was read the article
array:23 [ "pii" => "S0213485321001274" "issn" => "02134853" "doi" => "10.1016/j.nrl.2021.08.002" "estado" => "S300" "fechaPublicacion" => "2024-05-01" "aid" => "1658" "copyright" => "Sociedad Española de Neurología" "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Neurologia. 2024;39:321-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:17 [ "pii" => "S0213485321001286" "issn" => "02134853" "doi" => "10.1016/j.nrl.2021.08.003" "estado" => "S300" "fechaPublicacion" => "2024-05-01" "aid" => "1659" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Neurologia. 2024;39:329-39" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Anticonvulsant effects of <span class="elsevierStyleItalic">Paeonia daurica</span> subsp. <span class="elsevierStyleItalic">macrophylla</span> root extracts in pentylenetetrazol-induced seizure models in mice" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "329" "paginaFinal" => "339" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Efectos anticonvulsivos de <span class="elsevierStyleItalic">Paeonia daurica</span> subsp. <span class="elsevierStyleItalic">macrophylla</span> extractos de raíz en modelos de convulsiones inducidas por pentilentetrazol en ratones" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3825 "Ancho" => 2667 "Tamanyo" => 627899 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Schematic diagram for anticonvulsant experiment of <span class="elsevierStyleItalic">P. daurica</span> subsp. <span class="elsevierStyleItalic">macrophylla</span> root extracts in PTZ models in mice.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "E. Tahmasebi, H. Monsef-Esfahani, M. Vazirian, P. Sharafi-Badr, M. Sharifzadeh, S.N. Sadati Lamardi" "autores" => array:6 [ 0 => array:2 [ "nombre" => "E." "apellidos" => "Tahmasebi" ] 1 => array:2 [ "nombre" => "H." "apellidos" => "Monsef-Esfahani" ] 2 => array:2 [ "nombre" => "M." "apellidos" => "Vazirian" ] 3 => array:2 [ "nombre" => "P." "apellidos" => "Sharafi-Badr" ] 4 => array:2 [ "nombre" => "M." "apellidos" => "Sharifzadeh" ] 5 => array:2 [ "nombre" => "S.N." "apellidos" => "Sadati Lamardi" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213485321001286?idApp=UINPBA00004N" "url" => "/02134853/0000003900000004/v1_202404170527/S0213485321001286/v1_202404170527/en/main.assets" ] "itemAnterior" => array:17 [ "pii" => "S0213485321001250" "issn" => "02134853" "doi" => "10.1016/j.nrl.2021.07.004" "estado" => "S300" "fechaPublicacion" => "2024-05-01" "aid" => "1656" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Neurologia. 2024;39:315-20" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Factors affecting resolution of oculomotor nerve palsy following endovascular embolization of posterior communicating artery aneurysms" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "315" "paginaFinal" => "320" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Factores que influyen en el tratamiento de la parálisis oculomotora con embolización endovascular de aneurismas comunicantes posteriores" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "C.G. Chen, J.W. Wang, J.F. Li, C.H. Li, B.L. Gao" "autores" => array:5 [ 0 => array:2 [ "nombre" => "C.G." "apellidos" => "Chen" ] 1 => array:2 [ "nombre" => "J.W." "apellidos" => "Wang" ] 2 => array:2 [ "nombre" => "J.F." "apellidos" => "Li" ] 3 => array:2 [ "nombre" => "C.H." "apellidos" => "Li" ] 4 => array:2 [ "nombre" => "B.L." "apellidos" => "Gao" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213485321001250?idApp=UINPBA00004N" "url" => "/02134853/0000003900000004/v1_202404170527/S0213485321001250/v1_202404170527/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Novel multifunctional nanoliposomes inhibit α-synuclein fibrillization, attenuate microglial activation, and silence the expression of <span class="elsevierStyleItalic">SNCA</span> gene" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "321" "paginaFinal" => "328" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "A. Jebali, M. Rashidi, R. Keikha, K. Daliri, T.F. Outeiro" "autores" => array:5 [ 0 => array:4 [ "nombre" => "A." "apellidos" => "Jebali" "email" => array:1 [ 0 => "alijebal2011@gmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "M." "apellidos" => "Rashidi" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 2 => array:4 [ "nombre" => "R." "apellidos" => "Keikha" "email" => array:1 [ 0 => "reza.23.md@gmail.com" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0025" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 3 => array:3 [ "nombre" => "K." "apellidos" => "Daliri" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">f</span>" "identificador" => "aff0030" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">g</span>" "identificador" => "aff0035" ] ] ] 4 => array:3 [ "nombre" => "T.F." "apellidos" => "Outeiro" "referencia" => array:4 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">h</span>" "identificador" => "aff0040" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">i</span>" "identificador" => "aff0045" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">j</span>" "identificador" => "aff0050" ] 3 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">k</span>" "identificador" => "aff0055" ] ] ] ] "afiliaciones" => array:11 [ 0 => array:3 [ "entidad" => "Department of Medical Nanotechnology, Faculty of Advanced Sciences and Technology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Department of Pharmacology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "The Health of Plant and Livestock Products Research Center, Mazandaran University of Medical Sciences, Sari, Iran" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Infectious Diseases and Tropical Medicine Research Center, Resistant Tuberculosis Institute, Zahedan University of Medical Sciences, Zahedan, Iran" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Department of Pathology, Faculty of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Child Development Center, Shiraz University of Medical Sciences, Shiraz, Iran" "etiqueta" => "f" "identificador" => "aff0030" ] 6 => array:3 [ "entidad" => "Institute of Biomedical Sciences, Dehkadeh Salamat Faroq, Faroq, Fars, Iran" "etiqueta" => "g" "identificador" => "aff0035" ] 7 => array:3 [ "entidad" => "Department of Experimental Neurodegeneration, Center for Biostructural Imaging of Neurodegeneration, University Medical Center Gottingen, Gottingen, Germany" "etiqueta" => "h" "identificador" => "aff0040" ] 8 => array:3 [ "entidad" => "Max Planck Institute for Experimental Medicine, Göttingen, Germany" "etiqueta" => "i" "identificador" => "aff0045" ] 9 => array:3 [ "entidad" => "Translational and Clinical Research Institute, Faculty of Medical Sciences, Newcastle University, NE2 4HH, United Kingdom" "etiqueta" => "j" "identificador" => "aff0050" ] 10 => array:3 [ "entidad" => "Scientific employee with an honorary contract at German Center for Neurodegenerative Diseases (DZNE), Göttingen, Germany" "etiqueta" => "k" "identificador" => "aff0055" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Nuevos nanoliposomas multifuncionales inhiben la fibrilización de la α-sinucleína, atenúan la activación de la microglía y silencian la expresión de SNCA" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2189 "Ancho" => 2917 "Tamanyo" => 503312 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">The effect of PNL1 (a), PNL2 (b), PNL3 (c), PNL4 (d), and PNL5 (e) on α-syn fibrillization by ThT kinetic fibrillization assay. Endpoint ThT results for different concentrations of PNLs (f). TEM images showed the inhibition of fibrillization by PNL1 and PNL2 (g). As seen, very low fibrils were seen when α-syn treated with PNL1 and PNL2 at a concentration of 1%, 2%, and 4% for 60<span class="elsevierStyleHsp" style=""></span>h. The scale bar is 100<span class="elsevierStyleHsp" style=""></span>nm Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>3; *<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was α-syn alone without PNLs.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Synucleinopathies are a group of neurodegenerative diseases characterized by the accumulation of α-synuclein (α-syn) in intra-cytoplasmic inclusions in neurons and/or in glial cells.<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">1</span></a> Parkinson's disease (PD), dementia with Lewy bodies, and multiple system atrophy are examples of synucleinopathy.<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">2</span></a> The physiological role of α-syn in neurodegenerative disorders is unclear and more studies are needed.<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">3</span></a> The aggregation process is complex and involves the formation of various types of oligomers, intermediate supramolecular assemblies, and amyloid fibrils.<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">4</span></a> The fibrils are linear rods with 5–10<span class="elsevierStyleHsp" style=""></span>nm in diameter and several micrometers in length. Importantly, oligomeric α-syn intermediates, produced at early stages of α-syn aggregation, appear to be the most toxic species.<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">5</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">A main important problem of synucleinopathies is neuroinflammation, associated with microglial activation.<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">6</span></a> Under normal conditions, microglia remove cell debris and foreign biomolecules.<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">7</span></a> But the high concentration of α-syn leads to impair of α-syn clearance pathway and induces a pro-inflammatory microglial phenotype.<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">8</span></a> The release of pro-inflammatory mediators, such as tumor necrosis factor (TNF-a), interleukin-6 (IL-6), nitric oxide (NO), reactive oxygen species (ROS), and toxic protein aggregates, are the results of microglial activation.<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">9</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">We posit that, in order to efficiently treat synucleinopathies, α-syn must be targeted at various stages,<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">10</span></a> including (1) reducing α-syn synthesis, (2) increasing α-syn degradation, (3) reducing α-syn aggregation, (4) blocking α-syn propagation, (5) activating immune cells against α-syn, and (6) inhibiting neuroinflammation. It should be noted that, although it is difficult to target all pathways, some of them may be targeted by multifunctional nanoparticles. With new advances in medical nanotechnology over the last years, it can be argued that in the near future, it will be possible to treat synucleinopathies using nanoparticles. There are now some data showing that some nanoparticles, i.e. antioxidant nanoparticles,<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">11</span></a> zwitterionic nanoliposomes,<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">12</span></a> cerium oxide nanoparticles,<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">13</span></a> gold nanoparticles,<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">14</span></a> and PEGlated nanoliposome <a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">15</span></a> are able to inhibit α-syn fibrillization, reduce α-Syn toxicity, and attenuate microglial activation. These nanoparticles may be a part of future therapeutic alternative.</p><p id="par0020" class="elsevierStylePara elsevierViewall">The aim of this study was to compare five types of multifunctional nanoliposomes for their abilities to inhibit α-syn fibrillization, to attenuate microglial activation, and to silence the <span class="elsevierStyleItalic">SNCA</span> gene.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Synthesis and characterization of nanoliposomes</span><p id="par0025" class="elsevierStylePara elsevierViewall">In this study, 5 types of nanoliposomes were synthesized and characterized, including:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">1.</span><p id="par0030" class="elsevierStylePara elsevierViewall">PEGlated nanoliposomes 1 (PNL1) containing sodium percarbonate (SPC) (Merk, Germany), 1,2-dioleoyl-3-trimethylammonium propane (DOTAP) (Merk, Germany), 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine-polyethylene glycol-2000 (DSPE-PEG-2000) (Merk, Germany), carboxy-PEG (Merk, Germany), omega-3 (Merk, Germany), mannitol (Merk, Germany), 7-hydroxyflavone (Merk), and antisense oligonucleotides (Bioneer, South Korea).</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">2.</span><p id="par0035" class="elsevierStylePara elsevierViewall">PEGlated nanoliposomes 2 (PNL2) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, omega-3, mannitol, and 7-hydroxyflavone.</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">3.</span><p id="par0040" class="elsevierStylePara elsevierViewall">PEGlated nanoliposomes 3 (PNL3) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, omega-3, and mannitol.</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">4.</span><p id="par0045" class="elsevierStylePara elsevierViewall">PEGlated nanoliposomes 4 (PNL4) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, and omega-3.</p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel">5.</span><p id="par0050" class="elsevierStylePara elsevierViewall">PEGlated nanoliposomes 5 (PNL5) containing SPC, DOTAP, DSPE-PEG-2000, and carboxy-PEG.</p></li></ul></p><p id="par0055" class="elsevierStylePara elsevierViewall">To synthesize PNLs, reverse-phase evaporation method was used.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">16</span></a> Briefly, SPC, DOTAP, DSPE-PEG-2000, and carboxy-PEG were dissolved in chloroform, and then omega-3, mannitol, 7-hydroxyflavone, and antisense oligonucleotides (5′-CTACATAGAGAACAC-3′) were separately added based on each formulation. The mixture was hardly mixed and homogenized using a probe ultrasound. The pulse was 5<span class="elsevierStyleHsp" style=""></span>s, 2<span class="elsevierStyleHsp" style=""></span>s off, 100% amplitude, and 36<span class="elsevierStyleHsp" style=""></span>joles per pulse. Subsequently, the chloroform was evaporated by a rotary vacuum pump. To hydrate PNLs, PBS was used and their concentrations were adjusted to 1%, 2%, and 4%. Finally, their size distribution was measured by dynamic light scattering (DLS) and their stability was checked until one week at 25<span class="elsevierStyleHsp" style=""></span>°C.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Kinetic of α-syn fibrillization</span><p id="par0060" class="elsevierStylePara elsevierViewall">First, 100<span class="elsevierStyleHsp" style=""></span>μL of PNLs at concentration of 1%, 2%, and 4% was separately incubated with 100<span class="elsevierStyleHsp" style=""></span>μL of 100<span class="elsevierStyleHsp" style=""></span>nM recombinant monomeric α-syn (Sigma-Aldrich) in presence of Thioflavin T (ThT) (Acros Organics) for 60<span class="elsevierStyleHsp" style=""></span>min at 37<span class="elsevierStyleHsp" style=""></span>°C, as previously described.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">17</span></a> The α-syn fibrillization was assessed each 20<span class="elsevierStyleHsp" style=""></span>min at the emission wavelength of 490<span class="elsevierStyleHsp" style=""></span>nm and the excitation wavelength of 450<span class="elsevierStyleHsp" style=""></span>nm</p><p id="par0065" class="elsevierStylePara elsevierViewall">Also, after incubation of PNLs with recombinant monomeric α-syn for 60<span class="elsevierStyleHsp" style=""></span>min, 50<span class="elsevierStyleHsp" style=""></span>μL of each mixture was separately placed on a Butvar-coated copper grid, dried, and then negatively stained by uranyl acetate (1.0%, w/v). Here, a transmission electron microscopy (TEM) (Zeiss EM10, Germany) with an excitation voltage of 100<span class="elsevierStyleHsp" style=""></span>kV was applied to observe and compared the size and morphology of α-syn aggregates.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Microglia activation</span><p id="par0070" class="elsevierStylePara elsevierViewall">BV2 microglia were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (Atlanta Biologics) and 1% Penicillin-Streptomycin (Merck, Germany). Then, they were plated at 50,000<span class="elsevierStyleHsp" style=""></span>cells/well in a 96-well plate to adhere overnight. Cells were first treated with 100<span class="elsevierStyleHsp" style=""></span>nM A53T α-syn and then with PNLs at a final concentration of 1%, 2%, and 4%. After 24<span class="elsevierStyleHsp" style=""></span>h, supernatants were collected and assayed for TNF-a and IL-6 by ELISA kit (R&D systems) as previously described.<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">11</span></a> Briefly, the high binding ELISA plates (Biomat, Italy) were separately coated with anti-TNF-a IgG and anti-IL-6 IgG (R&D systems) at 1<span class="elsevierStyleHsp" style=""></span>μg<span class="elsevierStyleHsp" style=""></span>mL<span class="elsevierStyleSup">−1</span>. After washing, 50<span class="elsevierStyleHsp" style=""></span>μL of supernatants was added and incubated for 1<span class="elsevierStyleHsp" style=""></span>h at 37<span class="elsevierStyleHsp" style=""></span>°C. Then, plates were washed and 100<span class="elsevierStyleHsp" style=""></span>μL of secondary antibody (anti-TNF-a IgG and anti-IL-6 IgG (R&D systems)) was added. After incubation and washes, 50<span class="elsevierStyleHsp" style=""></span>μL of 3,3′, 5,5′-tetramethylbenzidine was added and then stopped by a stopping solution. Finally, the absorbance of each well was read by a Spectrophotometer at 450<span class="elsevierStyleHsp" style=""></span>nm (BioTek Industries) and the concentration of TNF-a and IL-6 was calculated using standard curve.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Expression of <span class="elsevierStyleItalic">SNCA</span></span><p id="par0075" class="elsevierStylePara elsevierViewall">To quantify the expression of <span class="elsevierStyleItalic">SNCA</span> at mRNA level, BV2 microglia cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% Penicillin-Streptomycin, plated, and treated with PNLs at a final concentration of 1%, 2%, and 4% for 24<span class="elsevierStyleHsp" style=""></span>h. Then, total RNA was extracted by extraction buffer (QIAGEN) and then cDNA was synthesized by cDNA mastermix (Life Technologies). Finally, quantitative real-time PCR was performed on an ABI real-time PCR system using qPCR Master Mix (Life Technologies). The <span class="elsevierStyleItalic">GAPDH</span> was used as a reference gene and the delta-delta CT formula was applied to evaluate the relative expression. The primers used in this study are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0080" class="elsevierStylePara elsevierViewall">To quantify the expression of <span class="elsevierStyleItalic">SNCA</span> at the protein level, BV2 microglia cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% Penicillin-Streptomycin, plated, and treated with PNLs at a final concentration of 1%, 2%, and 4% for 24<span class="elsevierStyleHsp" style=""></span>h. Cell lysates were mixed with Laemlli sample buffer, boiled, and separated on polyacrylamide gel (Thermo Fisher Scientific). After protein transfer to polyvinylidene fluoride membranes (Thermo Fisher Scientific), the blots were probed with the primary antibodies (α-syn (BD Transduction Laboratories) and beta-actin (Millipore)), visualized with secondary antibodies, HRP-conjugated anti-mouse IgG (GE Healthcare), and developed using ECL Prime Western Blotting Detection Reagent. The signals of immunoblots were recorded with a Chemidoc Touch Imaging System. Images of blots were cropped from different parts of the same gel for densitometry analysis.</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">In vivo assessment</span><p id="par0085" class="elsevierStylePara elsevierViewall">For this part of the study, we used α-syn transgenic mouse model (<a href="https://qpsneuro.com/in">https://qpsneuro.com/in</a> vivo-services/animal-models/alpha-synuclein-transgenic-mouse-models) to check the efficacy of PNLs. Briefly, transgenic mice were separately treated with 100<span class="elsevierStyleHsp" style=""></span>μL of PNLs 1–5 at a concentration of 4% which taken orally for 5 days. After treatment period, all mice were killed under high dose of anesthesia and then their brains were removed. Then, tissue sections were prepared and fixed. After passing from the serial dilutions of alcohols, the slides were immersed in distilled water and then antigen retrieval was carried out by microwaving in the citric acid buffer. In the next step, 50<span class="elsevierStyleHsp" style=""></span>μL of primary antibody (anti-α-syn IgG (BD Transduction Laboratories)) were added and incubated for 12<span class="elsevierStyleHsp" style=""></span>h. After washing, 50<span class="elsevierStyleHsp" style=""></span>μL of the secondary antibody (FITC-conjugated anti-mouse IgG (GE Healthcare)) were added and incubated for 3<span class="elsevierStyleHsp" style=""></span>h. Finally, the slides were examined by a fluorescent microscopy. The amount of α-syn accumulation was scored and finally normalized to control. To evaluate the neuroinflammation, cerebrospinal fluid (CSF) of mice was used. After treatment of mice, the concentration of TNF-a and IL-6 in CSF was evaluated by ELISA kit (R&D systems) as previously described.<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">11</span></a> To evaluate the expression of <span class="elsevierStyleItalic">SNCA</span>, several pieces of brain were cut and hardly crushed by a mechanical pressure. In the next step, the mixture was centrifuged at 5000<span class="elsevierStyleHsp" style=""></span>RPM for 5<span class="elsevierStyleHsp" style=""></span>min and the supernatant is separated for the evaluation of <span class="elsevierStyleItalic">SNCA</span> expression at both mRNA and protein by real-time PCR and Western blot with above mentioned details.</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0090" class="elsevierStylePara elsevierViewall">Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD with 3 independent repeats (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>3) for in vitro experiments and with 5 independent biological repeats for in vivo experiments. Analysis of different study groups was performed using one-way ANOVA with Tukey's post hoc test with <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05.</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Results</span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Characterization of PNLs</span><p id="par0095" class="elsevierStylePara elsevierViewall">The size distribution of all synthesized PNLs was approximately between 120 and 130<span class="elsevierStyleHsp" style=""></span>nm and all of them were stable during one week at 25<span class="elsevierStyleHsp" style=""></span>°C.</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">The inhibition of α-syn fibrillization</span><p id="par0100" class="elsevierStylePara elsevierViewall">First we explored the effect of PNLs on α-syn fibrillization using a standard ThT kinetic fibrillization assay. We found that all PNLs shortened the α-syn growth phase, suggesting inhibition of α-syn fibrillization (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>a–e). Importantly, the endpoint ThT assay showed both PNL1 and PNL2 had significantly less fibrillization when compared with other PNLs (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>f).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0105" class="elsevierStylePara elsevierViewall">After incubation of PNLs with recombinant monomeric α-syn, they were negatively stained by uranyl acetate and observed by TEM at 100<span class="elsevierStyleHsp" style=""></span>kV. The inhibition of α-syn fibrillization was also seen when monomeric α-syn incubated with PNL1 or PNL2 at concentration of 1%, 2%, and 4%. In other treated groups, we saw high degrees of fibrillization (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>g).</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Attenuation of microglial activation</span><p id="par0110" class="elsevierStylePara elsevierViewall">Activation of microglia leads to the release of inflammatory agents which particularly are harmful for neurons.<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">18</span></a> Here, we investigated the effect of PNLs on the production of TNF-a and IL-6 when microglial cells exposed to 100<span class="elsevierStyleHsp" style=""></span>nM α-syn. It was found that the production of TNF-a (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>a), and IL-6 (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>b) was significantly decreased when microglial cells were treated with PNL1 or PNL2 at concentrations of 1%, 2%, and 4%.</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Silencing of <span class="elsevierStyleItalic">SNCA</span> expression</span><p id="par0115" class="elsevierStylePara elsevierViewall">The expression of <span class="elsevierStyleItalic">SNCA</span> at the mRNA level was significantly decreased when BV2 microglia cells were treated with PNL1 or PNL2 (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>c). Also, the expression <span class="elsevierStyleItalic">of SNCA</span> at the protein level was significantly decreased when BV2 microglia cells were treated with PNL1 or PNL2 (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>d).</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">In vivo evaluation of the efficacy of PNLs</span><p id="par0120" class="elsevierStylePara elsevierViewall">Based on in vivo experiments, we confirmed the inhibition of α-syn fibrillization, attenuation of microglial activation, and silencing of <span class="elsevierStyleItalic">SNCA</span> in α-syn transgenic mice when treated with PNL1 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>a) or PNL2 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>b) at concentration of 4%. Importantly, we could not confirm the efficacy of PNL3 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>c), PNL4 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>d), and PNL5 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>e), suggesting these are not good candidates.</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Discussion</span><p id="par0125" class="elsevierStylePara elsevierViewall">Finding a chemical compound that can act as a drug for a specific disease is not an easy task and requires many studies and numerous laboratory tests. In the most diseases, several pathways are involved and each pathway must be edited or modified by chemical molecules. In synucleinopathies, several pathways are impaired and their causative agents have not been discovered yet.<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">19</span></a> The problem starts with the fact that the expression of <span class="elsevierStyleItalic">SNCA</span> is increased for unknown reasons and then α-syn forms fibrils, which are toxic for nerve cells.<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">20</span></a> On the other hand, they cause neuroinflammation at the site of accumulation.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">21</span></a> Based on review literature, various strategies can be considered for the treatment of synucleinopathies.<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">10</span></a> First, the overexpression of <span class="elsevierStyleItalic">SNCA</span> must be prevented. The next step is to inhibit aggregation and forming fibril molecules. Another strategy is to decrease neuroinflammation, caused by α-syn molecules and fibrils. With this explanation, it is clear that finding a drug molecule that can affect all of these pathways is very difficult and maybe impossible. Different molecules with different functions can be put inside a nanoliposome and it is possible that different molecules may interact with each other and reduce effects. Contrary, it is also possible that different molecules have a synergistic effect and create a more effective drug.</p><p id="par0130" class="elsevierStylePara elsevierViewall">In this study, we have developed a similar strategy. We synthesized five multifunctional nanoliposomes with different functional molecules. Previous studies had shown that mannitol<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">22</span></a> and 7-hydroxyflavone<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">23</span></a> have a good ability to inhibit α-syn aggregation. Also, the omega-3 molecule is a powerful anti-inflammatory agent<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">24</span></a> and antisense oligonucleotides suppress the expression of <span class="elsevierStyleItalic">SNCA.</span><a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">25</span></a> In this study, we found that if all functional molecules are included together, they have a very strong effect and can simultaneously inhibit aggregation of α-syn, silence <span class="elsevierStyleItalic">SNCA</span> gene, and attenuate neuroinflammation. An important point is the difference between PNL1 and PNL2. This study showed that although both PNL1 and PNL2 were significantly effective compared with other PNLs, the efficiency of PNL2 was higher than PNL1. We think that the reason for this phenomenon is that some molecules are incompatible with each other and their accumulation does not cause synergy. It can be said that the addition of antisense oligonucleotides slightly affects the function of other molecules. On the other hand, with a closer look at the results of PNL4 and PNL3, we will find an interesting phenomenon. We found that although these nanoliposomes have omega-3 and/or mannitol, they did not lead to inhibit α-syn aggregation or attenuate neuroinflammation, indicating that the presence of all compounds is necessary for maximum effect. Regarding PNL5, it should be noted that although this nanoliposome did not have any functional molecules, it could slightly inhibit α-syn aggregation, neuroinflammation, and <span class="elsevierStyleItalic">SNCA</span> expression.</p><p id="par0135" class="elsevierStylePara elsevierViewall">Zhao et al. showed that antioxidant nanoparticles inhibit α-syn fibrillization and attenuate microglial activation.<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">11</span></a> This study is an example that showed us a nanotherapeutic candidate can target both protein aggregation and neuroinflammation in neurodegenerative diseases. Zwitterionic nanoliposomes were also used to inhibit neurotoxic α-syn aggregation in PD. The effect of neutral (zwitterionic) nanoliposomes, supplemented with cholesterol and decorated with PEG, on α-syn aggregation and neurotoxicity was reported by Aliakbari et al., <a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">12</span></a> cerium oxide nanoparticles<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">13</span></a> and gold nanoparticles<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">14</span></a> also could inhibit α-syn aggregation. Previously, Jebali et al. also showed that PEGlated nanoliposome could attenuate inflammatory response in mice model of multiple sclerosis.<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">15</span></a></p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conclusion</span><p id="par0140" class="elsevierStylePara elsevierViewall">Taken together, this study showed that PNL1 and PNL2 could significantly inhibit α-syn fibrillization, attenuate microglial activation, and silence <span class="elsevierStyleItalic">SNCA</span> gene, when compared with other PNLs. We hypothesize that, in the future, clinical trials using PNL1 and PNL2 should be considered for the treatment of synucleinopathies.</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Ethical approval</span><p id="par0145" class="elsevierStylePara elsevierViewall">All experiments were performed under the guidelines of the National Institute of Health, the provisions of the Declaration of Helsinki, and the National Ethics Committee of Medical Science.</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Funding</span><p id="par0150" class="elsevierStylePara elsevierViewall">The main parts of the study were financially supported by Zahedan University of Medical Sciences, Zahedan, Iran (Grant number: 9936 and 9937). Also, some parts were financed by the internal budget of the authors.</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Competing interests</span><p id="par0155" class="elsevierStylePara elsevierViewall">The authors have no conflicts of interest to declare.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:14 [ 0 => array:3 [ "identificador" => "xres2130755" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1809590" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres2130754" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1809589" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Synthesis and characterization of nanoliposomes" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Kinetic of α-syn fibrillization" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Microglia activation" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Expression of SNCA" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "In vivo assessment" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0045" "titulo" => "Results" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0050" "titulo" => "Characterization of PNLs" ] 1 => array:2 [ "identificador" => "sec0055" "titulo" => "The inhibition of α-syn fibrillization" ] 2 => array:2 [ "identificador" => "sec0060" "titulo" => "Attenuation of microglial activation" ] 3 => array:2 [ "identificador" => "sec0065" "titulo" => "Silencing of SNCA expression" ] 4 => array:2 [ "identificador" => "sec0070" "titulo" => "In vivo evaluation of the efficacy of PNLs" ] ] ] 7 => array:2 [ "identificador" => "sec0075" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0080" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0085" "titulo" => "Ethical approval" ] 10 => array:2 [ "identificador" => "sec0090" "titulo" => "Funding" ] 11 => array:2 [ "identificador" => "sec0095" "titulo" => "Competing interests" ] 12 => array:2 [ "identificador" => "xack739369" "titulo" => "Acknowledgements" ] 13 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2021-07-13" "fechaAceptado" => "2021-08-05" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1809590" "palabras" => array:4 [ 0 => "Nanoliposomes" 1 => "Synuclein fibrillization" 2 => "Microglial activation" 3 => "<span class="elsevierStyleItalic">SNCA</span>" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1809589" "palabras" => array:4 [ 0 => "Nanoliposomas" 1 => "Fibrilización de sinucleína" 2 => "Activación microglial" 3 => "SNCA" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">The aim of this study was to compare the effect of five types of PEGlated nanoliposomes (PNLs) on α-synuclein (α-syn) fibrillization, attenuation of microglial activation, and silence of the <span class="elsevierStyleItalic">SNCA</span> gene, which encodes α-syn.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">To evaluate the inhibition of α-syn fibrillization, we used standard in vitro assay based on Thioflavin T (ThT) fluorescence. Next, to evaluate the attenuation of microglial activation, the concentration of TNF-a and IL-6 was quantified by ELISA assay in BV2 microglia cells treated with 100<span class="elsevierStyleHsp" style=""></span>nM A53T α-syn and PNLs. In order to determine the silencing of the <span class="elsevierStyleItalic">SNCA</span>, real-time PCR and Western blot analysis was used. Finally, the efficacy of PNLs was confirmed in a transgenic mouse model expressing human α-syn.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">ThT assay showed both PNL1 and PNL2 significantly inhibited a-syn fibrillization. ELISA test also showed the production of TNF-a and IL-6 was significantly attenuated when microglial cells treated with PNL1 or PNL2. We also found that <span class="elsevierStyleItalic">SNCA</span> gene, at both mRNA and protein levels, was significantly silenced when BV2 microglia cells were treated with PNL1 or PNL2. Importantly, the efficacy of PNL1 and PNL2 was finally confirmed in vivo in a transgenic mouse model.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">In conclusion, the novel multifunctional nanoliposomes tested in our study inhibit α-syn fibrillization, attenuate microglial activation, and silence <span class="elsevierStyleItalic">SNCA</span> gene<span class="elsevierStyleItalic">.</span> Our findings suggest the therapeutic potential of PNL1 and PNL2 for treating synucleinopathies.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducción</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">El objetivo de este estudio fue comparar el efecto de cinco tipos de nanoliposomas PEGlados (PNL) sobre la fibrilización de la α-sinucleína (α-syn), la atenuación de la activación microglial y el silencio del gen synuclein alpha (SNCA), que codifica α-syn.</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Métodos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Para evaluar la inhibición de la fibrilización α-syn, utilizamos un ensayo <span class="elsevierStyleItalic">in vitro</span> estándar basado en la fluorescencia de la tioflavina T (ThT). A continuación, para evaluar la atenuación de la activación microglial, se cuantificó la concentración de factor de necrosis tumoral alpha (TNF-a) e interleucina 6 (IL-6)mediante ensayo ELISA en células de microglía BV2 tratadas con 100<span class="elsevierStyleHsp" style=""></span>nM de α-syn de A53T y PNL. Para determinar el silenciamiento del SNCA, se utilizó reacción en cadena de la polimerasa (PCR) en tiempo real y análisis de Western blot. Finalmente, la eficacia de las PNL se confirmó en un modelo de ratón transgénico que expresa α-syn humana.</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El ensayo ThT mostró que tanto PNL1 como PNL2 inhibieron significativamente la fibrilización de α-syn. La prueba enzyme-linked immunosorbent assay (ELISA) también mostró que la producción de TNF-a e IL-6 se atenuó significativamente cuando las células microgliales se trataron con PNL1 o PNL2. También encontramos que el gen SNCA, tanto a nivel de ARN mensajero (ARNm) como de proteína, se silenciaba significativamente cuando las células de microglía BV2 se trataban con PNL1 o PNL2. Es importante destacar que la eficacia de PNL1 y PNL2 finalmente se confirmó <span class="elsevierStyleItalic">in vivo</span> en un modelo de ratón transgénico.</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusiones</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Los nuevos nanoliposomas multifuncionales probados en nuestro estudio inhiben la fibrilización α-syn, atenúan la activación microglial y silencian el gen SNCA. Nuestros hallazgos sugieren el potencial terapéutico de PNL1 y PNL2 para el tratamiento de sinucleinopatías.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] ] "multimedia" => array:4 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2189 "Ancho" => 2917 "Tamanyo" => 503312 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">The effect of PNL1 (a), PNL2 (b), PNL3 (c), PNL4 (d), and PNL5 (e) on α-syn fibrillization by ThT kinetic fibrillization assay. Endpoint ThT results for different concentrations of PNLs (f). TEM images showed the inhibition of fibrillization by PNL1 and PNL2 (g). As seen, very low fibrils were seen when α-syn treated with PNL1 and PNL2 at a concentration of 1%, 2%, and 4% for 60<span class="elsevierStyleHsp" style=""></span>h. The scale bar is 100<span class="elsevierStyleHsp" style=""></span>nm Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>3; *<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was α-syn alone without PNLs.</p>" ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1481 "Ancho" => 2500 "Tamanyo" => 365299 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Production of TNF-a (a), and IL-6 (b) when microglial cells were first exposed to 100<span class="elsevierStyleHsp" style=""></span>nM α-syn and then treated with PNLs. The expression of <span class="elsevierStyleItalic">SNCA</span> mRNA (c) and <span class="elsevierStyleItalic">SNCA</span> protein (d) when microglial cells were treated with PNLs for 24<span class="elsevierStyleHsp" style=""></span>h. Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>3; *<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was microglial cells were exposed to 100<span class="elsevierStyleHsp" style=""></span>nM α-syn and did not treat with PNLs.</p>" ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2536 "Ancho" => 2917 "Tamanyo" => 424793 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Levels of α-syn fibrillization, TNF-a, IL-6, <span class="elsevierStyleItalic">SNCA</span> mRNA, and <span class="elsevierStyleItalic">SNCA</span> protein in α-syn transgenic mouse model when treated with PNL1 (a), PNL2 (b), PNL3 (c), PNL4 (d), and PNL5 (e) for 5 days. Data are presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5; *<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was α-syn transgenic mouse model which was not treated with PNLs.</p>" ] ] 3 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer sequence (5′<span class="elsevierStyleHsp" style=""></span>→<span class="elsevierStyleHsp" style=""></span>3′)<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer sequence (5′<span class="elsevierStyleHsp" style=""></span>→<span class="elsevierStyleHsp" style=""></span>3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product length (bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">SNCA</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ATTCGACGACAGTGTGGTGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTTTTCTCAGCAGCAGCCAC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">102 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">GAPDH</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GACAGTCAGCCGCATCTTCT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCGCCCAATACGACCAAATC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">104 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab3512583.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">These primers were designed by NCBI Primer Blast (<span class="elsevierStyleInterRef" id="intr0005" href="https://www.ncbi.nlm.nih.gov/tools/primer-blast/">https://www.ncbi.nlm.nih.gov/tools/primer-blast/</span>).</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">The primers used in this study for real-time PCR.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:25 [ 0 => array:3 [ "identificador" => "bib0130" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "α-Synuclein strains: does amyloid conformation explain the heterogeneity of synucleinopathies?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.O. Hoppe" 1 => "G. Uzunoğlu" 2 => "C. Nussbaum-Krammer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/biom11070931" "Revista" => array:5 [ "tituloSerie" => "Biomolecules" "fecha" => "2021" "volumen" => "11" "paginaInicial" => "931" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34201558" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0135" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emerging concepts in synucleinopathies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "T.F. Outeiro" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "fecha" => "2021" "editorial" => "Springer" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0140" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Synucleinopathies: a pathological and molecular review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "I.V. Murray" 1 => "V.M.-Y. Lee" 2 => "J.Q. Trojanowski" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Neurosci Res" "fecha" => "2001" "volumen" => "1" "paginaInicial" => "445" "paginaFinal" => "455" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0145" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Neuropathology, biochemistry, and biophysics of α-synuclein aggregation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "V.N. Uversky" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1471-4159.2007.04764.x" "Revista" => array:6 [ "tituloSerie" => "J Neurochem" "fecha" => "2007" "volumen" => "103" "paginaInicial" => "17" "paginaFinal" => "37" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17623039" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0150" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cytotoxic oligomers and fibrils trapped in a gel-like state of α-synuclein assemblies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Kumar" 1 => "S. Das" 2 => "G.M. Mohite" 3 => "S.K. Rout" 4 => "S. Halder" 5 => "N.N. Jha" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Angew Chem" "fecha" => "2018" "volumen" => "130" "paginaInicial" => "5360" "paginaFinal" => "5364" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0155" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Neuroinflammation in Alzheimer's disease and Parkinson's disease: are microglia pathogenic in either disorder?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J. Rogers" 1 => "D. Mastroeni" 2 => "B. Leonard" 3 => "J. Joyce" 4 => "A. Grover" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0074-7742(07)82012-5" "Revista" => array:6 [ "tituloSerie" => "Int Rev Neurobiol" "fecha" => "2007" "volumen" => "82" "paginaInicial" => "235" "paginaFinal" => "246" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17678964" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0160" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Targeted overexpression of human α-synuclein triggers microglial activation and an adaptive immune response in a mouse model of Parkinson disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S. Theodore" 1 => "S. Cao" 2 => "P.J. McLean" 3 => "D.G. Standaert" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/NEN.0b013e31818e5e99" "Revista" => array:6 [ "tituloSerie" => "J Neuropathol Exp Neurol" "fecha" => "2008" "volumen" => "67" "paginaInicial" => "1149" "paginaFinal" => "1158" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19018246" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0165" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathogenic mechanisms of prion protein, amyloid β and α synuclein misfolding: the prion concept and neurotoxicity of protein oligomers" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C.L. Ugalde" 1 => "D.I. Finkelstein" 2 => "V.A. Lawson" 3 => "A.F. Hill" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Neurochem" "fecha" => "2016" "volumen" => "139" "paginaInicial" => "162" "paginaFinal" => "180" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0170" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of tumour necrosis factor, interleukin 6, interferon-γ and inducible nitric oxide synthase in the development and pathology of the nervous system" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.A. Muñoz-Fernández" 1 => "M. Fresno" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s0301-0082(98)00045-8" "Revista" => array:6 [ "tituloSerie" => "Prog Neurobiol" "fecha" => "1998" "volumen" => "56" "paginaInicial" => "307" "paginaFinal" => "340" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9770242" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0175" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "α-Synuclein toxicity in neurodegeneration: mechanism and therapeutic strategies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y.C. Wong" 1 => "D. Krainc" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nm.4341" "Revista" => array:6 [ "tituloSerie" => "Nat Med" "fecha" => "2017" "volumen" => "23" "paginaInicial" => "1" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28586335" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0180" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antioxidant nanoparticles for concerted inhibition of α-synuclein fibrillization, and attenuation of microglial intracellular aggregation and activation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Zhao" 1 => "X. Yang" 2 => "H.R. Calvelli" 3 => "Y. Cao" 4 => "N.L. Francis" 5 => "R.A. Chmielowski" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fbioe.2020.00112" "Revista" => array:5 [ "tituloSerie" => "Front Bioeng Biotechnol" "fecha" => "2020" "volumen" => "8" "paginaInicial" => "112" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32154238" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0185" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The potential of zwitterionic nanoliposomes against neurotoxic alpha-synuclein aggregates in Parkinson's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Aliakbari" 1 => "H. Mohammad-Beigi" 2 => "N. Rezaei-Ghaleh" 3 => "S. Becker" 4 => "F.D. Esmatabad" 5 => "H.A.E. Seyedi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1039/c8nr00632f" "Revista" => array:6 [ "tituloSerie" => "Nanoscale" "fecha" => "2018" "volumen" => "10" "paginaInicial" => "9174" "paginaFinal" => "9185" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29725687" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0190" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cerium oxide nanoparticles rescue α-synuclein-induced toxicity in a yeast model of Parkinson's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "R. Ruotolo" 1 => "G. De Giorgio" 2 => "I. Minato" 3 => "M.G. Bianchi" 4 => "O. Bussolati" 5 => "N. Marmiroli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3390/nano10020235" "Revista" => array:5 [ "tituloSerie" => "Nanomaterials" "fecha" => "2020" "volumen" => "10" "paginaInicial" => "235" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32013138" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0195" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of gold nanoparticles on the kinetics of α-synuclein aggregation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y.D. Álvarez" 1 => "J.A. Fauerbach" 2 => "Pellegrotti JsV" 3 => "T.M. Jovin" 4 => "E.A. Jares-Erijman" 5 => "F.D. Stefani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1021/nl403490e" "Revista" => array:6 [ "tituloSerie" => "Nano Lett" "fecha" => "2013" "volumen" => "13" "paginaInicial" => "6156" "paginaFinal" => "6163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24219503" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0200" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Attenuation of inflammatory response in the EAE model by PEGlated nanoliposome of pistachio oils" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Jebali" 1 => "M.N. Karimabad" 2 => "Z. Ahmadi" 3 => "H. Khorramdel" 4 => "A. Kaeidi" 5 => "M. Mirzaei" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jneuroim.2020.577352" "Revista" => array:5 [ "tituloSerie" => "J Neuroimmunol" "fecha" => "2020" "volumen" => "347" "paginaInicial" => "577352" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32781342" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0205" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Preparation of liposomes by reverse-phase evaporation using alternative organic solvents" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "R. Cortesi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/026520499289220" "Revista" => array:6 [ "tituloSerie" => "J Microencapsulation" "fecha" => "1999" "volumen" => "16" "paginaInicial" => "251" "paginaFinal" => "256" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10080118" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0210" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Glycation potentiates α-synuclein-associated neurodegeneration in synucleinopathies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Vicente Miranda" 1 => "É.M. Szegő" 2 => "L.M. Oliveira" 3 => "C. Breda" 4 => "E. Darendelioglu" 5 => "R.M. de Oliveira" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/brain/awx056" "Revista" => array:6 [ "tituloSerie" => "Brain" "fecha" => "2017" "volumen" => "140" "paginaInicial" => "1399" "paginaFinal" => "1419" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28398476" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0215" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Microglial activation and chronic neurodegeneration" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.E. Lull" 1 => "M.L. Block" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.nurt.2010.05.014" "Revista" => array:6 [ "tituloSerie" => "Neurotherapeutics" "fecha" => "2010" "volumen" => "7" "paginaInicial" => "354" "paginaFinal" => "365" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20880500" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0220" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Neuropathology of synuclein aggregates: new insights into mechanisms of neurodegenerative diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.E. Duda" 1 => "V.M.Y. Lee" 2 => "J.Q. Trojanowski" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/1097-4547(20000715)61:2<121::AID-JNR1>3.0.CO;2-4" "Revista" => array:6 [ "tituloSerie" => "J Neurosci Res" "fecha" => "2000" "volumen" => "61" "paginaInicial" => "121" "paginaFinal" => "127" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10878583" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0225" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In vivo demonstration that α-synuclein oligomers are toxic" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Winner" 1 => "R. Jappelli" 2 => "S.K. Maji" 3 => "P.A. Desplats" 4 => "L. Boyer" 5 => "S. Aigner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.1100976108" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci" "fecha" => "2011" "volumen" => "108" "paginaInicial" => "4194" "paginaFinal" => "4199" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21325059" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0230" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Amyloid fibrils are the molecular trigger of inflammation in Parkinson's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Gustot" 1 => "J.I. Gallea" 2 => "R. Sarroukh" 3 => "M.S. Celej" 4 => "J.-M. Ruysschaert" 5 => "V. Raussens" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BJ20150617" "Revista" => array:6 [ "tituloSerie" => "Biochem J" "fecha" => "2015" "volumen" => "471" "paginaInicial" => "323" "paginaFinal" => "333" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26272943" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0235" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A blood–brain barrier (BBB) disrupter is also a potent α-synuclein (α-syn) aggregation inhibitor: a novel dual mechanism of mannitol for the treatment of Parkinson disease (PD)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Shaltiel-Karyo" 1 => "M. Frenkel-Pinter" 2 => "E. Rockenstein" 3 => "C. Patrick" 4 => "M. Levy-Sakin" 5 => "A. Schiller" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Biol Chem" "fecha" => "2013" "volumen" => "288" "paginaInicial" => "17579" "paginaFinal" => "17588" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0240" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Screening of small molecules using the inhibition of oligomer formation in α-synuclein aggregation as a selection parameter" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Staats" 1 => "T.C. Michaels" 2 => "P. Flagmeier" 3 => "S. Chia" 4 => "R.I. Horne" 5 => "J. Habchi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s42004-019-0249-6" "Revista" => array:6 [ "tituloSerie" => "Commun Chem" "fecha" => "2020" "volumen" => "3" "paginaInicial" => "1" "paginaFinal" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/36703346" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0245" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The anti-inflammatory role of omega-3 polyunsaturated fatty acids metabolites in pre-clinical models of psychiatric, neurodegenerative and neurological disorders" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J. Giacobbe" 1 => "B. Benoiton" 2 => "P. Zunszain" 3 => "C.M. Pariante" 4 => "A. Borsini" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Front Psychiatry" "fecha" => "2020" "volumen" => "11" "paginaInicial" => "122" ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0250" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Amido-bridged nucleic acid (AmNA)-modified antisense oligonucleotides targeting α-synuclein as a novel therapy for Parkinson's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Uehara" 1 => "C.-J. Choong" 2 => "M. Nakamori" 3 => "H. Hayakawa" 4 => "K. Nishiyama" 5 => "Y. Kasahara" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/s41598-018-37186-2" "Revista" => array:6 [ "tituloSerie" => "Sci Rep" "fecha" => "2019" "volumen" => "9" "paginaInicial" => "1" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30626917" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack739369" "titulo" => "Acknowledgements" "texto" => "<p id="par0160" class="elsevierStylePara elsevierViewall">We thank the Laboratory staff of Faculty of Advanced Sciences and Technology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran, and Zahedan University of Medical Sciences, Zahedan, Iran.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/02134853/0000003900000004/v1_202404170527/S0213485321001274/v1_202404170527/en/main.assets" "Apartado" => array:4 [ "identificador" => "9397" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/02134853/0000003900000004/v1_202404170527/S0213485321001274/v1_202404170527/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0213485321001274?idApp=UINPBA00004N" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 November | 4 | 0 | 4 |
2024 October | 18 | 1 | 19 |
2024 September | 32 | 18 | 50 |
2024 August | 40 | 12 | 52 |
2024 July | 21 | 2 | 23 |
2024 June | 36 | 2 | 38 |
2024 May | 73 | 11 | 84 |
2024 April | 107 | 9 | 116 |
2024 March | 48 | 6 | 54 |
2024 February | 34 | 10 | 44 |
2024 January | 26 | 5 | 31 |
2023 December | 10 | 7 | 17 |
2023 November | 14 | 7 | 21 |
2023 October | 16 | 11 | 27 |
2023 September | 7 | 2 | 9 |
2023 August | 10 | 5 | 15 |
2023 July | 6 | 4 | 10 |
2023 June | 28 | 2 | 30 |
2023 May | 36 | 3 | 39 |
2023 April | 28 | 0 | 28 |
2023 March | 0 | 2 | 2 |
2023 February | 0 | 3 | 3 |
2023 January | 0 | 5 | 5 |
2022 December | 0 | 4 | 4 |
2022 November | 0 | 4 | 4 |
2022 October | 0 | 6 | 6 |
2022 September | 0 | 8 | 8 |
2022 August | 0 | 6 | 6 |
2022 July | 0 | 6 | 6 |
2022 June | 0 | 6 | 6 |
2022 May | 0 | 12 | 12 |
2022 April | 0 | 7 | 7 |
2022 March | 0 | 6 | 6 |
2022 February | 0 | 5 | 5 |
2022 January | 0 | 6 | 6 |
2021 December | 0 | 12 | 12 |
2021 November | 0 | 10 | 10 |
2021 October | 0 | 11 | 11 |
2021 September | 0 | 6 | 6 |