" ] ] ] 7 => array:1 [ "titulo" => "Discussion" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2008-01-25" "fechaAceptado" => "2008-09-01" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec137868" "palabras" => array:4 [ 0 => "Nosocomial outbreak" 1 => "Imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span>" 2 => "Metallo-β-lactamase" 3 => "Intensive care unit" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec137867" "palabras" => array:4 [ 0 => "Brote nosocomiales" 1 => "<span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> resistente la imipenem" 2 => "Metallo-β-lactamase" 3 => "Unidad de cuidados intensivos" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span class="elsevierStyleSectionTitle">Objective</span><p class="elsevierStyleSimplePara elsevierViewall">To describe an outbreak of imipenem-resistant metallo-β-lactamase-producing <span class="elsevierStyleItalic">Pseudomonas aeruginosa,</span> enzyme type <span class="elsevierStyleItalic">bla</span>, by horizontal transmission in patients admitted to a mixed adult ICU.</p> <span class="elsevierStyleSectionTitle">Methods</span><p class="elsevierStyleSimplePara elsevierViewall">A case-control study was carried out, including 47 patients (cases) and 122 patients (control) admitted to the mixed ICU of a university hospital in Minas Gerais, Brazil from November 2003 to July 2005. The infection site, risk factors, mortality, antibiotic susceptibility, metallo-β-lactamase (MBL) production, enzyme type, and clonal diversity were analyzed.</p> <span class="elsevierStyleSectionTitle">Results</span><p class="elsevierStyleSimplePara elsevierViewall">A temporal/spatial relationship was detected in most patients (94%), overall mortality was 55.3%, and pneumonia was the predominant infection (85%). The majority of isolates (95%) were resistant to imipenem and other antibiotics, except for polymyxin, and showed MBL production (76.7%). Only <span class="elsevierStyleItalic">bla SPM-1</span> (33%) was identified in the 15 specimens analyzed. In addition, 4 clones were identified, with a predominance of clone A (61.5%) and B (23.1%). On multivariate analysis, advanced age, mechanical ventilation, tracheostomy, and previous imipenem use were significant risk factors for imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span> infection.</p> <span class="elsevierStyleSectionTitle">Conclusions</span><p class="elsevierStyleSimplePara elsevierViewall">Clonal dissemination of MBL-producing <span class="elsevierStyleItalic">P. aeruginosa</span> strains with a spatial/temporal relationship disclosed problems in the practice of hospital infection control, low adherence to hand hygiene, and empirical antibiotic use.</p>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<span class="elsevierStyleSectionTitle">Objetivo</span><p class="elsevierStyleSimplePara elsevierViewall">Describir un brote causado por <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> resistente a imipenem productora de metallo-β-lactamasa (MBL), tipo de bla de la enzima, con transmisión horizontal de la muestra epidémica en pacientes ingresados en una unidad de cuidados intensivos para adultos mixta.</p> <span class="elsevierStyleSectionTitle">Métodos</span><p class="elsevierStyleSimplePara elsevierViewall">Durante el período comprendido entre noviembre de 2003 y julio de 2005, se realizó un estudio de casos y controles en el que se incluyó a 47 (casos) y 122 (control) pacientes en una unidad de cuidados intensivos para adultos mixta, de un hospital universitario de Uberlândia (Minas Gerais [Brasil]). Se analizaron los sitios de la infección, los factores de riesgo, la mortalidad total, la susceptibilidad a los antibióticos, la producción del tipo MBL, de la enzima y de la diversidad clonal.</p> <span class="elsevierStyleSectionTitle">Resultados</span><p class="elsevierStyleSimplePara elsevierViewall">En la mayoría de los pacientes (94%) se detectó una relación temporal/espacial. El índice de mortalidad total fue del 55,3% y la neumonía era la infección predominante (85%). La mayoría de las cepas (95%) era resistente a imipenem y a otros antibióticos, excepto al polimixin y la producción de MBL (76,7%). Únicamente se identificó bla<span class="elsevierStyleItalic"><span class="elsevierStyleInf">SPM−1</span></span> en los 15 especímenes analizados. Además, se detectaron 4 clones, con predominio del clon A (61,5%) y B (23,1%). En análisis multivariados, la vejez, la ventilación mecánica, la traqueotomía y el uso previo del carbapenem son factores de riesgo significativos para el desarrollo de la infección de <span class="elsevierStyleItalic">P. aeruginosa</span> resistente a imipenem.</p> <span class="elsevierStyleSectionTitle">Conclusiones</span><p class="elsevierStyleSimplePara elsevierViewall">La diseminación clonal de cepas de <span class="elsevierStyleItalic">P. aeruginosa</span> productora de MBL entre los pacientes con una relación temporal/espacial mostró problemas en el control de la infección del hospital, probablemente relacionado con una adherencia baja a la higiene de las manos y el uso empírico de los antibióticos.</p>" ] ] "multimedia" => array:4 [ 0 => array:7 [ "identificador" => "fig1" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2791 "Ancho" => 2916 "Tamanyo" => 521284 ] ] "descripcion" => array:1 [ "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Schematic representation of temporal and spatial relationships among patients infected with imipenem-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> during the study period. The arrows represent referral of patients from other hospitals to the ICU in Uberlandia Federal University Hospital, black sections indicate the time the patient was another ward, sections with hatched lines indicate time the patient was in the ICU and infected by imipenem-resistant <span class="elsevierStyleItalic">P. aeruginosa</span>, and crosses indicate death of the patient.</p>" ] ] 1 => array:7 [ "identificador" => "tbl1" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Infection \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">n/n IRPa (%)<a class="elsevierStyleCrossRef" href="#tblfn1ast"><span class="elsevierStyleSup">*</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">MBL n (%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ventilation-associated pneumonia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">41/38 (93.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 (87.0) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bloodstream infections \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3/3 (100.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (67.0) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Surgical wound \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2/1 (50.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (50.0) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Urinary tract \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1/1 (100.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (100.0) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">47/43 (94.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33 (76.7) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab243797.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn1ast" "etiqueta" => "*" "nota" => "<p class="elsevierStyleNotepara"><span class="elsevierStyleItalic">Pseudomonas aeruginosa-</span>infected patients/number of infections by IRPa.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Infections by imipenem-resistant metallo-β-lactamase-producing <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> in ICU patients at Uberlandia Federal University Hospital</p>" ] ] 2 => array:7 [ "identificador" => "tbl2" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Isolation period \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Source (n isolates) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">IRPa positive for <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">PGFE profile \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">December 2003 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">March, April 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Breath (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">January, February 2005 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Intestine (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">March 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Headboard (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND<a class="elsevierStyleCrossRef" href="#tblfn2ast"><span class="elsevierStyleSup">*</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A<span class="elsevierStyleInf">1</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">February 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A<span class="elsevierStyleInf">2</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">January 2005 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Intestine (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A<span class="elsevierStyleInf">2</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">May 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">B \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">October 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">B<span class="elsevierStyleInf">1</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">May 2005 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">February 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Intestine (1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">D \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">January, November 2004 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tracheal secretion (2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ND \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab243798.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn2ast" "etiqueta" => "*" "nota" => "<p class="elsevierStyleNotepara">Not determined.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Data on 15 metallo-β-lactamase-producing <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> isolates at the Uberlandia Federal University Hospital ICU</p>" ] ] 3 => array:7 [ "identificador" => "tbl3" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "<p class="elsevierStyleSimplePara elsevierViewall">OR: odds ratio; 95% CI: 95% confidence interval.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Variables \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="4" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Patients</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Infected n=47 (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Noninfected n=122 (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span><a class="elsevierStyleCrossRef" href="#tblfn3ast"><span class="elsevierStyleSup"><span class="elsevierStyleItalic">*</span></span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">OR (95% CI) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sex</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female/Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17/30 (36.2/63.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62/60 (50.8/49.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.55 (0.56–1.16) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age, y</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>⩾60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11 (23.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">50 (41.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.44 (0.19–1.00) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Length of stay, days</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>⩾7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">44 (93.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 (16.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.14 (10.59–83.71) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Comorbid conditions</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Diabetes mellitus \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">03 (6.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">07 (5.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.08 (0.41–2.89) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Cardiac disease \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">03 (6.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">27 (22.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.02 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.32 (0.11–0.95) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>AIDS \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">02 (4.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">00 (0.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.07 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.71 (2.89–4.76) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Immunosuppression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">03 (6.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">03 (2.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.35 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.85 (0.80–4.29) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Invasive Devices</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Central venous catheter \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 (63.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">110 (90.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.37 (0.24–0.57) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Mechanical ventilation; MV \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 (95.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">80 (65.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7.92 (2.00–31.30) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Duration of MV, days</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>⩾7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">40 (85.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 (11.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.10 (0.04–0.22) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Trauma \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (25.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 (18.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.381 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.36 (0.80–2.33) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Surgery \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (59.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 (24.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.82 (1.73–4.60) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="5" align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Antibiotic use</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>⩾2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (59.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 (39.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.02 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.27 (1.08–4.79) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Cephalosporin (3rd/4th generation) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 (64.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 (39.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.007 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.06 (1.23–3.44) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Carbapenem \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 (46.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">04 (3.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><0.001 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.84 (3.27–7.16) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Quinolone \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">05 (10.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">07 (5.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.95 (0.95–4.02) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Vancomycin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 (27.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 (11.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.019 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.01 (1.23–3.28) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab243799.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn3ast" "etiqueta" => "*" "nota" => "<p class="elsevierStyleNotepara"><span class="elsevierStyleItalic">P</span>⩽0,05.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p class="elsevierStyleSimplePara elsevierViewall">Univariate analysis of risk factors for nosocomial infection by resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> in ICU patients at Uberlandia Federal University Hospital</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:1 [ "bibliografiaReferencia" => array:30 [ 0 => array:3 [ "identificador" => "bib1" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An outbreak of multidrug-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> associated with increased risk of patient death in an intensive care unit" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G. Bukholm" 1 => "T. Tannaes" 2 => "A.B.B. Kjelsberg" 3 => "N. Smith-Erichsen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/502082" "Revista" => array:6 [ "tituloSerie" => "Infect Control Hosp Epidemiol" "fecha" => "2002" "volumen" => "23" "paginaInicial" => "441" "paginaFinal" => "446" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12186209" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib2" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increasing prevalence of antimicrobial resistance among <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> isolates in Latin American Medical Centers: 5 years report of the SENTRY antimicrobial Surveillance Program (1997–001)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.S. Andrade" 1 => "R.N. Jones" 2 => "A.C. Gales" 3 => "H.S. Sader" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkg270" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2003" "volumen" => "52" "paginaInicial" => "140" "paginaFinal" => "141" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12775681" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib3" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nosocomial infection caused by multiresistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.A. Arruda" 1 => "I.S. Marinho" 2 => "M. Boulos" 3 => "S.I. Sinto" 4 => "H.H. Caiffa" 5 => "C.M. Mendes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/501683" "Revista" => array:6 [ "tituloSerie" => "Infect Control Hosp Epidemiol" "fecha" => "1999" "volumen" => "20" "paginaInicial" => "620" "paginaFinal" => "623" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10501262" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib4" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors and clinical outcomes of nosocomial multidrug resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> infections" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "B. Cao" 1 => "H. Wang" 2 => "H. Sun" 3 => "Y. Zhu" 4 => "M. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhin.2004.03.021" "Revista" => array:6 [ "tituloSerie" => "J Hosp Infect" "fecha" => "2004" "volumen" => "57" "paginaInicial" => "112" "paginaFinal" => "118" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15183240" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib5" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Treatment and control of severe infections caused by multiresistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "G.M. Rossolini" 1 => "E. Mantengoli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1469-0691.2005.01239.x" "Revista" => array:7 [ "tituloSerie" => "Clin Microbiol Infect" "fecha" => "2005" "volumen" => "11" "numero" => "S4" "paginaInicial" => "17" "paginaFinal" => "32" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16138815" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib6" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiple mechanism of antimicrobial resistance in <span class="elsevierStyleItalic">Pseudomonas aeruginosa:</span> our worst nightmare?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D.M. Livermore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/338782" "Revista" => array:7 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2002" "volumen" => "34" "paginaInicial" => "634" "paginaFinal" => "640" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11823954" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S001502820400901X" "estado" => "S300" "issn" => "00150282" ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib7" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Carbapenemases: the versatile β-lactamases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A.M. Queenan" 1 => "K. Bush" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.00001-07" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2007" "volumen" => "20" "paginaInicial" => "440" "paginaFinal" => "448" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17630334" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib8" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reappraisal of <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> hospital-acquired pneumonia mortality in the era of metallo-β-lactamase-mediated multidrug resistance: a prospective observational study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A.P. Zavaski" 1 => "A.L. Barth" 2 => "J.F. Fernandes" 3 => "A.L.D. Moro" 4 => "A.L.S. Gonçalves" 5 => "L.Z. Goldani" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Critical Care" "fecha" => "2006" "volumen" => "10" "paginaInicial" => "100" "paginaFinal" => "110" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib9" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pneumonia associada à ventilação mecânica: impacto da multirresistência bacteriana na morbidade e mortalidade" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "P.J.Z. Teixeira" 1 => "F.T. Hertz" 2 => "D.B. Cruz" 3 => "F. Caraver" 4 => "R.C. Hallal" 5 => "J.S. Moreira" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Bras Pneumol" "fecha" => "2004" "volumen" => "30" "paginaInicial" => "540" "paginaFinal" => "548" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib10" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> clonal dissemination in Brazilian intensive care units" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.M. Figueredo-Mendes" 1 => "S. Sinto" 2 => "J.L. Mello-Sampaio" 3 => "S. Cardoso-Leão" 4 => "C.P. Oplustil" 5 => "P. Turner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Enferm Infecc Microbiol Clin" "fecha" => "2005" "volumen" => "23" "paginaInicial" => "402" "paginaFinal" => "405" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16159539" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0015028205039464" "estado" => "S300" "issn" => "00150282" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib11" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Deanna L, Gilligan PH. <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span>. En: Murria P, Baron EJ, Jorgensen JH, Pfaller MA, Yhocken RH, editors. Manual of Clinical Microbiology. 8th ed. Washington: American Society for Microbiology; 2003. p.719–8." ] ] ] 11 => array:3 [ "identificador" => "bib12" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "NCCLS Performance Standards for Antimicrobial Susceptibility Testing; fourteenth Informational Supplement M100-S14. Pennsylvania: NCCLS; 2004." ] ] ] 12 => array:3 [ "identificador" => "bib13" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Convenient test for screening metallo-β-lactamase—producing Gram negative bacteria by using thiol compounds" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Arakawa" 1 => "N. Shibata" 2 => "K. Shibayama" 3 => "H. Kurokawa" 4 => "T. Yagi" 5 => "H. Fujiwara" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2000" "volumen" => "38" "paginaInicial" => "40" "paginaFinal" => "43" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10618060" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib14" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dissemination in distinct Brazilian regions of an epidemic carbapenem-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> producing SPM metallo-β-lactamases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A.C. Gales" 1 => "L.C. Menezes" 2 => "S. Silbert" 3 => "H.S. Sader" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jac/dkg416" "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2003" "volumen" => "52" "paginaInicial" => "699" "paginaFinal" => "702" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12951331" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib15" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterization of SPM-1, a novel metallo-β-lactamase isolated in Latin America: report from the sentry antimicrobial surveillance programme" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.A. Toleman" 1 => "A.M. Simm" 2 => "T.A. Murphy" 3 => "A.C. Gales" 4 => "D.J. Biedenbach" 5 => "R.N. Jones" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2002" "volumen" => "50" "paginaInicial" => "673" "paginaFinal" => "679" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12407123" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib16" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of <span class="elsevierStyleItalic">Stenotrophomonas maltophilia</span> isolated from clinical specimens from patients with cystic fibrosis and associated environmental samples" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Denton" 1 => "N.J. Tood" 2 => "K.G. Kerr" 3 => "P.M. Hawkey" 4 => "J.N. Littlewood" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1998" "volumen" => "36" "paginaInicial" => "1953" "paginaFinal" => "1958" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib17" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "F.C. Tenover" 1 => "R.D. Arbeit" 2 => "R.V. Goering" 3 => "P.A. Mickelsen" 4 => "B.E. Murray" 5 => "D.H. Persing" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1995" "volumen" => "33" "paginaInicial" => "2233" "paginaFinal" => "2239" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib18" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metallo-β-lactamases: the quiet before the storm?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T.R. Wash" 1 => "M.A. Toleman" 2 => "L. Poriel" 3 => "P. Nordmann" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.18.2.306-325.2005" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2005" "volumen" => "18" "paginaInicial" => "306" "paginaFinal" => "325" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15831827" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib19" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Metallo-β-lactamases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R.E. Mendes" 1 => "M. Castanheira" 2 => "A.C.C. Pignatari" 3 => "A.C. Gales" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Bras Patol Med Lab" "fecha" => "2006" "volumen" => "42" "paginaInicial" => "103" "paginaFinal" => "113" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib20" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Etiologia de la neumonia associada a ventilación mecânica em um hospital clinico" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C.M. Ruiz" 1 => "P.J. Guerrero" 2 => "P.C. Romero" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Chil Infect" "fecha" => "2007" "volumen" => "24" "paginaInicial" => "131" "paginaFinal" => "136" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib21" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors for imipenem-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span>: a comparative analysis of two case-control studies in hospitalized patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "A.P. Zavascki" 1 => "R.P. Cruz" 2 => "L.Z. Goldani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jhin.2004.09.007" "Revista" => array:6 [ "tituloSerie" => "J Hosp Infect" "fecha" => "2005" "volumen" => "59" "paginaInicial" => "96" "paginaFinal" => "101" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15620442" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib22" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk factors for acquisition of multidrug-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> producing SPM Metallo-β-lactamase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S.A. Nouér" 1 => "M. Nucci" 2 => "M.P. De-Oliveira" 3 => "F.L.P.C. Pellegrino" 4 => "B.M. Moreira" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/AAC.49.9.3663-3667.2005" "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2005" "volumen" => "49" "paginaInicial" => "3663" "paginaFinal" => "3667" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16127037" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib23" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Of <span class="elsevierStyleItalic">Pseudomonas,</span> porins, pumps and carbapenems" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D.M. Livermore" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Antimicrob Chemother" "fecha" => "2001" "volumen" => "47" "paginaInicial" => "247" "paginaFinal" => "250" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11222556" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib24" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Structure of In 31a <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">IMP</span></span> containing <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> integron phyletically related to In5 which carries an unusual array of gene cassettes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Lariki" 1 => "M. Gallenni" 2 => "L. Thamm" 3 => "M.L. Riccio" 4 => "G. Amicosante" 5 => "J.M. Frere" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "1999" "volumen" => "43" "paginaInicial" => "890" "paginaFinal" => "901" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10103196" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib25" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular analysis of metallo-β-lactamase gene <span class="elsevierStyleItalic">bla<span class="elsevierStyleInf">SPM−1</span></span> surrounding sequences from disseminated <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> isolates in Recife, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.M. Poriel" 1 => "M. Magalhaes" 2 => "M. Lopes" 3 => "P. Nordmann" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2004" "volumen" => "48" "paginaInicial" => "406" "paginaFinal" => "409" "itemHostRev" => array:3 [ "pii" => "S0015028201017873" "estado" => "S300" "issn" => "00150282" ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib26" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IMPs, VIMs, SPMs: the diversity of metallo-β-lactamases produced by carbapenem-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> in a Brazilian hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H.S. Sader" 1 => "A.O. Reis" 2 => "S. Silber" 3 => "A.C. Gales" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1469-0691.2004.01031.x" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Infect" "fecha" => "2005" "volumen" => "11" "paginaInicial" => "73" "paginaFinal" => "76" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15649310" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib27" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Looking for risk factors for the acquisition of antibiotic resistance: a 21st-century approach" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D.L. Paterson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/340532" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis" "fecha" => "2002" "volumen" => "34" "paginaInicial" => "1564" "paginaFinal" => "1567" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12032890" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib28" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic and phenotypic variations of a resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> epidemic clone" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D. Hocquet" 1 => "X. Bertrand" 2 => "T. Kohler" 3 => "D. Talon" 4 => "P. Plésiat" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Antimicrob Agents Chemother" "fecha" => "2003" "volumen" => "47" "paginaInicial" => "1887" "paginaFinal" => "1894" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12760863" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib29" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Occurrence of a multidrug-resistant <span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> clone in different hospitals in Rio de Janeiro, Brasil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F.L.P.C. Pellegrino" 1 => "L.M. Teixeira" 2 => "M.G.S. Carvalho" 3 => "A.S. Noúer" 4 => "M.P. Oliveira" 5 => "J.L.M. Sampaio" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2002" "volumen" => "40" "paginaInicial" => "2420" "paginaFinal" => "2424" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12089256" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib30" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Borges LFA, Rocha LA, Gontijo Filho PP. Adesão á pratica de higienização das mãos e sua associação ás taxas de infecção hospitalar em um hospital universitário mineiro. Anais do 2.<span class="elsevierStyleSup">o</span> Congresso Mineiro de Infectologia. 2006. Uberlândia, Minas Gerais, Brazil." ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/0213005X/0000002700000005/v1_201305090137/S0213005X09001220/v1_201305090137/en/main.assets" "Apartado" => array:4 [ "identificador" => "8693" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/0213005X/0000002700000005/v1_201305090137/S0213005X09001220/v1_201305090137/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213005X09001220?idApp=UINPBA00004N" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 November | 1 | 0 | 1 |
2024 October | 12 | 11 | 23 |
2024 September | 20 | 6 | 26 |
2024 August | 22 | 12 | 34 |
2024 July | 15 | 6 | 21 |
2024 June | 9 | 6 | 15 |
2024 May | 7 | 4 | 11 |
2024 April | 15 | 7 | 22 |
2024 March | 28 | 6 | 34 |
2024 February | 16 | 3 | 19 |
2024 January | 17 | 4 | 21 |
2023 December | 19 | 3 | 22 |
2023 November | 26 | 3 | 29 |
2023 October | 22 | 12 | 34 |
2023 September | 17 | 7 | 24 |
2023 August | 15 | 3 | 18 |
2023 July | 15 | 3 | 18 |
2023 June | 22 | 5 | 27 |
2023 May | 13 | 5 | 18 |
2023 April | 8 | 2 | 10 |
2023 March | 11 | 3 | 14 |
2023 February | 13 | 3 | 16 |
2023 January | 7 | 8 | 15 |
2022 December | 15 | 14 | 29 |
2022 November | 26 | 7 | 33 |
2022 October | 21 | 8 | 29 |
2022 September | 21 | 27 | 48 |
2022 August | 18 | 9 | 27 |
2022 July | 21 | 8 | 29 |
2022 June | 17 | 6 | 23 |
2022 May | 20 | 19 | 39 |
2022 April | 38 | 17 | 55 |
2022 March | 24 | 18 | 42 |
2022 February | 11 | 13 | 24 |
2022 January | 23 | 18 | 41 |
2021 December | 28 | 13 | 41 |
2021 November | 20 | 11 | 31 |
2021 October | 23 | 14 | 37 |
2021 September | 13 | 8 | 21 |
2021 August | 13 | 6 | 19 |
2021 July | 48 | 12 | 60 |
2021 June | 26 | 11 | 37 |
2021 May | 21 | 10 | 31 |
2021 April | 21 | 15 | 36 |
2021 March | 20 | 9 | 29 |
2021 February | 28 | 9 | 37 |
2021 January | 20 | 15 | 35 |
2020 December | 12 | 11 | 23 |
2020 November | 17 | 8 | 25 |
2020 October | 18 | 7 | 25 |
2020 September | 28 | 13 | 41 |
2020 August | 24 | 14 | 38 |
2020 July | 14 | 12 | 26 |
2020 June | 17 | 9 | 26 |
2020 May | 23 | 7 | 30 |
2020 April | 14 | 5 | 19 |
2020 March | 15 | 8 | 23 |
2020 February | 18 | 6 | 24 |
2020 January | 18 | 4 | 22 |
2019 December | 20 | 11 | 31 |
2019 November | 13 | 8 | 21 |
2019 October | 12 | 7 | 19 |
2019 September | 17 | 6 | 23 |
2019 August | 23 | 4 | 27 |
2019 July | 13 | 4 | 17 |
2019 June | 22 | 11 | 33 |
2019 May | 72 | 28 | 100 |
2019 April | 24 | 19 | 43 |
2019 March | 4 | 7 | 11 |
2019 February | 5 | 6 | 11 |
2019 January | 7 | 9 | 16 |
2018 December | 6 | 15 | 21 |
2018 November | 6 | 3 | 9 |
2018 October | 14 | 14 | 28 |
2018 September | 17 | 5 | 22 |
2018 August | 2 | 2 | 4 |
2018 July | 9 | 9 | 18 |
2018 June | 4 | 1 | 5 |
2018 May | 9 | 10 | 19 |
2018 April | 5 | 0 | 5 |
2018 March | 2 | 3 | 5 |
2018 February | 5 | 1 | 6 |
2018 January | 4 | 0 | 4 |
2017 December | 5 | 4 | 9 |
2017 November | 10 | 3 | 13 |
2017 October | 4 | 2 | 6 |
2017 September | 9 | 10 | 19 |
2017 August | 14 | 1 | 15 |
2017 July | 10 | 3 | 13 |
2017 June | 15 | 8 | 23 |
2017 May | 29 | 3 | 32 |
2017 April | 20 | 3 | 23 |
2017 March | 18 | 14 | 32 |
2017 February | 9 | 3 | 12 |
2017 January | 13 | 2 | 15 |
2016 December | 18 | 4 | 22 |
2016 November | 15 | 4 | 19 |
2016 October | 46 | 3 | 49 |
2016 September | 25 | 6 | 31 |
2016 August | 25 | 6 | 31 |
2016 July | 11 | 2 | 13 |
2016 June | 27 | 9 | 36 |
2016 May | 18 | 12 | 30 |
2016 April | 9 | 25 | 34 |
2016 March | 14 | 15 | 29 |
2016 February | 20 | 12 | 32 |
2016 January | 18 | 15 | 33 |
2015 December | 18 | 15 | 33 |
2015 November | 23 | 17 | 40 |
2015 October | 11 | 10 | 21 |
2015 September | 18 | 12 | 30 |
2015 August | 7 | 3 | 10 |
2015 July | 12 | 1 | 13 |
2015 June | 6 | 2 | 8 |
2015 May | 11 | 4 | 15 |
2015 April | 8 | 3 | 11 |
2015 March | 6 | 14 | 20 |
2015 February | 18 | 9 | 27 |
2015 January | 22 | 2 | 24 |
2014 December | 42 | 3 | 45 |
2014 November | 29 | 3 | 32 |
2014 October | 38 | 1 | 39 |
2014 September | 30 | 1 | 31 |
2014 August | 24 | 2 | 26 |
2014 July | 49 | 1 | 50 |
2014 June | 28 | 0 | 28 |
2014 May | 33 | 2 | 35 |
2014 April | 26 | 2 | 28 |
2014 March | 19 | 0 | 19 |
2014 February | 21 | 2 | 23 |
2014 January | 20 | 2 | 22 |
2013 December | 32 | 1 | 33 |
2013 November | 27 | 8 | 35 |
2013 October | 43 | 25 | 68 |
2013 September | 28 | 11 | 39 |
2013 August | 33 | 5 | 38 |
2013 July | 19 | 3 | 22 |
2009 April | 1086 | 0 | 1086 |